WO2009082817A1 - Silencing of polo-like kinase expression using interfering rna - Google Patents
Silencing of polo-like kinase expression using interfering rna Download PDFInfo
- Publication number
- WO2009082817A1 WO2009082817A1 PCT/CA2008/002285 CA2008002285W WO2009082817A1 WO 2009082817 A1 WO2009082817 A1 WO 2009082817A1 CA 2008002285 W CA2008002285 W CA 2008002285W WO 2009082817 A1 WO2009082817 A1 WO 2009082817A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- lipid
- nucleic acid
- particle
- nucleotides
- mol
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
- A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
- A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
- A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11021—Polo kinase (2.7.11.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/335—Modified T or U
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3521—Methyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3525—MOE, methoxyethoxy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
- C12N2310/3533—Halogen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
Definitions
- a cancer cell may have unregulated cell division through either the overexpression of a positive regulator of the cell cycle or the loss of a negative regulator of the cell cycle, perhaps by mutation.
- a cancer cell may have lost the ability to undergo programmed cell death through the overexpression of a negative regulator of apoptosis. Therefore, there is a need to develop new therapeutic agents that will restore the processes of checkpoint control and programmed cell death to cancerous cells.
- RNA interference is an evolutionarily conserved process in which recognition of double-stranded RNA (dsRNA) ultimately leads to posttranscriptional suppression of gene expression. This suppression is mediated by short dsRNA, also called small interfering RNA (siRNA), which induces specific degradation of mRNA through complementary base pairing.
- siRNA small interfering RNA
- RNAi offers a new way to inactivate genes of interest.
- RNAi provides a potential new approach to modulate (e.g., reduce) the expression of certain genes, e.g., an anti-apoptotic molecule, a growth factor, a growth factor receptor, a mitotic spindle protein, a cell cycle protein, an angiogenic factor, an oncogene, an intracellular signal transducer, a molecular chaperone, and combinations thereof.
- polo-like kinase 1 (PLK-I) gene, which encodes a member of a family of serine/threonine protein kinases known as polo-like kinases ⁇ see, e.g., Nigg, Curr. Opin. Cell. Biol., 10:776-783 (1998)).
- PLK-I polo-like kinase 1
- heterodimeric complexes act by phosphorylating downstream targets that, in turn, trigger signaling events that liberate nuclear proteins necessary for entry into subsequent phases of the cell cycle.
- Polo-like kinases such as PLK-I contribute to the activation and inactivation of these heterodimeric complexes.
- polo-like kinases undergo fluctuations in abundance, activity, and localization to control multiple stages of the cell cycle (Hamanaka et al., J. Biol. Chem., 270:21086-21091 (1995)). This family of kinases also functions in centrosome maturation (Lane et al, J. Cell.
- PLK-I was the first member of this family of kinases to be identified as the mammalian counterpart to the Drosophila melanogaster gene polo, required for passage through mitosis (Golsteyn et al, J.
- 6,906,186 describes the inhibition of PLK-I expression using antisense oligonucleotides in an in vitro cell culture system.
- these strategies are untested as therapeutic protocols and consequently there remains a long-felt need for agents capable of effectively inhibiting PLK-I function in vivo.
- the present invention provides compositions comprising interfering RNA ⁇ e.g., siRNA, aiRNA, miRNA) that target polo-like kinase 1 (PLK-I) expression and methods of using such compositions to silence PLK-I expression. More particularly, the present invention provides unmodified and chemically modified interfering RNA molecules which silence PLK-I expression and methods of use thereof, e.g., for treating a cancer such as hepatocellular carcinoma (HCC).
- interfering RNA e.g., siRNA, aiRNA, miRNA
- PLK-I polo-like kinase 1
- the present invention also provides serum-stable nucleic acid-lipid particles ⁇ e.g., SNALP) comprising an interfering RNA molecule described herein, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles.
- SNALP serum-stable nucleic acid-lipid particles
- the present invention further provides methods of silencing PLK-I gene expression by administering an interfering RNA molecule described herein to a mammalian subject.
- the present invention additionally provides methods of identifying and/or modifying PLK-I interfering RNA having immunostimulatory properties.
- the present invention provides a modified siRNA molecule comprising a double-stranded region of about 15 to about 60 nucleotides in length (e.g., about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in length, or 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length), wherein the modified siRNA molecule is capable of silencing PLK-I expression.
- the modified siRNA molecule comprises one, two, three, four, five, six, seven, eight, nine, ten, or more modified nucleotides in the double-stranded region.
- the modified siRNA comprises from about 1% to about 100% (e.g., about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) modified nucleotides in the double-stranded region, hi preferred embodiments, less than about 25% (e.g., less than about 25%, 20%, 15%, 10%, or 5%) or from about 1% to about 25% (e.g., from about l%-25%, 5%-25%, 10%-25%, 15%-25%, 20%-25%, or 10%-20%) of the nucleotides in the double-stranded region comprise modified nucleotides.
- the modified siRNA comprises modified nucleotides including, but not limited to, 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2T) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof.
- modified nucleotides including, but not limited to, 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2T) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof.
- the modified siRNA comprises 2'OMe nucleotides (e.g., 2'OMe purine and/or pyrimidine nucleotides) such as, for example, 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, 2'OMe-adenosine nucleotides, 2'OMe-cytosine nucleotides, and mixtures thereof.
- the modified siRNA does not comprise 2'OMe-cytosine nucleotides.
- the modified siRNA comprises a hairpin loop structure.
- the modified siRNA can comprise modified nucleotides in one strand (i.e., sense or antisense) or both strands of the double-stranded region of the siRNA molecule.
- uridine and/or guanosine nucleotides are modified at selective positions in the double- stranded region of the siRNA duplex.
- at least one, two, three, four, five, six, or more of the uridine nucleotides in the sense and/or antisense strand can be a modified uridine nucleotide such as a 2'OMe-uridine nucleotide.
- every uridine nucleotide in the sense and/or antisense strand is a 2'OMe- uridine nucleotide.
- at least one, two, three, four, five, six, or more of the guanosine nucleotides in the sense and/or antisense strand can be a modified guanosine nucleotide such as a 2'OMe-guanosine nucleotide, hi some embodiments, every guanosine nucleotide in the sense and/or antisense strand is a 2'OMe- guanosine nucleotide.
- the modified siRNA molecule is less immunostimulatory than a corresponding unmodified siRNA sequence.
- the modified siRNA is at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% less immunostimulatory than the corresponding unmodified siRNA sequence.
- the modified siRNA is at least about 70% (e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) less immunostimulatory than the corresponding unmodified siRNA sequence.
- the immunostimulatory properties of the modified siRNA molecule and the corresponding unmodified siRNA molecule can be determined by, for example, measuring INF- ⁇ and/or IL-6 levels about two to about twelve hours after systemic administration in a mammal or transfection of a mammalian responder cell using an appropriate lipid-based delivery system (such as the SNALP delivery system or other lipoplex systems disclosed herein).
- an appropriate lipid-based delivery system such as the SNALP delivery system or other lipoplex systems disclosed herein.
- the modified siRNA molecule has an IC 50 (i.e., half- maximal inhibitory concentration) less than or equal to ten-fold that of the corresponding unmodified siRNA (i.e., the modified siRNA has an IC 50 that is less than or equal to ten- times the IC 50 of the corresponding unmodified siRNA).
- the modified siRNA has an IC 5O less than or equal to three- fold that of the corresponding unmodified siRNA sequence
- the modified siRNA has an IC 50 less than or equal to two-fold that of the corresponding unmodified siRNA. It will be readily apparent to those of skill in the art that a dose-response curve can be generated and the ICs 0 values for the modified siRNA and the corresponding unmodified siRNA can be readily determined using methods known to those of skill in the art.
- the modified siRNA is capable of silencing at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the expression of the target sequence relative to the corresponding unmodified siRNA sequence.
- the modified siRNA does not comprise phosphate backbone modifications, e.g., in the sense and/or antisense strand of the double-stranded region, hi other embodiments, the modified siRNA does not comprise 2'-deoxy nucleotides, e.g., in the sense and/or antisense strand of the double-stranded region. In certain instances, the nucleotide at the 3 '-end of the double-stranded region in the sense and/or antisense strand is not a modified nucleotide.
- the nucleotides near the 3'-end (e.g., within one, two, three, or four nucleotides of the 3 '-end) of the double-stranded region in the sense and/or antisense strand are not modified nucleotides.
- the modified siRNA molecules of the present invention may have 3' overhangs of one, two, three, four, or more nucleotides on one or both sides of the double-stranded region, or may lack overhangs (i.e., have blunt ends) on one or both sides of the double-stranded region.
- the modified siRNA has 3' overhangs of two nucleotides on each side of the double-stranded region.
- the 3' overhang on the antisense strand has complementarity to the target sequence and the 3' overhang on the sense strand has complementarity to the complementary strand of the target sequence.
- the 3' overhangs do not have complementarity to the target sequence or the complementary strand thereof.
- the 3' overhangs comprise one, two, three, four, or more nucleotides such as 2'-deoxy (2'H) nucleotides.
- the 3' overhangs comprise deoxythymidine (dT) and/or uridine nucleotides.
- one or more of the nucleotides in the 3' overhangs on one or both sides of the double-stranded region comprise modified nucleotides.
- modified nucleotides include 2'OMe nucleotides, 2'-deoxy-2'F nucleotides, 2'-deoxy nucleotides, 2'-0-2-MOE nucleotides, LNA nucleotides, and mixtures thereof.
- one, two, three, four, or more nucleotides in the 3' overhangs present on the sense and/or antisense strand of the siRNA comprise 2'0Me nucleotides (e.g., 2'0Me purine and/or pyrimidine nucleotides) such as, for example, 2'OMe-guanosine nucleotides, 2'0Me- uridine nucleotides, 2'OMe-adenosine nucleotides, 2'OMe-cytosine nucleotides, and mixtures thereof.
- 2'0Me nucleotides e.g., 2'0Me purine and/or pyrimidine nucleotides
- 2'OMe-guanosine nucleotides e.g., 2'0Me purine and/or pyrimidine nucleotides
- 2'OMe-guanosine nucleotides e.g., 2'0Me purine and
- the siRNA molecules of the present invention may comprise at least one or a cocktail (e.g., at least two, three, four, five, six, seven, eight, nine, ten, or more) of modified siRNA sequences that silence PLK-I expression.
- one or more of the modified siRNA described herein are present in a cocktail with one or more (e.g., at least two, three, four, five, six, seven, eight, nine, ten, or more) unmodified siRNA sequences that silence PLK-I expression
- the modified siRNA molecule comprises a chemically modified (e.g., 2'OMe-modified) version of at least one or a cocktail of the unmodified sequences set forth in Tables 1-7.
- the modified siRNA molecule comprises at least one or a cocktail of the modified sequences set forth in Tables 3, 6, and 10-11.
- the modified siRNA molecule is selected from the group consisting of PLKl 424 2/6, PLKl 424 U4/GU, PLKl 424 U4/G, PLK773 G/GU, PLKl 425 3/5, and a mixture thereof.
- the corresponding unmodified siRNA sequence comprises at least one, two, three, four, five, six, seven, or more 5'-GU-3' motifs.
- the 5'-GU-3' motif can be in the sense strand, the antisense strand, or both strands of the unmodified siRNA sequence.
- the 5'-GU-3' motifs may be adjacent to each other or, alternatively, they may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more nucleotides.
- the modified siRNA further comprises a carrier system, e.g., to deliver the modified siRNA into a cell of a mammal.
- carrier systems suitable for use in the present invention include, but are not limited to, nucleic acid-lipid particles, liposomes, micelles, virosomes, nucleic acid complexes, and mixtures thereof.
- the siRNA is complexed with a lipid such as a cationic lipid to form a lipoplex.
- the modified siRNA is complexed with a polymer such as a cationic polymer ⁇ e.g., polyethylenimine (PEI)) to form a polyplex.
- PEI polyethylenimine
- the modified siRNA may also be complexed with cyclodextrin or a polymer thereof.
- the modified siRNA is encapsulated in a nucleic acid-lipid particle.
- the present invention also provides a pharmaceutical composition comprising a modified siRNA molecule described herein and a pharmaceutically acceptable carrier.
- the present invention provides a nucleic acid-lipid particle that targets PLK-I expression.
- the nucleic acid-lipid particle comprises a modified siRNA molecule that silences PLK-I expression, a cationic lipid, and a non-cationic lipid, hi certain instances, the nucleic acid-lipid particle further comprises a conjugated lipid that inhibits aggregation of particles.
- the nucleic acid-lipid particle comprises a modified siRNA molecule that silences PLK-I expression, a cationic lipid, a non-cationic lipid, and a conjugated lipid that inhibits aggregation of particles.
- the cationic lipid may be, e.g., l,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1 ,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), N,N-dioleyl- N,N-dimethylammonium chloride (DODAC), dioctadecyldimethylammonium (DODMA), distearyldimethylammonium (DSDMA), N-(I -(2,3-dioleyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I -(2,3 -dioleoyloxy) ⁇ ropyl)-N,N,N-trimethylammonium chloride (DOTAP), 3
- Cationic lipids such as CLinDMA, as well as additional cationic lipids are described in U.S. Patent Publication No. 20060240554.
- Cationic lipids such as DLin-K-DMA, as well as additional cationic lipids are described in U.S. Provisional Application No. 61/018,627, filed January 2, 2008, U.S. Provisional Application No. 61/049,568, filed May 1, 2008, and U.S. Provisional Application No. 61/104,219, filed October 9, 2008.
- Cationic lipids such as DLin-K-XTC2-DMA, as well as additional cationic lipids are described in U.S. Provisional Application No. 61/104,212, filed October 9, 2008.
- the cationic lipid may comprise from about 2 mol % to about 60 mol %, about 5 mol % to about 45 mol %, about 5 mol % to about 15 mol %, about 20 mol % to about 50 mol %, about 30 mol % to about 50 mol %, about 40 mol % to about 50 mol %, or about 40 mol % of the total lipid present in the particle.
- the non-cationic lipid may be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleyol-phosphatidylglycerol (POPG), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl- phosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, dielaidoyl- phosphatidylethanolamine (DEPE), stearoyloleoyl-phosphati
- the non-cationic lipid may comprise from about 5 mol % to about 90 mol %, about 10 mol % to about 85 mol %, about 20 mol % to about 85 mol %, about 10 mol % (e.g., phospholipid such as DSPC or DPPC only), or about 60 mol % (e.g., about 10 mol % of a phospholipid such as DSPC or DPPC and about 48 mol % cholesterol) of the total lipid present in the particle.
- 10 mol % e.g., phospholipid such as DSPC or DPPC only
- about 60 mol % e.g., about 10 mol % of a phospholipid such as DSPC or DPPC and about 48 mol % cholesterol
- the conjugated lipid that inhibits aggregation of particles may be a polyethyleneglycol (PEG)-lipid conjugate, a polyamide (ATTA)-lipid conjugate, a cationic- polymer-lipid conjugates (CPLs), or mixtures thereof, hi one preferred embodiment, the nucleic acid-lipid particles comprise either a PEG-lipid conjugate or an ATTA-lipid conjugate. In certain embodiments, the PEG-lipid conjugate or ATTA-lipid conjugate is used together with a CPL.
- PEG polyethyleneglycol
- ATTA polyamide
- CPLs cationic- polymer-lipid conjugates
- the conjugated lipid that inhibits aggregation of particles may comprise a polyethyleneglycol-lipid including, e.g., a PEG-diacylglycerol (DAG), a PEG dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or mixtures thereof.
- the PEG-DAA conjugate may be PEG-dilauryloxypropyl (C 12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), and a PEG-distearyloxypropyl (C18).
- PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, PEG-C-DOMG, described in U.S. Provisional Application No. 61/039,748, filed March 26, 2008, and 1 -[8'-(1 ,2-Dimyristoyl-3-propanoxy)-carboxamido-3',6 l -dioxaoctanyl]carbamoyl- ⁇ -methyl-poly(ethylene glycol) (2KPEG-DMG), described in U.S. Patent No. 7,404,969.
- the conjugated lipid that inhibits aggregation of particles is a CPL that has the formula: A-W-Y, wherein A is a lipid moiety, W is a hydrophilic polymer, and Y is a polycationic moiety.
- W may be a polymer selected from the group consisting of polyethyleneglycol (PEG), polyamide, polylactic acid, polyglycolic acid, polylactic acid/polyglycolic acid copolymers, or combinations thereof, the polymer having a molecular weight of from about 250 to about 7000 daltons.
- Y has at least 4 positive charges at a selected pH.
- Y may be lysine, arginine, asparagine, glutamine, derivatives thereof, or combinations thereof.
- the conjugated lipid that prevents aggregation of particles may be from 0 mol % to about 20 mol %, about 0.5 mol % to about 20 mol %, about 1 mol % to about 15 mol %, about 4 mol % to about 10 mol %, or about 2 mol % of the total lipid present in the particle.
- the nucleic acid-lipid particle further comprises cholesterol or a derivative thereof.
- suitable cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, and cholesteryl-4'-hydroxybutyl ether.
- the cholesterol or cholesterol derivative may be from 0 mol % to about 10 mol %, about 2 mol % to about 10 mol %, about 10 mol % to about 60 mol %, about 20 mol % to about 45 mol %, about 30 mol % to about 50 mol %, or about 48 mol % of the total lipid present in the particle.
- the nucleic acid-lipid particle comprises 40 mol % DLinDMA, 10 mol % DSPC, 2 mol % PEG-cDMA, and 48 mol % cholesterol.
- the nucleic acid-lipid particle comprises: (a) one or more unmodified and/or modified siRNA that silence PLK-I expression; (b) a cationic lipid comprising from about 50 mol % to about 85 mol % of the total lipid present in the particle; (c) a non-cationic lipid comprising from about 13 mol % to about 49.5 mol % of the total lipid present in the particle; and (d) a conjugated lipid that inhibits aggregation of particles comprising from about 0.5 mol % to about 2 mol % of the total lipid present in the particle.
- the siRNA is fully encapsulated within the lipid of the nucleic acid-lipid particle such that the siRNA in the nucleic acid-lipid particle is resistant in aqueous solution to degradation by a nuclease.
- the nucleic acid- lipid particle is substantially non-toxic to mammals.
- the nucleic acid-lipid particle may comprise one or more of the cationic lipids described above.
- the cationic lipid is DLinDMA.
- the cationic lipid typically comprises from about 50 mol % to about 85 mol %, about 50 mol % to about 80 mol %, about 50 mol % to about 75 mol %, about 50 mol % to about 65 mol %, or about 55 mol % to about 65 mol % of the total lipid present in the particle.
- the non-cationic lipid in these SNALP embodiments may be an anionic lipid or a neutral lipid.
- the non-cationic lipid comprises cholesterol or a derivative thereof.
- the cholesterol or cholesterol derivative comprises from about 30 mol % to about 40 mol % of the total lipid present in the particle.
- the non-cationic lipid comprises a phospholipid.
- the non-cationic lipid comprises a mixture of a phospholipid and cholesterol or a cholesterol derivative.
- Phospholipids suitable for use in these SNALP embodiments include, but are not limited to, DPPC, DSPC, DOPE, POPC, POPE, POPG, DPPE, DMPE, DSPE, monomethyl- phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, DEPE, SOPE, EPC, and a mixture thereof.
- the non-cationic lipid is a mixture of a phospholipid and cholesterol or a cholesterol derivative
- the phospholipid comprises from about 4 mol % to about 10 mol % of the total lipid present in the particle
- the cholesterol or cholesterol derivative comprises from about 30 mol % to about 40 mol % of the total lipid present in the particle.
- the cholesterol derivative includes, but is not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, and cholesteryl-4'-hydroxybutyl ether.
- the phospholipid comprises DPPC.
- the SNALPs of these embodiments also comprise a conjugated lipid that inhibits aggregation of the particles.
- suitable conjugated lipids include, but are not limited to, a PEG-lipid conjugate, a polyamide (ATTA)-lipid conjugate, a cationic-polymer- lipid conjugates (CPLs), or mixtures thereof.
- the nucleic acid- lipid particles comprise either a PEG-lipid conjugate or an ATTA-lipid conjugate, hi certain embodiments, the PEG-lipid conjugate or ATTA-lipid conjugate is used together with a CPL.
- the conjugated lipid is a PEG-lipid.
- PEG-lipids include, but are not limited to, a PEG- DAG, a PEG-DAA, a PEG-phospholipid, a PEG-ceramide (Cer), or mixtures thereof.
- the PEG-lipid is a PEG-DAA conjugate.
- suitable PEG-DAA conjugates include, but are not limited to, a PEG-dilauryloxypropyl (C 12), a PEG- dimyristyloxypropyl (C 14), a PEG-dipalmityloxypropyl (C 16), and a PEG- distearyloxypropyl (Cl 8).
- the PEG-DAA conjugate is PEG- dimyristyloxypropyl (C14). In another preferred embodiment, the PEG-DAA conjugate is PEG-distearyloxypropyl (Cl 8).
- Additional PEG-lipid conjugates include, without limitation, PEG-C-DOMG, 2KPEG-DMG, and a mixture thereof.
- the conjugated lipid typically comprises about 0.5 mol % to about 2 mol % of the total lipid present in the particle.
- the SNALPs of these embodiments have a lipid:nucleic acid ratio of about 1 to about 100. hi a preferred embodiment, these SNALPs have a lipid:nucleic acid ratio of about 5 to about 15.
- these SNALPs have a lipid:nucleic acid ratio of about 6.
- these SNALPs have a mean diameter of from about 50 nm to about 150 run. In a preferred embodiment, these SNALPs have a mean diameter of from about 70 nm to about 90 nm.
- the SNALP comprises: (a) one or more unmodified and/or modified siRNA that silence PLK-I expression; (b) a cationic lipid comprising from about 56.5 mol % to about 66.5 mol % of the total lipid present in the particle; (c) a non-cationic lipid comprising from about 31.5 mol % to about 42.5 mol % of the total lipid present in the particle; and (d) a conjugated lipid that inhibits aggregation of particles comprising from about 1 mol % to about 2 mol % of the total lipid present in the particle.
- This embodiment of SNALP is generally referred to herein as the "1:62" formulation, hi a preferred embodiment, the cationic lipid is DLinDMA, the non-cationic lipid is cholesterol and the conjugated lipid is a PEG-DAA conjugate.
- the 1:62 formulation those of skill in the art will appreciate that other cationic lipids, non-cationic lipids, including other cholesterol derivatives, and conjugated lipids can be used in the 1 : 62 formulation as described herein.
- the SNALP comprises: (a) one or more unmodified and/or modified siRNA that silence PLK-I expression; (b) a cationic lipid comprising from about 52 mol % to about 62 mol % of the total lipid present in the particle; (c) a non-cationic lipid comprising from about 36 mol % to about 47 mol % of the total lipid present in the particle; and (d) a conjugated lipid that inhibits aggregation of particles comprising from about 1 mol % to about 2 mol % of the total lipid present in the particle.
- the cationic lipid is DLinDMA
- the non-cationic lipid is a mixture of a phospholipid (such as DPPC) and cholesterol, wherein the phospholipid comprises about 5 mol % to about 9 mol % of the total lipid present in the particle, and the cholesterol (or cholesterol derivative) comprises about 32 mol % to about 37 mol % of the total lipid present in the particle
- the PEG-lipid is PEG-DAA.
- the nucleic acid-lipid particles comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more unmodified or modified siRNA molecules comprising or consisting of the sequences set forth in Tables 1-7 and 10-11.
- the nucleic acid-lipid particles comprise modified siRNA molecules selected from the group consisting of PLKl 424 U4/GU, PLKl 424 U4/G, PLK773 G/GU, PLKl 425 3/5, and mixtures thereof.
- the nucleic acid-lipid particles of the invention are useful for the therapeutic delivery of siRNA molecules that silence PLK-I expression
- a modified siRNA molecule described herein is formulated into nucleic acid-lipid particles, and the particles are administered to a mammal (e.g., a rodent such as a mouse or a primate such as a human, chimpanzee, or monkey) requiring such treatment, hi certain instances, a therapeutically effective amount of the nucleic acid-lipid particle can be administered to the mammal, e.g., for treating a cancer such as hepatocellular carcinoma (HCC).
- HCC hepatocellular carcinoma
- the nucleic acid-lipid particle can be by any route known in the art, such as, e.g., oral, intranasal, intravenous, intraperitoneal, intramuscular, intra-articular, intralesional, intratracheal, subcutaneous, or intradermal.
- the siRNA molecule in the nucleic acid-lipid particle is not substantially degraded after exposure of the particle to a nuclease at 37 0 C for at least 20, 30, 45, or 60 minutes, or after incubation of the particle in serum at 37°C for at least 30, 45, or 60 minutes or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours.
- the siRNA molecule is fully encapsulated in the nucleic acid- lipid particle. In other embodiments, the siRNA molecule is complexed with the lipid portion of the particle. [0043]
- the present invention further provides pharmaceutical compositions comprising the nucleic acid-lipid particles described herein and a pharmaceutically acceptable carrier.
- the siRNA molecules described herein are used in methods for silencing PLK-I expression.
- the present invention provides a method for introducing an siRNA that silences expression ⁇ e.g., mRNA and/or protein levels) of a PLK-I gene into a cell by contacting the cell with an siRNA molecule described herein.
- the present invention provides a method for in vivo delivery of an siRNA molecule that silences expression of a PLK-I gene by administering to a mammal an siRNA molecule described herein.
- Administration of the siRNA molecule can be by any route known in the art, such as, e.g., oral, intranasal, intravenous, intraperitoneal, intramuscular, intra-articular, intralesional, intratracheal, subcutaneous, or intradermal.
- the siRNA molecule that silences PLK-I expression is typically formulated with a carrier system, and the carrier system comprising the siRNA molecule is administered to a mammal requiring such treatment.
- the carrier system comprising the siRNA molecule is administered to a mammal requiring such treatment.
- cells are removed from a mammal such as a human, the siRNA is delivered in vitro using a carrier system, and the cells are then administered to the mammal, such as by injection.
- carrier systems suitable for use in the present invention include, but are not limited to, nucleic acid-lipid particles, liposomes, micelles, virosomes, nucleic acid complexes ⁇ e.g., lipoplexes, polyplexes, etc.), and mixtures thereof.
- the carrier system may comprise at least one or a cocktail ⁇ e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of siRNA molecules that silence PLK- 1 expression.
- the carrier system comprises at least one or a cocktail of the sequences set forth in Tables 1-7 and 10-11.
- the siRNA molecule that silences PLK-I expression is in a nucleic acid-lipid particle comprising the siRNA molecule, a cationic lipid, and a non- cationic lipid.
- the siRNA molecule is in a nucleic acid-lipid particle comprising the siRNA molecule, a cationic lipid, a non-cationic lipid, and a conjugated lipid that inhibits aggregation of particles.
- a therapeutically effective amount of the nucleic acid-lipid particle can be administered to a mammal (e.g., a rodent such as a mouse or a primate such as a human, chimpanzee, or monkey).
- the mammal has a cell proliferative disorder.
- the mammal has a cell proliferative disorder selected from the group consisting of neoplasia (e.g., cancer), hyperplasia, restenosis, cardiac hypertrophy, immune disorders, and inflammation.
- the cell proliferative disorder is a neoplastic disorder such as cancer.
- the cancer includes, but is not limited to, hepatocellular carcinoma (HCC), papilloma, blastoglioma, Kaposi's sarcoma, melanoma, lung cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, astrocytoma, head cancer, neck cancer, bladder cancer, breast cancer, lung cancer, colorectal cancer, thyroid cancer, pancreatic cancer, gastric cancer, leukemia, lymphoma, Hodgkin's disease, osteosarcoma, testicular cancer, and Burkitt's disease.
- HCC hepatocellular carcinoma
- papilloma papilloma
- blastoglioma Kaposi's sarcoma
- melanoma melanoma
- lung cancer ovarian cancer
- prostate cancer squamous cell carcinoma
- astrocytoma head cancer
- neck cancer bladder cancer
- breast cancer breast cancer
- lung cancer colorectal cancer
- thyroid cancer pancre
- At least about 1%, 2%, 4%, 6%, 8%, 10%, 12%. 14%, 16%, 18%, or 20% of the total injected dose of the nucleic acid-lipid particles is present in plasma at about 1, 2, 4, 6, 8, 12, 16, 18, or 24 hours after injection, hi other embodiments, more than about 20%, 30%, 40%, or as much as about 60%, 70%, or 80% of the total injected dose of the nucleic acid-lipid particles is present in plasma at about 1, 4, 6, 8, 10, 12, 20, or 24 hours after injection.
- the effect of the siRNA molecule e.g., downregulation of the target PLK-I sequence
- the effect of the siRNA molecule is detectable at about 12, 24, 48, 72, or 96 hours, or at about 6, 8, 10, 12, 14, 16, 18, 19, 20, 22, 24, 26, or 28 days after administration of the nucleic acid-lipid particles.
- downregulation of expression of the target PLK-I sequence is detectable at about 12, 24, 48, 72, or 96 hours, or at about 6, 8, 10, 12, 14, 16, 18, 19, 20, 22, 24, 26, or 28 days after administration.
- downregulation of a PLK-I gene is determined by detecting mRNA or protein levels in a biological sample from the mammal, hi other embodiments, downregulation of expression of a PLK-I sequence is detected by measuring cell viability or the induction of apoptosis of cells in a biological sample from the mammal.
- the nucleic acid-lipid particles are suitable for use in intravenous nucleic acid delivery as they are stable in circulation, of a size required for pharmacodynamic behavior resulting in access to extravascular sites, and target cell populations.
- the present invention also provides pharmaceutically acceptable compositions comprising nucleic acid-lipid particles.
- the siRNA molecules described herein are used in methods for sensitizing a cell to the effects of a chemotherapy drug, hi particular, it is an object of the present invention to provide in vitro and in vivo methods for the treatment of a cell proliferative disorder in a mammal by downregulating or silencing the transcription and/or translation of a PLK-I gene in combination with administration of a chemotherapy drug.
- a mammal such as a human can be treated with a suitable dose of one or more unmodified or modified siRNA molecules (e.g., formulated in nucleic acid-lipid particles) before, during, and/or after chemotherapy drug administration, hi preferred embodiments, a cell such as a cancer cell in a mammal such as a human is contacted with an siRNA that silences PLK-I expression prior to administering the chemotherapy drug.
- a suitable dose of one or more unmodified or modified siRNA molecules e.g., formulated in nucleic acid-lipid particles
- a cell such as a cancer cell in a mammal such as a human is contacted with an siRNA that silences PLK-I expression prior to administering the chemotherapy drug.
- the present invention provides compositions comprising the asymmetrical interfering RNA (aiRNA) molecules described herein that target PLK-I expression and methods of using such compositions to silence PLK-I expression.
- aiRNA asymmetrical interfering RNA
- the present invention provides compositions comprising the microRNA (miRNA) molecules described herein that target PLK-I expression and methods of using such compositions to silence PLK-I expression.
- Figure 1 illustrates data demonstrating the RNAi activity of selected SNALP- formulated PLK-I siRNA sequences in HT29 and Neuro2A cells.
- Figure 2 illustrates data demonstrating that the potent effects of PLK-I SNALP on cell viability is due to the silencing of PLK-I mRNA.
- Figure 3 illustrates data demonstrating the RNAi activity of additional SNALP- formulated PLK-I siRNA sequences in HT29 and Neuro2A cells.
- Figure 4 illustrates data demonstrating the activity of SNALP-formulated PLKl 424 and PLK773 in HT29 and LS174T cells.
- Figure 5 illustrates data demonstrating that SNALP-formulated PLKl 424 and PLK773 induce apoptosis in LS174T cells.
- Figure 6 illustrates data demonstrating the RNAi activity of additional SNALP- formulated PLK-I siRNA sequences in HT29 and Neuro2A cells.
- Figure 7 illustrates data demonstrating that different 2'OMe modification patterns in the PLKl 424 siRNA sequence were well tolerated and the modified siRNA molecules retained potent activity.
- Figure 8 illustrates data demonstrating that 2'OMe-modified PLKl 424 siRNAs induced no detectable IL-6 or IFN- ⁇ response in murine FLT3L DC cultures.
- Figure 9 illustrates data demonstrating that different 2 1 OMe modification patterns in the PLK773 siRNA sequence were well tolerated and the modified siRNA molecules retained potent activity.
- Figure 10 illustrates data demonstrating that different 2OMe modification patterns in the PLKl 425 siRNA sequence were well tolerated and the modified siRNA molecules retained potent activity.
- Figure 11 illustrates data demonstrating that sequential combination treatment with PLK-I SNALP and paclitaxel (taxol) significantly enhanced the inhibition of Neuro2A and HepG2 cell growth.
- Figure 12 illustrates data demonstrating that sequential combination treatment with PLK-I SNALP and paclitaxel (taxol) significantly enhanced the level of apoptosis induced in Neuro2A cells.
- Figure 13 illustrates data demonstrating that a treatment regimen of SNALP- formulated PLKl 424 is well tolerated with no apparent signs of treatment related toxicity in mice bearing Hep3B liver tumors.
- Figure 14 illustrates data demonstrating that treatment with SNALP-formulated PLK1424 caused a significant increase in the survival of Hep3B tumor-bearing mice.
- Figure 15 illustrates data demonstrating that treatment with SNALP-formulated PLKl 424 reduced PLK-I mRNA levels by 50% in intrahepatic Hep3B tumors growing in mice 24 hours after SNALP administration.
- Figure 16 illustrates data demonstrating that a specific cleavage product of PLK- 1 mRNA was detectable in mice treated with PLKl 424 SNALP by 5' RACE-PCR. 10 ⁇ l PCR product/well were loaded onto a 1.5% agarose gel. Lane Nos.: (1) molecular weight (MW) marker; (2) PBS mouse 1; (3) PBS mouse 2; (4) PBS mouse 3; (5) Luc SNALP mouse 1; (6) Luc SNALP mouse 2; (7) PLK SNALP mouse 1; (8) PLK SNALP mouse 2; (9) PLK SNALP mouse 3; and (10) no template control.
- MW molecular weight
- Figure 17 illustrates data demonstrating that control (Luc) SNALP-treated mice displayed normal mitoses in Hep3B tumors (top panels), whereas PLK1424 SNALP-treated mice exhibited numerous aberrant mitoses and tumor cell apoptosis in Hep3B tumors (bottom panels).
- Figure 18 illustrates data demonstrating that multiple doses of 1 :57 PLK- 1 SNALP containing PEG-cDSA induced the regression of established Hep3B subcutaneous (S. C.) tumors.
- Figure 19 illustrates data demonstrating mRNA silencing of 1 : 57 PLK SNALP in S. C. Hep3B tumors following a single intravenous SNALP administration.
- Figure 20 illustrates data demonstrating that PLKl -cDSA SNALP inhibited the growth of large S.C. Hep3B tumors.
- Figure 21 illustrates data demonstrating tumor-derived PLK-I mRNA silencing in Hep3B intrahepatic tumors.
- Figure 22 illustrates data demonstrating the blood clearance profile of 1 : 57 PLK-I SNALP containing either PEG-cDMA or PEG-cDSA.
- Figure 23 illustrates data demonstrating an in vitro activity screen of PLK-I siRNA sequences.
- Activity of native PLK-I siRNA sequences targeting human PLK-I mRNA were assessed in the HT29 cell viability assay. Cells were treated with SNALP formulated PLK-I or Luc siRNA at 1 nM (white bar), 5 nM (grey bar), and 25 nM (black bar). Cell viability was assessed at 72 h using CellTiter Blue resazurin dye. Two rounds of siRNA design (A & B, C) were conducted. Sequence numbers represent the siRNA target site in the hPLK-1 mRNA open reading frame (Genbank Accession No. NM 005030).
- Figure 24 illustrates data demonstrating the activity of PLK-I siRNAs in vitro.
- PLK-I mRNA was determined by bDNA analysis at 24 h. Duplicate plates were assessed for cell viability at 72 h.
- D PLKl 424 siRNA causes dose dependent reductions in viability of LS 174T, HT29, Hep3B, and HepG2 cell cultures. Cells were treated for 72 h with PLK1424 SNALP at 5 (black bar), 2.5, 1.25, 0.63, and 0.31 (white bar) nM siRNA.
- Figure 25 illustrates data demonstrating the in vivo characterization of the interferon response induced by SNALP-formulated siRNA.
- Figure 26 illustrates data demonstrating the in vitro activity of unmodified versus 2'OMe-modified PLK-I and KSP siRNA.
- Unmodified PLK1424 or PLK773 siRNA (black) were compared in the Hep3B cell viability assay to the 2'0Me modified duplexes I/A, 2/ A, 1/B, 2/B, 1/C, or 2/C that comprise the respective 2'0Me sense/antisense oligonucleotides (see, Table 6).
- HT29 cells were treated with 10 nM SNALP-formulated PLKl 424, Luc siRNA or PBS .
- RNA was isolated 24 hours after transfection and assayed for the specific PLK-I mRNA cleavage product by 5'-RACE-PCR.
- Neuro2a cells were treated with SNALP-formulated KSP2263, PLK773 siRNA or PBS.
- RNA was isolated 24 hours after transfection and assayed for the specific mouse KSP mRNA cleavage product by 5'-RACE-PCR.
- the identity of the RNAi-specific 476bp PLK- 1 mRNA and 102b ⁇ KSP mRNA cleavage products were confirmed by direct oligonucleotide sequencing.
- Figure 28 illustrates data demonstrating that 2'OMe-modified PLK- 1 , KSP, or Luc siRNA induce no measurable IFN response in mice.
- SNALP-formulated Luc (unmodified) and the 2'OMe-modified Luc-U/U, PLK1424-2/A, PLK773-1/B, or KSP2263-U/U siRNA were administered at 2 mg/kg i.v. to Balb/C mice.
- IFITl relative to GAPDH mRNA in liver and spleen was assessed at 4 h by bDNA analysis.
- B Serum IFN ⁇ was assessed at 6 h by ELISA.
- FIG. 29 illustrates data demonstrating the therapeutic activity of PLK-I and KSP siRNA in hepatic tumors.
- C Residual hepatic Hep3B tumor burden in mice 24 h after final administration of PLK1424-2/A siRNA (5 x 2 mg/kg siRNA on d 8, 11, 14, 18 & 21).
- a Kaplan-Meier plot of days to euthanization due to tumor burden and endpoints are based on clinical scores as a humane surrogate for survival.
- Mean SNALP particle size and (polydispersity) were 83 (0.09), and 90 (0.12) nm for PLKl 424 and Luc formulations, respectively.
- Figure 30 illustrates data demonstrating that PLKl 424 SNALP confers significant survival advantages in the hepatic Hep3B - nu/nu mouse model.
- Mice bearing established hepatic tumors were treated with PLK1424-2/A or Luc-U/U SNALP (2 mg/kg twice weekly between dl 1 and d28 after tumor seeding) and monitored for tumor burden until euthanasia defined by humane endpoints.
- Data represent 2 independent studies.
- Figure 31 illustrates data demonstrating that PLKl 424-2/A SNALP significantly reduces macroscopic tumor burden after completion of dosing.
- Results are from individual mice described in Figure 37C. Livers from (A) PBS control and (B) PLK1424-2/A SNALP treated mice showing macroscopic tumor burden in the left lateral hepatic lobe. (C) Body weights of individual mice shown in (A) and (B) over the duration of the study from day 8 - day 21 after tumor seeding. Loss of body weight directly correlated with tumor burden in individual mice.
- Figure 32 illustrates data demonstrating that PLK-I SNALP is well tolerated in mice.
- Groups of CDl ICR mice were administered PBS, PLK773-1/B, or Luc-U/U SNALP to assess potential cumulative toxicities associated with either PLK-I silencing or the lipid vehicle.
- Mice were treated twice weekly at 2 mg/kg siRNA, equivalent to the efficacious dosing regimen in tumor studies.
- Clinical chemistry and complete blood counts were evaluated 24 h after dose 5 (day 15) and dose 9 (day 29).
- Figure 33 illustrates data demonstrating target mRNA silencing in hepatic tumors by the RNAi mechanism.
- A,B Target mRNA silencing and
- C,D detection of RNAi-specific mRNA cleavage products in tumors following SNALP formulated siRNA administration.
- Scid/beige mice with established intrahepatic Hep3B tumors were administered a single 2 mg/kg dose of SNALP formulated PLKl 424-2/A or Luc-U/U siRNA and RNAi activity assessed by (A) PLK-I mRNA in tumor lysates and (C) 5' RACE-PCR analysis.
- C RACE-PCR detects the specific 5' cleavage product of PLK-I mRNA from tumors analyzed in (A).
- RACE-PCR detects the specific 5' cleavage product of mouse KSP mRNA from tumors.
- Figure 34 illustrates data demonstrating the duration of RNAi activity within hepatic tumors.
- A 5'-RACE-PCR analysis of Hep3B liver tumors 24 h, 48 h, 96 h, 7 d, & 10 d after a single intravenous administration of SNALP-formulated PLK1424-2/A siRNA (2 mg/kg). Specificity of the PLKl 424-specific RACE-PCR product (arrowed) was confirmed by sequencing at d 1 and d 7.
- B Corresponding levels of PLK-I mRNA in isolated tumor RNA analyzed in (A). Duration of RNAi correlated with duration of mRNA silencing compared to Luc-U/U SNALP treated mice.
- Figure 35 illustrates data demonstrating the induction of monoastral spindle formation by KSP2263 siRNA.
- HeLa cells were treated for 16 h with (A) Luc or (B) KSP2263 siRNA at 20 nM then immunostained for ⁇ -tubulin (FITC). DNA was stained with DAPI and flourescent images captured and overlayed. Control cells show normal bipolar spindles at metaphase compared to monoastral spindles in KSP2263 treated cells.
- FIG. 36 illustrates data demonstrating that KSP2263-U/U induces distinct phenotypic changes typical of KSP inhibition in hepatic tumor cells.
- H&E Hematoxylin and eosin
- FIG. 38 illustrates data demonstrating a comparison of PLK1424 SNALP comprising either PEG-cDMA or PEG-cDSA in the hepatic tumor model.
- PLK1424-2/A SNALP comprising either PEG-cDMA or PEG-cDSA confers significant survival advantages in scid/beige mice bearing intrahepatic Hep3B tumors.
- Mice were administered PLK1424-2/A SNALP comprising PEG cDMA or PEG-cDSA or Luc-U/U SNALP (PEG-cDMA) at 2 mg/kg twice weekly between d 10 and d 28 after seeding (6 doses).
- Time to euthanization due to tumor burden was assessed based on clinical scores as a humane surrogate to survival.
- Both PLK1424-2/A SNALP compositions provided significant survival advantage over control (p ⁇ 0.05, Log-rank Mantel Cox test).
- Figure 39 illustrates data demonstrating the therapeutic activity of PLK-I SNALP containing either C14 or Cl 8 PEG-lipids in subcutaneous tumors.
- Mean SNALP particle size and (polydispersity) were 81 (0.10), 71 (0.03), 82 (0.12), and 74 (0.05) nm for PLKl 424 PEG-cDMA, PLKl 424 PEG-cDSA, Luc PEG-cDMA, and Luc PEG- cDSA, respectively.
- Figure 40 illustrates data demonstrating that different chemical modification patterns in the PLKl 424 siRNA sequence were well tolerated and the modified siRNA molecules retained potent activity in killing human tumor cells.
- Figure 41 illustrates data demonstrating that modified PLK1424 siRNAs did not induce an IFN- ⁇ response that was greater than the negative controls.
- Figure 42 illustrates data demonstrating that there was no significant IFITl induction above that of empty SNALP with PLKl 424 1/3, PLKl 424 2/3, PLKl 424 2/4, and PLKl 424 2/6 siRNAs.
- Figure 43 illustrates data demonstrating that all PLKl 424 siRNAs tested in He ⁇ 3B tumors produced an equivalent level of PLK-I mRNA silencing in vivo.
- Hepatocellular carcinoma is the fifth most common solid tumor worldwide and the fourth leading cause of cancer mortality accounting for approximately 400,000 deaths annually (Thomas et al, J. CHn. Oncol, 23:2892-2899 (2005)).
- HCC Hepatocellular carcinoma
- Surgical resection or complete liver transplantation are considered the only therapies with curative potential; however, 70-85% of HCC patients present with advanced tumors and are often compromised with underlying liver disease that contraindicates invasive surgery (Llovet et al, J. Natl. Cancer Inst., 100:698-711 (2008)).
- Sorafenib will become part of the standard of care for this patient population.
- the liver is also a common site of tumor metastatic disease; for example, approximately 50% of colorectal cancer patients develop metastases to the liver, resulting in significant increase in patient mortality (Steele et ah, Annals Surgery, 210:127-138 (1989)).
- Combinatorial therapy with systemically administered conventional and targeted chemotherapeutics improves the survival times of these patients; however, the non-surgical cure for metastatic colon cancer remains elusive. It is clear that HCC and metastatic disease in the liver represent a significant unmet medical need that requires the development of novel therapeutic agents for more effective treatment options.
- RNAs are powerful, target-specific molecules designed to suppress gene expression through the endogenous cellular process of RNAi (Elbashir et al, Nature, 411 :494-498 (2001)). Since the characterization of this fundamental gene silencing mechanism, tremendous progress has been made in developing siRNA as a potentially novel class of therapeutic agent for a broad spectrum of diseases. However, the primary barrier to realizing the potential of siRNA therapeutics is the need for drug delivery vehicles that facilitate disease site targeting and intracellular delivery of the siRNA (Zimmermann et al, Nature, 441:111-114 (2006); de Fougerolles et al. , Nat. Rev. DrugDiscov., 6:443-453 (2007); Behlke, MoI.
- Drug Carrier Syst., 9:135-187 (1992) also referred to as passive targeting, whereby charge neutral carriers of suitable size can pass through the fenestrated epithelium observed in sites of clinical interest such as tumors.
- carriers In order to take advantage of this effect and achieve significant enrichment at the target site, carriers must be small (diameter on the order of 100 nm) and long-circulating, thereby able to bypass the microcapillary beds of the "first pass" organs, the lungs, liver and the phagocytic cells of the reticuloendothelial system.
- Targets generally fall into three broad categories: (i) those that are involved in the cell cycle or cell division and are directly cytotoxic when down-regulated; (ii) those that support tumor cell growth, tumor progression or metastasis such as growth factors, their receptors or angiogenic factors; and (iii) those that increase tumor sensitivity to conventional therapeutic approaches such as anti-apoptotic proteins, drug resistance genes and DNA repair enzymes.
- the present invention is drawn to targeting the expression of an essential cell cycle protein Polo-like kinase 1 (PLK-I). [0100] Progress through the cell cycle is controlled by kinases, such as those of the Cyclin- dependant and Polo-like kinase families.
- the polo-like kinases are named for Polo, a serine/threonine kinase first identified in Drosophila Melanogaster and characterized by their unique phosphopeptide binding polo-box domain (Barr et al, Nat. Rev. MoI. Cell Biol, 5:429-440 (2004)).
- Polo a serine/threonine kinase first identified in Drosophila Melanogaster and characterized by their unique phosphopeptide binding polo-box domain
- PLK-I also known as Snk
- PLK-3 also known as Prk or Fnk
- PLK-4 also known as Sak
- All have predicted nuclear localization signals (Taniguchi et al, J. Biol.
- PLK-I acts to phosphorylate Cdc25C phosphatase, cyclin B, a cohesin subunit of the mitotic spindle, subunits of the anaphase promoting complex, mammalian kinesin-like protein 1 MKLP-I and other kinesin related proteins.
- This diverse array of substrates illustrates the multiple roles of PLK-I in mitosis and cytokinesis (Barr et al, supra).
- PLK-I PLK-I-induced in many human tumor types, is a negative prognosticator of patient outcome (Strebhardt et al, Nat. Rev. Cancer, 6:321-330 (2006)), while inhibition of PLK-I activity rapidly induces mitotic arrest and tumor cell apoptosis (Steegmaier et al, Curr. Biol, 17:316-322 (2007); Liu et al, Proc. Natl Acad. ScL USA, 100:5789-5794 (2003)).
- PLK-I also acts to sensitize cancer cells to the pro-apoptotic activity of small molecule drugs (Spankuch et al, Oncogene, 26:5793-5807 (2007)), likely due to its functional role in the DNA damage and spindle assembly checkpoints.
- PLK-I siRNA sequences can be immunostimulatory, e.g., stimulate potent inflammatory responses from innate immune cells, particularly when associated with delivery vehicles that facilitate intracellular uptake. This represents a significant barrier to the therapeutic development of PLK-I siRNA molecules due to toxicity and off-target gene effects associated with the inflammatory response.
- the present invention overcomes these limitations by reducing or completely abrogating the immune response to PLK-I siRNA using the selective incorporation of modified nucleotides such as 2'-O-methyl (2'0Me) uridine and/or guanosine nucleotides into either or both strands of the siRNA.
- modified nucleotides such as 2'-O-methyl (2'0Me) uridine and/or guanosine nucleotides
- the immunostimulatory properties of PLK-I siRNA sequences and their ability to silence PLK-I expression can be balanced or optimized by the introduction of minimal and selective 2 1 OMe modifications within the double-stranded region of the siRNA duplex. This can be achieved at therapeutically viable siRNA doses without cytokine induction, toxicity, and off-target effects associated with the use of unmodified siRNA.
- the present invention provides chemically modified siRNA molecules which silence PLK-I expression and methods of use thereof.
- the present invention also provides nucleic acid-lipid particles (e.g., SNALP) comprising a modified siRNA molecule described herein, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles.
- the present invention further provides methods of silencing PLK-I gene expression by administering a modified siRNA molecule described herein to a mammalian subject.
- the present invention provides an siRNA therapeutic targeting human PLK-I for the treatment of liver cancers such as HCC and liver metastatic disease.
- the present invention additionally provides methods of identifying and/or modifying PLK-I siRNA having immunostimulatory properties.
- Methods for sensitizing a cell such as a cancer cell to the effects of a chemotherapy drug comprising sequentially delivering PLK-I siRNA followed by the chemotherapy drug are also provided.
- the present invention demonstrates that rationally designed siRNA, when delivered using a safe and effective systemic delivery vehicle, are able to affect therapeutic PLK-I gene silencing through the confirmed mechanism of RNAi in the absence of unintended immune stimulation.
- poly-like kinase 1 refers to a serine/threonine kinase containing two functional domains: (1) a kinase domain; and (2) a polo-box domain (see, e.g., Barr et al, Nat. Rev. MoI. Cell Biol, 5:429-440 (2004)).
- the activity and cellular concentration of PLK-I are crucial for the precise regulation of cell division. PLK-I expression and activity are low throughout the GO, Gl, and S phases of the cell cycle, but begin to rise in G2 and peak during M phase.
- PLK-I is essential for mitosis and cell division and contributes to the following processes: centrosome maturation and the activation of maturation-promoting factors by Cdc25C and cyclinBl phosphorylation; bipolar spindle formation; and DNA damage checkpoint adaptation (DNA damage inhibits PLK-I in G2 and mitosis).
- PLK-I is also involved in the activation of components of the anaphase promoting complex for mitotic exit and cytokinesis.
- PLK-I is overexpressed in many cancer types including hepatoma and colon cancer, and PLK-I expression often correlates with poor patient prognosis. Overexpression of PLK-I (wild-type or kinase inactive) results in multinucleation (genetic instability).
- Hyperactive PLK-I overrides the DNA damage checkpoint. Constitutive PLK-I expression causes transformation of NIH 3T3 cells. PLK-I phosphorylates the p53 tumor suppressor, thereby inhibiting the pro-apoptotic effects of p53.
- Human PLK-I mRNA sequences are set forth in Genbank Accession Nos. NM_005030,
- a mouse PLK-I mRNA sequence is set forth in Genbank Accession No. NM_011121. PLK-I is also known as serine/threonine protein kinase 13 (STPKl 3).
- interfering RNA or "RNAi” or “interfering RNA sequence” refers to single-stranded RNA (e.g., mature miRNA) or double-stranded RNA (i.e., duplex RNA such as siRNA, aiRNA, or pre-miRNA) that is capable of reducing or inhibiting expression of a target gene (i.e., by mediating the degradation or inhibiting the translation of mRNAs which are complementary to the sequence of the interfering RNA) when the interfering RNA is in the same cell as the target gene.
- target gene i.e., by mediating the degradation or inhibiting the translation of mRNAs which are complementary to the sequence of the interfering RNA
- Interfering RNA thus refers to the single-stranded RNA that is complementary to an mRNA sequence or to the double-stranded RNA formed by two complementary strands or by a single, self-complementary strand.
- Interfering RNA may have substantial or complete identity to the target gene or may comprise a region of mismatch (i.e., a mismatch motif).
- the sequence of the interfering RNA can correspond to the full length target gene, or a subsequence thereof.
- Interfering RNA includes "small-interfering RNA" or "siRNA,” e.g., interfering
- RNA of about 15-60, 15-50, or 15-40 (duplex) nucleotides in length more typically about 15- 30, 15-25, or 19-25 (duplex) nucleotides in length, and is preferably about 20-24, 21-22, or 21-23 (duplex) nucleotides in length
- each complementary sequence of the double- stranded siRNA is 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in length, preferably about 20-24, 21-22, or 21-23 nucleotides in length
- the double-stranded siRNA is about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 base pairs in length, preferably about 18-22, 19-20, or 19-21 base pairs in length).
- siRNA duplexes may comprise 3' overhangs of about 1 to about 4 nucleotides or about 2 to about 3 nucleotides and 5' phosphate termini.
- siRNA include, without limitation, a double-stranded polynucleotide molecule assembled from two separate stranded molecules, wherein one strand is the sense strand and the other is the complementary antisense strand; a double- stranded polynucleotide molecule assembled from a single stranded molecule, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense and antisense regions; and a circular single-stranded polynucleotide molecule with two or more loop structures and a stem having self- complementary sense and antisense regions, where the circular polynucleotide can be processed in vivo
- siRNA are chemically synthesized.
- siRNA can also be generated by cleavage of longer dsRNA (e.g., dsRNA greater than about 25 nucleotides in length) with the E. coli RNase III or Dicer. These enzymes process the dsRNA into biologically active siRNA (see, e.g., Yang et al., Proc. Natl. Acad. ScL USA, 99:9942-9947 (2002); Calegari et a!., Proc. Natl. Acad. Sci. USA, 99:14236 (2002); Byrom et al., Ambion TechNotes, 10(l):4-6 (2003); Kawasaki et al.
- dsRNA are at least 50 nucleotides to about 100, 200, 300, 400, or 500 nucleotides in length.
- a dsRNA maybe as long as 1000, 1500, 2000, 5000 nucleotides in length, or longer.
- the dsRNA can encode for an entire gene transcript or a partial gene transcript, hi certain instances, siRNA may be encoded by a plasmid (e.g., transcribed as sequences that automatically fold into duplexes with hairpin loops).
- mismatch motif or mismatch region refers to a portion of an interfering RNA (e.g., siRNA, aiRNA, miRNA) sequence that does not have 100 % complementarity to its target sequence.
- An interfering RNA may have at least one, two, three, four, five, six, or more mismatch regions.
- the mismatch regions may be contiguous or may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more nucleotides.
- the mismatch motifs or regions may comprise a single nucleotide or may comprise two, three, four, five, or more nucleotides.
- an "effective amount” or “therapeutically effective amount” of an interfering RNA is an amount sufficient to produce the desired effect, e.g., an inhibition of expression of a target sequence in comparison to the normal expression level detected in the absence of the interfering RNA. Inhibition of expression of a target gene or target sequence is achieved when the value obtained with the interfering RNA relative to the control is about 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%.
- Suitable assays for measuring expression of a target gene or target sequence include, e.g., examination of protein or mRNA levels using techniques known to those of skill in the art such as dot blots, northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays known to those of skill in the art.
- a detectable decrease of an immune response to a given interfering RNA e.g., a modified interfering RNA.
- the amount of decrease of an immune response by a modified interfering RNA may be determined relative to the level of an immune response in the presence of an unmodified interfering RNA.
- a detectable decrease can be about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more lower than the immune response detected in the presence of the unmodified interfering RNA.
- a decrease in the immune response to interfering RNA is typically measured by a decrease in cytokine production (e.g., IFN ⁇ , IFN ⁇ , TNF ⁇ , IL-6, or IL- 12) by a responder cell in vitro or a decrease in cytokine production in the sera of a mammalian subject after administration of the interfering RNA.
- cytokine production e.g., IFN ⁇ , IFN ⁇ , TNF ⁇ , IL-6, or IL- 12
- responder cell refers to a cell, preferably a mammalian cell, that produces a detectable immune response when contacted with an immunostimulatory interfering RNA such as an unmodified siRNA.
- Exemplary responder cells include, e.g., dendritic cells, macrophages, peripheral blood mononuclear cells (PBMCs), splenocytes, and the like.
- Detectable immune responses include, e.g., production of cytokines or growth factors such as TNF- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IL-I, IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL- 12, IL- 13, TGF, and combinations thereof.
- cytokines or growth factors such as TNF- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IL-I, IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL- 12, IL- 13, TGF, and combinations thereof.
- Substantial identity refers to a sequence that hybridizes to a reference sequence under stringent conditions, or to a sequence that has a specified percent identity over a
- stringent hybridization conditions refers to conditions under which a nucleic acid will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-1O 0 C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength pH.
- T m thermal melting point
- the T m is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T m , 50% of the probes are occupied at equilibrium).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- a positive signal is at least two times background, preferably 10 times background hybridization.
- Exemplary stringent hybridization conditions can be as follows: 50% formamide,
- a temperature of about 62 0 C is typical, although high stringency annealing temperatures can range from about 50 0 C to about 65 0 C, depending on the primer length and specificity.
- Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90°C-95°C for 30 sec-2 min., an annealing phase lasting 30 sec-2 min., and an extension phase of about 72 0 C for 1-2 min. Protocols and guidelines for low and high stringency amplification reactions are provided, e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.
- nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions.
- Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl,
- nucleic acids refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same ⁇ i.e., at least about 60%, preferably at least about 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
- This definition when the context indicates, also refers analogously to the complement of a sequence.
- the substantial identity exists over a region that is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
- the sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window,” as used herein, includes reference to a segment of any one of a number of contiguous positions selected from the group consisting of from about 5 to about 60, usually about 10 to about 45, more usually about 15 to about 30, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well known in the art.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoI.
- BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids of the invention.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
- the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sd. USA, 90:5873-5787 (1993)).
- BLAST algorithm One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide sequences would occur by chance.
- P(N) the smallest sum probability
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
- nucleic acid refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in either single- or double-stranded form and includes DNA and RNA.
- DNA may be in the form of, e.g., antisense molecules, plasmid DNA, pre-condensed DNA, a PCR product, vectors (Pl, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups.
- RNA may be in the form of siRNA, asymmetrical interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, vRNA, and combinations thereof.
- Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and which have similar binding properties as the reference nucleic acid. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2'-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs).
- PNAs peptide-nucleic acids
- nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid.
- a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)).
- "Nucleotides” contain a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate groups.
- Bases include purines and pyrimidines, which further include natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, and synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications which place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkylhalides.
- Gene refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises partial length or entire length coding sequences necessary for the production of a polypeptide or precursor polypeptide.
- Gene product refers to a product of a gene such as an RNA transcript or a polypeptide.
- lipid refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are characterized by being insoluble in water, but soluble in many organic solvents. They are usually divided into at least three classes: (1) “simple lipids,” which include fats and oils as well as waxes; (2) “compound lipids,” which include phospholipids and glycolipids; and (3) “derived lipids” such as steroids.
- Lipid vesicle refers to any lipid composition that can be used to deliver a compound such as an interfering RNA including, but not limited to, liposomes, wherein an aqueous volume is encapsulated by an amphipathic lipid bilayer; or wherein the lipids coat an interior comprising a large molecular component, such as a plasmid comprising an interfering RNA sequence, with a reduced aqueous interior; or lipid aggregates or micelles, wherein the encapsulated component is contained within a relatively disordered lipid mixture.
- a compound such as an interfering RNA including, but not limited to, liposomes, wherein an aqueous volume is encapsulated by an amphipathic lipid bilayer; or wherein the lipids coat an interior comprising a large molecular component, such as a plasmid comprising an interfering RNA sequence, with a reduced aqueous interior; or lipid aggregates or micelles, wherein the
- lipid vesicle encompasses any of a variety of lipid-based carrier systems including, without limitation, SPLPs, pSPLPs, SNALPs, liposomes, micelles, virosomes, lipid-nucleic acid complexes, and mixtures thereof.
- lipid encapsulated can refer to a lipid formulation that provides a compound, such as a nucleic acid (e.g., an interfering RNA), with full encapsulation, partial encapsulation, or both.
- the nucleic acid is fully encapsulated in the lipid formulation (e.g., to form an SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle).
- SNALP refers to a stable nucleic acid-lipid particle.
- a SNALP represents a particle made from lipids (e.g., a cationic lipid, a non-cationic lipid and a conjugated lipid that prevents aggregation of the particle), wherein the nucleic acid (e.g., siRNA, aiRNA, miRNA, ssDNA, dsDNA, ssRNA, short hairpin RNA (shRNA), dsRNA, or a plasmid, including plasmids from which an interfering RNA is transcribed) is fully encapsulated within the lipid.
- the nucleic acid e.g., siRNA, aiRNA, miRNA, ssDNA, dsDNA, ssRNA, short hairpin RNA (shRNA), dsRNA, or a plasmid, including plasmids from which an interfering RNA is transcribed
- SNALP includes an SPLP, which is the term used to refer to a nucleic acid-lipid particle comprising a nucleic acid (e.g., a plasmid) encapsulated within the lipid.
- SNALPs and SPLPs typically contain a cationic lipid, a non-cationic lipid, and a lipid conjugate (e.g., a PEG-lipid conjugate).
- SNALPs and SPLPs are extremely useful for systemic applications, as they can exhibit extended circulation lifetimes following intravenous (i.v.) injection, they can accumulate at distal sites (e.g., sites physically separated from the administration site) and they can mediate expression of the transfected gene or silencing of target gene expression at these distal sites.
- SPLPs include "pSPLP," which comprise an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683.
- the nucleic acid-lipid particles of the present invention typically have a mean diameter of about 50 ran to about 150 ran, more typically about 60 ran to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 to about 90 nm, and are substantially nontoxic.
- the nucleic acids when present in the nucleic acid-lipid particles of the present invention, are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Publication No. 20040142025 and U.S. Patent Publication No. 20070042031.
- Lipid formulation or, alternatively, a “lipid-based formulation” is used herein to refer to a SNALP that can be used to deliver a nucleic acid, such as an interfering RNA, to a target site of interest.
- a nucleic acid such as an interfering RNA
- the lipid formulation which is typically formed from a cationic lipid, a non-cationic lipid and a lipid conjugate, the nucleic acid is encapsulated in the lipid, thereby protecting the nucleic acid from nuclease degradation.
- lipid conjugate refers to a conjugated lipid that inhibits aggregation of nucleic acid-lipid particles.
- lipid conjugates include, but are not limited to, polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates, such as PEG coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, PEG conjugated to ceramides (see, e.g., U.S. Patent No. 5,885,613), cationic PEG lipids, and mixtures thereof.
- polyamide oligomers e.g., ATTA-lipid conjugates
- PEG-lipid conjugates such as PEG coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, PEG conjugated to ceramides (see, e.g
- PEG can be conjugated directly to the lipid or may be linked to the lipid via a linker moiety.
- Any linker moiety suitable for coupling the PEG to a lipid can be used including, e.g., non-ester containing linker moieties and ester-containing linker moieties. In preferred embodiments, non-ester containing linker moieties are used.
- amphipathic lipid refers, in part, to any suitable material wherein the hydrophobic portion of the lipid material orients into a hydrophobic phase, while the hydrophilic portion orients toward the aqueous phase.
- Hydrophilic characteristics derive from the presence of polar or charged groups such as carbohydrates, phosphate, carboxylic, sulfato, amino, sulfhydryl, nitro, hydroxyl, and other like groups. Hydrophobicity can be conferred by the inclusion of apolar groups that include, but are not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s).
- amphipathic compounds include, but are not limited to, phospholipids, aminolipids, and sphingolipids.
- Representative examples of phospholipids include, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and dilinoleoylphosphatidylcholine.
- amphipathic lipids Other compounds lacking in phosphorus, such as sphingolipid, glycosphingolipid families, diacylglycerols, and ⁇ -acyloxyacids, are also within the group designated as amphipathic lipids. Additionally, the amphipathic lipids described above can be mixed with other lipids including triglycerides and sterols.
- neutral lipid refers to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH.
- lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides, and diacylglycerols.
- non-cationic lipid refers to any amphipathic lipid as well as any other neutral lipid or anionic lipid.
- anionic lipid refers to any lipid that is negatively charged at physiological pH. These lipids include, but are not limited to, phosphatidylglycerols, cardiolipins, diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl phosphatidylethanolamines, N-succinyl phosphatidylethanolamines, N- glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids.
- phosphatidylglycerols cardiolipins
- diacylphosphatidylserines diacylphosphatidic acids
- N-dodecanoyl phosphatidylethanolamines N-succinyl phosphatidylethanolamines
- cationic lipid refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH (e.g., pH of about 7.0). It has been surprisingly found that cationic lipids comprising alkyl chains with multiple sites of unsaturation, e.g., at least two or three sites of unsaturation, are particularly useful for forming nucleic acid-lipid particles with increased membrane fluidity. A number of cationic lipids and related analogs, which are also useful in the present invention, have been described in U.S. Patent Publication Nos. 20060083780 and 20060240554; U.S. Patent Nos.
- cationic lipids include, but are not limited to, l,2-dilinoleyloxy-N,N- dimethylaminopropane (DLinDMA), 1 ,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), dioctadecyldimethylammonium (DODMA), distearyldimethylammonium (DSDMA), N-(I- (2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N- dimethylammonium bromide (DDAB
- CpLinDMA N,N-dimethyl-3,4-dioleyloxybenzylamine
- DOcarbDAP 1,2-N.N 1 - dioleylcarbamyl-3-dimethylaminopropane
- DOcarbDAP 1,2-N.N 1 - dioleylcarbamyl-3-dimethylaminopropane
- DLinDAP 2,3-Dilinoleoyloxy-N,N- dimethylpropylamine
- DLincarbDAP 1,2-N,N'-Dilinoleylcarbamyl-3 -dimethylaminopropane
- DLincarbDAP 1,2-N,N'-Dilinoleylcarbamyl-3 -dimethylaminopropane
- DLinCDAP 2,2- dilinoleyl-4-dimethylaminomethyl-[l ,3]-dioxolane
- DLin-K-DMA 2,2-dil
- the cationic lipids comprise a protonatable tertiary amine head group, Cl 8 alkyl chains, ether linkages between the head group and alkyl chains, and 0 to 3 double bonds.
- Such lipids include, e.g., DSDMA, DLinDMA, DLenDMA, and DODMA.
- the cationic lipids may also comprise ether linkages and pH titratable head groups.
- Such lipids include, e.g., DODMA.
- hydrophobic lipid refers to compounds having apolar groups that include, but are not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups optionally substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s). Suitable examples include, but are not limited to, diacylglycerol, dialkylglycerol, N-N-dialkylamino, l,2-diacyloxy-3-aminopropane, and l,2-dialkyl-3- aminopropane.
- aqueous solution refers to a composition comprising in whole, or in part, water.
- organic lipid solution refers to a composition comprising in whole, or in part, an organic solvent having a lipid.
- distal site refers to a physically separated site, which is not limited to an adjacent capillary bed, but includes sites broadly distributed throughout an organism.
- “Serum-stable” in relation to nucleic acid-lipid particles means that the particle is not significantly degraded after exposure to a serum or nuclease assay that would significantly degrade free DNA or RNA.
- Suitable assays include, for example, a standard serum assay, a DNAse assay, or an RNAse assay.
- Systemic delivery refers to delivery that leads to a broad biodistribution of a compound such as an interfering RNA within an organism. Some techniques of administration can lead to the systemic delivery of certain compounds, but not others. Systemic delivery means that a useful, preferably therapeutic, amount of a compound is exposed to most parts of the body. To obtain broad biodistribution generally requires a blood lifetime such that the compound is not rapidly degraded or cleared (such as by first pass organs (liver, lung, etc.) or by rapid, nonspecific cell binding) before reaching a disease site distal to the site of administration.
- Systemic delivery of nucleic acid-lipid particles can be by any means known in the art including, for example, intravenous, subcutaneous, and intraperitoneal. In a preferred embodiment, systemic delivery of nucleic acid-lipid particles is by intravenous delivery.
- “Local delivery,” as used herein, refers to delivery of a compound such as an interfering RNA directly to a target site within an organism.
- a compound can be locally delivered by direct injection into a disease site such as a tumor or other target site such as a site of inflammation or a target organ such as the liver, heart, pancreas, kidney, and the like.
- mammal refers to any mammalian species such as a human, mouse, rat, dog, cat, hamster, guinea pig, rabbit, livestock, and the like.
- cancer refers to any member of a class of diseases characterized by the uncontrolled growth of aberrant cells. The term includes all known cancers and neoplastic conditions, whether characterized as malignant, benign, soft tissue, or solid, and cancers of all stages and grades including pre- and post-metastatic cancers.
- cancers examples include, but are not limited to, liver cancer, lung cancer, colon cancer, rectal cancer, anal cancer, bile duct cancer, small intestine cancer, stomach (gastric) cancer, esophageal cancer; gallbladder cancer, pancreatic cancer, appendix cancer, breast cancer, ovarian cancer; cervical cancer, prostate cancer, renal cancer (e.g., renal cell carcinoma), cancer of the central nervous system, glioblastoma, skin cancer, lymphomas, choriocarcinomas, head and neck cancers, osteogenic sarcomas, and blood cancers.
- liver cancer lung cancer, colon cancer, rectal cancer, anal cancer, bile duct cancer, small intestine cancer, stomach (gastric) cancer, esophageal cancer
- gallbladder cancer pancreatic cancer, appendix cancer, breast cancer, ovarian cancer
- cervical cancer prostate cancer
- renal cancer e.g., renal cell carcinoma
- cancer of the central nervous system glioblastoma
- liver cancer Non-limiting examples of specific types of liver cancer include hepatocellular carcinoma, secondary liver cancer (caused by metastasis of some other non-liver cancer cell type), and hepatoblastoma.
- a "tumor" comprises one or more cancerous cells.
- compositions comprising interfering RNA (e.g., siRNA, aiRNA, miRNA, etc.) that target PLK-I expression and methods of using such compositions to silence PLK-I expression.
- interfering RNA e.g., siRNA, aiRNA, miRNA, etc.
- the present invention provides a modified siRNA molecule comprising a double-stranded region of about 15 to about 60 nucleotides in length, wherein one or more of the nucleotides in the double-stranded region comprise modified nucleotides, and wherein the modified siRNA molecule is capable of silencing PLK-I expression.
- the modified siRNA molecule comprises modified nucleotides selected from the group consisting of 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2 1 F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof, hi a preferred embodiment, the modified siRNA molecule comprises 2'OMe nucleotides.
- the 2'OMe nucleotides may be selected from the group consisting of 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
- the modified siRNA molecule comprises a double-stranded region of about 15 to about 30 nucleotides in length, hi certain instances, the modified siRNA molecule comprises modified nucleotides in one strand of the modified siRNA molecule. In certain other instances, the modified siRNA molecule comprises modified nucleotides in both strands of the modified siRNA molecule. Typically, two, three, four, five, six, seven, or more of the nucleotides in the double-stranded region comprise modified nucleotides.
- the modified siRNA molecule is less immunostimulatory than a corresponding unmodified siRNA sequence.
- the modified siRNA molecule with reduced immunostimulatory properties advantageously retains RNAi activity against the target PLK-I sequence.
- the immunostimulatory properties of the modified siRNA molecules described herein and their ability to silence PLK-I expression can be balanced or optimized by the introduction of minimal and selective 2'OMe modifications within the siRNA sequence such as, e.g., within the double-stranded region of the siRNA duplex.
- the modified siRNA molecule is at least about 70% less immunostimulatory than the corresponding unmodified siRNA sequence. In certain other instances, the modified siRNA molecule has an IC 50 that is less than or equal to ten- fold that of the corresponding unmodified siRNA sequence.
- the modified siRNA molecule comprises 3' overhangs in one strand of the modified siRNA molecule. In other instances, the modified siRNA molecule comprises 3' overhangs in both strands of the modified siRNA molecule. In some instances, the modified siRNA molecule comprises a hairpin loop structure. [0156] The modified siRNA molecule typically comprises a sense strand, an antisense strand, or a sense strand and an antisense strand having one or more modified nucleotides in the double-stranded region of the siRNA molecule.
- the sense strand of the modified siRNA molecule comprises or consists of one of the sense strand sequences set forth in Table 1.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO: 1.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:3.
- the antisense strand of the modified siRNA molecule comprises or consists of one of the antisense strand sequences set forth in Table 1.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:2.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:4.
- one or more of the nucleotides in the sense and/or antisense strand sequences set forth in Table 1 may comprise modified nucleotides, wherein the modified nucleotides are located in the double-stranded region of the siRNA molecule, hi some instances, the sense and/or antisense strand contains "dTdT” or "UU” 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof.
- the 3' overhang on the sense strand, antisense strand, or both strands comprises one, two, three, four, or more modified nucleotides such as those described herein (e.g., 2'0Me nucleotides).
- the sense strand of the modified siRNA molecule comprises or consists of one of the sense strand sequences set forth in Table 2.
- the antisense strand of the modified siRNA molecule comprises or consists of one of the antisense strand sequences set forth in Table 2.
- one or more of the nucleotides in the sense and/or antisense strand sequences set forth in Table 2 may comprise modified nucleotides, wherein the modified nucleotides are located in the double-stranded region of the siRNA molecule.
- the sense and/or antisense strand contains "dTdT” or "UU" 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof.
- the 3' overhang on the sense strand, antisense strand, or both strands comprises one, two, three, four, or more modified nucleotides such as those described herein (e.g., 2'OMe nucleotides).
- the sense strand of the modified siRNA molecule comprises or consists of one of the unmodified sense strand sequences set forth in Table 3.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:51.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:58.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:65.
- the antisense strand of the modified siRNA molecule comprises or consists of one of the unmodified antisense strand sequences set forth in Table 3.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO: 52. In another preferred embodiment, the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:59. hi yet another preferred embodiment, the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:66. As described herein, one or more of the nucleotides in the unmodified sense and/or antisense strand sequences set forth in Table 3 may comprise modified nucleotides, wherein the modified nucleotides are located in the double-stranded region of the siRNA molecule.
- the sense and/or antisense strand contains "dTdT” or "UU” 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof. In further instances, the 3' overhang on the sense strand, antisense strand, or both strands comprises one, two, three, four, or more modified nucleotides such as those described herein (e.g., 2 1 OMe nucleotides). [0160] In some embodiments, the sense strand of the modified siRNA molecule comprises or consists of one of the modified sense strand sequences set forth in Table 3.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:57. In another preferred embodiment, the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:64. In yet another preferred embodiment, the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:67. hi some instances, the sense strand contains "dTdT" or "UU" 3' overhangs, hi other instances, the sense strand contains 3' overhangs that have complementarity to the complementary strand of the target sequence. In further instances, the 3' overhang on the sense strand comprises one, two, three, four, or more modified nucleotides such as those described herein (e.g., 2'OMe nucleotides).
- the antisense strand of the modified siRNA molecule comprises or consists of one of the modified antisense strand sequences set forth in Table 3.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:54.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:56.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:63.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:68.
- the antisense strand contains "dTdT” or "UU” 3' overhangs. In other instances, the antisense strand contains 3' overhangs that have complementarity to the target sequence. In further instances, the 3' overhang on the antisense strand comprises one, two, three, four, or more modified nucleotides such as those described herein (e.g., 2'OMe nucleotides).
- the sense strand of the modified siRNA molecule comprises or consists of one of the sense strand sequences set forth in Tables 4-5. In certain other embodiments, the antisense strand of the modified siRNA molecule comprises or consists of one of the antisense strand sequences set forth in Tables 4-5.
- one or more of the nucleotides in the sense and/or antisense strand sequences set forth in Tables 4-5 may comprise modified nucleotides, wherein the modified nucleotides are located in the double-stranded region of the siRNA molecule.
- the sense and/or antisense strand contains "dTdT” or "UU" 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof.
- the 3' overhang on the sense strand, antisense strand, or both strands comprises one, two, three, four, or more modified nucleotides such as those described herein (e.g., 2'OMe nucleotides).
- the sense strand of the modified siRNA molecule comprises or consists of one of the unmodified sense strand sequences set forth in Table 6. In one preferred embodiment, the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO: 211. In another preferred embodiment, the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:218. In certain other embodiments, the antisense strand of the modified siRNA molecule comprises or consists of one of the unmodified antisense strand sequences set forth in Table 6. In one preferred embodiment, the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:212.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:219.
- one or more of the nucleotides in the unmodified sense and/or antisense strand sequences set forth in Table 6 may comprise modified nucleotides, wherein the modified nucleotides are located in the double-stranded region of the siRNA molecule.
- one or both of the uridine nucleotides in the "UU" 3' overhang on the sense and/or antisense strand comprises modified nucleotides such as those described herein (e.g., 2'OMe-uridine nucleotides).
- the sense strand of the modified siRNA molecule comprises or consists of one of the modified sense strand sequences set forth in Table 6.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:214.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:220.
- one or both of the undine nucleotides in the "UU" 3' overhang on the sense strand comprises modified nucleotides such as those described herein (e.g., 2'OMe-uridine nucleotides).
- the antisense strand of the modified siRNA molecule comprises or consists of one of the modified antisense strand sequences set forth in Table 6.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:215.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:216.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:223.
- one or both of the uridine nucleotides in the "UU" 3' overhang on the antisense strand comprises modified nucleotides such as those described herein (e.g., 2'OMe-uridine nucleotides).
- the sense strand of the modified siRNA molecule comprises or consists of one of the sense strand sequences set forth in Table 7.
- the antisense strand of the modified siRNA molecule comprises or consists of a sequence that is complementary to one of the sense strand sequences set forth in Table 7 (except for the "UU" 3 ? overhang).
- one or more of the nucleotides in the sense sequences set forth in Table 7 and/or the complementary antisense strand sequences may comprise modified nucleotides, wherein the modified nucleotides are located in the double- stranded region of the siRNA molecule.
- one or both of the uridine nucleotides in the "UU" 3' overhang on the sense and/or antisense strand comprises modified nucleotides such as those described herein (e.g., 2OMe-uridine nucleotides).
- the sense strand of the modified siRNA molecule comprises or consists of one of the modified sense strand sequences set forth in Table 10.
- the sense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:400.
- the antisense strand of the modified siRNA molecule comprises or consists of one of the modified antisense strand sequences set forth in Table 10.
- the antisense strand comprises or consists of the nucleic acid sequence of SEQ ID NO:403.
- one or both of the nucleotides in the 3' overhang on the sense and/or antisense strand comprises modified nucleotides such as those described herein (e.g., 2'OMe-uridine nucleotides).
- the modified siRNA molecule is selected from the group consisting of any one or more of the siRNA molecules set forth in Table 11. hi preferred embodiments, the modified siRNA molecule is PLKl 424 2/6. [0169] In certain other embodiments, the modified siRNA molecule is selected from the group consisting of PLK1424 2/6, PLK1424 U4/GU, PLK1424 U4/G, PLK773 G/GU, PLKl 425 3/5, and a mixture thereof.
- the modified siRNA molecule further comprises a carrier system, hi certain instances, the carrier system is selected from the group consisting of a nucleic acid-lipid particle, a liposome, a micelle, a virosome, a nucleic acid complex, and mixtures thereof.
- the nucleic acid complex may comprise the modified siRNA complexed with a cationic lipid, a cationic polymer, a cyclodextrin, or mixtures thereof.
- the modified siRNA molecule may be complexed with a cationic polymer, wherein the cationic polymer is polyethylenimine (PEI).
- the carrier system is a nucleic acid-lipid particle.
- the present invention provides a pharmaceutical composition comprising a modified siRNA molecule described herein and a pharmaceutically acceptable carrier.
- the present invention provides a nucleic acid-lipid particle comprising: a modified siRNA molecule described herein; a cationic lipid; and a non-cationic lipid.
- the cationic lipid is a member selected from the group consisting of l,2-Dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2- Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), N,N-dioleyl-N,N- dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(l-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), distearyldimethylammonium (DSDMA), N-(I -(2,3-dioleyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxypropylamine
- DODAC N,N-
- the non-cationic lipid is a member selected from the group consisting of distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylcholine (POPC), palmitoyloleoyl- phosphatidylethanolamine (POPE), palmitoyloleyol-phosphatidylglycerol (POPG), dipalmitoyl-phosphatidylcholine (DPPC), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, dielaidoyl-phosphatidylethanolamine (DEPE), stearoyloleoyl-phosphatidylethanolamine
- the non-cationic lipid is DSPC, DPPC, or DSPE.
- the nucleic acid-lipid particle further comprises a conjugated lipid that inhibits aggregation of particles.
- the conjugated lipid that inhibits aggregation of particles is a member selected from the group consisting of a polyethyleneglycol (PEG)-lipid conjugate, a polyamide (ATTA)-lipid conjugate, and a mixture thereof.
- the PEG-lipid conjugate is a member selected from the group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a PEG-phospholipid, a PEG-ceramide, and a mixture thereof.
- the conjugated lipid that inhibits aggregation of particles comprises a PEG-dialkyloxypropyl (PEG-DAA) conjugate.
- the PEG-DAA conjugate is a member selected from the group consisting of a PEG-dilauryloxypropyl (C12) conjugate, a PEG-dimyristyloxypropyl (C14) conjugate, a PEG-dipalmityloxypropyl (C jg) conjugate, and a PEG-distearyloxypropyl (C ⁇ g) conjugate, hi a preferred embodiment, the PEG-DAA conjugate is a PEG-dimyristyloxypropyl (C 14) conjugate. Additional PEG-lipid conjugates include, e.g., PEG-C-DOMG, 2KPEG-DMG, or mixtures thereof.
- the cationic lipid comprises from about 20 mol % to about 50 mol % of the total lipid present in the particle. In a preferred embodiment, the cationic lipid comprises about 40 mol % of the total lipid present in the particle. [0178] In other embodiments, the non-cationic lipid comprises from about 5 mol % to about 90 mol % of the total lipid present in the particle. In certain instances, the non-cationic lipid comprises about 10 mol % of the total lipid present in the particle, hi certain other instances, the non-cationic lipid comprises about 60 mol % of the total lipid present in the particle.
- the PEG-DAA conjugate comprises from 0 mol % to about 20 mol % of the total lipid present in the particle. In a preferred embodiment, the PEG-DAA conjugate comprises about 2 mol % of the total lipid present in the particle.
- the nucleic acid-lipid particle further comprises cholesterol. In certain instances, the cholesterol comprises from about 10 mol % to about 60 mol % of the total lipid present in the particle, hi a preferred embodiment, the cholesterol comprises about 48 mol % of the total lipid present in the particle.
- the modified siRNA in the nucleic acid-lipid particle is not substantially degraded after exposure of the particle to a nuclease at 37 0 C for 20 minutes, hi a related embodiment, the modified siRNA in the nucleic acid-lipid particle is not substantially degraded after incubation of the particle in serum at 37°C for 30 minutes, hi a preferred embodiment, the modified siRNA is fully encapsulated in the nucleic acid-lipid particle.
- the particle has an siRNA:lipid mass ratio of from about 0.01 to about 0.2. In certain other instances, the particle has an siRNA:lipid mass ratio of from about 0.02 to about 0.1. hi yet other instances, the particle has an siRNA:lipid mass ratio of about 0.08.
- the particle has a median diameter of from about 50 nm to about 150 nm. hi other instances, the particle has a median diameter of from about 70 nm to about 90 nm. [0184] In yet another aspect, the present invention provides a nucleic acid-lipid particle comprising:
- a cationic lipid comprising from about 50 mol % to about 85 mol % of the total lipid present in the particle;
- a non-cationic lipid comprising from about 13 mol % to about 49.5 mol % of the total lipid present in the particle;
- the siRNA molecule comprises a double-stranded region of about 15 to about 60 nucleotides in length. In another embodiment, the siRNA molecule comprises at least one of the sequences set forth in Tables 1-7 and 10-11.
- the cationic lipid is a member selected from the group consisting of DLinDMA, DLenDMA, DODAC, DDAB, DOTAP, DSDMA, DOTMA, DODMA, DC-Choi, DMRIE, DOSPA, DOGS, CLinDMA, CpLinDMA, DMOBA,
- the cationic lipid comprises DLinDMA.
- the non-cationic lipid comprises cholesterol or a derivative thereof. In certain instances, the cholesterol or derivative thereof comprises from about 30 mol % to about 45 mol % of the total lipid present in the particle.
- the cholesterol derivative is a member selected from the group consisting of cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, and cholesteryl-4'-hydroxybutyl ether.
- the non-cationic lipid comprises a phospholipid
- the non-cationic lipid comprises a mixture of a phospholipid and cholesterol or a derivative thereof.
- the phospholipid may be a member selected from the group consisting of DPPC, DSPC, DOPE, POPC, POPE, POPG, DPPE, DMPE, DSPE, DEPE, SOPE, EPC, monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, and a mixture thereof.
- the phospholipid comprises from about 4 mol % to about 10 mol % of the total lipid present in the particle and the cholesterol comprises from about 30 mol % to about 40 mol % of the total lipid present in the particle, hi a preferred embodiment, the phospholipid comprises DPPC.
- the conjugated lipid that inhibits aggregation of particles is a member selected from the group consisting of a polyethyleneglycol (PEG)-lipid conjugate, a polyamide (ATTA)-lipid conjugate, and a mixture thereof.
- the PEG-lipid conjugate is a member selected from the group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a PEG-phospholipid, a PEG-ceramide, and a mixture thereof.
- the conjugated lipid that inhibits aggregation of particles comprises a PEG-dialkyloxypropyl (PEG-DAA) conjugate.
- the PEG-DAA conjugate is a member selected from the group consisting of a PEG- dilauryloxypropyl (C 12) conjugate, a PEG-dimyristyloxypropyl (C 14) conjugate, a PEG- dipalmityloxypropyl (C ⁇ ) conjugate, and a PEG-distearyloxypropyl (C ⁇ g) conjugate.
- the PEG-DAA conjugate is a PEG-dimyristyloxypropyl (C 14 ) conjugate.
- the PEG-DAA conjugate comprises a PEG- distearyloxypropyl (C ig) conjugate. Additional PEG-lipid conjugates include, e.g., PEG-C-
- DOMG DOMG, 2KPEG-DMG, or mixtures thereof.
- the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after exposure of the particle to a nuclease at 37°C for 20 minutes, hi a related embodiment, the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after incubation of the particle in serum at 37 0 C for 30 minutes. In a preferred embodiment, the nucleic acid is fully encapsulated in the nucleic acid-lipid particle.
- the particle has a lipid:siRNA mass ratio of from about 1 to about 100. In certain other embodiments, the particle has a lipid:siRNA mass ratio of from about 5 to about 15.
- the particle has a lipid:siRNA mass ratio of about 6. hi some instances, the particle has a median diameter of from about 50 nm to about 150 nm. hi other instances, the particle has a median diameter of from about 70 nm to about 90 nm. [0192]
- the present invention provides a nucleic acid-lipid particle comprising: (a) an siRNA molecule that silences PLK-I expression;
- a cationic lipid comprising from about 56.5 mol % to about 66.5 mol % of the total lipid present in the particle;
- the siRNA molecule comprises a double-stranded region of about 15 to about 60 nucleotides in length. In another embodiment, the siRNA molecule comprises at least one of the sequences set forth in Tables 1-7 and 10-11.
- the cationic lipid is a member selected from the group consisting of DLinDMA, DLenDMA, DODAC, DDAB, DOTAP, DSDMA, DOTMA, DODMA, DC-Choi, DMRIE, DOSPA, DOGS, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, DLin-K-DMA, DLin-K-XTC2-DMA, and a mixture thereof.
- the cationic lipid comprises DLinDMA.
- the non-cationic lipid comprises cholesterol a derivative thereof.
- the non-cationic lipid comprises cholesterol.
- the conjugated lipid that inhibits aggregation of particles is a PEG-lipid conjugate selected from the group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a PEG-phospholipid, a PEG-ceramide, and a mixture thereof.
- the conjugated lipid that inhibits aggregation of particles comprises a PEG-DAA conjugate.
- Additional PEG-lipid conjugates include, e.g., PEG-C-DOMG, 2KPEG-DMG, or mixtures thereof.
- nucleic acid-lipid particle comprising:
- a cationic lipid comprising from about 52 mol % to about 62 mol % of the total lipid present in the particle;
- a non-cationic lipid comprising from about 36 mol % to about 47 mol % of the total lipid present in the particle;
- the siRNA molecule comprises a double-stranded region of about 15 to about 60 nucleotides in length. In another embodiment, the siRNA molecule comprises at least one of the sequences set forth in Tables 1-7 and 10-11.
- the cationic lipid is a member selected from the group consisting of DLinDMA, DLenDMA, DODAC, DDAB, DOTAP, DSDMA, DOTMA, DODMA, DC-Choi, DMRIE, DOSPA, DOGS, CLinDMA, CpLinDMA, DMOBA,
- the cationic lipid comprises DLinDMA.
- the non-cationic lipid comprises a phospholipid, hi alternative embodiments, the non-cationic lipid comprises a mixture of a phospholipid and cholesterol or a derivative thereof.
- the phospholipid may be, for example, DPPC, DSPC, DOPE, POPC, POPE, POPG, DPPE, DMPE, DSPE, DEPE, SOPE, EPC, monomethyl- phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, or a mixture thereof.
- the non-cationic lipid comprises a mixture of DPPC and cholesterol.
- the DPPC typically comprises from about 5 mol % to about 9 mol % of the total lipid present in the particle and the cholesterol typically comprises from about 32 mol % to about 37 mol % of the total lipid present in the particle.
- the conjugated lipid that inhibits aggregation of particles is a PEG-lipid conjugate selected from the group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a PEG-phospholipid, a PEG-ceramide, and a mixture thereof.
- the conjugated lipid that inhibits aggregation of particles comprises a PEG-DAA conjugate.
- Additional PEG-lipid conjugates include, e.g., PEG-C-DOMG, 2KPEG-DMG, or mixtures thereof.
- the present invention provides a pharmaceutical composition comprising a nucleic acid-lipid particle described herein and a pharmaceutically acceptable carrier.
- the present invention provides a method for introducing an siRNA that silences PLK-I expression into a cell, comprising contacting the cell with a nucleic acid- lipid particle described herein.
- the cell is in a mammal.
- the mammal is a human.
- the present invention provides a method for the in vivo delivery of a nucleic acid, comprising administering to a mammalian subject a nucleic acid- lipid particle described herein.
- the administration is selected from the group consisting of oral, intranasal, intravenous, intraperitoneal, intramuscular, intra-articular, intralesional, intratracheal, subcutaneous, and intradermal.
- the mammalian subject is a human.
- the present invention provides a method for treating cancer in a mammalian subject in need thereof, comprising administering to the mammalian subject a therapeutically effective amount of a nucleic acid-lipid particle described herein.
- the cancer is liver cancer (e.g., hepatocellular carcinoma).
- the mammalian subject is a human.
- the present invention provides a method for introducing an siRNA that silences PLK-I expression into a cell, the method comprising contacting the cell with a modified siRNA molecule described herein.
- the modified siRNA molecule is in a carrier system.
- the carrier system may be, for example, a nucleic acid-lipid particle, a liposome, a micelle, a virosome, a nucleic acid complex, or a mixture thereof.
- the nucleic acid complex comprises the modified siRNA molecule complexed with a cationic lipid, a cationic polymer, a cyclodextrin, or a mixture thereof.
- the modified siRNA molecule is complexed with a cationic polymer, wherein the cationic polymer is polyethylenimine (PEI).
- PEI polyethylenimine
- the carrier system is a nucleic acid-lipid particle comprising: the modified siRNA molecule; a cationic lipid; and a non-cationic lipid.
- the nucleic acid-lipid particle further comprises a conjugated lipid that prevents aggregation of particles.
- the presence of the nucleic acid-lipid particle is detectable at least 1 hour after administration of the particle.
- more than 10% of a plurality of the particles are present in the plasma of a mammal about 1 hour after administration, hi further embodiments, the cell is in a mammal.
- the mammal is a human.
- the present invention provides a method for in vivo delivery of an siRNA that silences PLK-I expression, the method comprising administering to a mammalian subject a modified siRNA molecule described herein.
- the modified siRNA molecule is in a carrier system.
- the carrier system may be, for example, a nucleic acid-lipid particle, a liposome, a micelle, a virosome, a nucleic acid complex, or a mixture thereof.
- the nucleic acid complex comprises the modified siRNA molecule complexed with a cationic lipid, a cationic polymer, a cyclodextrin, or a mixture thereof, hi certain instances, the modified siRNA molecule is complexed with a cationic polymer, wherein the cationic polymer is polyethylenimine (PEI).
- the carrier system is a nucleic acid-lipid particle comprising: the modified siRNA molecule; a cationic lipid; and a non-cationic lipid.
- the nucleic acid-lipid particle further comprises a conjugated lipid that prevents aggregation of particles.
- the administration is selected from the group consisting of oral, intranasal, intravenous, intraperitoneal, intramuscular, intra-articular, intralesional, intratracheal, subcutaneous, and intradermal.
- the mammalian subject is a human.
- the present invention provides a method for treating cancer in a mammalian subject in need thereof, comprising administering to the mammalian subject a therapeutically effective amount of a modified siRNA molecule described herein.
- the cancer is liver cancer ⁇ e.g., hepatocellular carcinoma).
- the mammalian subject is a human.
- the present invention provides a method for modifying an immunostimulatory siRNA that silences PLK-I expression, the method comprising: (a) providing an unmodified siRNA sequence capable of silencing PLK-I expression, wherein the unmodified siRNA sequence has immunostimulatory properties and comprises a double-stranded sequence of about 15 to about 60 nucleotides in length; and (b) modifying the unmodified siRNA sequence by substituting one or more nucleotides with modified nucleotides, thereby generating a modified siRNA molecule that is less immunostimulatory than the unmodified siRNA sequence and is capable of silencing PLK-I expression.
- the modified siRNA molecule comprises modified nucleotides selected from the group consisting of 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof.
- the modified siRNA molecule comprises 2'OMe nucleotides.
- the 2'OMe nucleotides may be selected from the group consisting of 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
- two, three, four, five, six, seven, or more of the nucleotides in the unmodified siRNA sequence are substituted with modified nucleotides, hi some embodiments, less than about 25% of the nucleotides in the double-stranded region of the unmodified siRNA sequence are substituted with modified nucleotides.
- the modified siRNA molecule is at least about 70% less immunostimulatory than the unmodified siRNA sequence. In certain other instances, the modified siRNA molecule has an IC 50 that is less than or equal to ten-fold that of the unmodified siRNA sequence.
- the method further comprises: (c) confirming that the modified siRNA molecule is less immunostimulatory by contacting the modified siRNA molecule with a mammalian responder cell under conditions suitable for the responder cell to produce a detectable immune response.
- the present invention provides a method for identifying and modifying an immunostimulatory siRNA that silences PLK-I expression, the method comprising:
- the modified siRNA molecule comprises modified nucleotides selected from the group consisting of 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2 1 F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof.
- the modified siRNA molecule comprises 2'OMe nucleotides.
- the 2'0Me nucleotides may be selected from the group consisting of 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
- nucleotides in the unmodified siRNA sequence are substituted with modified nucleotides.
- less than about 25% of the nucleotides in the double-stranded region of the unmodified siRNA sequence are substituted with modified nucleotides, hi other embodiments, less than about 20% of the nucleotides in the double-stranded region of the unmodified siRNA sequence are substituted with modified nucleotides.
- less than about 15% of the nucleotides in the double-stranded region of the unmodified siRNA sequence are substituted with modified nucleotides.
- from about 10% to about 20% of the nucleotides in the double-stranded region of the unmodified siRNA sequence are substituted with modified nucleotides.
- the modified siRNA molecule is at least about 70% less immunostimulatory than the unmodified siRNA sequence. In certain other instances, the modified siRNA molecule has an IC 50 that is less than or equal to ten-fold that of the unmodified siRNA sequence.
- the mammalian responder cell is a peripheral blood mononuclear cell or dendritic cell.
- the detectable immune response comprises production of a cytokine or growth factor selected from the group consisting of TNF- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IL-6, IL- 12, and combinations thereof. In further embodiments, the detectable immune response comprises induction of interferon-induced protein with tetratricopeptide repeats 1 (IFITl) mRNA.
- IFITl interferon-induced protein with tetratricopeptide repeats 1
- the present invention provides a method for sensitizing a cell to the effects of a chemotherapy drug, the method comprising contacting the cell with an siRNA molecule that silences PLK-I expression prior to administering the chemotherapy drug.
- the siRNA molecule comprises a double-stranded region of about 15 to about 60 nucleotides in length, hi another embodiment, the cell is contacted with a modified siRNA molecule that silences PLK-I expression, hi certain instances, one or more of the nucleotides in the double-stranded region comprise modified nucleotides.
- the modified nucleotides are selected from the group consisting of 2'OMe- guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
- the modified siRNA molecule is less immunostimulatory than a corresponding unmodified siRNA sequence.
- the siRNA molecule is in a carrier system.
- carrier systems include a nucleic acid-lipid particle, a liposome, a micelle, a virosome, a nucleic acid complex, and a mixture thereof, hi a preferred embodiment, the carrier system is a nucleic acid-lipid particle comprising: the siRNA molecule; a cationic lipid; and a non-cationic lipid.
- the nucleic acid-lipid particle further comprises a conjugated lipid that prevents aggregation of particles.
- the cell is a cancer cell.
- the cancer cell is in a mammal.
- the mammal is a human.
- the chemotherapy drug is selected from the group consisting of paclitaxel, fluorouracil (5-FU), irinotecan, sorafenib, and mixtures thereof.
- the present invention provides compositions comprising the asymmetrical interfering RNA (aiRNA) molecules described herein that target PLK-I expression and methods of using such compositions to silence PLK-I expression.
- aiRNA asymmetrical interfering RNA
- the aiRNA molecule comprises a double-stranded (duplex) region of about 10 to about 25 (base paired) nucleotides in length, wherein the aiRNA molecule comprises an antisense strand comprising 5' and 3' overhangs, and wherein the aiRNA molecule is capable of silencing PLK-I expression.
- the aiRNA molecule comprises a double-stranded (duplex) region of about 12-20, 12-19, 12-18, 13-17, or 14-17 (base paired) nucleotides in length, more typically 12, 13, 14, 15, 16, 17, 18, 19, or 20 (base paired) nucleotides in length.
- the 5' and 3' overhangs on the antisense strand comprise sequences that are complementary to the target PLK-I mRNA, and may optionally further comprise nontargeting sequences.
- each of the 5' and 3' overhangs on the antisense strand comprises or consists of one, two, three, four, five, six, seven, or more nucleotides.
- Exemplary aiRNA molecules targeting PLK-I mRNA are provided in Table 8.
- the aiRNA molecule comprises modified nucleotides selected from the group consisting of 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2 1 F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof.
- the aiRNA molecule comprises 2 1 OMe nucleotides.
- the 2'OMe nucleotides may be selected from the group consisting of 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
- the present invention provides compositions comprising the microRNA (miRNA) molecules described herein that target PLK-I expression and methods of using such compositions to silence PLK-I expression.
- the miRNA molecule comprises about 15 to about 60 nucleotides in length, wherein the miRNA molecule is capable of silencing PLK-I expression.
- the miRNA molecule comprises about 15-50, 15-40, or 15-30 nucleotides in length, more typically about 15-25 or 19-25 nucleotides in length, and are preferably about 20-24, 21 -22, or 21 -23 nucleotides in length.
- the miRNA molecule is a mature miRNA molecule targeting PLK-I mRNA. Exemplary miRNA molecules targeting PLK-I mRNA are provided in Table 9.
- the miRNA molecule comprises modified nucleotides selected from the group consisting of 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures thereof.
- the miRNA molecule comprises 2 1 OMe nucleotides.
- the 2'OMe nucleotides maybe selected from the group consisting of 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
- the unmodified and modified siRNA molecules of the present invention are capable of silencing PLK-I expression and are typically about 15 to 60 nucleotides in length.
- the modified siRNA molecules are generally less immunostimulatory than a corresponding unmodified siRNA sequence and retain RNAi activity against the target PLK-I sequence.
- the modified siRNA contains at least one 2'OMe purine or pyrimidine nucleotide such as a 2'OMe-guanosine, 2'OMe-uridine, 2'OMe-adenosine, and/or 2 1 OMe- cytosine nucleotide.
- one or more of the undine and/or guanosine nucleotides are modified.
- the modified nucleotides can be present in one strand (i.e., sense or antisense) or both strands of the siRNA.
- the siRNA sequences may have overhangs (e.g., 3' or 5' overhangs as described in Elbashir et al, Genes Dev., 15:188 (2001) or Nykanen et al, Cell, 107:309 (2001)), or may lack overhangs (i.e., have blunt ends).
- the modified siRNA generally comprises from about 1% to about 100% (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) modified nucleotides in the double-stranded region of the siRNA duplex.
- one, two, three, four, five, six, seven, eight, nine, ten, or more of the nucleotides in the double-stranded region of the siRNA comprise modified nucleotides.
- less than about 25% e.g., less than about 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%) of the nucleotides in the double-stranded region of the siRNA comprise modified nucleotides.
- from about 1 % to about 25% e.g., from about 1 %-25%, 2%- 25%, 3%-25%, 4%-25%, 5%-25%, 6%-25%, 7%-25%, 8%-25%, 9%-25%, 10%-25%, 11%- 25%, 12%-25%, 13%-25%, 14%-25%, 15%-25%, 16%-25%, 17%-25%, 18%-25%, 19%- 25%, 20%-25%, 21%-25%, 22%-25%, 23%-25%, or 24%-25%) or from about 1% to about 20% (e.g., from about l%-20%, 2%-20%, 3%-20%, 4%-20%, 5%-20%, 6%-20%, 7%-20%, 8%-20%, 9%-20%, 10%-20%, l l%-20%, 12%-20%, 13%-20%, 14%-20%, 15%-20%, 16%- 20%, 17%-20%, 18%-20%, or 19%-20%-20
- the resulting modified siRNA can comprise less than about 30% modified nucleotides ⁇ e.g., less than about 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1 % modified nucleotides) or from about 1% to about 30% modified nucleotides ⁇ e.g., from about l%-30%, 2%-30%, 3%-30%, 4%-30%, 5%-30%, 6%-30%.
- Suitable siRNA sequences can be identified using any means known in the art. Typically, the methods described in Elbashir et al, Nature, 411 :494-498 (2001) and Elbashir et al, EMBO J, 20:6877-6888 (2001) are combined with rational design rules set forth in Reynolds et al. , Nature Biotech., 22(3):326-330 (2004).
- the nucleotides immediately 3' to the dinucleotide sequences are identified as potential siRNA sequences (i.e., a target sequence or a sense strand sequence).
- the 19, 21, 23, 25, 27, 29, 31, 33, 35, or more nucleotides immediately 3' to the dinucleotide sequences are identified as potential siRNA sequences.
- the dinucleotide sequence is an AA or NA sequence and the 19 nucleotides immediately 3' to the AA or NA dinucleotide are identified as a potential siRNA sequences.
- siRNA sequences are usually spaced at different positions along the length of the target gene.
- potential siRNA sequences maybe analyzed to identify sites that do not contain regions of homology to other coding sequences, e.g., in the target cell or organism.
- a suitable siRNA sequence of about 21 base pairs typically will not have more than 16-17 contiguous base pairs of homology to coding sequences in the target cell or organism. If the siRNA sequences are to be expressed from an RNA Pol III promoter, siRNA sequences lacking more than 4 contiguous A's or T's are selected. [0247] Once a potential siRNA sequence has been identified, a complementary sequence (i.e., an antisense strand sequence) can be designed. A potential siRNA sequence can also be analyzed using a variety of criteria known in the art.
- the siRNA sequences may be analyzed by a rational design algorithm to identify sequences that have one or more of the following features: (1) G/C content of about 25% to about 60% G/C; (2) at least 3 A/Us at positions 15-19 of the sense strand; (3) no internal repeats; (4) an A at position 19 of the sense strand; (5) an A at position 3 of the sense strand; (6) a U at position 10 of the sense strand; (7) no G/C at position 19 of the sense strand; and (8) no G at position 13 of the sense strand.
- siRNA design tools that incorporate algorithms that assign suitable values of each of these features and are useful for selection of siRNA can be found at, e.g., http://boz094.ust.hk/RNAi/siRNA.
- sequences with one or more of the foregoing characteristics may be selected for further analysis and testing as potential siRNA sequences.
- siRNA sequences with one or more of the following criteria can often be eliminated as siRNA: (1) sequences comprising a stretch of 4 or more of the same base in a row; (2) sequences comprising homopolymers of Gs (i.e., to reduce possible non-specific effects due to structural characteristics of these polymers; (3) sequences comprising triple base motifs (e.g., GGG, CCC, AAA, or TTT); (4) sequences comprising stretches of 7 or more G/Cs in a row; and (5) sequences comprising direct repeats of 4 or more bases within the candidates resulting in internal fold-back structures.
- sequences with one or more of the foregoing characteristics may still be selected for further analysis and testing as potential siRNA sequences.
- potential siRNA sequences may be further analyzed based on siRNA duplex asymmetry as described in, e.g., Khvorova et ah, Cell, 115:209-216 (2003); and Schwarz et ah, Cell, 115:199-208 (2003).
- potential siRNA sequences may be further analyzed based on secondary structure at the mRNA target site as described in, e.g., Luo et ah, Biophys. Res. Commun., 318:303-310 (2004).
- mRNA secondary structure can be modeled using the Mfold algorithm (available at http://www.biomfo.rpi.edu/applications/mfold/ma/forml.cgi) to select siRNA sequences which favor accessibility at the mRNA target site where less secondary structure in the form of base-pairing and stem-loops is present.
- the sequence can be analyzed for the presence of any immunostimulatory properties, e.g., using an in vitro cytokine assay or an in vivo animal model. Motifs in the sense and/or antisense strand of the siRNA sequence such as GU-rich motifs (e.g., 5 ?
- an siRNA sequence can be contacted with a mammalian responder cell under conditions such that the cell produces a detectable immune response to determine whether the siRNA is an immunostimulatory or a non-immunostimulatory siRNA.
- the mammalian responder cell may be from a na ⁇ ve mammal (i.e., a mammal that has not previously been in contact with the gene product of the siRNA sequence).
- the mammalian responder cell may be, e.g., a peripheral blood mononuclear cell (PBMC), a macrophage, and the like.
- the detectable immune response may comprise production of a cytokine or growth factor such as, e.g., TNF- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IL-6, IL- 12, or a combination thereof.
- siRNA molecule identified as being immunostimulatory can then be modified to decrease its immunostimulatory properties by replacing at least one of the nucleotides on the sense and/or antisense strand with modified nucleotides. For example, less than about 30% (e.g., less than about 30%, 25%, 20%, 15%, 10%, or 5%) of the nucleotides in the double- stranded region of the siRNA duplex can be replaced with modified nucleotides such as 2'OMe nucleotides.
- the modified siRNA can then be contacted with a mammalian responder cell as described above to confirm that its immunostimulatory properties have been reduced or abrogated.
- Suitable in vitro assays for detecting an immune response include, but are not limited to, the double monoclonal antibody sandwich immunoassay technique of David et al (U.S. Patent No. 4,376,110); monoclonal-polyclonal antibody sandwich assays (Wide et al, in Kirkham and Hunter, eds., Radioimmunoassay Methods, E. and S. Livingstone, Edinburgh (1970)); the "Western blot" method of Gordon et al. (U.S. Patent No. 4,452,901); immunoprecipitation of labeled ligand (Brown et al, J. Biol.
- a non-limiting example of an in vivo model for detecting an immune response includes an in vivo mouse cytokine induction assay as described in, e.g., Judge et ah, MoI Ther., 13:494-505 (2006).
- the assay that can be performed as follows: (1) siRNA can be administered by standard intravenous injection in the lateral tail vein; (2) blood can be collected by cardiac puncture about 6 hours after administration and processed as plasma for cytokine analysis; and (3) cytokines can be quantified using sandwich ELISA kits according to the manufacturer's instructions (e.g., mouse and human IFN- ⁇ (PBL Biomedical; Piscataway, NJ); human IL-6 and TNF- ⁇ (eBioscience; San Diego, CA); and mouse IL-6, TNF- ⁇ , and IFN- ⁇ (BD Biosciences; San Diego, CA)).
- sandwich ELISA kits e.g., mouse and human IFN- ⁇ (PBL Biomedical; Piscataway, NJ); human IL-6 and TNF- ⁇ (eBioscience; San Diego, CA); and mouse IL-6, TNF- ⁇ , and IFN- ⁇ (BD Biosciences; San Diego, CA)).
- Monoclonal antibodies that specifically bind cytokines and growth factors are commercially available from multiple sources and can be generated using methods known in the art (see, e.g., Kohler et al, Nature, 256: 495-497 (1975) and Harlow and Lane, ANTIBODIES, A LABORATORY MANUAL, Cold Spring Harbor Publication, New York (1999)). Generation of monoclonal antibodies has been previously described and can be accomplished by any means known in the art (Buhring et al, in Hybridoma, Vol. 10, No. 1, pp. 77-78 (1991)). In some methods, the monoclonal antibody is labeled (e.g., with any composition detectable by spectroscopic, photochemical, biochemical, electrical, optical, or chemical means) to facilitate detection.
- siRNA can be provided in several forms including, e.g., as one or more isolated small-interfering RNA (siRNA) duplexes, as longer double-stranded RNA (dsRNA), or as siRNA or dsRNA transcribed from a transcriptional cassette in a DNA plasmid.
- the siRNA sequences may have overhangs (e.g., 3' or 5' overhangs as described in Elbashir et al, Genes Dev., 15: 188 (2001) or Nykanen et al, Cell, 107:309 (2001), or may lack overhangs (i.e., to have blunt ends).
- RNA population can be used to provide long precursor RNAs, or long precursor RNAs that have substantial or complete identity to a selected target sequence can be used to make the siRNA.
- the RNAs can be isolated from cells or tissue, synthesized, and/or cloned according to methods well known to those of skill in the art.
- the RNA can be a mixed population (obtained from cells or tissue, transcribed from cDNA, subtracted, selected, etc.), or can represent a single target sequence.
- RNA can be naturally occurring (e.g., isolated from tissue or cell samples), synthesized in vitro (e.g., using T7 or SP6 polymerase and PCR products or a cloned cDNA), or chemically synthesized.
- the complement is also transcribed in vitro and hybridized to form a dsRNA.
- the RNA complements are also provided (e.g., to form dsRNA for digestion by E. coli RNAse III or Dicer), e.g., by transcribing cDNAs corresponding to the RNA population, or by using RNA polymerases.
- the precursor RNAs are then hybridized to form double stranded RNAs for digestion.
- the dsRNAs can be directly administered to a subject or can be digested in vitro prior to administration.
- siRNA are chemically synthesized.
- the oligonucleotides that comprise the siRNA molecules of the present invention can be synthesized using any of a variety of techniques known in the art, such as those described in Usman et al., J. Am. Chem. Soc, 109:7845 (1987); Scaringe et al., Nucl.
- oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end and phosphoramidites at the 3'-end.
- small scale syntheses can be conducted on an Applied Biosystems synthesizer using a 0.2 ⁇ mol scale protocol.
- syntheses at the 0.2 ⁇ mol scale can be performed on a 96-well plate synthesizer from Protogene (Palo Alto, CA).
- Protogene Protogene
- a larger or smaller scale of synthesis is also within the scope of the present invention.
- Suitable reagents for oligonucleotide synthesis, methods for RNA deprotection, and methods for RNA purification are known to those of skill in the art.
- the siRNA molecules of the present invention can also be synthesized via a tandem synthesis technique, wherein both strands are synthesized as a single continuous oligonucleotide fragment or strand separated by a cleavable linker that is subsequently cleaved to provide separate fragments or strands that hybridize to form the siRNA duplex.
- the linker can be a polynucleotide linker or a non-nucleotide linker.
- the tandem synthesis of siRNA can be readily adapted to both multiwell/multiplate synthesis platforms as well as large scale synthesis platforms employing batch reactors, synthesis columns, and the like.
- siRNA molecules can be assembled from two distinct oligonucleotides, wherein one oligonucleotide comprises the sense strand and the other comprises the antisense strand of the siRNA.
- each strand can be synthesized separately and joined together by hybridization or ligation following synthesis and/or deprotection.
- siRNA molecules can be synthesized as a single continuous oligonucleotide fragment, where the self-complementary sense and antisense regions hybridize to form an siRNA duplex having hairpin secondary structure.
- the siRNA molecules of the present invention comprise a duplex having two strands and at least one modified nucleotide in the double-stranded region, wherein each strand is about 15 to about 60 nucleotides in length.
- the modified siRNA is less immunostimulatory than a corresponding unmodified siRNA sequence, but retains the capability of silencing the expression of a target sequence.
- the degree of chemical modifications introduced into the siRNA molecule strikes a balance between reduction or abrogation of the immunostimulatory properties of the siRNA and retention of RNAi activity.
- an siRNA molecule that targets PLK-I can be minimally modified (e.g., less than about 30%, 25%, 20%, 15%, 10%, or 5% modified) at selective uridine and/or guanosine nucleotides within the siRNA duplex to eliminate the immune response generated by the siRNA while retaining its capability to silence PLK-I expression.
- modified nucleotides suitable for use in the present invention include, but are not limited to, ribonucleotides having a 2'-O-methyl (2'OMe), 2'-deoxy-2'-fluoro (2'F), 2'-deoxy, 5-C-methyl, 2'-O-(2-methoxyethyl) (MOE), 4'-thio, 2'-amino, or 2'-C-allyl group.
- Modified nucleotides having a Northern conformation such as those described in, e.g., Saenger, Principles of Nucleic Acid Structure, Springer- Verlag Ed. (1984), are also suitable for use in the siRNA molecules of the present invention.
- Such modified nucleotides include, without limitation, locked nucleic acid (LNA) nucleotides (e.g., T-O, 4'-C-methylene-(D- ribofuranosyl) nucleotides), 2'-0-(2-methoxyethyl) (MOE) nucleotides, 2'-methyl-thio-ethyl nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy-2'-chloro (2'Cl) nucleotides, and 2'-azido nucleotides.
- LNA locked nucleic acid
- MOE 2'-0-(2-methoxyethyl) nucleotides
- MOE 2-methoxyethyl
- 2'-methyl-thio-ethyl nucleotides 2'-methyl-thio-ethyl nucleotides
- 2'F deoxy-2'-fluoro
- a G-clamp nucleotide refers to a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson- Crick and Hoogsteen faces of a complementary guanine nucleotide within a duplex (see, e.g., Lin et al, J. Am. Chem. Soc, 120:8531-8532 (1998)).
- nucleotides having a nucleotide base analog such as, for example, C-phenyl, C-naphthyl, other aromatic derivatives, inosine, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, A- nitroindole, 5-nitroindole, and 6-nitroindole ⁇ see, e.g., Loakes, Nucl. Acids Res., 29:2437- 2447 (2001)) can be incorporated into the siRNA molecules of the present invention.
- the siRNA molecules of the present invention further comprise one or more chemical modifications such as terminal cap moieties, phosphate backbone modifications, and the like.
- terminal cap moieties include, without limitation, inverted deoxy abasic residues, glyceryl modifications, 4',5'-methylene nucleotides, l-( ⁇ -D-erythrofuranosyl) nucleotides, 4'-thio nucleotides, carbocyclic nucleotides, 1,5-anhydrohexitol nucleotides, L-nucleotides, ⁇ -nucleotides, modified base nucleotides, t/zreo-pentofuranosyl nucleotides, acyclic 3',4'-seco nucleotides, acyclic 3,4- dihydroxybutyl nucleotides, acyclic 3,5-dihydroxypentyl nucleotides, 3 '-3 '-inverted nucleotide moieties, 3 '-3 '-inverted abasic moieties, 3'-2'-inverted nucleotide moieties,
- Non-limiting examples of phosphate backbone modifications include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate, carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and alkylsilyl substitutions ⁇ see, e.g., Hunziker et al, Nucleic Acid
- the sense and/or antisense strand of the siRNA molecule can further comprise a 3'-terminal overhang having about 1 to about 4 ⁇ e.g., 1, 2, 3, or 4) 2'-deoxy ribonucleotides and/or any combination of modified and unmodified nucleotides. Additional examples of modified nucleotides and types of chemical modifications that can be introduced into the modified siRNA molecules of the present invention are described, e.g., in UK Patent No. GB 2,397,818 B and U.S. Patent Publication Nos. 20040192626, 20050282188, and 20070135372.
- the modified siRNA molecules of the present invention can optionally comprise one or more non-nucleotides in one or both strands of the siRNA.
- non-nucleotide refers to any group or compound that can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their activity.
- the group or compound is abasic in that it does not contain a commonly recognized nucleotide base such as adenosine, guanine, cytosine, uracil, or thymine and therefore lacks a base at the 1'- position.
- chemical modification of the siRNA comprises attaching a conjugate to the chemically-modified siRNA molecule.
- the conjugate can be attached at the 5' and/or 3 '-end of the sense and/or antisense strand of the chemically-modified siRNA via a covalent attachment such as, e.g., a biodegradable linker.
- the conjugate can also be attached to the chemically-modified siRNA, e.g., through a carbamate group or other linking group (see, e.g., U.S. Patent Publication Nos. 20050074771, 20050043219, and 20050158727).
- the conjugate is a molecule that facilitates the delivery of the chemically- modified siRNA into a cell.
- conjugate molecules suitable for attachment to the chemically-modified siRNA of the present invention include, without limitation, steroids such as cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (HSA), fatty acids, carotenoids, terpenes, bile acids, folates (e.g., folic acid, folate analogs and derivatives thereof), sugars (e.g., galactose, galactosamine, N-acetyl galactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, ligands for cellular receptors capable of mediating cellular uptake, and combinations thereof (see, e.g., U.S.
- Other examples include the lipophilic moiety, vitamin, polymer, peptide, protein, nucleic acid, small molecule, oligosaccharide, carbohydrate cluster, intercalator, minor groove binder, cleaving agent, and cross-linking agent conjugate molecules described in U.S. Patent Publication Nos. 20050119470 and 20050107325.
- Additional examples include the hydrophobic group, membrane active compound, cell penetrating compound, cell targeting signal, interaction modifier, and steric stabilizer conjugate molecules described in U.S. Patent Publication No. 20040167090.
- Further examples include the conjugate molecules described in U.S. Patent Publication No. 20050239739.
- the type of conjugate used and the extent of conjugation to the chemically-modified siRNA molecule can be evaluated for improved pharmacokinetic profiles, bioavailability, and/or stability of the siRNA while retaining RNAi activity.
- one skilled in the art can screen chemically- modified siRNA molecules having various conjugates attached thereto to identify ones having improved properties and full RNAi activity using any of a variety of well-known in vitro cell culture or in vivo animal models.
- asymmetrical interfering RNA can recruit the RNA-induced silencing complex (RISC) and lead to effective silencing of a variety of genes in mammalian cells by mediating sequence-specific cleavage of the target mRNA between nucleotide 10 and 11 relative to the 5' end of the antisense strand (Sun et ah, Nat. Biotech., 26:1379-1382
- an aiRNA molecule comprises a short RNA duplex having a sense strand and an antisense strand, wherein the duplex contains overhangs at the 3' and 5' ends of the antisense strand.
- the aiRNA is generally asymmetric because the sense strand is shorter on both ends when compared to the complementary antisense strand.
- the aiRNA molecules of the present invention may be designed, synthesized, and annealed under conditions similar to those used for siRNA molecules.
- aiRNA sequences may be selected and generated using the methods described above for selecting siRNA sequences.
- aiRNA duplexes of various lengths may be designed with overhangs at the 3' and 5' ends of the antisense strand to target an mRNA of interest.
- the sense strand of the aiRNA molecule is about 10-25, 12-20, 12-19, 12-18, 13-17, or 14-17 nucleotides in length, more typically 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.
- the antisense strand of the aiRNA molecule is about 15-60, 15-50, or 15-40 nucleotides in length, more typically about 15-30, 15-25, or 19-25 nucleotides in length, and is preferably about 20-24, 21-22, or 21-23 nucleotides in length.
- the 5' antisense overhang contains one, two, three, four, or more nontargeting nucleotides (e.g., "AA”, "UU”, "dTdT”, etc.).
- the 3' antisense overhang contains one, two, three, four, or more nontargeting nucleotides (e.g., "AA”, “UU”, “dTdT”, etc.).
- the aiRNA molecules described herein may comprise one or more modified nucleotides, e.g., in the double-stranded (duplex) region and/or in the antisense overhangs.
- aiRNA sequences may comprise one or more of the modified nucleotides described above for siRNA sequences.
- the aiRNA molecule comprises 2 1 OMe nucleotides such as, for example, 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, or mixtures thereof.
- the aiRNA molecule of the present invention comprises an antisense strand which corresponds to the antisense strand of an siRNA molecule, e.g., one of the siRNA molecules described herein which displays PLK-I silencing activity.
- aiRNAs targeting PLK-I mRNA are administered using a carrier system described herein such as a nucleic acid-lipid particle.
- the nucleic acid-lipid particle comprises: (a) one or more aiRNA molecules targeting PLK-I mRNA; (b) a cationic lipid (e.g., DLinDMA); and (c) a non-cationic lipid (e.g., DSPC, DPPC, DSPE, and/or cholesterol).
- the nucleic acid-lipid particle may further comprise a conjugated lipid that prevents aggregation of particles (e.g., PEG-DAA).
- aiRNA molecules suitable for modulating (e.g., silencing) PLK-I expression are provided in Table 8 of Example 17.
- miRNAs are single-stranded RNA molecules of about 21- 23 nucleotides in length which regulate gene expression. miRNAs are encoded by genes from whose DNA they are transcribed, but miRNAs are not translated into protein (non- coding RNA); instead, each primary transcript (a pri-miRNA) is processed into a short stem- loop structure called a pre-miRNA and finally into a functional mature miRNA. Mature miRNA molecules are either partially or completely complementary to one or more messenger RNA (mRNA) molecules, and their main function is to downregulate gene expression.
- mRNA messenger RNA
- miRNAs are much longer than the processed mature miRNA molecule. miRNAs are first transcribed as primary transcripts or pri-miRNA with a cap and poly-A tail and processed to short, ⁇ 70-nucleotide stem-loop structures known as pre-miRNA in the cell nucleus.
- RISC RNA-induced silencing complex
- RNA molecules When Dicer cleaves the pre-miRNA stem-loop, two complementary short RNA molecules are formed, but only one is integrated into the RISC complex.
- This strand is known as the guide strand and is selected by the argonaute protein, the catalytically active RNase in the RISC complex, on the basis of the stability of the 5' end (Preall et al, Curr. Biol, 16:530-535 (2006)).
- the remaining strand known as the anti-guide or passenger strand, is degraded as a RISC complex substrate (Gregory et al, Cell, 123:631-640 (2005)).
- miRNAs After integration into the active RISC complex, miRNAs base pair with their complementary mRNA molecules and induce target mRNA degradation and/or translational silencing.
- Mammalian miRNAs are usually complementary to a site in the 3' UTR of the target mRNA sequence.
- the annealing of the miRNA to the target mRNA inhibits protein translation by blocking the protein translation machinery.
- the annealing of the miRNA to the target mRNA facilitates the cleavage and degradation of the target mRNA through a process similar to RNA interference (RNAi).
- miRNAs may also target methylation of genomic sites which correspond to targeted mRNAs.
- miRNAs function in association with a complement of proteins collectively termed the miRNP.
- the miRNA molecules described herein are about 15-100, 15-90, 15-80, 15-75, 15-70, 15-60, 15-50, or 15-40 nucleotides in length, more typically about 15- 30, 15-25, or 19-25 nucleotides in length, and are preferably about 20-24, 21-22, or 21-23 nucleotides in length.
- the miRNA molecules described herein may comprise one or more modified nucleotides.
- miRNA sequences may comprise one or more of the modified nucleotides described above for siRNA sequences.
- the miRNA molecule comprises 2'OMe nucleotides such as, for example, 2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, or mixtures thereof.
- miRNAs targeting PLK-I mRNA are administered using a carrier system described herein such as a nucleic acid-lipid particle.
- the nucleic acid-lipid particle comprises: (a) one or more miRNA molecules targeting PLK-I mRNA; (b) a cationic lipid ⁇ e.g., DLinDMA); and (c) a non-cationic lipid (e.g., DSPC, DPPC, DSPE, and/or cholesterol).
- the nucleic acid-lipid particle may further comprise a conjugated lipid that prevents aggregation of particles (e.g., PEG-DAA).
- Non-limiting examples of miRNA molecules suitable for modulating (e.g., silencing) PLK-I expression are provided in Table 9 of Example 18.
- one or more agents that block the activity of a miRNA targeting PLK-I mRNA are administered using a carrier system described herein (e.g., a nucleic acid-lipid particle).
- a carrier system described herein e.g., a nucleic acid-lipid particle.
- blocking agents include, but are not limited to, steric blocking oligonucleotides, locked nucleic acid oligonucleotides, and Morpholino oligonucleotides. Such blocking agents may bind directly to the miRNA or to the miRNA binding site on the target mRNA.
- the present invention provides carrier systems containing one or more interfering RNA described herein, e.g., unmodified or modified siRNA, aiRNA, or miRNA.
- the carrier system is a lipid-based carrier system such as a stabilized nucleic acid-lipid particle (e.g., SNALP or SPLP), cationic lipid or liposome nucleic acid complexes (i.e., lipoplexes), a liposome, a micelle, a virosome, or a mixture thereof.
- the carrier system is a polymer-based carrier system such as a cationic polymer-nucleic acid complex (i.e., polyplex).
- the carrier system is a cyclodextrin-based carrier system such as a cyclodextrin polymer-nucleic acid complex.
- the carrier system is a protein-based carrier system such as a cationic peptide-nucleic acid complex.
- the carrier system is a stabilized nucleic acid-lipid particle such as a SNALP or SPLP.
- the stabilized nucleic acid-lipid particles (SNALP) of the present invention typically comprise an interfering RNA molecule as described herein, a cationic lipid (e.g., a cationic lipid of Formula I or II), and a non-cationic lipid.
- the SNALP can further comprise a lipid conjugate (i.e., a conjugated lipid that inhibits aggregation of the particles).
- the SNALP may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the modified interfering RNA molecules described herein, alone or in combination with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more unmodified interfering RNA molecules.
- the SNALP of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 to about 90 nm, and are substantially nontoxic, hi addition, the nucleic acids are resistant in aqueous solution to degradation with a nuclease when present in the nucleic acid-lipid particles.
- Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Nos. 5,753,613; 5,785,992; 5,705,385; 5,976,567; 5,981,501; 6,110,745; and 6,320,017; and PCT Publication No. WO 96/40964.
- cationic lipids may be used in the stabilized nucleic acid-lipid particles of the present invention, either alone or in combination with one or more other cationic lipid species or non-cationic lipid species.
- Cationic lipids which are useful in the present invention can be any of a number of lipid species which carry a net positive charge at physiological pH.
- Such lipids include, but are not limited to, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), dioctadecyldimethylammonium (DODMA), distearyldimethylammonium (DSDMA), N-(I- (2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N- dimethylammonium bromide (DDAB), N-(I -(2,3 -dioleoyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTAP), 3 -(N-(N',N'-dimethylaminoethane)- carbamoyl)cholesterol (DC-Choi), N-(1 ,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N- hydroxye
- LIPOFECTIN ® commercially available cationic liposomes comprising DOTMA and DOPE, from GIBCO/BRL, Grand Island, New York, USA
- LIPOFECT AMINE ® commercially available cationic liposomes comprising DOSPA and DOPE, from GIBCO/BRL
- TRANSFECTAM ® commercially available cationic liposomes comprising DOGS from Promega Corp., Madison, Wisconsin, USA.
- cationic lipids of Formula I having the following structures are useful in the present invention.
- R 1 and R 2 are independently selected and are H or C 1 -C 3 alkyls
- R 3 and R 4 are independently selected and are alkyl groups having from about 10 to about 20 carbon atoms
- at least one of R 3 and R 4 comprises at least two sites of unsaturation.
- R 3 and R 4 are both the same, i.e., R 3 and R 4 are both linoleyl (C 18 ), etc.
- R 3 and R 4 are different, i.e., R 3 is tetradectrienyl (C 14 ) and R 4 is linoleyl (C 18 ).
- the cationic lipid of Formula I is symmetrical, i.e., R 3 and R 4 are both the same.
- both R 3 and R 4 comprise at least two sites of unsaturation.
- R 3 and R 4 are independently selected from the group consisting of dodecadienyl, tetradecadienyl, hexadecadienyl, linoleyl, and icosadienyl.
- R 3 and R 4 are both linoleyl.
- R 3 and R 4 comprise at least three sites of unsaturation and are independently selected from, e.g., dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and icosatrienyl.
- the cationic lipid of Formula I is l,2-dilinoleyloxy-N,N- dimethylaminopropane (DLinDMA) or 1 ,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA).
- cationic lipids of Formula II having the following structures are useful in the present invention.
- R 1 and R 2 are independently selected and are H or C 1 -C 3 alkyls
- R 3 and R 4 are independently selected and are alkyl groups having from about 10 to about 20 carbon atoms
- at least one of R 3 and R 4 comprises at least two sites of unsaturation.
- R 3 and R 4 are both the same, i.e., R 3 and R 4 are both linoleyl (C 18 ), etc.
- R 3 and R 4 are different, i.e., R 3 is tetradectrienyl (Ci 4 ) and R 4 is linoleyl (C 18 ).
- the cationic lipids of the present invention are symmetrical, i.e., R and R 4 are both the same, hi another preferred embodiment, both R 3 and R 4 comprise at least two sites of unsaturation.
- R 3 and R 4 are independently selected from the group consisting of dodecadienyl, tetradecadienyl, hexadecadienyl, linoleyl, and icosadienyl. In a preferred embodiment, R 3 and R 4 are both linoleyl.
- R 3 and R 4 comprise at least three sites of unsaturation and are independently selected from, e.g., dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and icosatrienyl.
- the cationic lipid comprises from about 2 mol % to about 60 mol %, from about 5 mol % to about 50 mol %, from about 10 mol % to about 50 mol %, from about 20 mol % to about 50 mol %, from about 20 mol % to about 40 mol %, from about 30 mol % to about 40 mol %, or about 40 mol % of the total lipid present in the particle.
- the cationic lipid comprises from about 50 mol % to about 85 mol %, about 50 mol % to about 80 mol %, about 50 mol % to about 75 mol %, about 50 mol % to about 65 mol %, or about 55 mol % to about 65 mol % of the total lipid present in the particle.
- non-cationic lipids used in the stabilized nucleic acid-lipid particles of the present invention can be any of a variety of neutral uncharged, zwitterionic, or anionic lipids capable of producing a stable complex.
- Non-limiting examples of non-cationic lipids include phospholipids such as lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetylphosphate, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG
- acyl groups in these lipids are preferably acyl groups derived from fatty acids having C 10 -C 24 carbon chains, e.g., lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl.
- fatty acids having C 10 -C 24 carbon chains e.g., lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl.
- non-cationic lipids include sterols such as cholesterol and derivatives thereof such as cholestanol, cholestanone, cholestenone, and coprostanol.
- the non-cationic lipid present in the SNALP comprises or consists of cholesterol, e.g., a phospholipid-free SNALP. In other embodiments, the non- cationic lipid present in the SNALP comprises or consists of one or more phospholipids, e.g., a cholesterol-free SNALP. hi further embodiments, the non-cationic lipid present in the SNALP comprises or consists of a mixture of one or more phospholipids and cholesterol.
- non-cationic lipids suitable for use in the present invention include nonphosphorous containing lipids such as, e.g., stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerolricinoleate, hexadecyl stereate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethyl ammonium bromide, ceramide, sphingomyelin, and the like.
- nonphosphorous containing lipids such as, e.g., stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerolricinoleate, hexadecyl stereate,
- the non-cationic lipid comprises from about 5 mol % to about 90 mol %, from about 10 mol % to about 85 mol %, from about 20 mol % to about 80 mol %, about 10 mol % (e.g., phospholipid only), or about 60 mol % (e.g., phospholipid and cholesterol) of the total lipid present in the particle.
- the cholesterol or cholesterol derivative typically comprises from about 0 mol % to about 10 mol %, from about 2 mol % to about 10 mol %, from about 10 mol % to about 60 mol %, from about 12 mol % to about 58 mol %, from about 20 mol % to about 55 mol %, from about 30 mol % to about 50 mol %, or about 48 mol % of the total lipid present in the particle.
- the non-cationic lipid comprises from about 13 mol % to about 49.5 mol %, about 20 mol % to about 45 mol %, about 25 mol % to about 45 mol %, about 30 mol % to about 45 mol %, about 35 mol % to about 45 mol %, about 20 mol % to about 40 mol %, about 25 mol % to about 40 mol %, or about 30 mol % to about 40 mol % of the total lipid present in the particle.
- the cholesterol present in phospholipid-free nucleic acid- lipid particles comprises from about 30 mol % to about 45 mol %, about 30 mol % to about 40 mol %, about 35 mol % to about 45 mol %, or about 35 mol % to about 40 mol % of the total lipid present in the particle.
- a phospholipid-free nucleic acid-lipid particle may comprise cholesterol at about 37 mol % of the total lipid present in the particle.
- the cholesterol present in nucleic acid-lipid particles containing a mixture of phospholipid and cholesterol comprises from about 30 mol % to about 40 mol %, about 30 mol % to about 35 mol %, or about 35 mol % to about 40 mol % of the total lipid present in the particle.
- a nucleic acid-lipid particle comprising a mixture of phospholipid and cholesterol may comprise cholesterol at about 34 mol % of the total lipid present in the particle.
- the phospholipid may comprise from about 2 mol % to about 12 mol %, about 4 mol % to about 10 mol %, about 5 mol % to about 10 mol %, about 5 mol % to about 9 mol %, or about 6 mol % to about 8 mol % of the total lipid present in the particle.
- a nucleic acid-lipid particle comprising a mixture of phospholipid and cholesterol may comprise a phospholipid such as DPPC at about 7 mol % of the total lipid present in the particle.
- the stabilized nucleic acid-lipid particles of the present invention may comprise a lipid conjugate.
- the conjugated lipid is useful in that it prevents the aggregation of particles.
- Suitable conjugated lipids include, but are not limited to, PEG-lipid conjugates, ATTA-lipid conjugates, cationic-polymer-lipid conjugates (CPLs), and mixtures thereof.
- the particles comprise either a PEG-lipid conjugate or an ATTA-lipid conjugate together with a CPL.
- the lipid conjugate is a PEG-lipid.
- PEG- lipids include, but are not limited to, PEG coupled to dialkyloxypropyls (PEG-DAA) as described in, e.g., PCT Publication No. WO 05/026372, PEG coupled to diacylglycerol (PEG-DAG) as described in, e.g., U.S. Patent Publication Nos. 20030077829 and 2005008689, PEG coupled to phospholipids such as phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramides as described in, e.g., U.S. Patent No. 5,885,613, PEG conjugated to cholesterol or a derivative thereof, and mixtures thereof.
- PEG-DAA dialkyloxypropyls
- PEG-DAG diacylglycerol
- PEG-PE PEG coupled to phospholipids
- PEG conjugated to ceramides as described in, e.g., U.S. Patent No. 5,885,61
- PEG-lipids include, without limitation, PEG-C-DOMG, 2KPEG-DMG, and a mixture thereof.
- PEG is a linear, water-soluble polymer of ethylene PEG repeating units with two terminal hydroxyl groups. PEGs are classified by their molecular weights; for example, PEG 2000 has an average molecular weight of about 2,000 daltons, and PEG 5000 has an average molecular weight of about 5,000 daltons. PEGs are commercially available from Sigma Chemical Co.
- MePEG-OH monomethoxypolyethylene glycol
- MePEG-S monomethoxypolyethylene glycol- succinate
- MePEG-S- NHS monomethoxypolyethylene glycol-succinimidyl succinate
- MePEG-NH 2 monomethoxypolyethylene glycol-amine
- MePEG-TRES monomethoxypolyethylene glycol-tresylate
- MePEG-IM monomethoxypolyethylene glycol-imidazolyl-carbonyl
- Other PEGs such as those described in U.S. Patent Nos.
- 6,774,180 and 7,053,150 are also useful for preparing the PEG-lipid conjugates of the present invention, hi addition, monomethoxypolyethyleneglycol-acetic acid (MePEG-CH 2 COOH) is particularly useful for preparing PEG-lipid conjugates including, e.g., PEG-DAA conjugates.
- MePEG-CH 2 COOH monomethoxypolyethyleneglycol-acetic acid
- the PEG has an average molecular weight of from about 550 daltons to about 10,000 daltons, more preferably from about 750 daltons to about 5,000 daltons, more preferably from about 1,000 daltons to about 5,000 daltons, more preferably from about 1,500 daltons to about 3,000 daltons, and even more preferably about 2,000 daltons.
- the PEG can be optionally substituted by an alkyl, alkoxy, acyl, or aryl group.
- the PEG can be conjugated directly to the lipid or may be linked to the lipid via a linker moiety.
- linker moiety suitable for coupling the PEG to a lipid can be used including, e.g., non- ester containing linker moieties and ester-containing linker moieties.
- the linker moiety is a non-ester containing linker moiety.
- non-ester containing linker moiety refers to a linker moiety that does not contain a carboxylic ester bond (-OC(O)-).
- Suitable non-ester containing linker moieties include, but are not limited to, amido (-C(O)NH-), amino (-NR-), carbonyl (-C(O)-), carbamate (- NHC(O)O-), urea (-NHC(O)NH-), disulphide (-S-S-), ether (-O-), succinyl (- (O)CCH 2 CH 2 C(O)-), succinamidyl (-NHC(O)CH 2 CH 2 C(O)NH-), ether, disulphide, as well as combinations thereof (such as a linker containing both a carbamate linker moiety and an amido linker moiety).
- a carbamate linker is used to couple the PEG to the lipid.
- an ester containing linker moiety is used to couple the PEG to the lipid.
- Suitable ester containing linker moieties include, e.g., carbonate (-OC(O)O-), succinoyl, phosphate esters (-O-(O)POH-O-), sulfonate esters, and combinations thereof.
- Phosphatidylethanolamines having a variety of acyl chain groups of varying chain lengths and degrees of saturation can be conjugated to PEG to form the lipid conjugate. Such phosphatidylethanolamines are commercially available, or can be isolated or synthesized using conventional techniques known to those of skilled in the art.
- Phosphatidyl- ethanolamines containing saturated or unsaturated fatty acids with carbon chain lengths in the range of C 10 to C 20 are preferred. Phosphatidylethanolamines with mono- or diunsaturated fatty acids and mixtures of saturated and unsaturated fatty acids can also be used. Suitable phosphatidylethanolamines include, but are not limited to, dimyristoyl- phosphatidylethanolamine (DMPE), dipalmitoyl-phosphatidylethanolamine (DPPE), dioleoylphosphatidylethanolamine (DOPE), and distearoyl-phosphatidylethanolamine (DSPE).
- DMPE dimyristoyl- phosphatidylethanolamine
- DPPE dipalmitoyl-phosphatidylethanolamine
- DOPE dioleoylphosphatidylethanolamine
- DSPE distearoyl-phosphatidylethanolamine
- R is a member selected from the group consisting of hydrogen, alkyl and acyl
- R 1 is a member selected from the group consisting of hydrogen and alkyl; or optionally, R and R 1 and the nitrogen to which they are bound form an azido moiety
- R 2 is a member of the group selected from hydrogen, optionally substituted alkyl, optionally substituted aryl and a side chain of an amino acid
- R 3 is a member selected from the group consisting of hydrogen, halogen, hydroxy, alkoxy, mercapto, hydrazino, amino and NR 4 R 5 , wherein R 4 and R 5 are independently hydrogen or alkyl
- n is 4 to 80
- m is 2 to 6
- p is 1 to 4
- q is 0 or 1.
- diacylglycerol refers to a compound having 2 fatty acyl chains, R 1 and R 2 , both of which have independently between 2 and 30 carbons bonded to the 1- and 2- position of glycerol by ester linkages.
- the acyl groups can be saturated or have varying degrees of unsaturation. Suitable acyl groups include, but are not limited to, lauroyl (C 12 ), myristoyl (C 14 ), palmitoyl (C 16 ), stearoyl (Ci 8 ), and icosoyl (C 20 ).
- R 1 and R 2 are the same, i.e., R 1 and R 2 are both myristoyl ⁇ i.e., dimyristoyl), R 1 and R 2 are both stearoyl ⁇ i.e., distearoyl), etc.
- Diacylglycerols have the following general formula:
- dialkyloxypropyl refers to a compound having 2 alkyl chains, R 1 and R 2 , both of which have independently between 2 and 30 carbons.
- the alkyl groups can be saturated or have varying degrees of unsaturation.
- Dialkyloxypropyls have the following general formula:
- R 1 and R 2 are independently selected and are long-chain alkyl groups having from about 10 to about 22 carbon atoms.
- the PEG-lipid is a PEG-DAA conjugate having the following formula: wherein R 1 and R 2 are independently selected and are long-chain alkyl groups having from about 10 to about 22 carbon atoms; PEG is a polyethyleneglycol; and L is a non-ester containing linker moiety or an ester containing linker moiety as described above.
- the long- chain alkyl groups can be saturated or unsaturated. Suitable alkyl groups include, but are not limited to, lauryl (C 12 ), myristyl (C 14 ), palmityl (C 16 ), stearyl (C 18 ), and icosyl (C 2 o).
- R and R are the same, i.e., R and R are both myristyl (i.e.,
- R and R are both stearyl (i.e., distearyl), etc.
- the PEG has an average molecular weight ranging from about 550 daltons to about 10,000 daltons, more preferably from about 750 daltons to about 5,000 daltons, more preferably from about 1,000 daltons to about 5,000 daltons, more preferably from about 1,500 daltons to about 3,000 daltons, and even more preferably about 2,000 daltons.
- the PEG can be optionally substituted with alkyl, alkoxy, acyl, or aryl. hi a preferred embodiment, the terminal hydroxyl group is substituted with a methoxy or methyl group.
- L is a non-ester containing linker moiety.
- Suitable non-ester containing linkers include, but are not limited to, an amido linker moiety, an amino linker moiety, a carbonyl linker moiety, a carbamate linker moiety, a urea linker moiety, an ether linker moiety, a disulphide linker moiety, a succinamidyl linker moiety, and combinations thereof.
- the non-ester containing linker moiety is a carbamate linker moiety (i.e., a PEG-C-DAA conjugate).
- the non-ester containing linker moiety is an amido linker moiety (i.e., a PEG-/ ⁇ -DAA conjugate). In yet another preferred embodiment, the non-ester containing linker moiety is a succinamidyl linker moiety (i.e., a PEG-S-DAA conjugate).
- the PEG-DAA conjugates are synthesized using standard techniques and reagents known to those of skill in the art. It will be recognized that the PEG-DAA conjugates will contain various amide, amine, ether, thio, carbamate, and urea linkages. Those of skill in the art will recognize that methods and reagents for forming these bonds are well known and readily available.
- the PEG-DAA conjugate is a dilauryloxypropyl (C 12 )-PEG conjugate, dimyristyloxypropyl (C 14 )-PEG conjugate, a dipalmityloxypropyl (C 16 )-PEG conjugate, or a distearyloxypropyl (C 1S )-PEG conjugate.
- C 12 dilauryloxypropyl
- C 14 dimyristyloxypropyl
- C 16 dipalmityloxypropyl
- C 1S distearyloxypropyl
- suitable polymers that can be used in place of PEG include, but are not limited to, polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline, polyhydroxypropyl methacrylamide, polymethacrylamide and polydimethylacrylamide, polylactic acid, polyglycolic acid, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.
- the particles (e.g., SNALPs or SPLPs) of the present invention can further comprise cationic poly(ethylene glycol) (PEG) lipids or CPLs (see, e.g., Chen et al., Bioconj. Chem., 11:433-437 (2000)).
- PEG poly(ethylene glycol)
- Suitable SPLPs and SPLP- CPLs for use in the present invention, and methods of making and using SPLPs and SPLP- CPLs, are disclosed, e.g., in U.S. Patent No. 6,852,334 and PCT Publication No. WO 00/62813.
- Suitable CPLs include compounds of Formula VII:
- A-W-Y (VII), wherein A, W, and Y are as described below.
- A is a lipid moiety such as an amphipathic lipid, a neutral lipid, or a hydrophobic lipid that acts as a lipid anchor. Suitable lipid examples include, but are not limited to, diacylglycerolyls, dialkylglycerolyls, N-N-dialkylaminos, 1,2- diacyloxy-3-aminopropanes, and l,2-dialkyl-3-aminopropanes.
- W is a polymer or an oligomer such as a hydrophilic polymer or oligomer.
- the hydrophilic polymer is a biocompatable polymer that is nonimmunogenic or possesses low inherent immunogenicity.
- the hydrophilic polymer can be weakly antigenic if used with appropriate adjuvants.
- Suitable nonimmunogenic polymers include, but are not limited to, PEG, polyamides, polylactic acid, polyglycolic acid, polylactic acid/polyglycolic acid copolymers, and combinations thereof.
- the polymer has a molecular weight of from about 250 to about 7,000 daltons.
- "Y" is a polycationic moiety.
- polycationic moiety refers to a compound, derivative, or functional group having a positive charge, preferably at least 2 positive charges at a selected pH, preferably physiological pH.
- Suitable polycationic moieties include basic amino acids and their derivatives such as arginine, asparagine, glutamine, lysine, and histidine; spermine; spermidine; cationic dendrimers; polyamines; polyamine sugars; and amino polysaccharides.
- the polycationic moieties can be linear, such as linear tetralysine, branched or dendrimeric in structure.
- Polycationic moieties have between about 2 to about 15 positive charges, preferably between about 2 to about 12 positive charges, and more preferably between about 2 to about 8 positive charges at selected pH values.
- the selection of which polycationic moiety to employ may be determined by the type of particle application which is desired.
- the charges on the polycationic moieties can be either distributed around the entire particle moiety, or alternatively, they can be a discrete concentration of charge density in one particular area of the particle moiety e.g., a charge spike. If the charge density is distributed on the particle, the charge density can be equally distributed or unequally distributed. AU variations of charge distribution of the polycationic moiety are encompassed by the present invention.
- the lipid "A” and the nonimmunogenic polymer “W” can be attached by various methods and preferably by covalent attachment. Methods known to those of skill in the art can be used for the covalent attachment of "A” and “W.” Suitable linkages include, but are not limited to, amide, amine, carboxyl, carbonate, carbamate, ester, and hydrazone linkages. It will be apparent to those skilled in the art that "A” and “W” must have complementary functional groups to effectuate the linkage. The reaction of these two groups, one on the lipid and the other on the polymer, will provide the desired linkage.
- the lipid is a diacylglycerol and the terminal hydroxyl is activated, for instance with NHS and DCC, to form an active ester, and is then reacted with a polymer which contains an amino group, such as with a polyamide (see, e.g., U.S. Patent Nos. 6,320,017 and 6,586,559), an amide bond will form between the two groups.
- a polymer which contains an amino group such as with a polyamide (see, e.g., U.S. Patent Nos. 6,320,017 and 6,586,559)
- the polycationic moiety can have a ligand attached, such as a targeting ligand or a chelating moiety for complexing calcium.
- a ligand attached such as a targeting ligand or a chelating moiety for complexing calcium.
- the cationic moiety maintains a positive charge.
- the ligand that is attached has a positive charge.
- Suitable ligands include, but are not limited to, a compound or device with a reactive functional group and include lipids, amphipathic lipids, carrier compounds, bioaffinity compounds, biomaterials, biopolymers, biomedical devices, analytically detectable compounds, therapeutically active compounds, enzymes, peptides, proteins, antibodies, immune stimulators, radiolabels, fluorogens, biotin, drugs, haptens, DNA, RNA, polysaccharides, liposomes, virosomes, micelles, immunoglobulins, functional groups, other targeting moieties, or toxins.
- the lipid conjugate (e.g., PEG-lipid) comprises from about 0 mol % to about 20 mol %, from about 0.5 mol % to about 20 mol %, from about 1.5 mol % to about 18 mol %, from about 4 mol % to about 15 mol %, from about 5 mol % to about 12 mol %, or about 2 mol % of the total lipid present in the particle.
- the lipid conjugate (e.g., PEG-lipid) comprises from about 0.1 mol % to about 10 mol %, about 0.1 mol % to about 5 mol %, about 0.2 mol % to about 5 mol %, about 0.3 mol % to about 5 mol %, about 0.4 mol % to about 5 mol %, about 0.5 mol % to about 5 mol %, about 0.5 mol % to about 2 mol %, about 0.5 mol % to about 1.5 mol %, about 0.5 mol % to about 1 mol %, about 1 mol % to about 2 mol %, or about 1.5 mol % of the total lipid present in the particle.
- concentration of the lipid conjugate can be varied depending on the lipid conjugate employed and the rate at which the nucleic acid-lipid particle is to become fusogenic.
- concentration of the lipid conjugate can be varied depending on the lipid conjugate employed and the rate at which the nucleic acid-lipid particle is to become fusogenic.
- the rate at which the nucleic acid-lipid particle becomes fusogenic can be varied, for example, by varying the concentration of the lipid conjugate, by varying the molecular weight of the PEG, or by varying the chain length and degree of saturation of the acyl chain groups on the phosphatidylethanolamine or the ceramide.
- other variables including, for example, pH, temperature, ionic strength, etc. can be used to vary and/or control the rate at which the nucleic acid-lipid particle becomes fusogenic. Other methods which can be used to control the rate at which the nucleic acid-lipid particle becomes fusogenic will become apparent to those of skill in the art upon reading this disclosure.
- Non-limiting examples of additional lipid-based carrier systems suitable for use in the present invention include lipoplexes ⁇ see, e.g., U.S. Patent Publication No. 20030203865; and Zhang et al, J. Control Release, 100:165-180 (2004)), pH-sensitive lipoplexes ⁇ see, e.g., U.S. Patent Publication No. 20020192275), reversibly masked lipoplexes ⁇ see, e.g., U.S. Patent Publication Nos. 20030180950), cationic lipid-based compositions ⁇ see, e.g., U.S. Patent No. 6,756,054; and U.S. Patent Publication No.
- WO 00/50008 cell- type specific liposomes ⁇ see, e.g., U.S. Patent Publication No. 20030198664), liposomes containing nucleic acid and peptides ⁇ see, e.g., U.S. Patent No. 6,207,456), liposomes containing lipids derivatized with releasable hydrophilic polymers ⁇ see, e.g., U.S. Patent
- lipid-entrapped nucleic acid see, e.g., PCT Publication Nos. WO 03/057190 and WO 03/059322
- lipid-encapsulated nucleic acid see, e.g., U.S. Patent Publication No. 20030129221; and U.S. Patent No. 5,756,122
- other liposomal compositions see, e.g., U.S. Patent Publication Nos. 20030035829 and 20030072794; and U.S. Patent No.
- polymer-based carrier systems suitable for use in the present invention include, but are not limited to, cationic polymer-nucleic acid complexes ⁇ i.e., polyplexes).
- a nucleic acid ⁇ e.g., interfering RNA
- a cationic polymer having a linear, branched, star, or dendritic polymeric structure that condenses the nucleic acid into positively charged particles capable of interacting with anionic proteoglycans at the cell surface and entering cells by endocytosis.
- the polyplex comprises nucleic acid (e.g., interfering RNA) complexed with a cationic polymer such as polyethylenimine (PEI) ⁇ see, e.g., U.S. Patent No. 6,013,240; commercially available from Qbiogene, Inc.
- a cationic polymer such as polyethylenimine (PEI) ⁇ see, e.g., U.S. Patent No. 6,013,240; commercially available from Qbiogene, Inc.
- PEITM In vivo jetPEITM, a linear form of PEI), polypropylenimine (PPI), polyvinylpyrrolidone (PVP), poly-L-lysine (PLL), diethylaminoethyl (DEAE)-dextran, poly( ⁇ -amino ester) (PAE) polymers ⁇ see, e.g., Lynn et al., J. Am. Chem. Soc, 123:8155-8156 (2001)), chitosan, polyamidoamine (PAMAM) dendrimers (see, e.g., Kukowska-Latallo et al, Proc. Natl. Acad. Sd.
- PAMAM polyamidoamine
- porphyrin see, e.g., U.S. Patent No. 6,620,805
- polyvinylether see, e.g., U.S. Patent Publication No. 20040156909
- polycyclic amidinium see, e.g., U.S. Patent Publication No. 20030220289
- other polymers comprising primary amine, imine, guanidine, and/or imidazole groups (see, e.g., U.S. Patent No. 6,013,240; PCT Publication No. WO/9602655; PCT Publication No. WO95/21931; Zhang et al, J.
- the polyplex comprises cationic polymer-nucleic acid complexes as described in U.S. Patent Publication Nos. 20060211643, 20050222064, 20030125281, and 20030185890, and PCT Publication No. WO 03/066069; biodegradable poly( ⁇ -amino ester) polymer-nucleic acid complexes as described in U.S. Patent Publication No. 20040071654; microparticles containing polymeric matrices as described in U.S. Patent Publication No.
- the interfering RNA may be complexed with cyclodextrin or a polymer thereof.
- cyclodextrin-based carrier systems include the cyclodextrin-modified polymer-nucleic acid complexes described in U.S. Patent Publication No. 20040087024; the linear cyclodextrin copolymer-nucleic acid complexes described in U.S. Patent Nos. 6,509,323, 6,884,789, and 7,091,192; and the cyclodextrin polymer- complexing agent-nucleic acid complexes described in U.S. Patent No. 7,018,609.
- the interfering RNA may be complexed with a peptide or polypeptide.
- a protein-based carrier system includes, but is not limited to, the cationic oligopeptide-nucleic acid complex described in PCT Publication No. WO95/21931.
- the serum-stable nucleic acid-lipid particles of the present invention in which the interfering RNA described herein is encapsulated in a lipid bilayer and is protected from degradation, can be formed by any method known in the art including, but not limited to, a continuous mixing method, a direct dilution process, a detergent dialysis method, or a modification of a reverse-phase method which utilizes organic solvents to provide a single phase during mixing of the components.
- the cationic lipids are lipids of Formula I and II or combinations thereof.
- the non-cationic lipids are egg sphingomyelin (ESM), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), l-palmitoyl-2-oleoyl-phosphatidylcholine (POPC), dipalmitoyl-phosphatidylcholine (DPPC), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, 14:0 PE (1,2-dimyristoyl- ⁇ hos ⁇ hatidylethanolamine (DMPE)), 16:0 PE (1,2-dipalmitoyl- phosphatidylethanolamine (DPPE)), 18:0 PE (1,2-distearoyl-phosphatidylethanolamine (DSPE)), 18:1 PE (1,2-dioleoyl-phosphatidylethanolamine (DOPE)), 18:1 trans PE (1,2- dielaidoyl-phosphatid
- ESM egg
- the present invention provides for nucleic acid-lipid particles produced via a continuous mixing method, e.g., process that includes providing an aqueous solution comprising a nucleic acid such as an interfering RNA in a first reservoir, providing an organic lipid solution in a second reservoir, and mixing the aqueous solution with the organic lipid solution such that the organic lipid solution mixes with the aqueous solution so as to substantially instantaneously produce a liposome encapsulating the nucleic acid (e.g., interfering RNA).
- a continuous mixing method e.g., process that includes providing an aqueous solution comprising a nucleic acid such as an interfering RNA in a first reservoir, providing an organic lipid solution in a second reservoir, and mixing the aqueous solution with the organic lipid solution such that the organic lipid solution mixes with the aqueous solution so as to substantially instantaneously produce a liposome encapsulating the nucleic acid (e.g., interfering RNA
- the organic lipid solution undergoes a continuous stepwise dilution in the presence of the buffer solution (i.e., aqueous solution) to produce a nucleic acid-lipid particle.
- the buffer solution i.e., aqueous solution
- the serum-stable nucleic acid-lipid particles formed using the continuous mixing method typically have a size of from about 50 ran to about 150 nm, from about 60 ran to about 130 nm, from about 70 nm to about 110 nm, or from about 70 nm to about 90 nm.
- the particles thus formed do not aggregate and are optionally sized to achieve a uniform particle size.
- the present invention provides for nucleic acid-lipid particles produced via a direct dilution process that includes forming a liposome solution and immediately and directly introducing the liposome solution into a collection vessel containing a controlled amount of dilution buffer.
- the collection vessel includes one or more elements configured to stir the contents of the collection vessel to facilitate dilution.
- the amount of dilution buffer present in the collection vessel is substantially equal to the volume of liposome solution introduced thereto.
- a liposome solution in 45% ethanol when introduced into the collection vessel containing an equal volume of dilution buffer will advantageously yield smaller particles.
- the present invention provides for nucleic acid-lipid particles produced via a direct dilution process in which a third reservoir containing dilution buffer is fluidly coupled to a second mixing region.
- the liposome solution formed in a first mixing region is immediately and directly mixed with dilution buffer in the second mixing region.
- the second mixing region includes a T-connector arranged so that the liposome solution and the dilution buffer flows meet as opposing 180° flows; however, connectors providing shallower angles can be used, e.g., from about 27° to about 180°.
- a pump mechanism delivers a controllable flow of buffer to the second mixing region.
- the flow rate of dilution buffer provided to the second mixing region is controlled to be substantially equal to the flow rate of liposome solution introduced thereto from the first mixing region.
- This embodiment advantageously allows for more control of the flow of dilution buffer mixing with the liposome solution in the second mixing region, and therefore also the concentration of liposome solution in buffer throughout the second mixing process.
- Such control of the dilution buffer flow rate advantageously allows for small particle size formation at reduced concentrations.
- the serum-stable nucleic acid-lipid particles formed using the direct dilution process typically have a size of from about 50 ran to about 150 ran, from about 60 ran to about 130 nm, from about 70 ran to about 110 ran, or from about 70 nm to about 90 ran.
- the particles thus formed do not aggregate and are optionally sized to achieve a uniform particle size.
- the particles are formed using detergent dialysis.
- a nucleic acid such as an interfering RNA is contacted with a detergent solution of cationic lipids to form a coated nucleic acid complex.
- These coated nucleic acids can aggregate and precipitate.
- the presence of a detergent reduces this aggregation and allows the coated nucleic acids to react with excess lipids (typically, non-cationic lipids) to form particles in which the nucleic acid is encapsulated in a lipid bilayer.
- the serum-stable nucleic acid-lipid particles can be prepared as follows:
- step (c) dialyzing the detergent solution of step (b) to provide a solution of serum-stable nucleic acid-lipid particles, wherein the nucleic acid is encapsulated in a lipid bilayer and the particles are serum-stable and have a size of from about 50 nm to about 150 run.
- An initial solution of coated nucleic acid-lipid complexes is formed by combining the nucleic acid with the cationic lipids in a detergent solution.
- the detergent solution is preferably an aqueous solution of a neutral detergent having a critical micelle concentration of 15-300 mM, more preferably 20-50 mM.
- detergents include, for example, N,N'-((octanoylimino)-bis-(trimethylene))-bis-(D- gluconamide) (BIGCHAP); BRIJ 35; Deoxy-BIGCHAP; dodecylpoly(ethylene glycol) ether; Tween 20; Tween 40; Tween 60; Tween 80; Tween 85; Mega 8; Mega 9; Zwittergent ® 3-08; Zwittergent ® 3-10; Triton X-405; hexyl-, heptyl-, octyl- and nonyl- ⁇ -D-glucopyranoside; and heptylthioglucopyranoside; with octyl ⁇ -D-glucopyranoside and Tween-20 being the most preferred.
- concentration of detergent in the detergent solution is typically about 100 mM to about 2 M, preferably from about 200 mM to about 1.5 M.
- the cationic lipids and nucleic acids will typically be combined to produce a charge ratio (+/-) of about 1 : 1 to about 20 : 1 , in a ratio of about 1 : 1 to about 12 : 1 , or in a ratio of about 2:1 to about 6:1. Additionally, the overall concentration of nucleic acid in solution will typically be from about 25 ⁇ g/ml to about 1 mg/ml, from about 25 ⁇ g/ml to about 200 ⁇ g/ml, or from about 50 ⁇ g/ml to about 100 ⁇ g/ml.
- the combination of nucleic acids and cationic lipids in detergent solution is kept, typically at room temperature, for a period of time which is sufficient for the coated complexes to form.
- the nucleic acids and cationic lipids can be combined in the detergent solution and warmed to temperatures of up to about 37°C, about 5O 0 C, about 6O 0 C, or about 7O 0 C.
- the coated complexes can be formed at lower temperatures, typically down to about 4°C.
- the detergent solution of the coated nucleic acid-lipid complexes is then contacted with non-cationic lipids to provide a detergent solution of nucleic acid-lipid complexes and non-cationic lipids.
- the non-cationic lipids which are useful in this step include, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cardiolipin, and cerebrosides.
- the non-cationic lipids are diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, or sphingomyelin.
- the acyl groups in these lipids are preferably acyl groups derived from fatty acids having C 1O -C 24 carbon chains. More preferably, the acyl groups are lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl.
- the non-cationic lipids are DSPC, DOPE, POPC, egg phosphatidylcholine (EPC), cholesterol, or a mixture thereof.
- the nucleic acid-lipid particles are fusogenic particles with enhanced properties in vivo and the non-cationic lipid is DSPC or DOPE.
- the nucleic acid- lipid particles of the present invention may further comprise cholesterol.
- the non-cationic lipids can further comprise polyethylene glycol-based polymers such as PEG 2,000, PEG 5,000, and PEG conjugated to a diacylglycerol, a ceramide, or a phospholipid, as described in, e.g., U.S. Patent No. 5,820,873 and U.S. Patent Publication No. 20030077829.
- the non-cationic lipids can further comprise polyethylene glycol-based polymers such as PEG 2,000, PEG 5,000, and PEG conjugated to a dialkyloxypropyl.
- the amount of non-cationic lipid which is used in the present methods is typically from about 2 to about 20 mg of total lipids to 50 ⁇ g of nucleic acid.
- the amount of total lipid is from about 5 to about 10 mg per 50 ⁇ g of nucleic acid.
- the detergent is removed, preferably by dialysis.
- the removal of the detergent results in the formation of a lipid-bilayer which surrounds the nucleic acid providing serum-stable nucleic acid-lipid particles which have a size of from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about 110 nm, or from about 70 nm to about 90 nm.
- the particles thus formed do not aggregate and are optionally sized to achieve a uniform particle size.
- the serum-stable nucleic acid-lipid particles can be sized by any of the methods available for sizing liposomes. The sizing may be conducted in order to achieve a desired size range and relatively narrow distribution of particle sizes.
- Extrusion of the particles through a small-pore polycarbonate membrane or an asymmetric ceramic membrane is also an effective method for reducing particle sizes to a relatively well-defined size distribution.
- the suspension is cycled through the membrane one or more times until the desired particle size distribution is achieved.
- the particles may be extruded through successively smaller-pore membranes, to achieve a gradual reduction in size.
- the serum-stable nucleic acid-lipid particles can be prepared as follows:
- nucleic acid-lipid particles wherein the nucleic acid is encapsulated in a lipid bilayer and the particles are stable in serum and have a size of from about 50 nm to about 150 nm.
- the nucleic acids e.g., interfering RNA
- cationic lipids e.g., cationic lipids
- non-cationic lipids which are useful in this group of embodiments are as described for the detergent dialysis methods above.
- organic solvent which is also used as a solubilizing agent, is in an amount sufficient to provide a clear single phase mixture of nucleic acid and lipids.
- Suitable solvents include, but are not limited to, chloroform, dichloromethane, diethylether, cyclohexane, cyclopentane, benzene, toluene, methanol, or other aliphatic alcohols such as propanol, isopropanol, butanol, tert-butanol, iso-butanol, pentanol and hexanol.
- Combinations of two or more solvents may also be used in the present invention.
- Contacting the nucleic acid with the organic solution of cationic and non-cationic lipids is accomplished by mixing together a first solution of nucleic acid, which is typically an aqueous solution, and a second organic solution of the lipids.
- a first solution of nucleic acid which is typically an aqueous solution
- a second organic solution of the lipids One of skill in the art will understand that this mixing can take place by any number of methods, for example, by mechanical means such as by using vortex mixers.
- the organic solvent is removed, thus forming an aqueous suspension of serum- stable nucleic acid-lipid particles.
- the methods used to remove the organic solvent will typically involve evaporation at reduced pressures or blowing a stream of inert gas (e.g., nitrogen or argon) across the mixture.
- the serum-stable nucleic acid-lipid particles thus formed will typically be sized from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about 110 nm, or from about 70 nm to about 90 nm. To achieve further size reduction or homogeneity of size in the particles, sizing can be conducted as described above.
- the methods will further comprise adding non-lipid polycations which are useful to effect the delivery to cells using the present compositions.
- non-lipid polycations examples include, but are limited to, hexadimethrine bromide (sold under the brand name POLYBRENE ® , from Aldrich Chemical Co., Milwaukee, Wisconsin, USA) or other salts of heaxadimethrine.
- suitable polycations include, for example, salts of poly-L-ornithine, poly-L-arginine, poly-L-lysine, poly-D-lysine, polyallylamine, and polyethyleneimine.
- the formation of the nucleic acid-lipid particles can be carried out either in a mono-phase system (e.g., a Bligh and Dyer monophase or similar mixture of aqueous and organic solvents) or in a two-phase system with suitable mixing.
- a mono-phase system e.g., a Bligh and Dyer monophase or similar mixture of aqueous and organic solvents
- suitable mixing e.g., a Bligh and Dyer monophase or similar mixture of aqueous and organic solvents
- the cationic lipids and nucleic acids are each dissolved in a volume of the mono-phase mixture. Combination of the two solutions provides a single mixture in which the complexes form.
- the complexes can form in two-phase mixtures in which the cationic lipids bind to the nucleic acid (which is present in the aqueous phase), and "pull" it into the organic phase.
- the serum-stable nucleic acid-lipid particles can be prepared as follows:
- nucleic acids contacting nucleic acids with a solution comprising non-cationic lipids and a detergent to form a nucleic acid-lipid mixture;
- cationic lipids contacting cationic lipids with the nucleic acid-lipid mixture to neutralize a portion of the negative charge of the nucleic acids and form a charge-neutralized mixture of nucleic acids and lipids;
- the solution of non-cationic lipids and detergent is an aqueous solution.
- Contacting the nucleic acids with the solution of non-cationic lipids and detergent is typically accomplished by mixing together a first solution of nucleic acids and a second solution of the lipids and detergent.
- this mixing can take place by any number of methods, for example, by mechanical means such as by using vortex mixers.
- the nucleic acid solution is also a detergent solution.
- the amount of non-cationic lipid which is used in the present method is typically determined based on the amount of cationic lipid used, and is typically of from about 0.2 to about 5 times the amount of cationic lipid, preferably from about 0.5 to about 2 times the amount of cationic lipid used.
- the nucleic acids are precondensed as described in, e.g., U.S. Patent Application No. 09/744,103.
- the nucleic acid-lipid mixture thus formed is contacted with cationic lipids to neutralize a portion of the negative charge which is associated with the nucleic acids (or other polyanionic materials) present.
- the amount of cationic lipids used will typically be sufficient to neutralize at least 50% of the negative charge of the nucleic acid.
- the negative charge will be at least 70% neutralized, more preferably at least 90% neutralized.
- Cationic lipids which are useful in the present invention include, for example, DLinDMA and DLenDMA. These lipids and related analogs are described in U.S. Patent Publication No. 20060083780.
- Contacting the cationic lipids with the nucleic acid-lipid mixture can be accomplished by any of a number of techniques, preferably by mixing together a solution of the cationic lipid and a solution containing the nucleic acid-lipid mixture. Upon mixing the two solutions (or contacting in any other manner), a portion of the negative charge associated with the nucleic acid is neutralized. Nevertheless, the nucleic acid remains in an uncondensed state and acquires hydrophilic characteristics.
- the detergent (or combination of detergent and organic solvent) is removed, thus forming the nucleic acid-lipid particles.
- the methods used to remove the detergent will typically involve dialysis.
- organic solvents are present, removal is typically accomplished by evaporation at reduced pressures or by blowing a stream of inert gas (e.g., nitrogen or argon) across the mixture.
- inert gas e.g., nitrogen or argon
- the particles thus formed will typically be sized from about 50 nm to several microns, about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about 110 nm, or from about 70 nm to about 90 nm.
- the nucleic acid-lipid particles can be sonicated, filtered, or subjected to other sizing techniques which are used in liposomal formulations and are known to those of skill in the art.
- the methods will further comprise adding non-lipid polycations which are useful to effect the lipofection of cells using the present compositions.
- non-lipid polycations examples include, hexadimethrine bromide (sold under the brandname POLYBRENE ® , from Aldrich Chemical Co., Milwaukee, Wisconsin, USA) or other salts of hexadimethrine.
- suitable polycations include, for example, salts of poly- L-ornithine, poly-L-arginine, poly-L-lysine, poly-D-lysine, polyallylamine, and polyethyleneimine. Addition of these salts is preferably after the particles have been formed.
- serum-stable nucleic acid-lipid particles can be prepared as follows:
- nucleic acids e.g., interfering RNA
- non-cationic lipids e.g., cationic lipids
- organic solvents e.g., organic solvents
- the solution of step (a) is a mono-phase. In another group of embodiments, the solution of step (a) is two-phase.
- the non-cationic lipids are ESM, DSPC, DOPC, POPC, DPPC, monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, DMPE, DPPE, DSPE, DOPE, DEPE, SOPE, POPE, PEG-based polymers (e.g., PEG 2000, PEG 5000, PEG-modified diacylglycerols, or PEG-modif ⁇ ed dialkyloxypropyls), cholesterol, or combinations thereof, hi still other preferred embodiments, the organic solvents are methanol, chloroform, methylene chloride, ethanol, diethyl ether or combinations thereof.
- the nucleic acid is an interfering RNA as described herein;
- the cationic lipid is DLindMA, DLenDMA, DODAC, DDAB, DOTMA, DOSPA, DMRIE, DOGS, or combinations thereof;
- the non-cationic lipid is ESM, DOPE, PEG-DAG, DSPC, DPPC, DPPE, DMPE, monomethyl-phosphatidylethanolamine, dimethyl- phosphatidylethanolamine, DSPE, DEPE, SOPE, POPE, cholesterol, or combinations thereof (e.g., DSPC and PEG-DAA);
- the organic solvent is methanol, chloroform, methylene chloride, ethanol, diethyl ether or combinations thereof.
- contacting the nucleic acids with the cationic lipids is typically accomplished by mixing together a first solution of nucleic acids and a second solution of the lipids, preferably by mechanical means such as by using vortex mixers.
- the resulting mixture contains complexes as described above.
- These complexes are then converted to particles by the addition of non-cationic lipids and the removal of the organic solvent.
- the addition of the non-cationic lipids is typically accomplished by simply adding a solution of the non-cationic lipids to the mixture containing the complexes. A reverse addition can also be used. Subsequent removal of organic solvents can be accomplished by methods known to those of skill in the art and also described above.
- the amount of non-cationic lipids which is used in this aspect of the invention is typically an amount of from about 0.2 to about 15 times the amount (on a mole basis) of cationic lipids which was used to provide the charge-neutralized nucleic acid-lipid complex. Preferably, the amount is from about 0.5 to about 9 times the amount of cationic lipids used.
- the nucleic acid-lipid particles prepared according to the above- described methods are either net charge neutral or carry an overall charge which provides the particles with greater gene lipofection activity.
- the nucleic acid component of the particles is a nucleic acid which interferes with the production of an undesired protein.
- the non-cationic lipid may further comprise cholesterol.
- the nucleic acid to lipid ratios (mass/mass ratios) in a formed nucleic acid-lipid particle will range from about 0.01 to about 0.2, from about 0.02 to about 0.1, from about 0.03 to about 0.1, or from about 0.01 to about 0.08. The ratio of the starting materials also falls within this range.
- the nucleic acid-lipid particle preparation uses about 400 ⁇ g nucleic acid per 10 mg total lipid or a nucleic acid to lipid mass ratio of about 0.01 to about 0.08 and , more preferably, about 0.04, which corresponds to 1.25 mg of total lipid per 50 ⁇ g of nucleic acid.
- the particle has a nucleic acid:lipid mass ratio of about 0.08.
- the lipid to nucleic acid ratios (mass/mass ratios) in a formed nucleic acid-lipid particle will range from about 1 (1:1) to about 100 (100:1), from about 5 (5:1) to about 100 (100:1), from about 1 (1:1) to about 50 (50:1), from about 2 (2:1) to about 50 (50:1), from about 3 (3:1) to about 50 (50:1), from about 4 (4:1) to about 50 (50:1), from about 5 (5:1) to about 50 (50:1), from about 1 (1 :1) to about 25 (25:1), from about 2 (2:1) to about 25 (25:1), from about 3 (3:1) to about 25 (25:1), from about 4 (4:1) to about 25 (25:1), from about 5 (5:1) to about 25 (25:1), from about 5 (5:1) to about 20 (20:1), from about 5 (5:1) to about 15
- the conjugated lipid may further include a CPL.
- CPL-containing SNALPs A variety of general methods for making SNALP-CPLs (CPL-containing SNALPs) are discussed herein. Two general techniques include "post-insertion” technique, that is, insertion of a CPL into for example, a pre-formed SNALP, and the "standard” technique, wherein the CPL is included in the lipid mixture during for example, the SNALP formation steps.
- the post- insertion technique results in SNALPs having CPLs mainly in the external face of the SNALP bilayer membrane, whereas standard techniques provide SNALPs having CPLs on both internal and external faces.
- the method is especially useful for vesicles made from phospholipids (which can contain cholesterol) and also for vesicles containing PEG-lipids (such as PEG-DAAs and PEG-DAGs).
- PEG-lipids such as PEG-DAAs and PEG-DAGs.
- the present invention also provides nucleic acid-lipid particles in kit form.
- the kit may comprise a container which is compartmentalized for holding the various elements of the nucleic acid-lipid particles (e.g., the nucleic acids and the individual lipid components of the particles).
- the kit may further comprise an endosomal membrane destabilizer (e.g., calcium ions).
- the kit typically contains the nucleic acid-lipid particle compositions of the present invention, preferably in dehydrated form, with instructions for their rehydration and administration.
- the SNALPs of the present invention can be tailored to preferentially target particular tissues or organs of interest.
- Preferential targeting of SNALPs is carried out by controlling the composition of the SNALP itself. For instance, as set forth in Examples 14 and 15, it has been found that the 1:57 PEG-cDSA SNALP formulation can be used to preferentially target tumors outside of the liver, whereas the 1 :57 PEG-cDMA SNALP formulation can be used to preferentially target the liver. In certain instances, however, it may be desirable to have a targeting moiety attached to the surface of the particle to further enhance the targeting of the SNALP. Methods of attaching targeting moieties (e.g., antibodies, proteins) to lipids (such as those used in the present particles) are known to those ofskill in the art.
- targeting moieties e.g., antibodies, proteins
- the serum-stable nucleic acid-lipid particles (SNALP) of the present invention are useful for the introduction of nucleic acids (e.g., interfering RNA) into cells. Accordingly, the present invention also provides methods for introducing a nucleic acid (e.g., interfering RNA) into a cell. The methods are carried out in vitro or in vivo by first forming the particles as described above and then contacting the particles with the cells for a period of time sufficient for delivery of the nucleic acid to the cells to occur. [0375] The nucleic acid-lipid particles of the present invention can be adsorbed to almost any cell type with which they are mixed or contacted.
- the particles can either be endocytosed by a portion of the cells, exchange lipids with cell membranes, or fuse with the cells. Transfer or incorporation of the nucleic acid portion of the particle can take place via any one of these pathways. In particular, when fusion takes place, the particle membrane is integrated into the cell membrane and the contents of the particle combine with the intracellular fluid.
- a pharmaceutically-acceptable carrier e.g., physiological saline or phosphate buffer
- normal buffered saline e.g., 135-150 mM NaCl
- suitable carriers include, e.g., water, buffered water, 0.4% saline, 0.3% glycine, and the like, including glycoproteins for enhanced stability, such as albumin, lipoprotein, globulin, etc. Additional suitable carriers are described in, e.g., REMINGTON'S PHARMACEUTICAL SCIENCES, Mack Publishing Company, Philadelphia, PA, 17th ed. (1985).
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- pharmaceutically-acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.
- the pharmaceutically-acceptable carrier is generally added following particle formation.
- the particle can be diluted into pharmaceutically-acceptable carriers such as normal buffered saline.
- the concentration of particles in the pharmaceutical formulations can vary widely, i.e., from less than about 0.05%, usually at or at least about 2 to 5%, to as much as about 10 to 90% by weight, and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected. For example, the concentration may be increased to lower the fluid load associated with treatment. This may be particularly desirable in patients having atherosclerosis-associated congestive heart failure or severe hypertension.
- compositions of the present invention may be sterilized by conventional, well-known sterilization techniques.
- Aqueous solutions can be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration.
- the compositions can contain pharmaceutically-acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, and calcium chloride.
- the particle suspension may include lipid- protective agents which protect lipids against free-radical and lipid-peroxidative damages on storage.
- Lipophilic free-radical quenchers such as alphatocopherol and water-soluble iron- specific chelators, such as ferrioxamine, are suitable.
- nucleic acid-lipid particles such as those disclosed in PCT Publication Nos. WO 05/007196, WO 05/121348, WO 05/120152, and WO 04/002453.
- the present invention also provides fully encapsulated nucleic acid-lipid particles that protect the nucleic acid from nuclease degradation in serum, are nonimmunogenic, are small in size, and are suitable for repeat dosing.
- administration can be in any manner known in the art, e.g., by injection, oral administration, inhalation ⁇ e.g., intransal or intratracheal), transdermal application, or rectal administration. Administration can be accomplished via single or divided doses.
- the pharmaceutical compositions can be administered parenterally, i.e., intraarticularly, intravenously, intraperitoneally, subcutaneously, or intramuscularly, hi some embodiments, the pharmaceutical compositions are administered intravenously or intraperitoneally by a bolus injection ⁇ see, e.g. , U.S. Patent No. 5,286,634).
- Intracellular nucleic acid delivery has also been discussed in Straubringer et al, Methods En ⁇ ymol, 101:512 (1983); Mannino et al, Biotechniques, 6:682 (1988); Nicolau et al, Crit. Rev. Ther. Drug Carrier Syst., 6:239 (1989); and Behr, Ace. Chem. Res., 26:21 A (1993). Still other methods of administering lipid-based therapeutics are described in, for example, U.S. Patent Nos. 3,993,754; 4,145,410; 4,235,871; 4,224,179; 4,522,803; and 4,588,578.
- the lipid- nucleic acid particles can be administered by direct injection at the site of disease or by injection at a site distal from the site of disease ⁇ see, e.g., Culver, HUMAN GENE THERAPY, MaryAnn Liebert, Inc., Publishers, New York. pp.70-71(1994)).
- the compositions of the present invention can be made into aerosol formulations ⁇ i.e., they can be "nebulized") to be administered via inhalation ⁇ e.g., intranasally or intratracheally) ⁇ see, Brigham et al., Am. J. ScL, 298:278 (1989)).
- Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
- the pharmaceutical compositions may be delivered by intranasal sprays, inhalation, and/or other aerosol delivery vehicles. Methods for delivering nucleic acid compositions directly to the lungs via nasal aerosol sprays have been described, e.g., in U.S. Patent Nos. 5,756,353 and 5,804,212. Likewise, the delivery of drugs using intranasal microparticle resins and lysophosphatidyl-glycerol compounds (U.S. Patent 5,725,871) are also well-known in the pharmaceutical arts. Similarly, transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Patent No. 5,780,045.
- Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
- compositions are preferably administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically, or intrathecally.
- the nucleic acid-lipid formulations are formulated with a suitable pharmaceutical carrier.
- a suitable pharmaceutical carrier may be employed in the compositions and methods of the present invention. Suitable formulations for use in the present invention are found, for example, in REMINGTON'S PHARMACEUTICAL SCIENCES, Mack Publishing Company, Philadelphia, PA, 17th ed. (1985).
- a variety of aqueous carriers maybe used, for example, water, buffered water, 0.4% saline, 0.3% glycine, and the like, and may include glycoproteins for enhanced stability, such as albumin, lipoprotein, globulin, etc.
- compositions can be sterilized by conventional liposomal sterilization techniques, such as filtration.
- the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
- These compositions can be sterilized using the techniques referred to above or, alternatively, they can be produced under sterile conditions.
- the resulting aqueous solutions may be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration.
- the nucleic acid-lipid particles disclosed herein may be delivered via oral administration to the individual.
- the particles may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, pills, lozenges, elixirs, mouthwash, suspensions, oral sprays, syrups, wafers, and the like ⁇ see, e.g., U.S. Patent Nos. 5,641,515, 5,580,579, and 5,792,451).
- These oral dosage forms may also contain the following: binders, gelatin; excipients, lubricants, and/or flavoring agents.
- the unit dosage form When the unit dosage form is a capsule, it may contain, in addition to the materials described above, a liquid carrier.
- any material used in preparing any unit dosage form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
- these oral formulations may contain at least about 0.1% of the nucleic acid-lipid particles or more, although the percentage of the particles may, of course, be varied and may conveniently be between about 1% or 2% and about 60% or 70% or more of the weight or volume of the total formulation.
- the amount of particles in each therapeutically useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound.
- Formulations suitable for oral administration can consist of: (a) liquid solutions, such as an effective amount of the packaged nucleic acid ⁇ e.g., interfering RNA) suspended in diluents such as water, saline, or PEG 400; (b) capsules, sachets, or tablets, each containing a predetermined amount of the nucleic acid ⁇ e.g., interfering RNA), as liquids, solids, granules, or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions.
- liquid solutions such as an effective amount of the packaged nucleic acid ⁇ e.g., interfering RNA
- diluents such as water, saline, or PEG 400
- capsules, sachets, or tablets each containing a predetermined amount of the nucleic acid ⁇ e.g., interfering RNA
- Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, microcrystalline cellulose, gelatin, colloidal silicon dioxide, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers.
- Lozenge forms can comprise the nucleic acid ⁇ e.g., interfering RNA) in a flavor, e.g., sucrose, as well as pastilles comprising the nucleic acid ⁇ e.g., interfering RNA) in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the nucleic acid ⁇ e.g., interfering RNA), carriers known in the art.
- a flavor e.g., sucrose
- pastilles comprising the nucleic acid ⁇ e.g., interfering RNA) in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the nucleic acid ⁇ e.g., interfering RNA), carriers known in the art.
- nucleic acid-lipid particles can be incorporated into a broad range of topical dosage forms.
- the suspension containing the nucleic acid-lipid particles can be formulated and administered as gels, oils, emulsions, topical creams, pastes, ointments, lotions, foams, mousses, and the like.
- nucleic acid-lipid particles of the invention When preparing pharmaceutical preparations of the nucleic acid-lipid particles of the invention, it is preferable to use quantities of the particles which have been purified to reduce or eliminate empty particles or particles with nucleic acid associated with the external surface.
- the methods of the present invention may be practiced in a variety of hosts.
- Preferred hosts include mammalian species, such as primates (e.g., humans and chimpanzees as well as other nonhuman primates), canines, felines, equines, bovines, ovines, caprines, rodents (e.g., rats and mice), lagomorphs, and swine.
- the amount of particles administered will depend upon the ratio of nucleic acid to lipid, the particular nucleic acid used, the disease state being diagnosed, the age, weight, and condition of the patient, and the judgment of the clinician, but will generally be between about 0.01 and about 50 mg per kilogram of body weight, preferably between about 0.1 and about 5 mg/kg of body weight, or about 10 8 -10 10 particles per administration (e.g., injection).
- nucleic acids e.g., interfering RNA
- the delivery of nucleic acids can be to any cell grown in culture, whether of plant or animal origin, vertebrate or invertebrate, and of any tissue or type.
- the cells are animal cells, more preferably mammalian cells, and most preferably human cells.
- a nucleic acid-lipid particle suspension is added to 60-80% confluent plated cells having a cell density of from about 10 3 to about 10 5 cells/ml, more preferably about 2 x 10 4 cells/ml.
- the concentration of the suspension added to the cells is preferably of from about 0.01 to 0.2 ⁇ g/ml, more preferably about 0.1 ⁇ g/ml.
- ERP Endosomal Release Parameter
- an ERP assay is to distinguish the effect of various cationic lipids and helper lipid components of SNALPs based on their relative effect on binding/uptake or fusion with/destabilization of the endosomal membrane. This assay allows one to determine quantitatively how each component of the SNALP or other lipid-based carrier system affects delivery efficiency, thereby optimizing the SNALPs or other lipid-based carrier systems.
- an ERP assay measures expression of a reporter protein ⁇ e.g., luciferase, ⁇ -galactosidase, green fluorescent protein (GFP), etc.), and in some instances, a SNALP formulation optimized for an expression plasmid will also be appropriate for encapsulating an interfering RNA.
- a SNALP formulation optimized for an expression plasmid will also be appropriate for encapsulating an interfering RNA.
- an ERP assay can be adapted to measure downregulation of transcription or translation of a target sequence in the presence or absence of an interfering RNA ⁇ e.g., siRNA).
- C. Cells for delivery of interfering RNA include, e.g., hematopoietic precursor (stem) cells, fibroblasts, keratinocytes, hepatocytes, endothelial cells, skeletal and smooth muscle cells, osteoblasts, neurons, quiescent lymphocytes, terminally differentiated cells, slow or noncycling primary cells, parenchymal cells, lymphoid cells, epithelial cells, bone cells, and the like.
- stem hematopoietic precursor
- fibroblasts keratinocytes, hepatocytes, endothelial cells, skeletal and smooth muscle cells, osteoblasts, neurons, quiescent lymphocytes, terminally differentiated cells, slow or noncycling primary cells, parenchymal cells, lymphoid cells, epithelial cells, bone cells, and the like.
- an interfering RNA ⁇ e.g., siRNA
- cancer cells such as, e.g., lung cancer cells, colon cancer cells, rectal cancer cells, anal cancer cells, bile duct cancer cells, small intestine cancer cells, stomach (gastric) cancer cells, esophageal cancer cells, gallbladder cancer cells, liver cancer cells, pancreatic cancer cells, appendix cancer cells, breast cancer cells, ovarian cancer cells, cervical cancer cells, prostate cancer cells, renal cancer cells, cancer cells of the central nervous system, glioblastoma tumor cells, skin cancer cells, lymphoma cells, choriocarcinoma tumor cells, head and neck cancer cells, osteogenic sarcoma tumor cells, and blood cancer cells.
- cancer cells such as, e.g., lung cancer cells, colon cancer cells, rectal cancer cells, anal cancer cells, bile duct cancer cells, small intestine cancer cells, stomach (gastric) cancer cells, esophageal cancer cells, gallbladder cancer cells, liver
- nucleic acid-lipid particles encapsulating an interfering RNA ⁇ e.g., siRNA
- the methods and compositions can be employed with cells of a wide variety of vertebrates, including mammals, such as, e.g, canines, felines, equines, bovines, ovines, caprines, rodents ⁇ e.g., mice, rats, and guinea pigs), lagomorphs, swine, and primates ⁇ e.g. monkeys, chimpanzees, and humans).
- mammals such as, e.g, canines, felines, equines, bovines, ovines, caprines, rodents ⁇ e.g., mice, rats, and guinea pigs), lagomorphs, swine, and primates ⁇ e.g. monkeys, chimpanzees, and humans.
- rodents ⁇ e.g., mice, rats, and guinea pigs
- the nucleic acid-lipid particles are detectable in the subject at about 8, 12, 24, 48, 60, 72, or 96 hours, or 6, 8, 10, 12, 14, 16, 18, 19, 22, 24, 25, or 28 days after administration of the particles.
- the presence of the particles can be detected in the cells, tissues, or other biological samples from the subject.
- the particles may be detected, e.g., by direct detection of the particles, detection of the interfering RNA ⁇ e.g., siRNA) sequence, detection of the target sequence of interest ⁇ i.e., by detecting expression or reduced expression of the sequence of interest), or a combination thereof.
- Nucleic acid-lipid particles can be detected using any methods known in the art.
- a label can be coupled directly or indirectly to a component of the SNALP or other carrier system using methods well-known in the art.
- a wide variety of labels can be used, with the choice of label depending on sensitivity required, ease of conjugation with the SNALP component, stability requirements, and available instrumentation and disposal provisions.
- Suitable labels include, but are not limited to, spectral labels such as fluorescent dyes ⁇ e.g., fluorescein and derivatives, such as fluorescein isothiocyanate (FITC) and Oregon GreenTM; rhodamine and derivatives such Texas red, tetrarhodimine isothiocynate (TRITC), etc., digoxigenin, biotin, phycoerythrin, AMCA, CyDyesTM, and the like; radiolabels such as 3 H, 125 1, 35 S, 14 C, 32 P, 33 P, etc.; enzymes such as horse radish peroxidase, alkaline phosphatase, etc; spectral colorimetric labels such as colloidal gold or colored glass or plastic beads such as polystyrene, polypropylene, latex, etc.
- the label can be detected using any means known in the art.
- Nucleic acids ⁇ e.g. , interfering RNA
- the detection of nucleic acids proceeds by well-known methods such as Southern analysis, Northern analysis, gel electrophoresis, PCR, radiolabeling, scintillation counting, and affinity chromatography. Additional analytic biochemical methods such as spectrophotometry, radiography, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), and hyperdiffusion chromatography may also be employed.
- HPLC high performance liquid chromatography
- TLC thin layer chromatography
- nucleic acid hybridization format The selection of a nucleic acid hybridization format is not critical. A variety of nucleic acid hybridization formats are known to those skilled in the art. For example, common formats include sandwich assays and competition or displacement assays. Hybridization techniques are generally described in, e.g., "Nucleic Acid Hybridization, A Practical Approach,” Eds. Hames and Higgins, IRL Press (1985).
- the sensitivity of the hybridization assays may be enhanced through use of a nucleic acid amplification system which multiplies the target nucleic acid being detected.
- a nucleic acid amplification system which multiplies the target nucleic acid being detected.
- In vitro amplification techniques suitable for amplifying sequences for use as molecular probes or for generating nucleic acid fragments for subsequent subcloning are known.
- RNA polymerase mediated techniques e.g., NASBATM
- PCR polymerase chain reaction
- LCR ligase chain reaction
- NASBATM RNA polymerase mediated techniques
- the select sequences can be generally amplified using, for example, nonspecific PCR primers and the amplified target region later probed for a specific sequence indicative of a mutation.
- Nucleic acids for use as probes are typically synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage et ah, Tetrahedron Letts., 22:1859 1862 (1981), e.g., using an automated synthesizer, as described in Needham VanDevanter et ah, Nucleic Acids Res., 12:6159 (1984).
- Purification of ploynucleotides, where necessary, is typically performed by either native acrylamide gel electrophoresis or by anion exchange HPLC as described in Pearson et ah, J.
- In situ hybridization assays are well-known and are generally described in Angerer et ah, Methods Enzymoh, 152:649 (1987).
- in situ hybridization assay cells are fixed to a solid support, typically a glass slide. IfDNA is to be probed, the cells are denatured with heat or alkali. The cells are then contacted with a hybridization solution at a moderate temperature to permit annealing of specific probes that are labeled.
- the probes are preferably labeled with radioisotopes or fluorescent reporters.
- the present invention provides methods for sensitizing a cell to the effects of a chemotherapy drug by administering a PLK-I interfering RNA ⁇ e.g., using a suitable carrier system) in combination with the chemotherapy drug.
- the methods can be carried out in vitro using standard tissue culture techniques or in vivo by administering the interfering RNA and chemotherapy drug as described herein or using any means known in the art.
- this combination of therapeutic agents is delivered to a cancer cell in a mammal such as a human.
- a patient about to begin chemotherapy is first pretreated with a suitable dose of one or more nucleic acid-lipid particles (e.g., SNALP) containing PLK-I interfering RNA (e.g., siRNA).
- the patient can be pretreated with a suitable dose of one or more nucleic acid-lipid particles at any reasonable time prior to chemotherapy drug administration.
- the dose of one or more nucleic acid-lipid particles can be administered about 96, 84, 72, 60, 48, 36, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 hours, or any interval thereof, before chemotherapy drug administration.
- a patient about to begin chemotherapy can be pretreated with more than one dose of nucleic acid-lipid particles (e.g., SNALP) containing PLK-I interfering RNA (e.g., siRNA) at different times before chemotherapy drug administration.
- nucleic acid-lipid particles e.g., SNALP
- PLK-I interfering RNA e.g., siRNA
- the methods of the present invention can further comprise administering a second dose of nucleic acid-lipid particles prior to chemotherapy drug administration, hi certain instances, the nucleic acid-lipid particles of the first dose are the same as the nucleic acid-lipid particles of the second dose. In certain other instances, the nucleic acid-lipid particles of the first dose are different from the nucleic acid-lipid particles of the second dose.
- the two pretreatment doses use the same nucleic acid-lipid particles, e.g., SNALP containing the same PLK-I interfering RNA sequence.
- the second dose of nucleic acid-lipid particles can occur at any reasonable time following the first dose.
- the second dose can be administered about 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 hours, or any interval thereof, before chemotherapy drug administration.
- the second dose of nucleic acid-lipid particles can be the same or a different dose, hi additional embodiments of the present invention, the patient can be pretreated with a third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more dose of the same or different nucleic acid-lipid particles prior to chemotherapy drug administration.
- a patient can also be treated with a suitable dose of one or more nucleic acid-lipid particles (e.g., SNALP) containing PLK-I interfering RNA (e.g., siRNA) at any reasonable time during chemotherapy drug administration.
- the methods of the present invention can further comprise administering a dose of nucleic acid-lipid particles during chemotherapy drug administration.
- a SNALP containing an unmodified and/or modified PLK-I siRNA sequence can be administered at the beginning of chemotherapy drug administration, while chemotherapy drug administration is in progress, and/or at the end of chemotherapy drug administration.
- nucleic acid-lipid particles can be the same or a different dose.
- a patient can be treated with a suitable dose of one or more nucleic acid- lipid particles (e.g., SNALP) containing PLK-I interfering RNA (e.g., siRNA) at any reasonable time following chemotherapy drug administration.
- the methods of the present invention can further comprise administering a dose of nucleic acid-lipid particles after chemotherapy drug administration.
- the dose of one or more nucleic acid-lipid particles can be administered about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 36, 48, 60, 72, 84, 96, 108, or more hours, or any interval thereof, after chemotherapy drug administration.
- the same nucleic acid-lipid particle is used before and after chemotherapy drug administration.
- a different nucleic acid-lipid particle is used following chemotherapy drug administration.
- One skilled in the art will appreciate that more than one dose of nucleic acid-lipid particles can be administered at different times following chemotherapy drug administration.
- nucleic acid-lipid particles can be the same or a different dose.
- Chemotherapy drugs can be administered with a suitable pharmaceutical excipient as necessary and can be carried out via any of the accepted modes of administration.
- administration can be, for example, oral, buccal, sublingual, gingival, palatal, intravenous, topical, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intravesical, intrathecal, intralesional, intranasal, rectal, vaginal, or by inhalation.
- a chemotherapy drug is administered at the same time, just prior to, or just after the administration of a second drug or therapeutic agent (e.g., a nucleic acid-lipid particle, another chemotherapy drug, a drug useful for reducing the side-effects associated with chemotherapy, a radiotherapeutic agent, a hormonal therapeutic agent, an immunotherapeutic agent, etc.).
- a second drug or therapeutic agent e.g., a nucleic acid-lipid particle, another chemotherapy drug, a drug useful for reducing the side-effects associated with chemotherapy, a radiotherapeutic agent, a hormonal therapeutic agent, an immunotherapeutic agent, etc.
- Non-limiting examples of chemotherapy drugs suitable for use in the present invention include platinum-based drugs (e.g., oxaliplatin, cisplatin, carboplatin, spiroplatin, iproplatin, satraplatin, etc.), alkylating agents (e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, etc.), anti-metabolites (e.g., 5-fluorouracil (5-FU), azathioprine, methotrexate, leucovorin, capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, pemetrexed, raltitrexed, etc.), plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllot), alky
- nucleic acid-lipid particles and/or chemotherapy drugs described herein can also be co-administered with conventional hormonal therapaeutic agents including, but not limited to, steroids (e.g., dexamethasone), finasteride, aromatase inhibitors, tamoxifen, and gonadotropin-releasing hormone agonists (GnRH) such as goserelin.
- steroids e.g., dexamethasone
- finasteride e.g., aromatase inhibitors
- tamoxifen e.g., tamoxifen
- gonadotropin-releasing hormone agonists GnRH
- nucleic acid-lipid particles and/or chemotherapy drugs described herein can be co-administered with conventional immunotherapeutic agents including, but not limited to, immunostimulants (e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alpha-interferon, etc.), monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti- CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody- pseudomonas exotoxin conjugate, etc.), and radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated to 111 In, 90 Y, or 131 I, etc.).
- immunostimulants e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alpha
- nucleic acid-lipid particles and/or chemotherapy drugs described herein can be co-administered with conventional radiotherapeutic agents including, but not limited to, radionuclides such as 47 Sc, 64 Cu, 67 Cu, 89 Sr, 86 Y, 87 Y, 90 Y, 105 Rh, 111 Ag, 111 In, 117m Sn, 149 Pm, 153 Sm, 166 Ho, 177 Lu, 186 Re, 188 Re, 211 At, and 212 Bi, optionally conjugated to antibodies directed against tumor antigens.
- radionuclides such as 47 Sc, 64 Cu, 67 Cu, 89 Sr, 86 Y, 87 Y, 90 Y, 105 Rh, 111 Ag, 111 In, 117m Sn, 149 Pm, 153 Sm, 166 Ho, 177 Lu, 186 Re, 188 Re, 211 At, and 212 Bi, optionally conjugated to antibodies directed against tumor antigens.
- a therapeutically effective amount of a chemotherapy drug may be administered repeatedly, e.g., at least 2, 3, 4, 5, 6, 7, 8, or more times, or the dose may be administered by continuous infusion.
- the dose may take the form of solid, semi-solid, lyophilized powder, or liquid dosage forms, such as, for example, tablets, pills, pellets, capsules, powders, solutions, suspensions, emulsions, suppositories, retention enemas, creams, ointments, lotions, gels, aerosols, foams, or the like, preferably in unit dosage forms suitable for simple administration of precise dosages.
- administered dosages of chemotherapy drugs will vary depending on a number of factors, including, but not limited to, the particular chemotherapy drug or set of chemotherapy drugs to be administered, the mode of administration, the type of application, the age of the patient, and the physical condition of the patient. Preferably, the smallest dose and concentration required to produce the desired result should be used. Dosage should be appropriately adjusted for children, the elderly, debilitated patients, and patients with cardiac and/or liver disease. Further guidance can be obtained from studies known in the art using experimental animal models for evaluating dosage.
- unit dosage form refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of a chemotherapy drug calculated to produce the desired onset, tolerability, and/or therapeutic effects, in association with a suitable pharmaceutical excipient (e.g., an ampoule).
- a suitable pharmaceutical excipient e.g., an ampoule
- more concentrated dosage forms may be prepared, from which the more dilute unit dosage forms may then be produced.
- the more concentrated dosage forms thus will contain substantially more than, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times the amount of the chemotherapy drug.
- the dosage forms typically include a conventional pharmaceutical carrier or excipient and may additionally include other medicinal agents, carriers, adjuvants, diluents, tissue permeation enhancers, solubilizers, and the like.
- Appropriate excipients can be tailored to the particular dosage form and route of administration by methods well known in the art (see, e.g., REMINGTON'S PHARMACEUTICAL SCIENCES, supra).
- excipients include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, and polyacrylic acids such as Carbopols, e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc.
- Carbopols e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc.
- the dosage forms can additionally include lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying agents; suspending agents; preserving agents such as methyl-, ethyl-, and propyl-hydroxy-benzoates (i.e., the parabens); pH adjusting agents such as inorganic and organic acids and bases; sweetening agents; and flavoring agents.
- lubricating agents such as talc, magnesium stearate, and mineral oil
- wetting agents such as talc, magnesium stearate, and mineral oil
- emulsifying agents such as methyl-, ethyl-, and propyl-hydroxy-benzoates (i.e., the parabens)
- pH adjusting agents such as inorganic and organic acids and bases
- sweetening agents and flavoring agents.
- the dosage forms may also comprise biodegradable polymer beads, dextran, and cyclodextrin inclusion complexes.
- the therapeutically effective dose can be in the form of tablets, capsules, emulsions, suspensions, solutions, syrups, sprays, lozenges, powders, and sustained-release formulations.
- Suitable excipients for oral administration include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, gelatin, sucrose, magnesium carbonate, and the like.
- the therapeutically effective dose takes the form of a pill, tablet, or capsule, and thus, the dosage form can contain, along with a chemotherapy drug, any of the following: a diluent such as lactose, sucrose, dicalcium phosphate, and the like; a disintegrant such as starch or derivatives thereof; a lubricant such as magnesium stearate and the like; and a binder such a starch, gum acacia, polyvinylpyrrolidone, gelatin, cellulose and derivatives thereof.
- a chemotherapy drug can also be formulated into a suppository disposed, for example, in a polyethylene glycol (PEG) carrier.
- PEG polyethylene glycol
- Liquid dosage forms can be prepared by dissolving or dispersing a chemotherapy drug and optionally one or more pharmaceutically acceptable adjuvants in a carrier such as, for example, aqueous saline (e.g., 0.9% w/v sodium chloride), aqueous dextrose, glycerol, ethanol, and the like, to form a solution or suspension, e.g., for oral, topical, or intravenous administration.
- a chemotherapy drug can also be formulated into a retention enema.
- the therapeutically effective dose can be in the form of emulsions, lotions, gels, foams, creams, jellies, solutions, suspensions, ointments, and transdermal patches.
- a chemotherapy drug can be delivered as a dry powder or in liquid form via a nebulizer.
- the therapeutically effective dose can be in the form of sterile injectable solutions and sterile packaged powders.
- injectable solutions are formulated at a pH of from about 4.5 to about 7.5.
- the therapeutically effective dose can also be provided in a lyophilized form.
- dosage forms may include a buffer, e.g., bicarbonate, for reconstitution prior to administration, or the buffer may be included in the lyophilized dosage form for reconstitution with, e.g., water.
- the lyophilized dosage form may further comprise a suitable vasoconstrictor, e.g., epinephrine.
- the lyophilized dosage form can be provided in a syringe, optionally packaged in combination with the buffer for reconstitution, such that the reconstituted dosage form can be immediately administered to a subject.
- siRNA All siRNA molecules used in these studies were chemically synthesized by the University of Calgary (Calgary, AB), Dharmacon Inc. (Lafayette, CO), or Integrated DNA Technologies (Coralville, IA). The siRNAs were desalted and annealed using standard procedures.
- siRNA molecules were encapsulated into nucleic acid-lipid particles composed of the following lipids: synthetic cholesterol (Sigma- Aldrich Corp.; St. Louis, MO); the phospholipid DSPC (1 ,2-distearoyl- sn-glycero-3-phosphocholine; Avanti Polar Lipids; Alabaster, AL); the PEG-lipid PEG- cDMA (3-N-[(-Methoxy poly(ethylene glycol)2000)carbamoyl]-l,2-dimyrestyloxy- propylamine); and the cationic lipid DLinDMA (l,2-Dilinoleyloxy-3 -(N 5 N- dimethyl)aminopropane) in the molar ratio 48:10:2:40, respectively.
- siRNAs were encapsulated into liposomes of the following "2:40"
- siRNA molecules were encapsulated into nucleic acid-lipid particles composed of the following lipids: the lipid conjugate PEG-cDMA; the cationic lipid DLinDMA; the phospholipid DPPC (l,2-dipalmitoyl-sn-glycero-3-phosphocholine; Avanti Polar Lipids; Alabaster, AL); and synthetic cholesterol in the molar ratio 1.4:57.1 :7.1 :34.3, respectively.
- siRNAs were encapsulated into SNALPs of the following "1:57” formulation: 1.4% PEG-cDMA; 57.1% DLinDMA; 7.1% DPPC; and 34.3% cholesterol.
- siRNA molecules were encapsulated into phospholipid- free SNALPs composed of the following lipids: the lipid conjugate PEG-cDMA; the cationic lipid DLinDMA; and synthetic cholesterol in the molar ratio 1.5:61.5:36.9, respectively.
- siRNAs were encapsulated into phospholipid-free SNALPs of the following "1:62" formulation: 1.5% PEG-cDMA; 61.5% DLinDMA; and 36.9% cholesterol.
- the 1 : 57 formulation and 1 :62 formulation are target formulations, and that the amount of lipid (both cationic and non-cationic) present and the amount of lipid conjugate present in the formulation may vary.
- the amount of cationic lipid will be 57 mol % ⁇ 5 mol %, and the amount of lipid conjugate will be 1.5 mol % ⁇ 0.5 mol %, with the balance of the 1 :57 formulation being made up of non-cationic lipid (e.g., phospholipid, cholesterol, or a mixture of the two).
- the amount of cationic lipid will be 62 mol % ⁇ 5 mol %, and the amount of lipid conjugate will be 1.5 mol % ⁇ 0.5 mol %, with the balance of the 1 :62 formulation being made up of the non-cationic lipid (e.g., cholesterol).
- Cell Viability Assay Cell viability of in vitro cell cultures was assessed using the commercial reagent CellTiter-Blue ® (Promega Corp.; Madison, WI), a resazurin dye that is reduced by metabolically active cells to the flourogenic product resorufin.
- Various cancer cell lines were cultured in vitro using standard tissue culture techniques. 48-72 hours after treatment with siRNA formulations and/or chemotherapy drugs, the CellTiter-Blue ® reagent was added to the culture to quantify the metabolic activity of the cells, which is a measure of cell viability.
- Target mRNA Quantitation The QuantiGene ® branched DNA assay (Panomics, Inc.; Fremont, CA) was used to quantify the reduction of target mRNA in cell cultures treated with SNALP. Cell lysates were prepared according to the manufacturer's instructions and used directly for PLKl mRNA quantification. Relative PLK-I mRNA levels are expressed relative to the vehicle (PBS) treated control cells. Specific probe sets used for detection of mRNA were designed to target human PLK-I mRNA (Genbank Accession No. NM_005030). These probe sets are cross reactive with mouse PLK-I .
- Apoptosis/Caspase 3/7 Assay The level of Caspase 3 and 7 enzyme activity in siRNA treated cells was assessed using the commercial reagent Apo-ONE ® (Promega Corp., Madison, WI). This assay is based on the specific enzymatic cleavage of the Caspase 3/7 substrate (Z-DEVD)2-Rhodamine 110 to a flourogenic product and is used to quantify the level of apoptosis in cultured cells. The relative level of Caspase 3/7 activity was assessed in a number of cancer cell lines at 24-48 hours after treatment with siRNA formulations and/or chemotherapy drugs.
- Flt3-ligand derived murine dendritic cells (Flt3L DC) were generated as described by Gilliet et al. (J. Exp. Med., 195:953-958) using lOOng/ml murine Flt3-ligand (PeproTech Inc.; Rocky Hill, NJ) supplemented media. Femurs and tibiae of female Balb/C mice were isolated and rinsed in sterile PBS.
- Bone marrow cells were passed through a 70 ⁇ m strainer, centrifuged at 1000 rpm for 7minutes, and resuspended in complete media supplemented with 100ng/ml murine Flt3L to 2x10 6 cells/ml. 2mls of cells were seeded in 6-well plates and ImI fresh complete media added every two or three days.
- Candidate PLK-I siRNA sequences were identified by imputing the human PLK-I mRNA sequence (Genbank Accession No. NM 005030) or the mouse PLK-I mRNA sequence (Genbank Accession No. NM Ol 1121) into the Whitehead Institute for Biomedical Research siRNA design algorithm ⁇ see, e.g., Elbashir et al, Genes Dev., 15:188-200 (2001); Schwarz et al, Cell, 115:199-208 (2003); and Khvorova et al Cell, 115: 209-216 (2003); available at http://jura.wi.mit.edu/bioc/siRNAext/home.php).
- siRNA fulfilling the following criteria were selected: (1) NN(Nl 9)NN target sequences; (2) thermodynamically less stable 5' antisense end (Difference ⁇ -2.0); (3) G/C content between 30-70%; and (4) no four nucleotide stretches of the same base. Selected sequences were verified and the positions within both human and mouse target sequences were identified.
- the sense and/or antisense strand comprises modified nucleotides such as 2'-O-methyl (2'0Me) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- 2'-O-methyl (2'0Me) nucleotides 2'-deoxy-2'-fluoro (2'F) nucleotides
- T- deoxy nucleotides 2'-O-(2-methoxyethyl) (MOE) nucleotides
- LNA locked nucleic acid
- the sense and/or antisense strand contains "dTdT” or "UU” 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof.
- the PLKl 424 sense strand (SEQ ID NO:1) may contain a "UU” 3' overhang and the PLK1424 antisense strand (SEQ ID NO:2) may contain a "UC" 3' overhang.
- the PLK773 sense strand may contain a "GA" 3' overhang and the PLK773 antisense strand (SEQ ID NO:4) may contain a "CU" 3' overhang.
- the 3' overhang on the sense strand, antisense strand, or both strands may comprise one, two, three, four, or more modified nucleotides such as those described above.
- the sense and/or antisense strand comprises modified nucleotides such as 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2T) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- modified nucleotides such as 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2T) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- the sense and/or antisense strand contains "dTdT” or "UU” 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof. In further embodiments, the 3' overhangs may comprise modified nucleotides such as those described above.
- Various PLK-I siRNAs were formulated as SNALP ("2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) and evaluated for their inhibitory effects on cell growth in vitro.
- SNALP human colon adenocarcinoma
- Neuro2A mouse neuroblastoma
- HT29 human colon adenocarcinoma
- Neuro2A mouse neuroblastoma
- Viability of cell cultures is expressed as % viability relative to PBS treated controls.
- Figure IA shows that SNALP containing PLKl 424 were highly potent at killing human tumor cells.
- siRNA sequence is specific to human PLK-I, as shown by its inactivity in the mouse cell line ( Figure IB).
- SNALP containing either PLKl 081 or PLKl 345 also inhibited the growth of human tumor cells, but at higher siRNA concentrations ( Figure IA).
- PLKl 345 which was designed to be conserved between murine and human PLK-I, was effective at inhibiting the growth of mouse Neuro2A cells at higher siRNA concentrations ( Figure IB).
- siRNA targeting Luciferase (Luc) was used as a control SNALP.
- PLK-I SNALP (“2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) were tested for their ability to silence PLK-I mRNA in HT29 cells.
- Cells were plated in duplicates at relatively high concentrations (-10,000 cells/well). QuantiGene analysis was performed at 24 hours following transfection to detect the level of mRNA down-regulation. A visual score of the transfected cells was obtained at 48 hours following transfection. Cell viability analysis was performed at 72 hours following transfection.
- Figure 2 A shows the relative silencing of PLK-I mRNA by PLKl 424 and PLKl 081 at 24 hours versus a non-targeting (GFP) siRNA control.
- GFP non-targeting
- FIG. 2B shows the subsequent effects of these siRNA on cell viability at 72 hours. The results confirm that the potent effects of PLK-I SNALP on cell viability is due to the silencing of PLK-I mRNA.
- Example 5 Additional siRNAs Targeting PLK-I Inhibit the Growth of Cancer Cells.
- Additional PLK-I siRNA molecules were formulated as SNALP ("2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) and evaluated for their inhibitory effects on cell growth in vitro.
- HT29 or Neuro2A cells were plated in triplicate at 5000 cells/well and 2500 cells/well, respectively.
- PLK-I SNALP dosages were as follows: 25nM; 5nM; and InM. Cell viability analysis was performed at 72 hours following transfection. SNALP containing a non-targeting (GFP) siRNA were used as a negative control.
- Figure 3 A shows that PLK694, PLK773, PLK832, PLKl 195, PLKl 229, PLK1233, PLK1424, and PLK1556 were effective at killing human tumor cells, with PLKl 424 demonstrating the most potent effects.
- Figure 3B shows that mPLK1424 and mP LKl 425 were the most active mouse-specific siRNA sequences. PLK773 and PLKl 229 were the most potent human/mouse cross-reactive siRNA molecules.
- SNALP containing PLKl 424 or PLK773 siRNA (“2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) were tested for their effects on cell viability and silencing of PLK-I mRNA in HT29 and LS174T human colon cancer cells.
- Cells were plated in triplicate at -10,000 cells/well.
- SNALP dosages were as follows: 3OnM; 1OnM; 3.3nM; l.lnM; 0.37nM; and 0.12nM.
- Branched DNA mRNA assays were performed 24 hours following transfection. Cell viability assays were performed at 72 hours following transfection.
- FIG. 4 shows that PLKl 424 and PLK773 SNALP were effective at reducing PLK-I mRNA levels and inhibiting cell growth in both HT29 and LS174T cells. The effects on cell viability correlated with silencing of the target PLK-I mRNA.
- SNALP containing PLK1424 or PLK773 siRNA (“2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) were further tested for their effects on inducing the apoptosis of LS174T cells.
- Cells were plated in triplicate at -10,000 cells/well.
- SNALP dosages were as follows: 3OnM; 1OnM; and 3.3nM. Caspase 3/7 assays were performed at 24, 48, and 72 hours following transfection.
- SNALP containing a non- targeting (GFP) siRNA were used as a negative control.
- FIG. 5 shows that PLKl 424 and PLK773 SNALP induced a significant amount of apoptosis in LS174T cells at all SNALP doses tested.
- Additional PLK-I siRNA molecules were formulated as SNALP ("2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) and evaluated for their inhibitory effects on cell growth in vitro.
- HT29 or Neuro2A cells were plated in triplicate at 5000 cells/well and 2500 cells/well, respectively.
- PLK-I SNALP dosages were as follows: 3OnM; 1OnM; and 3.3nM.
- FIG. 6A shows that PLK772, PLK1232, PLK1242, and PLK1424 were effective at killing human tumor cells, with PLK1424 demonstrating the most potent effects.
- Figure 6B shows that mPLKl 607, mPLKl 608, and mPLKl 668 were the most active mouse-specific PLK-I siRNA sequences.
- PLKl 232 was the most potent human/mouse cross-reactive siRNA molecule.
- PLK-I siRNA molecules containing 2'-O-methyl (2'OMe) nucleotides at selective positions within the double-stranded region of the siRNA duplex were formulated as SNALP ("2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) and evaluated for their inhibitory effects on cell growth in vitro.
- SNALP 2:40 SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol
- the modified PLK-I siRNA sequences are shown in Table 3.
- HT29 cells were plated in triplicate at 5000 cells/well. Cell viability analysis was performed at 72 hours following transfection with a range of PLK-I SNALP dosages.
- SNALP containing a non-targeting (GFP) siRNA were used as a negative control.
- siRNA duplexes comprising sense and antisense PLK-I RNA polynucleotides.
- the siRNA can alternatively or additionally comprise 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- N deoxythymidine (dT) nucleotide, modified or unmodified uridine (U) ribonucleotide, or modified or unmodified ribonucleotide having complementarity to the target sequence or the complementary strand thereof.
- FIG. 8 shows that modified PLK1424 siRNAs induced no detectable cytokine (i.e., IL-6 or IFN- ⁇ ) response in this cell culture system.
- Figure 9 shows that different chemical modification patterns in the PLK773 siRNA sequence were well tolerated and the modified siRNA molecules retained potent activity. The most active modified siRNA molecule, PLK773 G/GU, was more potent than the unmodified PLKl 424 sequence in killing human tumor cells. PLK773 G/U and PLK773 U/GU showed similar activity to that of the unmodified PLK773 sequence.
- FIG. 10 shows that different chemical modification patterns in the PLKl 425 siRNA sequence were well tolerated and the modified siRNA molecules retained potent activity.
- This example illustrates that minimal 2'OMe modifications at selective positions in the PLK-I siRNA duplex are sufficient to decrease the immunostimulatory properties of PLK-I siRNAs while retaining RNAi activity.
- SNALP containing PLK1424 U4/GU or PLK773 G/GU siRNA (“2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48% cholesterol) were evaluated to determine whether sequential dosing of the SNALP before chemotherapy drug treatment produces synergistic effects in vitro in human and mouse cell lines.
- HepG2 (human hepatocellular liver carcinoma) and Neuro2A cells were plated in triplicate at 10,000 cells/well and 5000 cells/well, respectively.
- SNALP containing the modified PLK-I siRNA molecules were added to the cells 24 hours after plating at a range of dosages.
- paclitaxel (taxol) doses ranged from between 0.3 InM- 1OnM for human cells and 6.25nM-200nM for mouse cells.
- Cell viability analysis or an apoptosis assay was performed at 48 or 24 hours following chemotherapy drug treatment, respectively.
- SNALP containing a non-targeting (Luc) siRNA were used as a negative control.
- Figure 11 shows that the sequential administration of PLK-I SNALP followed by paclitaxel significantly enhanced the killing of both Neuro2A and HepG2 cells.
- suboptimal doses of PLK-I SNALP and paclitaxel were more effective than either agent alone. Similar synergistic effects were observed for sequential combination therapy with PLK-I SNALP followed by fluorouracil (5-FU) or irinotecan at higher SNALP doses.
- Figure 12 shows that the sequential combination dosing of PLK-I SNALP followed by paclitaxel significantly enhanced the level of apoptosis induction at both SNALP concentrations. The increased apoptosis correlated with the enhanced effects of this drug combination on cell viability.
- This example illustrates that pretreatment with SNALP containing PLK-I siRNA sensitizes cancer cells to the toxic effects of chemotherapy drugs such as paclitaxel, 5-FU, and irinotecan.
- chemotherapy drugs such as paclitaxel, 5-FU, and irinotecan.
- This example further illustrates that the sequential administration of PLK-I SNALP followed by chemotherapy drugs induces significant levels of apoptosis in cancer cells, correlating with the decreases in cell viability observed with this combination of dosing.
- Example 11 Selection of Additional Candidate Human PLK-I siRNA Molecules.
- Additional human PLK-I siRNA sequences were designed. Candidate PLK-I siRNA sequences were identified by imputing the human PLK-I mRNA sequence (Genbank Accession No. NM 005030) into the Whitehead Institute for Biomedical Research siRNA design algorithm (see, e.g., Elbashir et al, Genes Dev., 15:188-200 (2001); Schwarz et al, Cell, 115:199-208 (2003); and Khvorova et al Cell, 115:209-216 (2003); available at http://jura.wi.mit.edu/bioc/siRNAext/home.php).
- siRNA fulfilling the following criteria were selected (Table 4): (1) NA(N19)NN target sequences; (2) thermodynamically less stable 5' antisense end (Difference ⁇ -2.0); (3) G/C content between 30-70%; and (4) no four nucleotide stretches of the same base.
- a second set of siRNA (Table 5) were selected on the following criteria: (1) NN(N19)NN target sequences; (2) thermodynamically less stable 5' antisense end (Difference ⁇ -2.0); (3) Thermodynamics of 5' antisense end > -6 (-6 to 0); (4) G/C content between 30-70%; and (5) no four nucleotide stretches of the same base. Selected sequences were verified and the positions within the human PLK-I target sequence were identified.
- the sense and/or antisense strand comprises modified nucleotides such as 2'-O-methyl (2'0Me) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- 2'-O-methyl (2'0Me) nucleotides 2'-deoxy-2'-fluoro (2'F) nucleotides
- T- deoxy nucleotides 2'-O-(2-methoxyethyl) (MOE) nucleotides
- LNA locked nucleic acid
- the sense and/or antisense strand contains "dTdT” or "UU” 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof. In further embodiments, the 3' overhangs may comprise modified nucleotides such as those described above.
- the sense and/or antisense strand comprises modified nucleotides such as 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- modified nucleotides such as 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- the sense and/or antisense strand contains "dTdT” or "UU” 3' overhangs. In other instances, the sense and/or antisense strand contains 3' overhangs that have complementarity to the target sequence or the complementary strand thereof, hi further embodiments, the 3' overhangs may comprise modified nucleotides such as those described above.
- SNALP containing PLK-I siRNA (“1 :57” SNALP formulation: 1.4% PEG-cDMA; 57.1% DLinDMA; 7.1% DPPC; and 34.3% cholesterol) were tested for their effects on the survival of CDl nu/nu mice bearing Hep3B liver tumors.
- mice will receive Anafen by SC injection (100 ⁇ g in 20 ⁇ l saline) immediately prior to surgery. Individual mice are anesthetized by isoflourane gas inhalation and eye lube applied to prevent excessive eye drying. While maintained under gas anesthesia from a nose cone, a single 1.5 cm incision across the midline will be made below the sternum. The left lateral hepatic lobe is then exteriorized using an autoclaved cotton wool bud. 25 ⁇ l of tumor cells suspended in PBS is injected into the lobe at a shallow angle using a leur tip Hamilton syringe (50 ⁇ l) and 3OG (3/8") needle.
- Cells will be injected slowly ( ⁇ 30 s) and a swab applied to the puncture wound immediately after needle withdrawal. After any bleeding has stopped ( ⁇ 1 min), the incision is closed with 5-6 sutures in the muscle wall and 3-4 skin clips. Cell suspensions will be thoroughly mixed immediately prior to each injection. Mice will recover from anesthesia in a clean cage lined with paper towel and monitored closely for 2-4 hours. Animals are then returned to normal housing. Day 1 All mice will be lightly anesthetized by isoflourane gas and the sutures examined. Animals will then receive Anafen by SC injection (100 ⁇ g in 20 ⁇ l saline).
- Body weights Groups Mice will be weighed on the day of dosing for 5 weeks, then twice weekly until close of the study.
- Endpoint Tumor burden and formulations are expected to be well tolerated. Mice that exhibit signs of distress associated with the treatment or tumor burden are terminated at the discretion of the vivarium staff. Termination: Mice are anesthetized with a lethal dose of ketamine/xylazine followed by cervical dislocation.
- Figure 13 shows the mean body weights of mice during therapeutic dosing of
- FIG. 14 shows that treatment with SNALP-formulated PLKl 424 caused a significant increase in the survival of Hep3B tumor-bearing mice. This in vivo anti-tumor effect was observed in the absence of any apparent toxicity or immune stimulation.
- Test Articles All samples were filter-sterilized prior to dilution to working concentration. All tubes were labeled with the formulation date, lipid composition, and nucleic acid concentration. SNALP samples were provided at 0.2 mg/ml nucleic acid. A minimum of 2 ml of SNALP was required to perform the study. Formulations for this study contained:
- mice will receive Anafen by SC injection (100 ⁇ g in 20 ⁇ l saline) immediately prior to surgery. Individual mice are anesthetized by isoflourane gas inhalation and eye lube applied to prevent excessive eye drying. While maintained under gas anesthesia from a nose cone, a single 1.5 cm incision across the midline will be made below the sternum. The left lateral hepatic lobe is then exteriorized using an autoclaved cotton wool bud. 25 ⁇ l of tumor cells suspended in PBS is injected into the lobe at a shallow angle using a leur tip Hamilton syringe (50 ⁇ l) and 30G (3/8") needle.
- Cells will be injected slowly ( ⁇ 30 s) and a swab applied to the puncture wound immediately after needle withdrawal. After any bleeding has stopped ( ⁇ 1 min), the muscle wall incision is closed with 5-6 sutures. The skin incision is then closed with 3-4 metal skin clips. Cell suspensions will be thoroughly mixed immediately prior to each injection. Mice will recover from anesthesia in a clean cage lined with paper towel and monitored closely for 2-4 hours. Animals are then returned to normal housing.
- mice will be lightly anesthetized by isoflourane gas and the sutures examined. Animals will then receive Anafen by SC injection (100 ⁇ g in 20 ⁇ l saline).
- mice will be randomized into the appropriate treatment groups.
- Day 20 Groups A-C Mice will be weighed and then administered either
- PBS, Luc, or PLKl 424 SNALP by IV injection via the lateral tail vein.
- SNALP will be dosed at 2 mg/kg or equivalent volume (10 ml/kg) according to body weight.
- Day 21 Groups A-C All mice will be weighed and then euthanized by lethal anesthesia.
- RNALater Tumor bearing liver lobes from all mice in each group will be weighed and collected into RNALater for RNA analysis.
- Tumor burden and formulations are expected to be well tolerated. Mice that exhibit signs of distress associated with the treatment or tumor burden are terminated at the discretion of the vivarium staff.
- mice are anaesthetized with a lethal dose of ketamine/xylazine followed by cervical dislocation.
- FIG. 16 shows that a specific cleavage product of PLK-I mRNA was detectable in mice treated with PLK1424 SNALP by 5' RACE-PCR. No specific PCR product was detectable in mice treated with either PBS or control (Luc) SNALP. Nucleotide sequencing of the PCR product confirmed the predicted cleavage site by PLKl 424 siRNA-mediated RNA interference in the PLK-I mRNA.
- Figure 17 shows Hep3B tumor histology in mice treated with either Luc SNALP (top) or PLK1424 SNALP (bottom).
- Luc SNALP-treated mice displayed normal mitoses in Hep3B tumors, whereas PLKl 424 SNALP-treated mice exhibited numerous aberrant mitoses and tumor cell apoptosis in Hep3B tumors.
- This example illustrates that a single administration of PLKl 424 SNALP to Hep3B tumor-bearing mice induced significant in vivo silencing of PLK-I mRNA.
- This reduction in PLK-I mRNA was confirmed to be mediated by RNA interference using 5' RACE-PCR analysis.
- PLK-I mRNA silencing by SNALP-formulated PLKl 424 profoundly disrupted tumor cell proliferation (mitosis), causing subsequent apoptosis of tumor cells. As demonstrated in the previous example, this anti-tumor effect translated into extended survival times in the tumor-bearing mice.
- Example 14 Comparison of PLK-I SNALP containing either PEG-cDMA or PEG- cDSA in a subcutaneous Hep3B tumor model.
- This example demonstrates the utility of the PEG-lipid PEG-cDSA (3-N-[(- Methoxypoly(ethylene glycol)2000)carbamoyl]-l,2-distearyloxypropylamine) in the 1:57 formulation for systemically targeting distal (e.g., subcutaneous) tumors.
- this example compares the tumor targeting ability of PLK-I SNALPs containing either PEG- cDMA (C 14 ) or PEG-cDSA (C 18 ). Readouts are tumor growth inhibition and PLKl mRNA silencing.
- the PLK-I siRNA used was PLK1424 U4/GU, the sequence of which is provided in Table 3.
- Administration of 6 x 2mg/kg siRNA was initiated once tumors reached about 5 mm in diameter (Day 10). Dosing was performed on Days 10, 12, 14, 17, 19, and 21. Tumors were measured by caliper twice weekly.
- Figure 18 shows that multiple doses of PLK- 1 SNALP containing PEG-cDSA induced the regression of established Hep3B S. C. tumors. In particular, 5/5 tumors in the PLKl -cDS A treated mice appeared flat, measurable only by discoloration at the tumor site.
- Figure 19 shows the mRNA silencing of PLK SNALP in S.C. Hep3B tumors following a single intravenous SNALP administration. The extent of silencing observed with the PLKl -cDS A SNALP correlated with the anti-tumor activity in the multi-dose study shown in Figure 18.
- the Luc-cDMA SNALP-treated group which had developed large S.C.
- Figure 21 shows that PLK-cDMA SNALP and PLK-cDSA SNALP had similar silencing activities after 24 hours, but that the PLK-cDSA SNALP may increase the duration of mRNA silencing in intrahepatic tumors.
- Figure 22 shows the blood clearance profile of PLK-I SNALP containing either PEG-cDMA or PEG-cDSA.
- the extended blood circulation times observed for the PLK- cDSA SNALP may enable the increased accumulation and activity at distal (e.g., subcutaneous) tumor sites.
- Example 15 Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics.
- siRNA Short interfering RNAs
- PLK-I Polo-like kinasel
- KSP kinesin spindle protein
- SNALP lipid nanoparticles
- siRNA mechanism of action was confirmed by: (1) the use of appropriately designed siRNA formulations that induced no measureable immune response, therefore excluding the potential for non-specific efficacy; (2) induction of RNAi-specific mRNA cleavage products in tumor cells; (3) correlation of this active RNAi signature with the duration of target mRNA silencing; and (4) confirmation of functional target inhibition by histologic biomarkers.
- This example provides results which represent a significant advance in the development of siRNA-based cancer therapeutics, and serves to highlight the technical requirements needed to support a conclusion that RNAi is the primary mechanism of siRNA-mediated therapeutic effects.
- Short interfering RNA are target-specific double-stranded RNA molecules designed to suppress gene expression through the endogenous cellular process of RNA interference (RNAi) (1). Since the characterization of this fundamental gene silencing mechanism, tremendous progress has been made in developing siRNA as a potentially novel class of therapeutic agent for a broad spectrum of diseases including cancer, viral infection, and metabolic disorders.
- siRNA targets in oncology have been described in the literature, although direct evidence that their therapeutic effects in tumor models are mediated by RNAi is notably lacking.
- the interpretation of anti-tumor activity attributable to siRNA is problematic due to the potential for off-target effects of the nucleic acids, including their propensity to activate immune responses through TLR-dependent (2-4) and independent mechanisms (5, 6). These types of response are known to elicit anti-tumor effects, primarily through the actions of interferons and inflammatory cytokines that exert anti-angiogenic, pro- apoptotic, and adjuvant effects that enhance cellular immunity (7, 8).
- KSP kinesin spindle protein
- PLK-I Polo-like kinase 1
- PLK-I acts to phosphorylate a number of cell cycle proteins, including Cdc25C, cyclin B, cohesin subunit SCC-I, subunits of the anaphase promoting complex, mammalian kinesin-like protein 1, and other kinesin-related proteins.
- This diverse array of substrates reflects the multiple roles of PLK-I in mitosis and cytokinesis (22).
- Over- expression of PLK-I observed in many human tumor types, is a negative prognosticator of patient outcome (20), while inhibition of PLK-I activity rapidly induces mitotic arrest and tumor cell apoptosis (23, 24). Depletion of PLK-I may also sensitize cancer cells to the pro- apoptotic activity of small molecule drugs (25), likely due to the role of PLK-I in the DNA damage and spindle assembly checkpoints.
- siRNA therapeutics One of the primary barriers to realizing the potential of siRNA therapeutics is the requirement for drug delivery vehicles to facilitate disease site targeting, cellular uptake, and cytoplasmic delivery of the siRNA (26-28).
- Common approaches to delivery include complexing the siRNA with polycations such as polyethyleneimine (29, 30) and cyclodextrin polymers (31) or incorporation into cationic lipid-based carriers (17, 18, 26, 32).
- polycations such as polyethyleneimine (29, 30) and cyclodextrin polymers (31) or incorporation into cationic lipid-based carriers (17, 18, 26, 32).
- SNALP stable nucleic acid-lipid particles
- SNALP small nucleic acid
- charge neutral carriers of suitable size (around 100 nm diameter or smaller) can pass through the fenestrated epithelium of tumors, sites of inflammation, and the healthy liver.
- active targeting moieties such as peptides, antibodies, and receptor ligands that may otherwise be candidates for incorporation into siRNA delivery vehicles to enhance target cell selectivity (31, 35, 36).
- This example describes the development of SNALP formulated siRNA as novel cancer therapeutics.
- Results demonstrate that rationally designed siRNA targeting PLK-I or KSP, when delivered with an effective systemic delivery vehicle, are able to affect therapeutic gene silencing in solid tumors.
- the specificity and mechanism of action is confirmed using a combination of methodologies that demonstrate RNAi-mediated silencing of target mRNA causing mitotic disruption in tumor cells typical of target inhibition. This can be achieved in the complete absence of immune stimulation through the use of appropriately designed, chemically modified siRNA.
- PLK-I represents a validated gene target in oncology whose inhibition is known to cause mitotic arrest and apoptosis in proliferating tumor cell cultures (20).
- This screen identified PLK1424 as the most potent human siRNA and PLK773 as the most potent mouse, rat, and human cross-reactive siRNA based on PLK-I sequence homology.
- These lead siRNA were formulated into a SNALP composition that has been shown to effectively target siRNA to the liver of rodents and non-human primates (26).
- PLKl 424 siRNA displayed potent activity in a range of human cancer cell lines, including LS174T colon carcinoma and HepG2 and He3B hepatocellular carcinoma (HCC) cell lines ( Figure 24D), that was associated with the dose- dependent induction of apoptosis 48 h after siRNA transfection ( Figure 24E).
- siRNA sequences incorporating a 2'OMe-modified sense strand may retain low-grade immunostimulatory activity. This was only evidenced by the induction of IFN-inducible p56 IFITl mRNA in the liver and spleen following intravenous administration of SNALP-formulated U(S)-ApoBl siRNA in mice, despite there being no measurable serum cytokine response (Figure 25).
- 2'0Me-PLKl 424 duplexes containing the modified AS strands A or B showed similar antiproliferative activity to the native PLKl 424 sequence when paired with either of the modified sense strands 1 or 2.
- 2'OMe-PLKl 424 containing AS strand C displayed anti-proliferative activity at higher concentrations (Figure 26A).
- the panel of 2'0Me-PLK773 duplexes displayed modest differences in activity compared to the native PLK773 sequence ( Figure 26B).
- PLK1424-2/A and PLK773-1/B siRNA duplexes comprising the designated 2'OMe-modified sense/AS strands
- the sense (S) or antisense (AS) strand can alternatively or additionally comprise 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- S sense
- AS antisense
- LNA locked nucleic acid
- KSP2263 has full sequence homology to mouse and human KSP mRNA and showed potent anti-proliferative effects in both human and mouse cancer cell lines.
- treatment of mouse Neuro2a cells with SNALP-formulated KSP2263 induced dose-dependent reductions in KSP mRNA 24 h after transfection, correlating with a subsequent loss of cell viability at 72 h ( Figure 26D).
- RNAi mechanism Confirmation of the RNAi mechanism by 5 ' RACE-PCR
- the detection of specific RNA cleavage products generated by RISC-mediated hydrolysis of target mRNA is the definitive marker confirming RNAi as the mechanism of gene silencing (39, 40).
- Activated RISC cleaves target mRNA precisely between the nucleotides complementary to positions 10 and 11 of the siRNA AS strand generating an mRNA cleavage product that is unique to the siRNA sequence. This can be detected in cells using an appropriately designed 5'- rapid amplification of cDNA ends-PCR method (RACE- PCR).
- siRNA design and screening approach can be applied to any given sequence to rapidly identify siRNA in which the chemical modifications are well tolerated with respect to RNAi activity and predicted to fully abrogate immune stimulation.
- enhancing nuclease resistance was not a primary design consideration since SNALP, the intended delivery vehicle for in vivo studies, is known to protect unmodified siRNA from nuclease degradation for greater than 24 h in serum (18).
- the 2'0Me modification pattern can take into account the avoidance of: (1) position 9 in the sense strand based on the observation that efficient activation of RISC involves initial cleavage of the siRNA sense strand between positions 9-10 and this can be inhibited by the introduction of nuclease resistant chemistries at this linkage (41, 42); and (2) the 5' antisense terminus where modified chemistries may interfere with effective RNA loading into RISC (43, 44).
- Orthotopic liver tumor models were established to examine the pharmacodynamics and therapeutic efficacy of SNALP-formulated PLK1424-2/A and KSP2263-U/U siRNA. These were a Hep3B xenograft in scid/beige mice as a representative model of human HCC and a syngeneic Neuro2a tumor model in immune competent A/J mice. Tumor cells were injected directly into the left lateral liver lobe to establish primary intrahepatic tumors (45). This procedure resulted in histologically distinct, localized tumor nodules in greater than 90% of mice in both models.
- mice bearing established Hep3B liver tumors were treated with 2 mg/kg PLK1424-2/A or Luc-U/U siRNA by intravenous administration twice weekly for 3 weeks, until control groups displayed symptoms of extensive tumor burden.
- PLK1424-2/A SNALP treated mice typically maintained body weight over the duration of treatment, indicating that the siRNA formulation was well tolerated and suggesting therapeutic benefit.
- RNAi was the primary mechanism underlying the potent therapeutic effects of these PLK-I and KSP siRNA formulations.
- RNAi as the mechanism responsible for mRNA silencing in vivo by the 5'- RACE PCR method.
- a PCR product of the predicted size was readily amplified from hepatic Hep3B tumor samples taken 24 h after administration of PLK1424-2/A SNALP ( Figure 33C).
- Oligonucleotide sequencing of the 476 bp PCR product from three individual mice confirmed its identity as the predicted 5' cut end of hPLK-1 mRNA. This PCR product was not evident in tumors taken from Luc-U/U siRNA treated mice or in liver samples from non-tumor bearing animals.
- RACE-PCR analysis also confirmed the specific induction of RNAi-mediated KSP mRNA cleavage within tumors of KSP2263-U/U treated animals ( Figure 33D).
- RNAi The duration of RNAi determined by RACE-PCR closely correlated with the level of hP LK-I mRNA silencing in these liver tumors ( Figure 34B), providing further confirmation that RNAi was the primary mechanism for reductions in PLK-I mRNA. Since the cleaved mRNA species are inherently unstable in the cell cytoplasm, it can be concluded that active RISC-mediated cleavage of the target mRNA persisted for 7-10 days after a single siRNA treatment. This suggests that active RNAi continued to occur either within a subset of tumor cells at sub-cytotoxic levels or within an initially non-proliferative population that subsequently entered cell cycle and re- expressed PLK-I mRNA.
- KSP KSP
- PLK-I inhibitors 47, 48
- siRNA duplexes of 21 bp or longer have also been reported to activate cell surface TLR3 on endothelial cells, causing non-specific anti-angiogenic effects in models of choroidal neovascularization (4).
- the consequences of immune activation by siRNA in tumor models was recently illustrated by the potent anti-tumor effects elicited by both active and non-targeting immune stimulatory siRNA constructs through the activation of immune effector functions (15).
- the 2'0Me siRNAs described herein induced no measurable cytokine response in mice. There was also no induction of the IFN inducible gene IFITl in either the liver, representing the primary target organ for these delivery vehicles, or within secondary lymphoid tissues.
- IFITl expression is responsive to local IFN signaling within tissues, and is also induced directly via dsRNA receptors, including TLR3, through an IFN-independent pathway (54-56). Its measure can therefore be considered more broadly indicative of siRNA-mediated immune activation compared to the induction of particular systemic cytokines. Taken together, these results indicate that the appropriate design of 2'0Me siRNA can not only circumvent the activation of endosomal TLR7/8 (2, 3, 18, 53), but also TLR3 (56). This likely reflects the fact that encapsulation of siRNA within delivery vehicles such as SNALP effectively shields the RNA from exposure to TLR3 on the cell surface. It is important that researchers confirm the foil abrogation of an immune response to their selected siRNA in the context of their preferred delivery vehicle and animal model.
- Target silencing by siRNA may offer several advantages over functional inhibition by small molecule drugs.
- RNAi is highly specific and allows for the selective inhibition of closely related proteins compared to the relative promiscuity of kinase inhibitors.
- Current PLK-I inhibitors for example also inhibit PLK-2 and PLK-3 kinase activity (23, 59), raising some concern that concomitant inhibition of these family members may have opposing effects in controlling cell division (60).
- the biological response to protein depletion by RNAi can also differ from its functional inhibition by small molecules, for example, the loss of both kinase and polo-box functionality upon PLK-I gene silencing (61).
- the duration of drug effect that can be achieved with siRNA is another attractive advantage.
- RNAi Once RNAi is established within mammalian cells, gene silencing can persist for many days, due to the relative stability of activated RISC in the presence of its complementary mRNA (26, 62). Therefore, the maintenance of drug activity for an siRNA therapeutic is uncoupled from the requirement to maintain an effective drug concentration in the blood.
- active RNAi in our tumor models persisted for up to 10 days based on detection of the specific mRNA cleavage product by RACE-PCR. Interestingly, this duration of effect was substantially shorter than that observed in comparable studies targeting ApoB expression in the healthy mouse liver in which silencing at the mRNA level slowly resolved between 14 and 28 days after siRNA administration (26).
- RNAi in the tumor most likely results from the effective killing of PLK-I silenced tumor cells and from the dilution of activated RISC through the proliferation of cells receiving sub-lethal doses of PLK-I siRNA (62).
- siRNA sequences targeting human PLK-I (Genbank Accession No. NM 005030) were selected using a standard siRNA design algorithm (40, 64). Target sequences of PLK-I siRNAs are listed in Table 7. All siRNA were synthesized as oligonucleotides by Integrated DNA Technologies and received as desalted, deprotected RNA.
- siRNA were formulated into SNALP comprised of synthetic cholesterol (Sigma), DSPC (1,2-distearoyl- sn-glycero-3-phosphocholine; Avanti Polar Lipids), PEG-cDMA (3-N-(-Methoxy poly(ethylene glycol)2000)carbamoyl-l,2-dimyrestyloxy-propylamine), and DLinDMA (1,2- Dilmoleyloxy-3-(N,N-dimethyl)aminopropane) as previously described (26).
- Formulations used for in vivo studies comprised a final Hpid:siRNA mass ratio of 9:1.
- PEG-cDMA was substituted at equimolar concentrations with the Cl 8 analogue PEG-cDSA (50). All stabilized lipid particles were dialyzed in PBS prior to use and were stable as a wet preparation stored at 4°C for greater than 6 months.
- the number under "siRNA” in Table 7 refers to the nucleotide position of the 5' base of the sense strand relative to the start codon (ATG) of the human PLK-I mRNA sequence NM OO5O3O.
- the sense strand comprises modified nucleotides such as 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- the cell lines Hep3B, HepG2, HT29, LS 174T, and Neuro2a cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA) and cultured in the recommended basal media with 10% heat inactivated FBS and 1% penicillin- streptomycin.
- ATCC American Type Culture Collection
- Hep3B or Neuro2a cells were cultured in Tl 75 flasks, harvested and washed once in PBS prior to implantation.
- siRNA activity assays cell lines were cultured in 96 well plates in the presence of SNALP formulated siRNA. Cell viability was assessed after 72 h using the resazurin dye CellTiter Blue (Promega Corp).
- Intrahepatic tumor models Liver tumors were established in mice by direct intrahepatic injection of Hep3B or Neuro2a tumor cells (45).
- Female scid/beige mice (Charles River Laboratories) and male AJJ mice (Jackson Laboratories) were used as hosts for the Hep3B and Neuro2a tumors, respectively.
- Animals received Anafen by SC injection immediately prior to surgery.
- Individual mice were anaesthetized by isoflourane gas inhalation and eye lube applied to prevent excessive eye drying. While maintained under gas anaesthesia, a single 1.5 cm incision across the midline was made below the sternum and the left lateral hepatic lobe exteriorized.
- IxIO 6 Hep3B cells or IxIO 5 Neuro2a cells suspended in 25 ⁇ L PBS were injected slowly into the lobe at a shallow angle using a Hamilton syringe and 3OG needle. A swab was then applied to the puncture wound to stop any bleeding prior to suturing. Mice were allowed to recover from anaesthesia in a sterile cage and monitored closely for 2-4 h before being returned to conventional housing.
- mice Eight to 11 days after tumor implantation, mice were randomized into treatment groups. siRNA SNALP formulations or PBS vehicle control were administered by standard intravenous injection via the lateral tail vein, calculated on a mg siRNA/kg basis according to individual animal weights (10 mL/kg injection volume). Body weights were then monitored throughout the duration of the study as an indicator of developing tumor burden and treatment tolerability. For efficacy studies, defined humane endpoints were determined as a surrogate for survival. Assessments were made by qualified veterinary technicians based on a combination of clinical signs, weight loss, and abdominal distension to define the day of euthanization due to tumor burden. [0521] Subcutaneous tumor models.
- Tumors were harvested directly into RNALater and stored at 4 0 C until processing.
- 100 mg tumor tissue was homogenized in Tissue and Lysis Solution (EpiCentre Biotechnologies) containing 50 mg/ml proteinase K (EpiCentre) in a Fastprep tissue homogenizer followed by incubation in a 65 0 C waterbath for 15min and centrifuged to clarify lysates.
- mRNA analysis in Figure 33B was performed on purified RNA isolated according the 5'-RACE-PCR protocol. Human PLK-I and GAPDH mRNA were measured in tumor lystes by the QuantiGene bDNA assay (Panomics) as per the manufacturer's instructions (Quantigene 1.0 Manual).
- RNA Ligase Mediated Rapid Amplification of cDNA ends 5' RLM RACE. Total RNA was isolated from in vitro cultured cells by direct lysis in TRIZOL (Invitrogen, Carlsbad, CA).
- RNAlater (Sigma Co.) and stored at 4 0 C for at least 24 h prior to processing. 30 mg tumor tissue was homogenized in 1 mL TRIZOL then processed to isolate total RNA. RNA quality was confirmed by gel electropharesis (1% agarose TBE). 5' RLM RACE was performed according to the Invitrogen GeneRacer manual with modifications. Primers were designed using the Primer 3 software. 10 ⁇ g total RNA was mixed with 1.3 ng GeneRacer RNA adaptor (5'-
- RNA ligation was performed at 37 0 C for 1 h in Ix ligase buffer, 30 U RNase-Out (Invitrogen) and 30 U RNA ligase (Ambion Inc, Austin, TX). Samples were then purified by diafiltration using Microcon 100 filters as per the manufacturer's instructions for nucleic acids (Millipore Inc).
- RNA ligation product 10 ⁇ L was reverse transcribed using Superscript III (Invitrogen) and a PLK-I -specific primer (5'-GGACAAGGCTGTAGAACCCACAC-S'; SEQ ID NO:275) designed downstream of the predicted PLKl 424 siRNA cut site.
- Reverse transcription was carried out at 55 0 C for 50 min followed by inactivation at 70 0 C for 15min and snap-cooling on ice.
- 5' RLM RACE PCR was performed using forward (GR5) and reverse (PLK1424rev) primers in the GeneRacer adaptor and 3' end of PLK-I mRNA, respectively, to span the predicted PLK1424 cut site.
- PCR primer sequences were as follows: GR5 - 5'- CGACTGGAGCACGAGGACACTGA-3' (SEQ ID NO:276); and PLK1424rev - 5'- CCAGATGCAGGTGGGAGTGAGGA-S ' (SEQ ID NO:277).
- PCR was performed using a BIO-RAD iCycler using touchdown PCR conditions of 94°C for 2 min (1 cycle), 94°C for 30 sec and 72 0 C for 1 min (5 cycles), 94 0 C for 30 sec and 70 0 C for 1 min (5 cycles), 94 0 C for 30 sec, 65 0 C for 30 sec and 68°C for 1 min (25 cycles), and 68 0 C for 10 min (1 cycle).
- PCR products were run on a 2% TBE Agarose 1000 (Invitrogen) gel and stained with l ⁇ g/ml ethidium bromide. The identity of PCR products was confirmed by direct sequencing of the gel-purified products using the following sequencing primers: GeneRacer 5' Seq - 5'- ACTGGAGCACGAGGACAC-3' (SEQ ID NO:278); and PLK1424 3 1 Seq - 5'- G AG ACGGGC AGGGATAT AG-3' (SEQ ID NO:279). Similar assay conditions and primer design were employed to amplify the cleaved KSP mRNA product by KSP2263 siRNA using the following unique primers: KSP-specific cDNA primer 5'-
- Cytokine ELISA All cytokines were quantified using sandwich ELISA kits. These were mouse interferon- ⁇ (PBL Biomedical; Piscataway, NJ) and human and mouse IL- 6 (BD Biosciences; San Diego, CA). [0527] ApoB-1 siRNA sequences.
- ApoB-1 siRNA 5'-3' sequences were used in the experiments shown in Figure 25: Sense - GUC AUC AC ACUG AAUACC AAU (SEQ ID NO:283); 2 1 OMe sense - GUCAUCACACUGAAUACCAAU (SEQ ID NO:284); Antisense (AS) - AUUGGUAUUCAGUGUGAUGACAC (SEQ ID NO:285); 2'OMe AS - AUUGGUAUUCAGUGUGAUGACAC (SEQ ID NO:286). 2'OMe nucleotides are indicated in bold and underlined.
- RNAi-mediated gene-targeting through systemic application of polyethylenimine
- Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes.
- RNA signaling by Toll-like receptor 3 requires specific tyrosine residues in its cytoplasmic domain. J Biol Chem 278: 4393-4396.
- Step 1 A 250 ml round bottom flask containing cholesterol (5.0 g, 12.9 mmol) and a stir bar was sealed and flushed with nitrogen. Toluenesulphonyl chloride (5.0 g, 26.2 mmol) was weighed into a separate 100-mL round bottom flask, also sealed and flushed with nitrogen. Anhydrous pyridine (2 x 50 ml) was delivered to each flask. The toluenesulphonyl chloride solution was then transferred, via cannula, into the 250 ml flask, and the reaction stirred overnight. The pyridine was removed by rotovap, and methanol (80 ml) added to the residue.
- Step 2 Cholesteryl tosylate (2.0 g, 3.7 mmol), 1,4-dioxane (50 mL), and ethylene glycol (4.6 g, 74 mmol) were added to a 100 ml flask containing a stir bar. The flask was fitted with a condenser, and refluxed overnight.
- the dioxane was then removed by rotovap, and the reaction mixture suspended in water (100 ml). The solution was transferred to a separating funnel and extracted with chloroform (3 x 100 ml). The organic phases were combined, washed with water (2 x 150 ml), dried over magnesium sulphate, and the solvent removed. The crude product was purified by column chromatography (5% acetone/hexane) to yield the product as a white solid (1.1 g, 69%).
- Example 17 Exemplary aiRNA molecules targeting PLK-I.
- Table 8 provides non-limiting examples of aiRNA molecules that are suitable for modulating (e.g., silencing) PLK-I expression.
- the first set of aiRNA molecules comprises the PLKl 424 siRNA antisense strand sequence (SEQ ID NO:2).
- the second set of aiRNA molecules comprises the PLK773 siRNA antisense strand sequence (SEQ ID NO:4).
- the 5' antisense overhang may contain one, two, three, four, or more nontargeting nucleotides (e.g., "AA”, "UU”, "dTdT”, etc.).
- the 5' antisense overhang contains two nontargeting nucleotides.
- the 3' antisense overhang may contain one, two, three, four, or more nontargeting nucleotides.
- the aiRNA molecules may comprise one or more modified nucleotides, e.g., in the double-stranded (duplex) region and/or in the antisense overhangs. Examples of modified nucleotides are described herein and include 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2T) nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and locked nucleic acid (LNA) nucleotides.
- the aiRNA molecules may further comprise one of the carrier systems described herein (e.g., a nucleic acid particle) and find utility in treating cancers such as liver cancer (e.g., hepatocellular carcinoma).
- RNA duplexes comprising sense and antisense PLK-I RNA polynucleotides.
- PLK1424 (14 bp/1) 5' -CACCCUCCUUAAAU- 3' (SEQ ID NO:293)
- PLK1424 (15 bp/1) 5' -UCACCCUCCUUAAAU- 3' (SEQ ID NO:296)
- Example 18 Exemplary miRNA molecules targeting PLK-I.
- Table 9 provides non-limiting examples of miRNA molecules that are suitable for modulating (e.g., silencing) PLK-I expression.
- the miRNA molecules described herein may comprise one or more modified nucleotides. Examples of modified nucleotides are described herein and include 2'-O-methyl (2 1 OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and locked nucleic acid (LNA) nucleotides.
- modified nucleotides include 2'-O-methyl (2 1 OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, T- deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, and locked nucleic acid (LNA) nucleo
- the 5' and/or 3' ends of the miRNA sequence may contain one, two, three, four, or more nontargeting nucleotides.
- a fragment of one of the miRNA sequences set forth in Table 9 may be used for modulating (e.g., silencing) PLK-I expression.
- an agent that blocks the interaction between one or more of the miRNA molecules set forth in Table 9 and their target PLK-I mRNA sequence(s) may be used for modulating (e.g., silencing) PLK-I expression.
- the miRNA molecules or blocking agents thereof may further comprise one of the carrier systems described herein (e.g., a nucleic acid particle) and find utility in treating cancers such as hepatocellular carcinoma.
- Unmodified or modified pre-miRNA sequences corresponding to any of the mature miRNA sequences listed in Table 9 are also suitable for use in the present invention, e.g., to modulate (e.g., silence) PLK-I expression.
- the pre-miRNA molecule may further comprise one of the carrier systems described herein (e.g., a nucleic acid particle) and find utility in treating cancers such as liver cancer (e.g., hepatocellular carcinoma).
- the Accession Nos. for the mature miRNA and pre-miRNA sequences correspond to entries that can be found in the miRBase Sequence Database from the Sanger Institute.
- the miRBase Sequence Database is a searchable database of published miRNA sequences and annotation.
- PLK-I siRNA molecules containing 2'-O-methyl (2 1 OMe) nucleotides at selective positions on the sense and antisense strands of the siRNA were formulated as SNALP and evaluated for their inhibitory effects on cell growth in vitro.
- the modified PLK-I siRNA sense and antisense strand sequences are shown in Table 10.
- Exemplary double-stranded modified PLK-I siRNA molecules generated from the sequences of Table 10 are shown in Table 11.
- the siRNA can alternatively or additionally comprise 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides, 2'-O- (2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- 2'-deoxy-2'-fluoro (2'F) nucleotides 2'-deoxy nucleotides, 2'-O- (2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- the siRNA duplex can alternatively or additionally comprise 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides, 2'-O-(2- methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- 2'-deoxy-2'-fluoro (2'F) nucleotides 2'-deoxy nucleotides, 2'-O-(2- methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid (LNA) nucleotides.
- MOE 2- methoxyethyl
- LNA locked nucleic acid
- Figure 41 shows that modified PLKl 424 siRNAs did not induce an IFN- ⁇ response that was greater than the "PBS” and "Empty” negative controls. Only the BimA siRNA positive control induced IFN- ⁇ protein in plasma above the level of detection (15.6 pg/ml).
- Figure 42 shows that there was no significant IFITl induction above that of empty SNALP with PLK1424 1/3, PLK1424 2/3, PLK1424 2/4, and PLK1424 2/6 siRNAs. The IFITl QG analysis was more sensitive than the IFN- ⁇ ELISA for measuring immunogenicity because it resolved low-grade immune stimulation.
- Hep3B tumors were established in scid/beige mice by subcutaneous injection of tumor cells into the left hind flank.
- PLKl 424 siRNA SNALP formulations were then administered by intravenous injection as a 3 mg/kg single dose.
- the extent of PLK-I mRNA knockdown was determined in the Hep3B tumors about 24 hours after SNALP administration.
- Figure 43 shows that all PLKl 424 siRNAs tested produced an equivalent level of PLK- 1 mRNA silencing in vivo.
- SNALP containing PLK1424 1/3 siRNA was substantially less immunogenic than SNALP containing the corresponding unmodified PLKl 424 siRNA sequence.
- PLK1424 1/3 SNALP had a significantly lower potential for generating an IgG or IgM antibody response against the PEG-lipid conjugate PEG-cDMA.
- SNALP containing either PLK1424 2/3, PLK1424 2/4, or PLK1424 2/6 siRNA produced almost no detectable antibody responses against the PEG-lipid.
- PLKl 424 2/6 SNALP consistently had the lowest antibody response to PEG-cDMA out of all PLK-I siRNA sequences tested.
- the present invention provides methods for designing and optimizing PLK-I siRNA sequences to substantially reduce or abrogate the immunogenic properties of unmodified siRNA sequences.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Dispersion Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Dermatology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
- Saccharide Compounds (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2710713A CA2710713C (en) | 2007-12-27 | 2008-12-23 | Silencing of polo-like kinase expression using interfering rna |
| JP2010539978A JP5697988B2 (ja) | 2007-12-27 | 2008-12-23 | 干渉rnaを使用したポロ様キナーゼ発現のサイレンシング方法 |
| AU2008342535A AU2008342535B2 (en) | 2007-12-27 | 2008-12-23 | Silencing of polo-like kinase expression using interfering RNA |
| EP20080867007 EP2238251B1 (en) | 2007-12-27 | 2008-12-23 | Silencing of polo-like kinase expression using interfering rna |
| ES08867007.0T ES2535419T3 (es) | 2007-12-27 | 2008-12-23 | Silenciamiento de expresión de quinasa tipo polo usando ARN interferente |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US1707507P | 2007-12-27 | 2007-12-27 | |
| US61/017,075 | 2007-12-27 | ||
| US4522808P | 2008-04-15 | 2008-04-15 | |
| US61/045,228 | 2008-04-15 | ||
| US10065308P | 2008-09-26 | 2008-09-26 | |
| US61/100,653 | 2008-09-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009082817A1 true WO2009082817A1 (en) | 2009-07-09 |
Family
ID=40823727
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2008/002285 Ceased WO2009082817A1 (en) | 2007-12-27 | 2008-12-23 | Silencing of polo-like kinase expression using interfering rna |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US9006191B2 (https=) |
| EP (1) | EP2238251B1 (https=) |
| JP (1) | JP5697988B2 (https=) |
| AU (1) | AU2008342535B2 (https=) |
| CA (1) | CA2710713C (https=) |
| ES (1) | ES2535419T3 (https=) |
| WO (1) | WO2009082817A1 (https=) |
Cited By (66)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010017319A3 (en) * | 2008-08-05 | 2010-04-15 | Mdrna, Inc. | Nucleic acid compounds for inhibiting plk1 gene expression and uses thereof |
| WO2011000107A1 (en) | 2009-07-01 | 2011-01-06 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for delivery of therapeutic agents to solid tumors |
| WO2011038160A2 (en) | 2009-09-23 | 2011-03-31 | Protiva Biotherapeutics, Inc. | Compositions and methods for silencing genes expressed in cancer |
| WO2011073326A2 (en) | 2009-12-18 | 2011-06-23 | Novartis Ag | Organic compositions to treat hsf1-related diseases |
| JP2011155914A (ja) * | 2010-02-01 | 2011-08-18 | Osaka Univ | 脂質異常症治療薬剤としての化学修飾siRNA |
| WO2011131707A1 (en) | 2010-04-23 | 2011-10-27 | Novartis Ag | ORGANIC COMPOSITIONS TO TREAT BETA-ENaC-RELATED DISEASES |
| WO2011139710A1 (en) * | 2010-04-26 | 2011-11-10 | Marina Biotech, Inc. | Nucleic acid compounds with conformationally restricted monomers and uses thereof |
| WO2011141704A1 (en) | 2010-05-12 | 2011-11-17 | Protiva Biotherapeutics, Inc | Novel cyclic cationic lipids and methods of use |
| WO2011141705A1 (en) | 2010-05-12 | 2011-11-17 | Protiva Biotherapeutics, Inc. | Novel cationic lipids and methods of use thereof |
| WO2011153323A2 (en) | 2010-06-02 | 2011-12-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods directed to treating liver fibrosis |
| US20120015026A1 (en) * | 2009-03-25 | 2012-01-19 | Giancarlo Francese | Pharmaceutical composition containing a drug and sirna |
| CN102441175A (zh) * | 2010-10-05 | 2012-05-09 | 韩国科学技术研究院 | 人血清白蛋白-siRNA纳米尺寸载体系统 |
| WO2012078967A2 (en) | 2010-12-10 | 2012-06-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for increasing erythropoietin (epo) production |
| WO2012079046A2 (en) | 2010-12-10 | 2012-06-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of klf-1 and bcl11a genes |
| WO2012177784A2 (en) | 2011-06-21 | 2012-12-27 | Alnylam Pharmaceuticals | Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof |
| WO2012178033A2 (en) | 2011-06-23 | 2012-12-27 | Alnylam Pharmaceuticals, Inc. | Serpina1 sirnas: compositions of matter and methods of treatment |
| JP2013500960A (ja) * | 2009-07-31 | 2013-01-10 | ラモット アット テル アビブ ユニバーシティ, リミテッド | ポリヌクレオチド剤を含む細胞標的化ナノ粒子およびその使用 |
| WO2013019857A2 (en) | 2011-08-01 | 2013-02-07 | Alnylam Pharmaceuticals, Inc. | Method for improving the success rate of hematopoietic stem cell transplants |
| WO2013023982A1 (en) * | 2011-08-12 | 2013-02-21 | Westfaelische Wilhelms-Universitaet Muenster | Novel compounds for the treatment of inflammatory bowel disease |
| WO2013030778A2 (en) | 2011-09-02 | 2013-03-07 | Novartis Ag | Organic compositions to treat hsf1-related diseases |
| WO2013056670A1 (zh) * | 2011-10-19 | 2013-04-25 | 苏州瑞博生物技术有限公司 | 小干扰RNA及其应用和抑制plk1基因表达的方法 |
| JP2013515693A (ja) * | 2009-12-23 | 2013-05-09 | ノバルティス アーゲー | 脂質、脂質組成物およびそれらの使用方法 |
| US20130156845A1 (en) * | 2010-04-29 | 2013-06-20 | Alnylam Pharmaceuticals, Inc. | Lipid formulated single stranded rna |
| WO2013105022A2 (en) | 2012-01-09 | 2013-07-18 | Novartis Ag | Organic compositions to treat beta-catenin-related diseases |
| WO2013126803A1 (en) | 2012-02-24 | 2013-08-29 | Protiva Biotherapeutics Inc. | Trialkyl cationic lipids and methods of use thereof |
| WO2013155204A2 (en) | 2012-04-10 | 2013-10-17 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the alas1 gene |
| WO2013166004A2 (en) | 2012-05-02 | 2013-11-07 | Novartis Ag | Organic compositions to treat kras-related diseases |
| WO2014130922A1 (en) | 2013-02-25 | 2014-08-28 | Trustees Of Boston University | Compositions and methods for treating fungal infections |
| WO2014134255A2 (en) | 2013-02-28 | 2014-09-04 | Novartis Ag | Organic compositions to treat epas1-related diseases |
| WO2014131773A3 (de) * | 2013-02-27 | 2014-10-23 | Friedrich-Schiller-Universität Jena | Verfahren zur gezielten abtötung von zellen durch zur mrna-anbindung ausgerichtete nukleotid-moleküle sowie nukleotid-moleküle und applikationskit für solche verwendung |
| WO2014182661A2 (en) | 2013-05-06 | 2014-11-13 | Alnylam Pharmaceuticals, Inc | Dosages and methods for delivering lipid formulated nucleic acid molecules |
| WO2015051135A2 (en) | 2013-10-04 | 2015-04-09 | Novartis Ag | Organic compositions to treat hepcidin-related diseases |
| WO2015050990A1 (en) | 2013-10-02 | 2015-04-09 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
| US9126966B2 (en) | 2011-08-31 | 2015-09-08 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods of use thereof |
| WO2016011123A1 (en) | 2014-07-16 | 2016-01-21 | Arrowhead Research Corporation | Organic compositions to treat apoc3-related diseases |
| WO2016038550A1 (en) | 2014-09-11 | 2016-03-17 | Novartis Ag | Inhibition of prmt5 to treat mtap-deficiency-related diseases |
| WO2016089883A1 (en) | 2014-12-01 | 2016-06-09 | Novartis Ag | Compositions and methods for diagnosis and treatment of prostate cancer |
| WO2016193945A2 (en) | 2015-06-05 | 2016-12-08 | Novartis Ag | Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders |
| WO2018006052A1 (en) * | 2016-06-30 | 2018-01-04 | Protiva Biotherapeutics, Inc. | Compositions and methods for delivering messenger rna |
| WO2018047148A1 (en) | 2016-09-12 | 2018-03-15 | Novartis Ag | Compounds for the inhibition of mirna |
| WO2018083606A1 (en) | 2016-11-01 | 2018-05-11 | Novartis Ag | Methods and compositions for enhancing gene editing |
| WO2019016772A2 (en) | 2017-07-21 | 2019-01-24 | Novartis Ag | COMPOSITIONS AND METHODS FOR TREATING CANCER |
| WO2019094578A1 (en) | 2017-11-09 | 2019-05-16 | Alnylam Pharmaceuticals Inc. | Assays and methods for determining expression of the lect2 gene |
| US10342761B2 (en) | 2014-07-16 | 2019-07-09 | Novartis Ag | Method of encapsulating a nucleic acid in a lipid nanoparticle host |
| WO2019150309A1 (en) | 2018-02-02 | 2019-08-08 | Hammack Scott | Modulators of gpr68 and uses thereof for treating and preventing diseases |
| EP3564393A1 (en) | 2011-06-21 | 2019-11-06 | Alnylam Pharmaceuticals, Inc. | Assays and methods for determining activity of a therapeutic agent in a subject |
| WO2019213276A1 (en) | 2018-05-02 | 2019-11-07 | Novartis Ag | Regulators of human pluripotent stem cells and uses thereof |
| WO2020037125A1 (en) | 2018-08-16 | 2020-02-20 | Alnylam Pharmaceuticals Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
| WO2020132346A1 (en) | 2018-12-20 | 2020-06-25 | Vir Biotechnology, Inc. | Combination hbv therapy |
| EP3674409A1 (en) | 2011-03-29 | 2020-07-01 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of tmprss6 gene |
| EP3693463A1 (en) | 2013-10-04 | 2020-08-12 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the alas1 gene |
| WO2021046122A1 (en) | 2019-09-03 | 2021-03-11 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
| WO2021067747A1 (en) | 2019-10-04 | 2021-04-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing ugt1a1 gene expression |
| WO2021087325A1 (en) | 2019-11-01 | 2021-05-06 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing dnajb1-prkaca fusion gene expression |
| WO2021163066A1 (en) | 2020-02-10 | 2021-08-19 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing vegf-a expression |
| WO2021202443A2 (en) | 2020-03-30 | 2021-10-07 | Alnylam Pharmaceucticals, Inc. | Compositions and methods for silencing dnajc15 gene expression |
| WO2021207189A1 (en) | 2020-04-07 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing scn9a expression |
| WO2021207167A1 (en) | 2020-04-06 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing myoc expression |
| WO2021237097A1 (en) | 2020-05-21 | 2021-11-25 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting marc1 gene expression |
| WO2021262840A1 (en) | 2020-06-24 | 2021-12-30 | Vir Biotechnology, Inc. | Engineered hepatitis b virus neutralizing antibodies and uses thereof |
| EP4209592A1 (en) | 2012-04-26 | 2023-07-12 | Genzyme Corporation | Serpinc1 irna compositions and methods of use thereof |
| US11718852B2 (en) | 2010-06-30 | 2023-08-08 | Arbutus Biopharma Corporation | Non-liposomal systems for nucleic acid delivery |
| EP4385568A2 (en) | 2010-04-06 | 2024-06-19 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of cd274/pd-l1 gene |
| EP4241767B1 (en) | 2008-11-10 | 2024-10-23 | Arbutus Biopharma Corporation | Novel lipids and compositions for the delivery of therapeutics |
| US12221610B2 (en) | 2019-01-09 | 2025-02-11 | Arrowhead Pharmaceuticals, Inc. | RNAi agents for inhibiting expression of HIF-2 alpha (EPAS1), compositions thereof, and methods of use |
| US12416006B2 (en) | 2021-08-31 | 2025-09-16 | Alnylam Pharmaceuticals, Inc. | Cell death-inducing DFFA-like effector B (CIDEB) iRNA compositions and methods of use thereof |
Families Citing this family (88)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9228186B2 (en) | 2002-11-14 | 2016-01-05 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
| ES2423060T3 (es) | 2004-03-12 | 2013-09-17 | Alnylam Pharmaceuticals, Inc. | Agentes iRNA que tienen como diana al VEGF |
| NZ571568A (en) | 2006-03-31 | 2010-11-26 | Alnylam Pharmaceuticals Inc | Double-stranded RNA molecule compositions and methods for inhibiting expression of Eg5 gene |
| CN101484588B (zh) | 2006-05-11 | 2013-11-06 | 阿尔尼拉姆医药品有限公司 | 抑制pcsk9基因表达的组合物和方法 |
| US8598333B2 (en) * | 2006-05-26 | 2013-12-03 | Alnylam Pharmaceuticals, Inc. | SiRNA silencing of genes expressed in cancer |
| ES2535419T3 (es) * | 2007-12-27 | 2015-05-11 | Protiva Biotherapeutics Inc. | Silenciamiento de expresión de quinasa tipo polo usando ARN interferente |
| WO2009086558A1 (en) * | 2008-01-02 | 2009-07-09 | Tekmira Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
| CA2713379A1 (en) * | 2008-01-31 | 2009-11-05 | Alnylam Pharmaceuticals, Inc. | Optimized methods for delivery of dsrna targeting the pcsk9 gene |
| KR101397407B1 (ko) | 2008-03-05 | 2014-06-19 | 알닐람 파마슈티칼스 인코포레이티드 | Eg5 및 VEGF 유전자의 발현을 억제하기 위한 조성물 및 방법 |
| CA2721333C (en) | 2008-04-15 | 2020-12-01 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for nucleic acid delivery |
| AU2009296395A1 (en) | 2008-09-25 | 2010-04-01 | Alnylam Pharmaceuticals, Inc. | Lipid formulated compositions and methods for inhibiting expression of Serum Amyloid A gene |
| MX360460B (es) | 2008-10-20 | 2018-11-05 | Alnylam Pharmaceuticals Inc | Composiciones y metodos para inhibir la expresion de transtiretina. |
| CA2746514C (en) | 2008-12-10 | 2018-11-27 | Alnylam Pharmaceuticals, Inc. | Gnaq targeted dsrna compositions and methods for inhibiting expression |
| EP3243504A1 (en) * | 2009-01-29 | 2017-11-15 | Arbutus Biopharma Corporation | Improved lipid formulation |
| JP5894913B2 (ja) | 2009-06-15 | 2016-03-30 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Pcsk9遺伝子を標的とする、脂質で製剤化されたdsrna |
| US9051567B2 (en) | 2009-06-15 | 2015-06-09 | Tekmira Pharmaceuticals Corporation | Methods for increasing efficacy of lipid formulated siRNA |
| US8716464B2 (en) | 2009-07-20 | 2014-05-06 | Thomas W. Geisbert | Compositions and methods for silencing Ebola virus gene expression |
| AP2015008874A0 (en) | 2009-08-14 | 2015-11-30 | Alnylam Pharmaceuticals Inc | Lipid formulated compositions and methods for inhibiting expression of a gene from the ebola virus |
| CN107519133A (zh) | 2009-09-15 | 2017-12-29 | 阿尔尼拉姆医药品有限公司 | 脂质配制的组合物及抑制Eg5和VEGF基因的表达的方法 |
| US9187746B2 (en) | 2009-09-22 | 2015-11-17 | Alnylam Pharmaceuticals, Inc. | Dual targeting siRNA agents |
| US9101643B2 (en) | 2009-11-03 | 2015-08-11 | Alnylam Pharmaceuticals, Inc. | Lipid formulated compositions and methods for inhibiting expression of transthyretin (TTR) |
| CN107028886A (zh) * | 2009-11-04 | 2017-08-11 | 不列颠哥伦比亚大学 | 含有核酸的脂质粒子及相关的方法 |
| EP3318248B1 (en) | 2009-12-01 | 2019-04-10 | Translate Bio, Inc. | Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases |
| CN103189511B (zh) | 2010-07-12 | 2016-10-12 | 国立大学法人鸟取大学 | 利用siRNA导入的新型hiPSC制作法 |
| US20120039983A1 (en) * | 2010-08-11 | 2012-02-16 | Uhrich Kathryn E | Amphiphilic macromolecule-lipid complexes |
| WO2012048265A2 (en) * | 2010-10-08 | 2012-04-12 | The Broad Institute Of Mit And Harvard | Methods of treating inflammation |
| AR083445A1 (es) | 2010-10-14 | 2013-02-27 | Univ Mie | siARN CONTRA LA FIBROSIS |
| US8853377B2 (en) | 2010-11-30 | 2014-10-07 | Shire Human Genetic Therapies, Inc. | mRNA for use in treatment of human genetic diseases |
| RU2013154295A (ru) | 2011-06-08 | 2015-07-20 | Шир Хьюман Дженетик Терапис, Инк. | КОМПОЗИЦИИ ЛИПИДНЫХ НАНОЧАСТИЦ И СПОСОБЫ ДЛЯ ДОСТАВКИ мРНК |
| EP3730618A1 (en) | 2011-11-18 | 2020-10-28 | Alnylam Pharmaceuticals, Inc. | Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases |
| US9035039B2 (en) | 2011-12-22 | 2015-05-19 | Protiva Biotherapeutics, Inc. | Compositions and methods for silencing SMAD4 |
| ITRM20110685A1 (it) | 2011-12-23 | 2013-06-24 | Internat Ct For Genetic En Gineering And | Microrna per la rigenerazione cardiaca attraverso l induzione della proliferazione dei miociti cardiaci |
| CA2868238A1 (en) | 2012-04-18 | 2013-10-24 | Ramot At Tel Aviv University Ltd. | Lipidated glycosaminoglycan particles for the delivery of nucleic acids |
| WO2013185067A1 (en) | 2012-06-08 | 2013-12-12 | Shire Human Genetic Therapies, Inc. | Nuclease resistant polynucleotides and uses thereof |
| EP2858679B2 (en) | 2012-06-08 | 2024-06-05 | Translate Bio, Inc. | Pulmonary delivery of mrna to non-lung target cells |
| IL292159B1 (en) | 2012-12-05 | 2026-04-01 | Alnylam Pharmaceuticals Inc | PCSK9 iRNA compositions and methods of using them |
| RS57739B1 (sr) | 2013-03-14 | 2018-12-31 | Translate Bio Inc | Kompozicije cftr irnk i postupci i upotrebe u vezi sa njima |
| BR112015022855A2 (pt) | 2013-03-14 | 2017-11-07 | Shire Human Genetic Therapies | composições e método para produção de um anticorpo in vitro |
| JP6586075B2 (ja) | 2013-03-14 | 2019-10-02 | トランスレイト バイオ, インコーポレイテッド | メッセンジャーrnaの精製方法 |
| EP3388834B1 (en) | 2013-03-15 | 2020-04-15 | Translate Bio, Inc. | Synergistic enhancement of the delivery of nucleic acids via blended formulations |
| CN106413811A (zh) | 2013-10-22 | 2017-02-15 | 夏尔人类遗传性治疗公司 | 精氨基琥珀酸合成酶缺乏症的mrna疗法 |
| AU2014340149B2 (en) | 2013-10-22 | 2020-12-24 | Shire Human Genetic Therapies, Inc. | CNS delivery of mRNA and uses thereof |
| JP6506749B2 (ja) | 2013-10-22 | 2019-04-24 | シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド | フェニルケトン尿症のためのmRNA療法 |
| ES3032935T3 (en) | 2013-10-22 | 2025-07-29 | Translate Bio Inc | Lipid formulations for delivery of messenger rna |
| US9850269B2 (en) | 2014-04-25 | 2017-12-26 | Translate Bio, Inc. | Methods for purification of messenger RNA |
| JP6557722B2 (ja) | 2014-05-30 | 2019-08-07 | シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド | 核酸の送達のための生分解性脂質 |
| KR102559979B1 (ko) | 2014-06-24 | 2023-07-25 | 샤이어 휴먼 지네틱 테라피즈 인크. | 핵산의 전달용 입체화학적으로 풍부한 조성물 |
| EP3160448B1 (en) | 2014-06-26 | 2025-08-06 | Ramot at Tel-Aviv University Ltd. | Liposomal formulations for delivery of nucleic acids |
| BR112016030852A2 (pt) | 2014-07-02 | 2018-01-16 | Shire Human Genetic Therapies | encapsulação de rna mensageiro |
| US9765333B2 (en) | 2014-08-21 | 2017-09-19 | Protiva Biotherapeutics, Inc. | Compositions and methods for silencing marburg virus gene expression |
| CN113599539A (zh) | 2014-08-29 | 2021-11-05 | 阿尔尼拉姆医药品有限公司 | 治疗甲状腺素运载蛋白(ttr)介导的淀粉样变性的方法 |
| JP6767976B2 (ja) | 2014-12-05 | 2020-10-14 | トランスレイト バイオ, インコーポレイテッド | 関節疾患の治療のためのメッセンジャーrna治療法 |
| JP2018504380A (ja) | 2014-12-18 | 2018-02-15 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Reversir(商標)化合物 |
| WO2016149508A1 (en) | 2015-03-19 | 2016-09-22 | Shire Human Genetic Therapies, Inc. | Mrna therapy for pompe disease |
| GB201506509D0 (en) | 2015-04-16 | 2015-06-03 | Univ Wageningen | Nuclease-mediated genome editing |
| US10648020B2 (en) | 2015-06-18 | 2020-05-12 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| PT3329002T (pt) | 2015-07-31 | 2021-01-12 | Alnylam Pharmaceuticals Inc | Composições de iarn de transtirretina (ttr) e métodos de seu uso para tratamento ou prevenção de doenças associadas à ttr |
| JP6997704B2 (ja) | 2015-10-14 | 2022-02-04 | トランスレイト バイオ, インコーポレイテッド | 生産性向上のためのrna関連酵素の修飾 |
| EP3825400B1 (en) | 2016-04-08 | 2024-12-25 | Translate Bio, Inc. | Multimeric coding nucleic acid and uses thereof |
| EP3445853A1 (en) | 2016-04-19 | 2019-02-27 | The Broad Institute, Inc. | Cpf1 complexes with reduced indel activity |
| EP3469074B1 (en) | 2016-06-13 | 2020-12-09 | Translate Bio, Inc. | Messenger rna therapy for the treatment of ornithine transcarbamylase deficiency |
| CN108283624B (zh) * | 2017-01-10 | 2021-01-12 | 北京化工大学 | 一种索拉非尼纳米脂质体制剂及其制备方法 |
| EA201991747A1 (ru) | 2017-02-27 | 2020-06-04 | Транслейт Био, Инк. | НОВАЯ КОДОН-ОПТИМИЗИРОВАННАЯ мРНК CFTR |
| MX2019013752A (es) | 2017-05-16 | 2020-07-20 | Translate Bio Inc | Tratamiento de la fibrosis quística mediante el suministro de arnm que codifica cftr optimizado en codones. |
| BR112019025224A2 (pt) | 2017-05-31 | 2020-12-08 | Ultragenyx Pharmaceutical Inc. | Terapêutica para doença de armazenamento de glicogênio tipo iii |
| CN107320484B (zh) * | 2017-06-08 | 2022-05-17 | 中国人民解放军第四军医大学第一附属医院 | mir-452-3p在制备治疗肝癌的药物组合物中的用途 |
| US20200375912A1 (en) * | 2017-08-03 | 2020-12-03 | Rita Elena Serda | Liposomal coated nanoparticles for immunotherapy applications |
| KR20240161202A (ko) | 2017-09-11 | 2024-11-12 | 애로우헤드 파마슈티컬스 인코포레이티드 | 아포지단백질 C-III (APOC3)의 발현을 억제하기 위한 RNAi 작용제 및 조성물 |
| BR112020005230A2 (pt) | 2017-09-19 | 2020-09-24 | Alnylam Pharmaceuticals, Inc. | composições e métodos para o tratamento da amiloidose mediada por transtiretina (ttr) |
| US11167043B2 (en) | 2017-12-20 | 2021-11-09 | Translate Bio, Inc. | Composition and methods for treatment of ornithine transcarbamylase deficiency |
| WO2020068798A1 (en) | 2018-09-24 | 2020-04-02 | Guo Jimin | Living mammalian cells modified with functional modular nanoparticles |
| HRP20240586T1 (hr) * | 2018-10-09 | 2024-07-19 | The University Of British Columbia | Sastavi i sustavi koji sadrže transfekcijske sposobne vezikle bez organskih otapala i deterdženta i s njim povezanim postupcima |
| KR20210105889A (ko) | 2018-11-09 | 2021-08-27 | 아뷰터스 바이오파마 코포레이션 | 지질 나노입자 제제 |
| WO2020106946A1 (en) | 2018-11-21 | 2020-05-28 | Translate Bio, Inc. | TREATMENT OF CYSTIC FIBROSIS BY DELIVERY OF NEBULIZED mRNA ENCODING CFTR |
| AU2019394996B2 (en) | 2018-12-06 | 2025-11-06 | Arcturus Therapeutics, Inc. | Compositions and methods for treating ornithine transcarbamylase deficiency |
| US12208164B2 (en) | 2019-02-28 | 2025-01-28 | Unm Rainforest Innovations | Modular metal-organic polyhedra superassembly compositions |
| EP4031662A1 (en) | 2019-09-20 | 2022-07-27 | Translate Bio, Inc. | Mrna encoding engineered cftr |
| KR102444740B1 (ko) * | 2020-02-25 | 2022-09-19 | 한국과학기술연구원 | Ksp 억제제와 유사분열 억제제를 포함하는 암의 예방 또는 치료용 약학 조성물 |
| US12351834B2 (en) | 2020-03-03 | 2025-07-08 | Arcturus Therapeutics, Inc. | Compositions and methods for the treatment of ornithine transcarbamylase deficiency |
| WO2022115645A1 (en) | 2020-11-25 | 2022-06-02 | Akagera Medicines, Inc. | Lipid nanoparticles for delivery of nucleic acids, and related methods of use |
| CA3227852A1 (en) | 2021-08-03 | 2023-02-09 | Alnylam Pharmaceuticals, Inc. | Transthyretin (ttr) irna compositions and methods of use thereof |
| WO2023013719A1 (ja) * | 2021-08-06 | 2023-02-09 | 東レ株式会社 | 癌の治療及び/又は予防用医薬組成物 |
| CA3256897A1 (en) | 2022-05-25 | 2023-11-30 | Akagera Medicines, Inc. | Lipid nanoparticles for the administration of nucleic acids and their methods of use |
| WO2023229535A1 (en) | 2022-05-27 | 2023-11-30 | Engine Biosciences Pte. Ltd. | Bet polypeptide therapeutic agents for generating synthetic lethality in tumors |
| US20260076970A1 (en) * | 2022-09-09 | 2026-03-19 | Cardiff Oncology, Inc. | Cancer treatment using mtdp inhibitors and plk1 inhibitors |
| CN115737557B (zh) * | 2022-11-18 | 2024-04-09 | 黑龙江中医药大学 | 一种miR-55制剂及其制备方法和应用 |
| WO2024158825A2 (en) | 2023-01-23 | 2024-08-02 | Engine Biosciences Pte. Ltd. | Methods to modulate tau for treatment of tauopathies |
| TW202449152A (zh) | 2023-02-09 | 2024-12-16 | 美商艾拉倫製藥股份有限公司 | Reversir分子及其使用方法 |
Citations (126)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3817827A (en) | 1972-03-30 | 1974-06-18 | Scott Paper Co | Soft absorbent fibrous webs containing elastomeric bonding material and formed by creping and embossing |
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US3993754A (en) | 1974-10-09 | 1976-11-23 | The United States Of America As Represented By The United States Energy Research And Development Administration | Liposome-encapsulated actinomycin for cancer chemotherapy |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4145410A (en) | 1976-10-12 | 1979-03-20 | Sears Barry D | Method of preparing a controlled-release pharmaceutical preparation, and resulting composition |
| US4224179A (en) | 1977-08-05 | 1980-09-23 | Battelle Memorial Institute | Process for the preparation of liposomes in aqueous solution |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
| US4452901A (en) | 1980-03-20 | 1984-06-05 | Ciba-Geigy Corporation | Electrophoretically transferring electropherograms to nitrocellulose sheets for immuno-assays |
| US4522803A (en) | 1983-02-04 | 1985-06-11 | The Liposome Company, Inc. | Stable plurilamellar vesicles, their preparation and use |
| US4588578A (en) | 1983-08-08 | 1986-05-13 | The Liposome Company, Inc. | Lipid vesicles prepared in a monophase |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4737323A (en) | 1986-02-13 | 1988-04-12 | Liposome Technology, Inc. | Liposome extrusion method |
| US5208036A (en) | 1985-01-07 | 1993-05-04 | Syntex (U.S.A.) Inc. | N-(ω, (ω-1)-dialkyloxy)- and N-(ω, (ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| US5279833A (en) | 1990-04-04 | 1994-01-18 | Yale University | Liposomal transfection of nucleic acids into animal cells |
| US5283185A (en) | 1991-08-28 | 1994-02-01 | University Of Tennessee Research Corporation | Method for delivering nucleic acids into cells |
| US5286634A (en) | 1989-09-28 | 1994-02-15 | Stadler Joan K | Synergistic method for host cell transformation |
| US5426039A (en) | 1993-09-08 | 1995-06-20 | Bio-Rad Laboratories, Inc. | Direct molecular cloning of primer extended DNA containing an alkane diol |
| WO1995021931A1 (fr) | 1994-02-08 | 1995-08-17 | Rhone-Poulenc Rorer S.A. | Composition contenant des acides nucleiques, preparation et utilisations |
| WO1996002655A1 (fr) | 1994-07-13 | 1996-02-01 | Rhone-Poulenc Rorer S.A. | Composition contenant des acides nucleiques, preparation et utilisations |
| WO1996010390A1 (en) | 1994-09-30 | 1996-04-11 | Inex Pharmaceuticals Corp. | Novel compositions for the introduction of polyanionic materials into cells |
| US5580579A (en) | 1995-02-15 | 1996-12-03 | Nano Systems L.L.C. | Site-specific adhesion within the GI tract using nanoparticles stabilized by high molecular weight, linear poly (ethylene oxide) polymers |
| WO1996040964A2 (en) | 1995-06-07 | 1996-12-19 | Inex Pharmaceuticals Corporation | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| US5705385A (en) | 1995-06-07 | 1998-01-06 | Inex Pharmaceuticals Corporation | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| US5756122A (en) | 1995-06-07 | 1998-05-26 | Georgetown University | Liposomally encapsulated nucleic acids having high entrapment efficiencies, method of manufacturer and use thereof for transfection of targeted cells |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US5785992A (en) | 1994-09-30 | 1998-07-28 | Inex Pharmaceuticals Corp. | Compositions for the introduction of polyanionic materials into cells |
| US5792451A (en) | 1994-03-02 | 1998-08-11 | Emisphere Technologies, Inc. | Oral drug delivery compositions and methods |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US5820873A (en) | 1994-09-30 | 1998-10-13 | The University Of British Columbia | Polyethylene glycol modified ceramide lipids and liposome uses thereof |
| US5885613A (en) | 1994-09-30 | 1999-03-23 | The University Of British Columbia | Bilayer stabilizing components and their use in forming programmable fusogenic liposomes |
| US5908635A (en) | 1994-08-05 | 1999-06-01 | The United States Of America As Represented By The Department Of Health And Human Services | Method for the liposomal delivery of nucleic acids |
| US5981501A (en) | 1995-06-07 | 1999-11-09 | Inex Pharmaceuticals Corp. | Methods for encapsulating plasmids in lipid bilayers |
| US5998203A (en) | 1996-04-16 | 1999-12-07 | Ribozyme Pharmaceuticals, Inc. | Enzymatic nucleic acids containing 5'-and/or 3'-cap structures |
| WO2000003683A2 (en) | 1998-07-20 | 2000-01-27 | Inex Pharmaceuticals Corporation | Liposomal encapsulated nucleic acid-complexes |
| US6110745A (en) | 1997-07-24 | 2000-08-29 | Inex Pharmaceuticals Corp. | Preparation of lipid-nucleic acid particles using a solvent extraction and direct hydration method |
| WO2000050008A2 (en) | 1999-02-22 | 2000-08-31 | Georgetown University | Antibody fragment-targeted immunoliposomes for systemic gene delivery |
| WO2000062813A2 (en) | 1999-04-20 | 2000-10-26 | The University Of British Columbia | Cationic peg-lipids and methods of use |
| US6200599B1 (en) | 1999-10-07 | 2001-03-13 | The Regents Of The University Of California | Ortho ester lipids |
| US6207456B1 (en) | 1995-09-07 | 2001-03-27 | Opperbas Holding B.V. | Nucleic acid delivery vehicle |
| WO2001072283A1 (en) | 2000-03-29 | 2001-10-04 | Aradigm Corporation | Cationic liposomes |
| US6320017B1 (en) | 1997-12-23 | 2001-11-20 | Inex Pharmaceuticals Corp. | Polyamide oligomers |
| US20020072121A1 (en) | 2000-04-20 | 2002-06-13 | Lam Angela M.I. | Methods of enhancing SPLP-mediated transfection using endosomal membrane destabilizers |
| US20020160038A1 (en) | 1997-03-21 | 2002-10-31 | Georgetown University School Of Medicine | Liposomes containing oligonucleotides |
| WO2002096551A1 (de) | 2001-05-31 | 2002-12-05 | Novosom Ag | Auflösbare nano- und mikrokapseln, verfahren zu ihrer herstellung sowie ihre verwendung |
| US20020192274A1 (en) | 2001-03-26 | 2002-12-19 | Ponnappa Biddanda C. | pH sensitive liposomal drug delivery |
| US20020192275A1 (en) | 2001-03-26 | 2002-12-19 | Samuel Zalipsky | Liposome composition for improved intracellular delivery of a therapeutic agent |
| US6509323B1 (en) | 1998-07-01 | 2003-01-21 | California Institute Of Technology | Linear cyclodextrin copolymers |
| US20030026831A1 (en) | 2001-04-20 | 2003-02-06 | Aparna Lakkaraju | Anionic liposomes for delivery of bioactive agents |
| US20030031704A1 (en) | 1999-04-23 | 2003-02-13 | Alza Corporation | Liposome composition for delivery of nucleic acid |
| US20030035829A1 (en) | 1997-07-24 | 2003-02-20 | Townsend And Townsend And Crew | Liposomal compositions for the delivery of nucleic acid catalysts |
| US20030072794A1 (en) | 2000-06-09 | 2003-04-17 | Teni Boulikas | Encapsulation of plasmid DNA (lipogenes™) and therapeutic agents with nuclear localization signal/fusogenic peptide conjugates into targeted liposome complexes |
| EP1304160A1 (de) | 2001-10-19 | 2003-04-23 | Novosom AG | Stabilisierte Mischungen von Liposomen und Emulsionen |
| US20030077829A1 (en) | 2001-04-30 | 2003-04-24 | Protiva Biotherapeutics Inc.. | Lipid-based formulations |
| AU2002358514A1 (en) | 2001-11-18 | 2003-06-10 | Novosom Ag | Nanocapsules and microcapsules comprising reactive polymers and method for the production thereof |
| US20030108597A1 (en) | 2001-08-13 | 2003-06-12 | Chancellor Michael B. | Application of lipid vehicles and use for drug delivery |
| US6586410B1 (en) | 1995-06-07 | 2003-07-01 | Inex Pharmaceuticals Corporation | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| US20030125281A1 (en) | 2001-08-27 | 2003-07-03 | David Lewis | Compositions and processes using siRNA, amphipathic compounds and polycations |
| US20030130186A1 (en) | 2001-07-20 | 2003-07-10 | Chandra Vargeese | Conjugates and compositions for cellular delivery |
| US20030129221A1 (en) | 1997-05-14 | 2003-07-10 | Semple Sean C. | High efficiency encapsulation of charged therapeutic agents in lipid vesicles |
| WO2003057190A1 (en) | 2001-12-31 | 2003-07-17 | Elan Pharmaceuticals, Inc. | Efficient nucleic acid encapsulation into medium sized liposomes |
| WO2003059322A1 (en) | 2002-01-09 | 2003-07-24 | Elan Pharmaceuticals, Inc. | Efficient nucleic acid encapsulation into medium sized liposomes |
| WO2003066069A1 (en) | 2002-02-01 | 2003-08-14 | Intradigm Corporation | Polymers for delivering peptides and small molecules in vivo |
| US20030157030A1 (en) | 2001-11-02 | 2003-08-21 | Insert Therapeutics, Inc. | Methods and compositions for therapeutic use of rna interference |
| AU2003210303A1 (en) | 2002-02-19 | 2003-09-09 | Novosom Ag | Ph-sensitive cationic lipids, and liposomes and nanocapsules containing the same |
| US6620805B1 (en) | 1996-03-14 | 2003-09-16 | Yale University | Delivery of nucleic acids by porphyrins |
| US20030180950A1 (en) | 2002-03-22 | 2003-09-25 | Baylor College Of Medicine | Reversible masking of liposomal complexes for targeted delivery |
| US20030185890A1 (en) | 1996-08-13 | 2003-10-02 | Zuckermann Ronald N. | Compositions and methods for polynucleotide delivery |
| US20030198664A1 (en) | 2002-03-29 | 2003-10-23 | Sullivan Sean Michael | Lipid mediated screening of drug candidates for identification of active compounds |
| US20030203865A1 (en) | 2001-04-30 | 2003-10-30 | Pierrot Harvie | Lipid-comprising drug delivery complexes and methods for their production |
| US20030220289A1 (en) | 2002-05-24 | 2003-11-27 | Monahan Sean D. | Compositions for delivering nucleic acids to cells |
| US20030229040A1 (en) | 1997-03-21 | 2003-12-11 | Georgetown University | Cationic liposomal delivery system and therapeutic use thereof |
| WO2004002453A1 (en) | 2002-06-28 | 2004-01-08 | Protiva Biotherapeutics Ltd. | Method and apparatus for producing liposomes |
| US20040071654A1 (en) | 2000-10-10 | 2004-04-15 | Anderson Daniel G. | Biodegradable poly(beta-amino esters) and uses thereof |
| US20040087024A1 (en) | 2002-02-22 | 2004-05-06 | Insert Therapeutics, Inc. | Carbohydrate-modified polymers, compositions and uses related thereto |
| WO2004045543A2 (en) * | 2002-11-14 | 2004-06-03 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| US6747014B2 (en) | 1997-07-01 | 2004-06-08 | Isis Pharmaceuticals, Inc. | Compositions and methods for non-parenteral delivery of oligonucleotides |
| US20040110296A1 (en) | 2001-05-18 | 2004-06-10 | Ribozyme Pharmaceuticals, Inc. | Conjugates and compositions for cellular delivery |
| US6753423B1 (en) | 1990-01-11 | 2004-06-22 | Isis Pharmaceuticals, Inc. | Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals |
| US6756054B1 (en) | 1996-05-24 | 2004-06-29 | Ic-Vec Limited | Polycationic sterol derivatives as transfection agents |
| US20040142475A1 (en) | 2000-06-02 | 2004-07-22 | Barman Shikha P. | Delivery systems for bioactive agents |
| US6774180B2 (en) | 2000-12-18 | 2004-08-10 | Nektar Therapeutics Al, Corporation | Synthesis of high molecular weight non-peptidic polymer derivatives |
| US20040156909A1 (en) | 2003-02-07 | 2004-08-12 | Rozema David B. | Polyvinylethers for delivery of polynucleotides to mammalian cells |
| US20040167090A1 (en) | 2003-02-21 | 2004-08-26 | Monahan Sean D. | Covalent modification of RNA for in vitro and in vivo delivery |
| US20040192626A1 (en) | 2002-02-20 | 2004-09-30 | Mcswiggen James | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US20040249178A1 (en) | 2001-05-18 | 2004-12-09 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| WO2005007196A2 (en) | 2003-07-16 | 2005-01-27 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| US6852334B1 (en) | 1999-04-20 | 2005-02-08 | The University Of British Columbia | Cationic peg-lipids and methods of use |
| US20050037086A1 (en) | 1999-11-19 | 2005-02-17 | Zycos Inc., A Delaware Corporation | Continuous-flow method for preparing microparticles |
| US20050043219A1 (en) | 1991-10-24 | 2005-02-24 | Isis Pharmaceuticals, Inc. | Derivatized oligonucleotides having improved uptake and other properties |
| GB2397818B (en) | 2002-02-20 | 2005-03-09 | Sirna Therapeutics Inc | Rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2005026372A1 (en) | 2003-09-15 | 2005-03-24 | Protiva Biotherapeutics, Inc. | Polyethyleneglycol-modified lipid compounds and uses thereof |
| US20050074771A1 (en) | 1996-09-13 | 2005-04-07 | Isis Pharmaceuticals, Inc. | Carbamate-derivatized nucleosides and oligonucleosides |
| US6884789B2 (en) | 1998-07-01 | 2005-04-26 | California Institute Of Technology | Linear cyclodextrin copolymers |
| US20050107325A1 (en) | 2003-04-17 | 2005-05-19 | Muthiah Manoharan | Modified iRNA agents |
| US20050119470A1 (en) | 1996-06-06 | 2005-06-02 | Muthiah Manoharan | Conjugated oligomeric compounds and their use in gene modulation |
| US20050123600A1 (en) | 2001-01-02 | 2005-06-09 | Trubetskoy Vladimir S. | Compositions and methods for drug delivery using pH sensitive molecules |
| US6906186B1 (en) | 2002-07-30 | 2005-06-14 | Isis Pharmaceuticals, Inc. | Antisense modulation of polo-like kinase expression |
| US20050153337A1 (en) | 2003-04-03 | 2005-07-14 | Muthiah Manoharan | iRNA conjugates |
| CN1651450A (zh) | 2003-11-21 | 2005-08-10 | 杭州新瑞佳生物医药技术开发有限公司 | 有效杀伤肿瘤细胞的针对PLK1 mRNA的小干扰核糖核酸分子(SiRNA)、其混合物及用途 |
| US20050222064A1 (en) | 2002-02-20 | 2005-10-06 | Sirna Therapeutics, Inc. | Polycationic compositions for cellular delivery of polynucleotides |
| US20050234232A1 (en) | 1997-07-23 | 2005-10-20 | Sirna Therapeutics, Inc. | Novel compositions for the delivery of negatively charged molecules |
| US20050239739A1 (en) | 2001-05-18 | 2005-10-27 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| WO2005120152A2 (en) | 2004-06-07 | 2005-12-22 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods of use |
| WO2005121348A1 (en) | 2004-06-07 | 2005-12-22 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| US20050282188A1 (en) | 2001-05-18 | 2005-12-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA) |
| US7018609B2 (en) | 2000-12-19 | 2006-03-28 | California Institute Of Technology | Compositions containing inclusion complexes |
| US7053150B2 (en) | 2000-12-18 | 2006-05-30 | Nektar Therapeutics Al, Corporation | Segmented polymers and their conjugates |
| US20060211643A1 (en) | 2005-02-03 | 2006-09-21 | Agency For Science, Technology And Research | Polycations capable of forming complexes with nucleic acids |
| US20060240554A1 (en) | 2005-02-14 | 2006-10-26 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| US20070042031A1 (en) | 2005-07-27 | 2007-02-22 | Protiva Biotherapeutics, Inc. | Systems and methods for manufacturing liposomes |
| WO2007051303A1 (en) | 2005-11-02 | 2007-05-10 | Protiva Biotherapeutics, Inc. | MODIFIED siRNA MOLECULES AND USES THEREOF |
| US20070265438A1 (en) | 2002-11-14 | 2007-11-15 | Dharmacon, Inc. | siRNA targeting polo-like kinase-1 (PLK-1) |
| US7404969B2 (en) | 2005-02-14 | 2008-07-29 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| WO2009086558A1 (en) | 2008-01-02 | 2009-07-09 | Tekmira Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
| WO2010042877A1 (en) | 2008-10-09 | 2010-04-15 | Tekmira Pharmaceuticals Corporation | Improved amino lipids and methods for the delivery of nucleic acids |
Family Cites Families (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6465188B1 (en) * | 1990-06-11 | 2002-10-15 | Gilead Sciences, Inc. | Nucleic acid ligand complexes |
| US5334761A (en) * | 1992-08-28 | 1994-08-02 | Life Technologies, Inc. | Cationic lipids |
| US5578475A (en) * | 1993-07-12 | 1996-11-26 | Life Technologies, Inc. | Composition and methods for transfecting eukaryotic cells |
| US5674908A (en) * | 1993-12-20 | 1997-10-07 | Life Technologies, Inc. | Highly packed polycationic ammonium, sulfonium and phosphonium lipids |
| US6989434B1 (en) * | 1994-02-11 | 2006-01-24 | Invitrogen Corporation | Reagents for intracellular delivery of macromolecules |
| US6075012A (en) * | 1994-02-11 | 2000-06-13 | Life Technologies, Inc. | Reagents for intracellular delivery of macromolecules |
| US5627159A (en) * | 1994-10-27 | 1997-05-06 | Life Technologies, Inc. | Enhancement of lipid cationic transfections in the presence of serum |
| WO1996040726A1 (en) * | 1995-06-07 | 1996-12-19 | Genta Incorporated | Novel carbamate-based cationic lipids |
| US6051429A (en) * | 1995-06-07 | 2000-04-18 | Life Technologies, Inc. | Peptide-enhanced cationic lipid transfections |
| EP0840744A4 (en) * | 1995-06-07 | 1999-03-10 | Genta Inc | CATIONIC LIPIDS BASED ON PHOSPHONIC ACID |
| EP0874910A4 (en) * | 1995-06-07 | 1999-04-21 | Life Technologies Inc | ENHANCED CATIONIC LIPID TRANSFECTION BY PEPTIDES |
| US20030069173A1 (en) * | 1998-03-16 | 2003-04-10 | Life Technologies, Inc. | Peptide-enhanced transfections |
| US6339173B1 (en) * | 1996-07-22 | 2002-01-15 | Promega Biosciences, Inc. | Amide-based cationic lipids |
| US6020526A (en) * | 1995-07-21 | 2000-02-01 | Genta, Incorporated | Amide-based cationic lipids |
| US6330349B1 (en) * | 1995-11-30 | 2001-12-11 | Chromavision Medical Systems, Inc. | Automated method for image analysis of residual protein |
| US5877220A (en) * | 1997-03-06 | 1999-03-02 | Genta, Incorporated | Amide-based oligomeric cationic lipids |
| US6034135A (en) * | 1997-03-06 | 2000-03-07 | Promega Biosciences, Inc. | Dimeric cationic lipids |
| NZ512244A (en) * | 1998-11-12 | 2003-12-19 | Invitrogen Corp | Polycationic transfection reagents for introducing anions into a cell |
| EP1058310A3 (en) * | 1999-06-02 | 2009-11-18 | Sel Semiconductor Energy Laboratory Co., Ltd. | Semiconductor device and manufacturing method thereof |
| EP1337664A4 (en) * | 2000-10-27 | 2005-01-19 | Invitrogen Corp | METHOD FOR INTRODUCING ANTISENSE OLIGONUCLEOTIDES IN EUKARYOTIC CELLS |
| EP1386004A4 (en) * | 2001-04-05 | 2005-02-16 | Ribozyme Pharm Inc | MODULATION OF GENE EXPRESSION ASSOCIATED WITH INFLAMMATORY PROLIFERATION AND GROWTH OF NEURITIES BY METHODS INVOLVING NUCLEIC ACID |
| CA2515243A1 (en) * | 2002-02-22 | 2003-08-28 | Klaus Strebhardt | Agent for inhibiting development or progress of proliferative diseases and especially cancer diseases and pharmaceutical composition containing said agent |
| EP1773857A4 (en) * | 2004-07-02 | 2009-05-13 | Protiva Biotherapeutics Inc | THE IMMUNE SYSTEM STIMULATING SIRNA MOLECULES AND APPLICATIONS THEREOF |
| WO2006035515A1 (ja) | 2004-09-28 | 2006-04-06 | Univ Kyoto | 膀胱表在性癌の治療又は予防用医薬組成物、及びその利用 |
| CA2587411A1 (en) * | 2004-11-17 | 2006-05-26 | Protiva Biotherapeutics, Inc. | Sirna silencing of apolipoprotein b |
| US20060228406A1 (en) * | 2005-03-17 | 2006-10-12 | Invitrogen Corporation | Transfection reagent for non-adherent suspension cells |
| US20070054873A1 (en) * | 2005-08-26 | 2007-03-08 | Protiva Biotherapeutics, Inc. | Glucocorticoid modulation of nucleic acid-mediated immune stimulation |
| WO2007048046A2 (en) * | 2005-10-20 | 2007-04-26 | Protiva Biotherapeutics, Inc. | Sirna silencing of filovirus gene expression |
| US8598333B2 (en) * | 2006-05-26 | 2013-12-03 | Alnylam Pharmaceuticals, Inc. | SiRNA silencing of genes expressed in cancer |
| US7915399B2 (en) * | 2006-06-09 | 2011-03-29 | Protiva Biotherapeutics, Inc. | Modified siRNA molecules and uses thereof |
| US20080311040A1 (en) * | 2007-03-06 | 2008-12-18 | Flagship Ventures | METHODS AND COMPOSITIONS FOR IMPROVED THERAPEUTIC EFFECTS WITH siRNA |
| CA2707042A1 (en) * | 2007-12-10 | 2009-06-18 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of factor vii gene |
| ES2535419T3 (es) * | 2007-12-27 | 2015-05-11 | Protiva Biotherapeutics Inc. | Silenciamiento de expresión de quinasa tipo polo usando ARN interferente |
| CA2721333C (en) * | 2008-04-15 | 2020-12-01 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for nucleic acid delivery |
| WO2011000107A1 (en) * | 2009-07-01 | 2011-01-06 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for delivery of therapeutic agents to solid tumors |
| CN103380113B (zh) * | 2010-11-15 | 2018-03-30 | 生命科技公司 | 含胺的转染试剂及其制备和使用方法 |
-
2008
- 2008-12-23 ES ES08867007.0T patent/ES2535419T3/es active Active
- 2008-12-23 US US12/343,342 patent/US9006191B2/en active Active
- 2008-12-23 WO PCT/CA2008/002285 patent/WO2009082817A1/en not_active Ceased
- 2008-12-23 EP EP20080867007 patent/EP2238251B1/en active Active
- 2008-12-23 AU AU2008342535A patent/AU2008342535B2/en not_active Ceased
- 2008-12-23 CA CA2710713A patent/CA2710713C/en active Active
- 2008-12-23 JP JP2010539978A patent/JP5697988B2/ja not_active Expired - Fee Related
-
2015
- 2015-03-04 US US14/638,885 patent/US20160115483A1/en not_active Abandoned
Patent Citations (140)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3817827A (en) | 1972-03-30 | 1974-06-18 | Scott Paper Co | Soft absorbent fibrous webs containing elastomeric bonding material and formed by creping and embossing |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US3993754A (en) | 1974-10-09 | 1976-11-23 | The United States Of America As Represented By The United States Energy Research And Development Administration | Liposome-encapsulated actinomycin for cancer chemotherapy |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US4145410A (en) | 1976-10-12 | 1979-03-20 | Sears Barry D | Method of preparing a controlled-release pharmaceutical preparation, and resulting composition |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4224179A (en) | 1977-08-05 | 1980-09-23 | Battelle Memorial Institute | Process for the preparation of liposomes in aqueous solution |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4452901A (en) | 1980-03-20 | 1984-06-05 | Ciba-Geigy Corporation | Electrophoretically transferring electropherograms to nitrocellulose sheets for immuno-assays |
| US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
| US4522803A (en) | 1983-02-04 | 1985-06-11 | The Liposome Company, Inc. | Stable plurilamellar vesicles, their preparation and use |
| US4588578A (en) | 1983-08-08 | 1986-05-13 | The Liposome Company, Inc. | Lipid vesicles prepared in a monophase |
| US5208036A (en) | 1985-01-07 | 1993-05-04 | Syntex (U.S.A.) Inc. | N-(ω, (ω-1)-dialkyloxy)- and N-(ω, (ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US4683202B1 (https=) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683195B1 (https=) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4737323A (en) | 1986-02-13 | 1988-04-12 | Liposome Technology, Inc. | Liposome extrusion method |
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| US5286634A (en) | 1989-09-28 | 1994-02-15 | Stadler Joan K | Synergistic method for host cell transformation |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US6753423B1 (en) | 1990-01-11 | 2004-06-22 | Isis Pharmaceuticals, Inc. | Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals |
| US5279833A (en) | 1990-04-04 | 1994-01-18 | Yale University | Liposomal transfection of nucleic acids into animal cells |
| US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| US5283185A (en) | 1991-08-28 | 1994-02-01 | University Of Tennessee Research Corporation | Method for delivering nucleic acids into cells |
| US20050043219A1 (en) | 1991-10-24 | 2005-02-24 | Isis Pharmaceuticals, Inc. | Derivatized oligonucleotides having improved uptake and other properties |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US20050158727A1 (en) | 1992-10-23 | 2005-07-21 | Isis Pharmaceuticals, Inc. | Derivatized oligonucleotides having improved uptake and other properties |
| US5426039A (en) | 1993-09-08 | 1995-06-20 | Bio-Rad Laboratories, Inc. | Direct molecular cloning of primer extended DNA containing an alkane diol |
| WO1995021931A1 (fr) | 1994-02-08 | 1995-08-17 | Rhone-Poulenc Rorer S.A. | Composition contenant des acides nucleiques, preparation et utilisations |
| US5792451A (en) | 1994-03-02 | 1998-08-11 | Emisphere Technologies, Inc. | Oral drug delivery compositions and methods |
| WO1996002655A1 (fr) | 1994-07-13 | 1996-02-01 | Rhone-Poulenc Rorer S.A. | Composition contenant des acides nucleiques, preparation et utilisations |
| US6013240A (en) | 1994-07-13 | 2000-01-11 | Rhone-Poulenc Rorer Sa | Nucleic acid containing composition, preparation and uses of same |
| US5908635A (en) | 1994-08-05 | 1999-06-01 | The United States Of America As Represented By The Department Of Health And Human Services | Method for the liposomal delivery of nucleic acids |
| US5753613A (en) | 1994-09-30 | 1998-05-19 | Inex Pharmaceuticals Corporation | Compositions for the introduction of polyanionic materials into cells |
| US5785992A (en) | 1994-09-30 | 1998-07-28 | Inex Pharmaceuticals Corp. | Compositions for the introduction of polyanionic materials into cells |
| WO1996010390A1 (en) | 1994-09-30 | 1996-04-11 | Inex Pharmaceuticals Corp. | Novel compositions for the introduction of polyanionic materials into cells |
| US5820873A (en) | 1994-09-30 | 1998-10-13 | The University Of British Columbia | Polyethylene glycol modified ceramide lipids and liposome uses thereof |
| US5885613A (en) | 1994-09-30 | 1999-03-23 | The University Of British Columbia | Bilayer stabilizing components and their use in forming programmable fusogenic liposomes |
| US5580579A (en) | 1995-02-15 | 1996-12-03 | Nano Systems L.L.C. | Site-specific adhesion within the GI tract using nanoparticles stabilized by high molecular weight, linear poly (ethylene oxide) polymers |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| US5981501A (en) | 1995-06-07 | 1999-11-09 | Inex Pharmaceuticals Corp. | Methods for encapsulating plasmids in lipid bilayers |
| US5705385A (en) | 1995-06-07 | 1998-01-06 | Inex Pharmaceuticals Corporation | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| US5976567A (en) | 1995-06-07 | 1999-11-02 | Inex Pharmaceuticals Corp. | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| US6586410B1 (en) | 1995-06-07 | 2003-07-01 | Inex Pharmaceuticals Corporation | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| WO1996040964A2 (en) | 1995-06-07 | 1996-12-19 | Inex Pharmaceuticals Corporation | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
| US5756122A (en) | 1995-06-07 | 1998-05-26 | Georgetown University | Liposomally encapsulated nucleic acids having high entrapment efficiencies, method of manufacturer and use thereof for transfection of targeted cells |
| US6534484B1 (en) | 1995-06-07 | 2003-03-18 | Inex Pharmaceuticals Corp. | Methods for encapsulating plasmids in lipid bilayers |
| US6207456B1 (en) | 1995-09-07 | 2001-03-27 | Opperbas Holding B.V. | Nucleic acid delivery vehicle |
| US6620805B1 (en) | 1996-03-14 | 2003-09-16 | Yale University | Delivery of nucleic acids by porphyrins |
| US5998203A (en) | 1996-04-16 | 1999-12-07 | Ribozyme Pharmaceuticals, Inc. | Enzymatic nucleic acids containing 5'-and/or 3'-cap structures |
| US6756054B1 (en) | 1996-05-24 | 2004-06-29 | Ic-Vec Limited | Polycationic sterol derivatives as transfection agents |
| US20050119470A1 (en) | 1996-06-06 | 2005-06-02 | Muthiah Manoharan | Conjugated oligomeric compounds and their use in gene modulation |
| US20030185890A1 (en) | 1996-08-13 | 2003-10-02 | Zuckermann Ronald N. | Compositions and methods for polynucleotide delivery |
| US20050074771A1 (en) | 1996-09-13 | 2005-04-07 | Isis Pharmaceuticals, Inc. | Carbamate-derivatized nucleosides and oligonucleosides |
| US20020160038A1 (en) | 1997-03-21 | 2002-10-31 | Georgetown University School Of Medicine | Liposomes containing oligonucleotides |
| US20030229040A1 (en) | 1997-03-21 | 2003-12-11 | Georgetown University | Cationic liposomal delivery system and therapeutic use thereof |
| US20030129221A1 (en) | 1997-05-14 | 2003-07-10 | Semple Sean C. | High efficiency encapsulation of charged therapeutic agents in lipid vesicles |
| US20050008689A1 (en) | 1997-05-14 | 2005-01-13 | Inex Pharmaceuticals Corporation | High efficiency encapsulation of charged therapeutic agents in lipid vesicles |
| US6747014B2 (en) | 1997-07-01 | 2004-06-08 | Isis Pharmaceuticals, Inc. | Compositions and methods for non-parenteral delivery of oligonucleotides |
| US20050234232A1 (en) | 1997-07-23 | 2005-10-20 | Sirna Therapeutics, Inc. | Novel compositions for the delivery of negatively charged molecules |
| US20030035829A1 (en) | 1997-07-24 | 2003-02-20 | Townsend And Townsend And Crew | Liposomal compositions for the delivery of nucleic acid catalysts |
| US6110745A (en) | 1997-07-24 | 2000-08-29 | Inex Pharmaceuticals Corp. | Preparation of lipid-nucleic acid particles using a solvent extraction and direct hydration method |
| US6586559B2 (en) | 1997-12-23 | 2003-07-01 | Inex Pharmaceuticals Corporation | Polyamide oligomers |
| US6320017B1 (en) | 1997-12-23 | 2001-11-20 | Inex Pharmaceuticals Corp. | Polyamide oligomers |
| US6884789B2 (en) | 1998-07-01 | 2005-04-26 | California Institute Of Technology | Linear cyclodextrin copolymers |
| US7091192B1 (en) | 1998-07-01 | 2006-08-15 | California Institute Of Technology | Linear cyclodextrin copolymers |
| US6509323B1 (en) | 1998-07-01 | 2003-01-21 | California Institute Of Technology | Linear cyclodextrin copolymers |
| WO2000003683A2 (en) | 1998-07-20 | 2000-01-27 | Inex Pharmaceuticals Corporation | Liposomal encapsulated nucleic acid-complexes |
| WO2000050008A2 (en) | 1999-02-22 | 2000-08-31 | Georgetown University | Antibody fragment-targeted immunoliposomes for systemic gene delivery |
| WO2000062813A2 (en) | 1999-04-20 | 2000-10-26 | The University Of British Columbia | Cationic peg-lipids and methods of use |
| US6852334B1 (en) | 1999-04-20 | 2005-02-08 | The University Of British Columbia | Cationic peg-lipids and methods of use |
| US20030031704A1 (en) | 1999-04-23 | 2003-02-13 | Alza Corporation | Liposome composition for delivery of nucleic acid |
| US6200599B1 (en) | 1999-10-07 | 2001-03-13 | The Regents Of The University Of California | Ortho ester lipids |
| US20050037086A1 (en) | 1999-11-19 | 2005-02-17 | Zycos Inc., A Delaware Corporation | Continuous-flow method for preparing microparticles |
| US20020012998A1 (en) | 2000-03-29 | 2002-01-31 | Igor Gonda | Cationic liposomes |
| WO2001072283A1 (en) | 2000-03-29 | 2001-10-04 | Aradigm Corporation | Cationic liposomes |
| US20020072121A1 (en) | 2000-04-20 | 2002-06-13 | Lam Angela M.I. | Methods of enhancing SPLP-mediated transfection using endosomal membrane destabilizers |
| US20040142475A1 (en) | 2000-06-02 | 2004-07-22 | Barman Shikha P. | Delivery systems for bioactive agents |
| US20030072794A1 (en) | 2000-06-09 | 2003-04-17 | Teni Boulikas | Encapsulation of plasmid DNA (lipogenes™) and therapeutic agents with nuclear localization signal/fusogenic peptide conjugates into targeted liposome complexes |
| US20040071654A1 (en) | 2000-10-10 | 2004-04-15 | Anderson Daniel G. | Biodegradable poly(beta-amino esters) and uses thereof |
| US6774180B2 (en) | 2000-12-18 | 2004-08-10 | Nektar Therapeutics Al, Corporation | Synthesis of high molecular weight non-peptidic polymer derivatives |
| US7053150B2 (en) | 2000-12-18 | 2006-05-30 | Nektar Therapeutics Al, Corporation | Segmented polymers and their conjugates |
| US7018609B2 (en) | 2000-12-19 | 2006-03-28 | California Institute Of Technology | Compositions containing inclusion complexes |
| US20050123600A1 (en) | 2001-01-02 | 2005-06-09 | Trubetskoy Vladimir S. | Compositions and methods for drug delivery using pH sensitive molecules |
| US20020192274A1 (en) | 2001-03-26 | 2002-12-19 | Ponnappa Biddanda C. | pH sensitive liposomal drug delivery |
| US20020192275A1 (en) | 2001-03-26 | 2002-12-19 | Samuel Zalipsky | Liposome composition for improved intracellular delivery of a therapeutic agent |
| US20030026831A1 (en) | 2001-04-20 | 2003-02-06 | Aparna Lakkaraju | Anionic liposomes for delivery of bioactive agents |
| US20030203865A1 (en) | 2001-04-30 | 2003-10-30 | Pierrot Harvie | Lipid-comprising drug delivery complexes and methods for their production |
| US20030077829A1 (en) | 2001-04-30 | 2003-04-24 | Protiva Biotherapeutics Inc.. | Lipid-based formulations |
| US20040249178A1 (en) | 2001-05-18 | 2004-12-09 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US20050282188A1 (en) | 2001-05-18 | 2005-12-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA) |
| US20050239739A1 (en) | 2001-05-18 | 2005-10-27 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US20040110296A1 (en) | 2001-05-18 | 2004-06-10 | Ribozyme Pharmaceuticals, Inc. | Conjugates and compositions for cellular delivery |
| WO2002096551A1 (de) | 2001-05-31 | 2002-12-05 | Novosom Ag | Auflösbare nano- und mikrokapseln, verfahren zu ihrer herstellung sowie ihre verwendung |
| US20030130186A1 (en) | 2001-07-20 | 2003-07-10 | Chandra Vargeese | Conjugates and compositions for cellular delivery |
| US20030108597A1 (en) | 2001-08-13 | 2003-06-12 | Chancellor Michael B. | Application of lipid vehicles and use for drug delivery |
| US20030125281A1 (en) | 2001-08-27 | 2003-07-03 | David Lewis | Compositions and processes using siRNA, amphipathic compounds and polycations |
| EP1304160A1 (de) | 2001-10-19 | 2003-04-23 | Novosom AG | Stabilisierte Mischungen von Liposomen und Emulsionen |
| US20030157030A1 (en) | 2001-11-02 | 2003-08-21 | Insert Therapeutics, Inc. | Methods and compositions for therapeutic use of rna interference |
| AU2002358514A1 (en) | 2001-11-18 | 2003-06-10 | Novosom Ag | Nanocapsules and microcapsules comprising reactive polymers and method for the production thereof |
| WO2003057190A1 (en) | 2001-12-31 | 2003-07-17 | Elan Pharmaceuticals, Inc. | Efficient nucleic acid encapsulation into medium sized liposomes |
| WO2003059322A1 (en) | 2002-01-09 | 2003-07-24 | Elan Pharmaceuticals, Inc. | Efficient nucleic acid encapsulation into medium sized liposomes |
| WO2003066069A1 (en) | 2002-02-01 | 2003-08-14 | Intradigm Corporation | Polymers for delivering peptides and small molecules in vivo |
| AU2003210303A1 (en) | 2002-02-19 | 2003-09-09 | Novosom Ag | Ph-sensitive cationic lipids, and liposomes and nanocapsules containing the same |
| US20050222064A1 (en) | 2002-02-20 | 2005-10-06 | Sirna Therapeutics, Inc. | Polycationic compositions for cellular delivery of polynucleotides |
| US20040192626A1 (en) | 2002-02-20 | 2004-09-30 | Mcswiggen James | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| GB2397818B (en) | 2002-02-20 | 2005-03-09 | Sirna Therapeutics Inc | Rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US20040087024A1 (en) | 2002-02-22 | 2004-05-06 | Insert Therapeutics, Inc. | Carbohydrate-modified polymers, compositions and uses related thereto |
| US20030180950A1 (en) | 2002-03-22 | 2003-09-25 | Baylor College Of Medicine | Reversible masking of liposomal complexes for targeted delivery |
| US20030198664A1 (en) | 2002-03-29 | 2003-10-23 | Sullivan Sean Michael | Lipid mediated screening of drug candidates for identification of active compounds |
| US20030220289A1 (en) | 2002-05-24 | 2003-11-27 | Monahan Sean D. | Compositions for delivering nucleic acids to cells |
| WO2004002453A1 (en) | 2002-06-28 | 2004-01-08 | Protiva Biotherapeutics Ltd. | Method and apparatus for producing liposomes |
| US20040142025A1 (en) | 2002-06-28 | 2004-07-22 | Protiva Biotherapeutics Ltd. | Liposomal apparatus and manufacturing methods |
| US6906186B1 (en) | 2002-07-30 | 2005-06-14 | Isis Pharmaceuticals, Inc. | Antisense modulation of polo-like kinase expression |
| WO2004045543A2 (en) * | 2002-11-14 | 2004-06-03 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| US20070265438A1 (en) | 2002-11-14 | 2007-11-15 | Dharmacon, Inc. | siRNA targeting polo-like kinase-1 (PLK-1) |
| US20040156909A1 (en) | 2003-02-07 | 2004-08-12 | Rozema David B. | Polyvinylethers for delivery of polynucleotides to mammalian cells |
| US20040167090A1 (en) | 2003-02-21 | 2004-08-26 | Monahan Sean D. | Covalent modification of RNA for in vitro and in vivo delivery |
| US20050153337A1 (en) | 2003-04-03 | 2005-07-14 | Muthiah Manoharan | iRNA conjugates |
| US20050107325A1 (en) | 2003-04-17 | 2005-05-19 | Muthiah Manoharan | Modified iRNA agents |
| WO2005007196A2 (en) | 2003-07-16 | 2005-01-27 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| WO2005026372A1 (en) | 2003-09-15 | 2005-03-24 | Protiva Biotherapeutics, Inc. | Polyethyleneglycol-modified lipid compounds and uses thereof |
| CN1651450A (zh) | 2003-11-21 | 2005-08-10 | 杭州新瑞佳生物医药技术开发有限公司 | 有效杀伤肿瘤细胞的针对PLK1 mRNA的小干扰核糖核酸分子(SiRNA)、其混合物及用途 |
| WO2005121348A1 (en) | 2004-06-07 | 2005-12-22 | Protiva Biotherapeutics, Inc. | Lipid encapsulated interfering rna |
| WO2005120152A2 (en) | 2004-06-07 | 2005-12-22 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods of use |
| US20060083780A1 (en) | 2004-06-07 | 2006-04-20 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods of use |
| US20060211643A1 (en) | 2005-02-03 | 2006-09-21 | Agency For Science, Technology And Research | Polycations capable of forming complexes with nucleic acids |
| US20060240554A1 (en) | 2005-02-14 | 2006-10-26 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| US7404969B2 (en) | 2005-02-14 | 2008-07-29 | Sirna Therapeutics, Inc. | Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules |
| US20070042031A1 (en) | 2005-07-27 | 2007-02-22 | Protiva Biotherapeutics, Inc. | Systems and methods for manufacturing liposomes |
| WO2007051303A1 (en) | 2005-11-02 | 2007-05-10 | Protiva Biotherapeutics, Inc. | MODIFIED siRNA MOLECULES AND USES THEREOF |
| US20070135372A1 (en) | 2005-11-02 | 2007-06-14 | Protiva Biotherapeutics, Inc. | Modified siRNA molecules and uses thereof |
| WO2009086558A1 (en) | 2008-01-02 | 2009-07-09 | Tekmira Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
| WO2010042877A1 (en) | 2008-10-09 | 2010-04-15 | Tekmira Pharmaceuticals Corporation | Improved amino lipids and methods for the delivery of nucleic acids |
Non-Patent Citations (210)
| Title |
|---|
| "Current Protocols in Molecular Biology" |
| "REMINGTON'S PHARMACEUTICAL SCIENCES, 17th ed.", 1985, MACK PUBLISHING COMPANY |
| "REMINGTON'S PHARMACEUTICAL SCIENCES, 18TH ED.,", 1990, MACK PUBLISHING CO. |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., NUC. ACIDS RES., vol. 25, 1977, pages 3389 - 3402 |
| AMBEGIA, E. ET AL.: "Stabilized plasmid-lipid particles containing PEG- diacylglycerols exhibit extended circulation lifetimes and tumor selective gene expression", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1669, 2005, pages 155 - 163, XP004890715, DOI: doi:10.1016/j.bbamem.2005.02.001 |
| ANGERER ET AL., METHODS ENZYMOL., vol. 152, 1987, pages 649 |
| ARNAUD ET AL., CHROMOSOMA, vol. 107, 1998, pages 424 - 429 |
| ARNHEIM; LEVINSON, C&EN, 1 October 1990 (1990-10-01), pages 36 |
| AUSUBEL ET AL.,: "Current Protocols in Molecular Biology", 1994 |
| AUSUBEL ET AL.,: "Current Protocols in Molecular Biology", 1995 |
| AUSUBEL ET AL.: "SHORT PROTOCOLS IN MOLECULAR BIOLOGY", 2002, GREENE PUBLISHING ASSOCIATES, INC. AND JOHN WILEY & SONS, INC. |
| BARR ET AL., NAT. REV. MOL. CELL BIOL., vol. 5, 2004, pages 429 - 440 |
| BARR, F.A.; SILLJE, H.H.; NIGG, E.A.: "Polo-like kinases and the orchestration of cell division", NAT REV MOL CELL BIOL, vol. 5, 2004, pages 429 - 440 |
| BARRINGER ET AL., GENE, vol. 89, 1990, pages 117 |
| BARTLETT, D.W.; DAVIS, M.E.: "Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging", NUCLEIC ACIDS RES, vol. 34, 2006, pages 322 - 333 |
| BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 5081 |
| BEAUCAGE ET AL., TETRAHEDRON LETTS., vol. 22, 1981, pages 1859 - 1862 |
| BEAUCAGE ET AL., TETRAHEDRON, vol. 49, 1993, pages 1925 |
| BEHLKE, M.A.: "Progress towards in vivo use of siRNAs", MOL THER., vol. 13, 2006, pages 644 - 670, XP005358601, DOI: doi:10.1016/j.ymthe.2006.01.001 |
| BEHLKE, MOL. THER., vol. 13, 2006, pages 644 - 670 |
| BEHR, ACC. CHEM. RES., vol. 26, 1993, pages 274 |
| BERNSTEIN ET AL., NATURE, vol. 409, 2001, pages 363 - 366 |
| BOWEN-POPE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 2396 - 2400 |
| BRIGHAM ET AL., AM. J. SCI., vol. 298, 1989, pages 278 |
| BROOKS ET AL., CLIN. EXP. IMMUNOL., vol. 39, 1980, pages 477 |
| BROWN ET AL., J. BIOL. CHEM., vol. 255, 1980, pages 4980 - 4983 |
| BUHRING ET AL., HYBRIDOMA, vol. 10, no. 1, 1991, pages 77 - 78 |
| BUHTOIAROV, I.N.; LUM, H.D.; BERKE, G.; SONDEL, P.M.; RAKHMILEVICH, A.L.: "Synergistic activation of macrophages via CD40 and TLR9 results in T cell independent antitumor effects", JIMMUNOL, vol. 176, 2006, pages 309 - 318 |
| BYROM ET AL., AMBION TECHNOTES, vol. 10, no. 1, 2003, pages 4 - 6 |
| CALEGARI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 14236 |
| CASTRO, J.E. ET AL.: "Thymidine-phosphorothioate oligonucleotides induce activation and apoptosis of CLL cells independently of CpG motifs or BCL-2 gene interference", LEUKEMIA, vol. 20, 2006, pages 680 - 688 |
| CEKAITE, L. ET AL.: "Gene Expression Analysis in Blood Cells in Response to Unmodified and 2'-Modified siRNA Reveals TLR- dependent and Independent Effects.", J. MOL. BIOL., vol. 365, no. 1, January 2007 (2007-01-01), pages 90 - 108, XP005728210 * |
| CHEN ET AL., BIOCONJ. CHEM., vol. 11, 2000, pages 433 - 437 |
| CHIU, Y.; RANA, T., SIRNA FUNCTION IN RNAI: A CHEMICAL, 2003 |
| CHONO, S.; LI, S.D.; CONWELL, C.C.; HUANG, L: "An efficient and low immunostimulatory nanoparticle formulation for systemic siRNA delivery to the tumor", J CONTROL RELEASE, vol. 131, 2008, pages 64 - 69, XP025506370, DOI: doi:10.1016/j.jconrel.2008.07.006 |
| CULVER: "HUMAN GENE THERAPY", 1994, MARYANN LIEBERT, INC., pages: 70 - 71 |
| CZAUDERNA, F. ET AL.: "Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells", NUCL. ACIDS RES., vol. 31, 2003, pages 2705 - 2716 |
| DE FOUGEROLLES, A.; VORNLOCHER, H.P.; MARAGANORE, J.; LIEBERMAN, J.: "Interfering with disease: a progress report on siRNA-based therapeutics", NAT REV DRUG DISCOV, vol. 6, 2007, pages 443 - 453 |
| DENLI ET AL., NATURE, vol. 432, 2004, pages 231 - 235 |
| DER, S.D.; ZHOU, A.; WILLIAMS, B.R.; SILVERMAN, R.H.: "Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays", PROC NATL ACAD SCI USA, vol. 95, 1998, pages 15623 - 15628, XP002229726, DOI: doi:10.1073/pnas.95.26.15623 |
| DIEBOLD, S.S. ET AL.: "Nucleic acid agonists for Toll-like receptor 7 are defined by the presence of uridine ribonucleotides", EURJIMMUNOL, vol. 36, 2006, pages 3256 - 3267, XP008101287, DOI: doi:10.1002/eji.200636617 |
| ELBASHIR ET AL., EMBO J., vol. 20, 2001, pages 6877 - 6888 |
| ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 |
| ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 - 200 |
| ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498 |
| ELBASHIR, S.M. ET AL.: "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells", NATURE, vol. 411, 2001, pages 494 - 498, XP002529540, DOI: doi:10.1038/35078107 |
| ELBASHIR, S.M.; LENDECKEL, W.; TUSCHL, T.: "RNA interference is mediated by 2 1 - and 22-nucleotide RNAs", GENES DEV., vol. 15, 2001, pages 188 - 200, XP002206453, DOI: doi:10.1101/gad.862301 |
| ELEZ ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 209, 2000, pages 352 - 356 |
| FOUGEROLLES ET AL., NAT. REV. DRUG DISCOV., vol. 6, 2007, pages 443 - 453 |
| FRESHNEY: "Culture of Animal Cells, a Manual of Basic Technique", 1994, WILEY-LISS |
| FURNISS: "VOGEL'S TEXTBOOK OF PRACTICAL ORGANIC CHEMISTRY", 1989, LONGMAN |
| GEISS, G. ET AL.: "A comprehensive view of regulation of gene expression by double-stranded RNA-mediated cell signaling", JBIOL CHEM, vol. 276, 2001, pages 30178 - 30182, XP002453475 |
| GILLIET ET AL., J. EXP. MED., vol. 195, pages 953 - 958 |
| GILLIET, M. ET AL.: "The development of murine plasmacytoid dendritic cell precursors is differentially regulated by FLT3-ligand and granulocyte/macrophage colony- stimulating factor", J EXP MED, vol. 195, 2002, pages 953 - 958, XP055248091, DOI: doi:10.1084/jem.20020045 |
| GOLSTEYN ET AL., J. CELL. BIOL., vol. 129, 1995, pages 1617 - 1628 |
| GOLSTEYN ET AL., J. CELL. SCI., vol. 107, 1994, pages 1509 - 1517 |
| GREEN; WUTS: "PROTECTIVE GROUPS IN ORGANIC SYNTHESIS", 1991, WILEY |
| GREGORY ET AL., CELL, vol. 123, 2005, pages 631 - 640 |
| GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 |
| GUBLER; HOFFMAN, GENE, vol. 25, 1983, pages 263 - 269 |
| HALL ET AL., NUCLEIC ACIDS RES., vol. 32, 2004, pages 5991 - 6000 |
| HAMANAKA ET AL., CELL. GROWTH DIFFER., vol. 5, 1994, pages 249 - 257 |
| HAMANAKA ET AL., J. BIOL. CHEM., vol. 270, 1995, pages 21086 - 21091 |
| HAMES AND HIGGINS,: "Nucleic Acid Hybridization, A Practical Approach", 1985, IRL PRESS |
| HAMMOND ET AL., NAT. REV. GENET., vol. 2, 2001, pages 110 - 119 |
| HARLOW; LANE: "ANTIBODIES, A LABORATORY MANUAL", 1999, COLD SPRING HARBOR PUBLICATION |
| HEIDEL ET AL., PROC. NATL. ACAD. SCI. USA, vol. 104, 2007, pages 5715 - 5721 |
| HEIDEL, J.D. ET AL.: "Administration in non-human primates of escalating intravenous doses of targeted nanoparticles containing ribonucleotide reductase subunit M2 siRNA", PROC NATL ACAD SCI US A, vol. 104, 2007, pages 5715 - 5721, XP002609879, DOI: doi:10.1073/PNAS.0701458104 |
| HEYES, J.; HALL, K.; TAILOR, V.; LENZ, R.; MACLACHLAN, I: "Synthesis and characterisation of novel poly(ethylene glycol)-lipid conjugates suitable for use in drug delivery", JOURNAL OF CONTROLLED RELEASE, vol. 112, 2006, pages 280 - 290, XP024957509, DOI: doi:10.1016/j.jconrel.2006.02.012 |
| HOLTRICH ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 91, 1994, pages 1736 - 1740 |
| HORNUNG, V. ET AL.: "5'-Triphosphate RNA is the ligand for RIG-I", SCIENCE, vol. 314, 2006, pages 994 - 997, XP002428032, DOI: doi:10.1126/science.1132505 |
| HORNUNG, V. ET AL.: "Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7", NAT MED, vol. 11, 2005, pages 263 - 270 |
| HUNZIKER ET AL.: "Modern Synthetic Methods", 1995, VCH, article "Nucleic Acid Analogues: Synthesis and Properties", pages: 331 - 417 |
| INNIS ET AL.: "PCR Protocols, A Guide to Methods and Applications", 1990, ACADEMIC PRESS INC. |
| INNIS ET AL.: "PCR Protocols, A Guide to Methods and Applications", 1990, ACADEMIC PRESS, INC. |
| INNIS ET AL.: "PCR Protocols: A Guide to Methods and Applications", 1990 |
| JOHNSON, E.F.; STEWART, K.D.; WOODS, K.W.; GIRANDA, V.L.; LUO, Y.: "Pharmacological and functional comparison of the polo-like kinase family: insight into inhibitor and substrate specificity", BIOCHEMISTRY, vol. 46, 2007, pages 9551 - 9563, XP002537861, DOI: doi:10.1021/bi7008745 |
| JUDGE ET AL., MOL. THER., vol. 13, 2006, pages 328 - 337 |
| JUDGE ET AL., MOL. THER., vol. 13, 2006, pages 494 - 505 |
| JUDGE ET AL., MOL. THER., vol. 13, no. 3, 2006, pages 494 - 505 |
| JUDGE, A.; MACLACHLAN, I.: "Overcoming the innate immune response to small interfering RNA", HUM GENE THER, vol. 19, 2008, pages 111 - 124, XP055046609, DOI: doi:10.1089/hum.2007.179 |
| JUDGE, A.D. ET AL.: "Design of Noninflammatory Synthetic siRNA Mediating Potent Gene Silencing in Vivo.", MOL. THER., vol. 13, no. 3, 2006, pages 494 - 505, XP005326762 * |
| JUDGE, A.D. ET AL.: "Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA", NAT BIOTECHNOL, vol. 23, 2005, pages 457 - 462, XP002371480, DOI: doi:10.1038/nbt1081 |
| JUDGE, A.D.; BOLA, G.; LEE, A.C.; MACLACHLAN, I.: "Design of non- inflammatory synthetic siRNA mediating potent gene silencing in vivo", MOL THER, vol. 13, 2006, pages 494 - 505 |
| KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787 |
| KAWASAKI ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 981 - 987 |
| KHVOROVA ET AL., CELL, vol. 115, 2003, pages 209 - 216 |
| KLEINMAN, M.E. ET AL.: "Sequence and target-independent angiogenesis suppression by siRNA via TLR3", NATURE, vol. 452, 2008, pages 591 - 597 |
| KNECHT ET AL., CANCER RES., vol. 59, 1999, pages 2794 - 2797 |
| KNIGHT ET AL., SCIENCE, vol. 293, 2001, pages 2269 - 2271 |
| KNIGHT, S.D.; PARRISH, C.A.: "Recent progress in the identification and clinical evaluation of inhibitors of the mitotic kinesin KSP", CURR TOP MED CHEM, vol. 8, 2008, pages 888 - 904 |
| KOHLER ET AL., NATURE, vol. 256, 1975, pages 495 - 497 |
| KOTANI ET AL., MOL. CELL, vol. 1, 1998, pages 371 - 380 |
| KRIEG, A.M.: "CpG motifs in bacterial DNA and their immune effects", ANNU. REV. IMMUNOL., vol. 20, 2002, pages 709 - 760, XP009016455, DOI: doi:10.1146/annurev.immunol.20.100301.064842 |
| KRIEG, A.M.: "Therapeutic potential of Toll-like receptor 9 activation", NAT REV DRUG DISCOV, vol. 5, 2006, pages 471 - 484, XP008109144, DOI: doi:10.1038/nrd2059 |
| KRIEGLER: "Gene Transfer and Expression: A Laboratory Manual", 1990 |
| KUCHLER ET AL.: "Biochemical Methods in Cell Culture and Virology", 1977, HUTCHINSON AND ROSS, INC. |
| KUKOWSKA-LATALLO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 4897 - 4902 |
| KWOH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 1173 |
| LAGOS-QUINTANA ET AL., SCIENCE, vol. 294, pages 853 - 858 |
| LAKE ET AL., MOL. CELL. BIOL., vol. 13, 1993, pages 7793 - 7801 |
| LANDEGREN ET AL., SCIENCE, vol. 241, 1988, pages 1077 |
| LANE ET AL., J. CELL. BIOL., vol. 135, 1996, pages 1701 - 1713 |
| LANUTI, M. ET AL.: "Cationic lipid:bacterial DNA complexes elicit adaptive cellular immunity in murine intraperitoneal tumor models", CANCER RES, vol. 60, 2000, pages 2955 - 2963 |
| LAROCK: "COMPREHENSIVE ORGANIC TRANSFORMATIONS", 1989, VCH |
| LAU ET AL., SCIENCE, vol. 294, pages 858 - 862 |
| LEE ET AL., SCIENCE, vol. 294, pages 862 - 864 |
| LENART, P. ET AL.: "The small-molecule inhibitor BI 2536 reveals novel insights into mitotic roles of polo-like kinase 1", CURR BIOL, vol. 17, 2007, pages 304 - 315, XP005890943, DOI: doi:10.1016/j.cub.2006.12.046 |
| LEUSCHNER, P.J.; AMERES, S.L.; KUENG, S.; MARTINEZ, J: "Cleavage of the siRNA passenger strand during RISC assembly in human cells", EMBO REP, vol. 7, 2006, pages 314 - 320, XP002443952, DOI: doi:10.1038/sj.embor.7400637 |
| LIN ET AL., J. AM. CHEM. SOC., vol. 120, 1998, pages 8531 - 8532 |
| LIU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 5789 - 5794 |
| LIU X. ET AL.: "Normal Cells, but Not Cancer Cells, Survive Severe Plkl Depletion.", MOL. CELL. BIOL., vol. 26, no. 6, 2006, pages 2093 - 2108, XP002482341 * |
| LIU, X.; ERIKSON, R.L: "Polo-like kinase (Plk)l depletion induces apoptosis in cancer cells", PROC NATL ACAD SCI USA, vol. 100, 2003, pages 5789 - 5794 |
| LLOVET ET AL., J. HEPATOL., vol. 48, no. 1, 2008, pages 20 - 37 |
| LLOVET ET AL., J. NATL. CANCER INST., vol. 100, 2008, pages 698 - 711 |
| LLOVET, J.M.; BRUIX, J.: "Novel advancements in the management of hepatocellular carcinoma in 2008", JHEPATOL, vol. 48, no. I, 2008, pages S20 - 37, XP022534900, DOI: doi:10.1016/j.jhep.2008.01.022 |
| LOAKES, NUCL. ACIDS RES., vol. 29, 2001, pages 2437 - 2447 |
| LOMELL ET AL., J. CLIN. CHEM., vol. 35, 1989, pages 1826 |
| LUO ET AL., BIOPHYS. RES. COMMUN., vol. 318, 2004, pages 303 - 310 |
| LYNN ET AL., J. AM. CHEM. SOC., vol. 123, 2001, pages 8155 - 8156 |
| MALUMBRES, M.; BARBACID, M.: "Cell cycle kinases in cancer", CURR OPIN GENET DEV, vol. 17, 2007, pages 60 - 65, XP005736996, DOI: doi:10.1016/j.gde.2006.12.008 |
| MANNINO ET AL., BIOTECHNIQUES, vol. 6, 1988, pages 682 |
| MANOHARAN, M.: "RNA interference and chemically modified small interfering RNAs", CURR. OPIN. CHEM. BIOL., vol. 8, 2004, pages 570 - 579, XP004649493, DOI: doi:10.1016/j.cbpa.2004.10.007 |
| MARCH: "ADVANCED ORGANIC CHEMISTRY", 1992, WILEY |
| MARQUES, J.T. ET AL.: "A structural basis for discriminating between self and nonself double-stranded RNAs in mammalian cells", NAT BIOTECHNOL, vol. 24, 2006, pages 559 - 565, XP002447307, DOI: doi:10.1038/nbt1205 |
| MATRANGA, C.; TOMARI, Y.; SHIN, C.; BARTEL, D.P.; ZAMORE, P.D.: "Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes", CELL, vol. 123, 2005, pages 607 - 620, XP002484663, DOI: doi:10.1016/j.cell.2005.08.044 |
| MAXAM; GILBERT: "Methods in Enzymology", vol. 65, 1980, ACADEMIC PRESS, pages: 499 |
| MAYER ET AL., CANCER LETTERS, vol. 53, 1990, pages 183 - 190 |
| MAYER, L.; BALLY, M.; CULLIS, P.; WILSON, S.; EMERMAN, J.: "Comparison of free and liposome encapsulated doxorubicin tumor drug uptake and anti- tumor efficacy in the SC 115 murine mammary tumor", CANCER LETTERS, vol. 53, 1990, pages 183 - 190 |
| MCINNES, C. ET AL.: "Inhibitors of Polo-like kinase reveal roles in spindle- pole maintenance", NAT CHEM BIOL, vol. 2, 2006, pages 608 - 617 |
| MESMAEKER ET AL.: "Carbohydrate Modifications in Antisense Research", 1994, ACS, article "Novel Backbone Replacements for Oligonucleotides", pages: 24 - 39 |
| MICHIE, H.R. ET AL.: "Detection of Circulating Tumor Necrosis Factor after Endotoxin Administration", N. ENGL. J. MED., vol. 318, 1988, pages 1481 - 1486 |
| MORRISSEY ET AL., HEPATOLOGY, vol. 41, 2005, pages 1349 - 1356 |
| MORRISSEY ET AL., NAT. BIOTECHNOL., vol. 23, 2005, pages 1002 - 1007 |
| MORRISSEY, D.V. ET AL.: "Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs", NAT BIOTECHNOL, vol. 23, 2005, pages 1002 - 1007, XP008157520, DOI: doi:10.1038/nbt1122 |
| MUNDT ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 239, 1997, pages 377 - 385 |
| NEEDHAM VANDEVANTER ET AL., NUCLEIC ACIDS RES., vol. 12, 1984, pages 6159 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| NICOLAU ET AL., CRIT. REV. THER. DRUG CARRIER SYST., vol. 6, 1989, pages 239 |
| NIGG, CURR. OPIN. CELL. BIOL., vol. 10, 1998, pages 776 - 783 |
| NYKANEN ET AL., CELL, vol. 107, 2001, pages 309 |
| OHTSUKA ET AL., J BIOL. CHEM., vol. 260, 1985, pages 2605 - 2608 |
| PEARSON ET AL., J. CHROM., vol. 255, 1983, pages 137 - 149 |
| PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PEER, D.; PARK, E.J.; MORISHITA, Y.; CARMAN, C.V.; SHIMAOKA, M: "Systemic leukocyte-directed siRNA delivery revealing cyclin D1 as an anti-inflammatory target", SCIENCE, vol. 319, 2008, pages 627 - 630, XP002531464, DOI: doi:10.1126/science.1149859 |
| POECK, H. ET AL.: "5'-triphosphate-siRNA: turning gene silencing and Rig-I activation against melanoma", NAT MED., vol. 14, 2008, pages 1256 - 1263, XP002535217, DOI: doi:10.1038/NM.1887 |
| PRAKASH, T. ET AL.: "Positional effect of chemical modifications on short interference RNA activity in mammalian cells", J. MED. CHEM., vol. 48, 2005, pages 4247 - 4253, XP008155072, DOI: doi:10.1021/jm050044o |
| PREALL ET AL., CURR. BIOL., vol. 16, 2006, pages 530 - 535 |
| RAINES ET AL., J. BIOL. CHEM., vol. 257, 1982, pages 5154 - 5160 |
| REYNOLDS ET AL., NATURE BIOTECH., vol. 22, no. 3, 2004, pages 326 - 330 |
| ROBBINS, M. ET AL.: "Misinterpreting the therapeutic effects of siRNA caused by immune stimulation", HUM GENE THER., 2008 |
| ROBERTSON ET AL., J. BIOL. CHEM., vol. 243, 1968, pages 82 |
| ROSSOLINI ET AL., MOL. CELL. PROBES, vol. 8, 1994, pages 91 - 98 |
| SAENGER: "Principles of Nucleic Acid Structure", 1984, SPRINGER-VERLAG |
| SAKOWITZ, R. ET AL.: "Antitumor activity of kinesin inhibitor", CANCER RESEARCH, vol. 64, 2004, pages 3276 - 3280, XP002476970, DOI: doi:10.1158/0008-5472.CAN-03-3839 |
| SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual 2nd ed.", 1989 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2000, COLD SPRING HARBOR LABORATORY PRESS |
| SANTEL, A. ET AL.: "A novel siRNA-lipoplex technology for RNA interference in the mouse vascular endothelium", GENE THER, vol. 13, 2006, pages 1222 - 1234, XP002459352, DOI: doi:10.1038/sj.gt.3302777 |
| SANTEL, A. ET AL.: "RNA interference in the mouse vascular endothelium by systemic administration of siRNA-lipoplexes for cancer therapy", GENE THER, vol. 13, 2006, pages 1360 - 1370, XP002443322, DOI: doi:10.1038/sj.gt.3302778 |
| SARKAR, S.N.; SMITH, H.L.; ROWE, T.M.; SEN, G.C.: "Double-stranded RNA signaling by Toll-like receptor 3 requires specific tyrosine residues in its cytoplasmic domain.", JBIOL CHEM, vol. 278, 2003, pages 4393 - 4396 |
| SCARINGE ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 5433 |
| SCHIFFELERS ET AL., NUCLEIC ACIDS RES., vol. 32, 2004, pages E149 |
| SCHIFFELERS R.M ET AL.: "Cancer siRNA therapy by tumor selective delivery with ligand-targeted sterically stabilized nanoparticle", NUCLEIC ACIDS RES., vol. 32, 2004, pages E149, XP002403860 |
| SCHLEE, M.; BARCHET, W.; HORNUNG, V.; HARTMANN, G.: "Beyond double-stranded RNA-type I IFN induction by 3pRNA and other viral nucleic acids", CURR TOP MICROBIOL IMMUNOL, vol. 316, 2007, pages 207 - 230 |
| SCHWARZ ET AL., CELL, vol. 115, 2003, pages 199 - 208 |
| SCHWARZ, D.S. ET AL.: "Asymetry in the assembly of the RNAi enzyme complex", CELL, vol. 115, 2003, pages 119 - 208 |
| SEYMOUR, CRIT. REV. THER. DRUG CARRIER SYST., vol. 9, 1992, pages 135 - 187 |
| SEYMOUR, L.W.: "Passive tumor targeting of soluble macromolecules and drug conjugates", CRIT REV THER DRUG CARRIER SYST, vol. 9, 1992, pages 135 - 187 |
| SMITH ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 234, 1997, pages 397 - 405 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| SOOKNANAN; MALEK, BIOTECHNOLOGY, vol. 13, 1995, pages 563 |
| SOUTSCHEK ET AL., NATURE, vol. 432, 2004, pages 173 - 178 |
| SOUTSCHEK, J. ET AL.: "Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs", NATURE, vol. 432, 2004, pages 173 - 178, XP055298595, DOI: doi:10.1038/nature03121 |
| SPANKUCH ET AL., ONCOGENE, vol. 26, 2007, pages 5793 - 5807 |
| SPANKUCH, B.; KURUNCI-CSACSKO, E.; KAUFMANN, M.; STREBHARDT, K.: "Rational combinations of siRNAs targeting Plkl with breast cancer drugs", ONCOGENE, vol. 26, 2007, pages 5793 - 5807, XP055017771, DOI: doi:10.1038/sj.onc.1210355 |
| SPANKUCH-SCHMITT, B.; BEREITER-HAHN, J.; KAUFMANN, M.; STREBHARDT, K.: "Effect of RNA silencing of polo-like kinase- (PLK1) on apoptosis and spindle formation in human cancer cells", JNATL CANCER INST, vol. 94, 2002, pages 1863 - 1877, XP002998259 |
| STEEGMAIER ET AL., CURR. BIOL., vol. 17, 2007, pages 316 - 322 |
| STEEGMAIER, M. ET AL.: "BI 2536, a potent and selective inhibitor of polo-like kinase 1, inhibits tumor growth in vivo", CURR BIOL, vol. 17, 2007, pages 316 - 322, XP005890944, DOI: doi:10.1016/j.cub.2006.12.037 |
| STEELE ET AL., ANNALS SURGERY, vol. 210, 1989, pages 127 - 138 |
| STEVENSON, H.C. ET AL.: "A phase I evaluation ofpoly(I,C)-LC in cancer patients", JBIOL RESPONSE MOD., vol. 4, 1985, pages 650 - 655 |
| STRAUBRINGER ET AL., METHODS ENZYMOL., vol. 101, 1983, pages 512 |
| STREBHARDT ET AL., NAT. REV. CANCER, vol. 6, 2006, pages 321 - 330 |
| STREBHARDT, K.; ULLRICH, A.: "Targeting polo-like kinase 1 for cancer therapy", NAT REV CANCER, vol. 6, 2006, pages 321 - 330, XP002419975, DOI: doi:10.1038/nrc1841 |
| SUN ET AL., NAT. BIOTECH., vol. 26, 2008, pages 1379 - 1382 |
| TANIGUCHI ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 48884 - 48888 |
| TAO, W. ET AL.: "Induction of apoptosis by an inhibitor of the mitotic kinesin KSP requires both activation of the spindle assembly checkpoint and mitotic slippage", CANCER CELL, vol. 8, 2005, pages 49 - 59, XP003006609, DOI: doi:10.1016/j.ccr.2005.06.003 |
| THE JOURNAL OFNIH RESEARCH, vol. 3, 1991, pages 81 |
| THOMAS ET AL., J. CLIN. ONCOL., vol. 23, 2005, pages 2892 - 2899 |
| TIERA ET AL., CURR. GENE THER., vol. 6, 2006, pages 59 - 71 |
| TIJSSEN: "Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Probes", 1993, article "Overview of principles of hybridization and the strategy of nucleic acid assays" |
| TOKUMITSU ET AL., INT. J. ONCOL., vol. 15, 1999, pages 687 - 692 |
| URBAN-KLEIN ET AL., GENE THER., vol. 12, 2005, pages 461 - 466 |
| URBAN-KLEIN, B.; WERTH, S.; ABUHARBEID, S.; CZUBAYKO, F.; AIGNER, A.: "RNAi-mediated gene-targeting through systemic application of polyethylenimine (PEI)-complexed siRNA in vivo", GENE THER., vol. 12, 2005, pages 461 - 466, XP003002818 |
| USMAN ET AL., J. AM. CHEM. SOC., vol. 109, 1987, pages 7845 |
| VAN BRUNT, BIOTECHNOLOGY, vol. 8, 1990, pages 291 |
| VON MARSCHALL, Z. ET AL.: "Effects of interferon alpha on vascular endothelial growth factor gene transcription and tumor angiogenesis", JNATL CANCER INST, vol. 95, 2003, pages 437 - 448 |
| WEIL, D.; GARCON, L.; HARPER, M.; DUMENIL, D.; DAUTRY, F.; KRESS, M.: "Targeting the kinesin Eg5 to monitor siRNA transfection in mammalian cells", BIOTECHNIQUES, vol. 33, 2002, pages 1244 - 1248, XP001207431 |
| WIDE ET AL.: "Radioimmunoassay Methods", 1970 |
| WINCOTT ET AL., METHODS MOL. BIO., vol. 74, 1997, pages 59 |
| WINCOTT ET AL., NUCL. ACIDS RES., vol. 23, 1995, pages 2677 - 2684 |
| WOLF ET AL., ONCOGENE, vol. 14, 1997, pages 543 - 549 |
| WU; WALLACE, GENE, vol. 4, 1989, pages 560 |
| YANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 9942 - 9947 |
| YAO, X. ET AL.: "A novel orthotopic tumor model to study growth factors and oncogenes in hepatocarcinogenesis", CLIN CANCER RES, vol. 9, 2003, pages 2719 - 2726 |
| YUAN ET AL., AM. J. PATHOL., vol. 150, 1997, pages 1165 - 1172 |
| ZHANG ET AL., J. CONTROL RELEASE, vol. 100, 2004, pages 165 - 180 |
| ZIMMERMAN ET AL., NATURE, vol. 441, 2006, pages 111 - 114 |
| ZIMMERMANN ET AL., NATURE, vol. 441, 2006, pages 111 - 114 |
| ZIMMERMANN, T.S. ET AL.: "RNAi-mediated gene silencing in non-human primates", NATURE, vol. 441, 2006, pages 111 - 114 |
Cited By (108)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010017319A3 (en) * | 2008-08-05 | 2010-04-15 | Mdrna, Inc. | Nucleic acid compounds for inhibiting plk1 gene expression and uses thereof |
| EP4241767B1 (en) | 2008-11-10 | 2024-10-23 | Arbutus Biopharma Corporation | Novel lipids and compositions for the delivery of therapeutics |
| US12453776B2 (en) | 2008-11-10 | 2025-10-28 | Arbutus Biopharma Corporation | Lipids and compositions for the delivery of therapeutics |
| US20120015026A1 (en) * | 2009-03-25 | 2012-01-19 | Giancarlo Francese | Pharmaceutical composition containing a drug and sirna |
| WO2011000107A1 (en) | 2009-07-01 | 2011-01-06 | Protiva Biotherapeutics, Inc. | Novel lipid formulations for delivery of therapeutic agents to solid tumors |
| JP2017014229A (ja) * | 2009-07-31 | 2017-01-19 | ラモット アット テル アビブ ユニバーシティ, リミテッド | ポリヌクレオチド剤を含む細胞標的化ナノ粒子およびその使用 |
| JP2013500960A (ja) * | 2009-07-31 | 2013-01-10 | ラモット アット テル アビブ ユニバーシティ, リミテッド | ポリヌクレオチド剤を含む細胞標的化ナノ粒子およびその使用 |
| WO2011038160A2 (en) | 2009-09-23 | 2011-03-31 | Protiva Biotherapeutics, Inc. | Compositions and methods for silencing genes expressed in cancer |
| WO2011073326A2 (en) | 2009-12-18 | 2011-06-23 | Novartis Ag | Organic compositions to treat hsf1-related diseases |
| EP3766976A1 (en) | 2009-12-18 | 2021-01-20 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat hsf1-related diseases |
| EP3000885A2 (en) | 2009-12-18 | 2016-03-30 | Arrowhead Research Corporation | Organic compositions to treat hsf1-related diseases |
| EP3406720A1 (en) | 2009-12-18 | 2018-11-28 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat hsf1-related diseases |
| JP2013515693A (ja) * | 2009-12-23 | 2013-05-09 | ノバルティス アーゲー | 脂質、脂質組成物およびそれらの使用方法 |
| US9301923B2 (en) | 2009-12-23 | 2016-04-05 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| JP2016041811A (ja) * | 2009-12-23 | 2016-03-31 | ノバルティス アーゲー | 脂質、脂質組成物およびそれらの使用方法 |
| JP2011155914A (ja) * | 2010-02-01 | 2011-08-18 | Osaka Univ | 脂質異常症治療薬剤としての化学修飾siRNA |
| EP4385568A2 (en) | 2010-04-06 | 2024-06-19 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of cd274/pd-l1 gene |
| EP3061824A2 (en) | 2010-04-23 | 2016-08-31 | Arrowhead Research Corporation | Organic compositions to treat beta-enac-related diseases |
| EP3431604A1 (en) | 2010-04-23 | 2019-01-23 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat beta-enac-related diseases |
| WO2011131707A1 (en) | 2010-04-23 | 2011-10-27 | Novartis Ag | ORGANIC COMPOSITIONS TO TREAT BETA-ENaC-RELATED DISEASES |
| WO2011139710A1 (en) * | 2010-04-26 | 2011-11-10 | Marina Biotech, Inc. | Nucleic acid compounds with conformationally restricted monomers and uses thereof |
| US20130156845A1 (en) * | 2010-04-29 | 2013-06-20 | Alnylam Pharmaceuticals, Inc. | Lipid formulated single stranded rna |
| WO2011141704A1 (en) | 2010-05-12 | 2011-11-17 | Protiva Biotherapeutics, Inc | Novel cyclic cationic lipids and methods of use |
| WO2011141705A1 (en) | 2010-05-12 | 2011-11-17 | Protiva Biotherapeutics, Inc. | Novel cationic lipids and methods of use thereof |
| EP3456827A2 (en) | 2010-06-02 | 2019-03-20 | Alnylam Pharmaceuticals, Inc. | Compositions and methods directed to treating liver fibrosis |
| WO2011153323A2 (en) | 2010-06-02 | 2011-12-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods directed to treating liver fibrosis |
| US11718852B2 (en) | 2010-06-30 | 2023-08-08 | Arbutus Biopharma Corporation | Non-liposomal systems for nucleic acid delivery |
| US12129467B2 (en) | 2010-06-30 | 2024-10-29 | Arbutus Biopharma Corporation | Non-liposomal systems for nucleic acid delivery |
| US8513402B2 (en) | 2010-10-05 | 2013-08-20 | Korea Institute Of Science And Technology | Human serum albumin-siRNA nano-sized carrier system |
| CN102441175A (zh) * | 2010-10-05 | 2012-05-09 | 韩国科学技术研究院 | 人血清白蛋白-siRNA纳米尺寸载体系统 |
| WO2012078967A2 (en) | 2010-12-10 | 2012-06-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for increasing erythropoietin (epo) production |
| WO2012079046A2 (en) | 2010-12-10 | 2012-06-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of klf-1 and bcl11a genes |
| EP3674409A1 (en) | 2011-03-29 | 2020-07-01 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of tmprss6 gene |
| WO2012177784A2 (en) | 2011-06-21 | 2012-12-27 | Alnylam Pharmaceuticals | Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof |
| EP3564393A1 (en) | 2011-06-21 | 2019-11-06 | Alnylam Pharmaceuticals, Inc. | Assays and methods for determining activity of a therapeutic agent in a subject |
| EP3656860A1 (en) | 2011-06-21 | 2020-05-27 | Alnylam Pharmaceuticals, Inc. | Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof |
| EP4092120A1 (en) | 2011-06-21 | 2022-11-23 | Alnylam Pharmaceuticals, Inc. | Angiopoietin-like 3 (anglptl3) irna compositions and methods of use thereof |
| EP3444348A1 (en) | 2011-06-21 | 2019-02-20 | Alnylam Pharmaceuticals, Inc. | Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof |
| EP3656860B1 (en) | 2011-06-21 | 2022-04-20 | Alnylam Pharmaceuticals, Inc. | Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof |
| EP4134433A1 (en) | 2011-06-23 | 2023-02-15 | Alnylam Pharmaceuticals, Inc. | Serpina1 sirnas: compositions of matter and methods of treatment |
| WO2012178033A2 (en) | 2011-06-23 | 2012-12-27 | Alnylam Pharmaceuticals, Inc. | Serpina1 sirnas: compositions of matter and methods of treatment |
| EP3366312A1 (en) | 2011-06-23 | 2018-08-29 | Alnylam Pharmaceuticals, Inc. | Serpina 1 sirnas: compositions of matter and methods of treatment |
| EP3597750A1 (en) | 2011-06-23 | 2020-01-22 | Alnylam Pharmaceuticals, Inc. | Serpina1 sirnas: compositions of matter and methods of treatment |
| WO2013019857A2 (en) | 2011-08-01 | 2013-02-07 | Alnylam Pharmaceuticals, Inc. | Method for improving the success rate of hematopoietic stem cell transplants |
| WO2013023982A1 (en) * | 2011-08-12 | 2013-02-21 | Westfaelische Wilhelms-Universitaet Muenster | Novel compounds for the treatment of inflammatory bowel disease |
| US9126966B2 (en) | 2011-08-31 | 2015-09-08 | Protiva Biotherapeutics, Inc. | Cationic lipids and methods of use thereof |
| WO2013030778A2 (en) | 2011-09-02 | 2013-03-07 | Novartis Ag | Organic compositions to treat hsf1-related diseases |
| EP3098314A1 (en) | 2011-09-02 | 2016-11-30 | Arrowhead Research Corporation | Organic compositions to treat hsf1-related diseases |
| EP3521432A1 (en) | 2011-09-02 | 2019-08-07 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat hsf1-related diseases |
| CN104024413B (zh) * | 2011-10-19 | 2016-08-17 | 苏州瑞博生物技术有限公司 | 小干扰RNA及其应用和抑制plk1基因表达的方法 |
| US9593335B2 (en) | 2011-10-19 | 2017-03-14 | Suzhou Ribo Life Science Co., Ltd. | Small interference RNAs, uses thereof and method for inhibiting the expression of PLK1 gene |
| CN104024413A (zh) * | 2011-10-19 | 2014-09-03 | 苏州瑞博生物技术有限公司 | 小干扰RNA及其应用和抑制plk1基因表达的方法 |
| US9328348B2 (en) | 2011-10-19 | 2016-05-03 | Suzhou Ribo Life Science Co., Ltd. | Small interference RNAs, uses thereof and method for inhibiting the expression of plk1 gene |
| WO2013056670A1 (zh) * | 2011-10-19 | 2013-04-25 | 苏州瑞博生物技术有限公司 | 小干扰RNA及其应用和抑制plk1基因表达的方法 |
| WO2013105022A2 (en) | 2012-01-09 | 2013-07-18 | Novartis Ag | Organic compositions to treat beta-catenin-related diseases |
| US10023862B2 (en) | 2012-01-09 | 2018-07-17 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat beta-catenin-related diseases |
| WO2013126803A1 (en) | 2012-02-24 | 2013-08-29 | Protiva Biotherapeutics Inc. | Trialkyl cationic lipids and methods of use thereof |
| EP3473611A1 (en) | 2012-02-24 | 2019-04-24 | Arbutus Biopharma Corporation | Trialkyl cationic lipids and methods of use thereof |
| EP3988104A1 (en) | 2012-02-24 | 2022-04-27 | Arbutus Biopharma Corporation | Trialkyl cationic lipids and methods of use thereof |
| WO2013155204A2 (en) | 2012-04-10 | 2013-10-17 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the alas1 gene |
| EP3284824A1 (en) | 2012-04-10 | 2018-02-21 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the alas1 gene |
| EP3868883A1 (en) | 2012-04-10 | 2021-08-25 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the alas1 gene |
| EP4209592A1 (en) | 2012-04-26 | 2023-07-12 | Genzyme Corporation | Serpinc1 irna compositions and methods of use thereof |
| EP3736333A1 (en) | 2012-05-02 | 2020-11-11 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat kras-related diseases |
| WO2013166004A2 (en) | 2012-05-02 | 2013-11-07 | Novartis Ag | Organic compositions to treat kras-related diseases |
| EP3272868A1 (en) | 2012-05-02 | 2018-01-24 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat kras-related diseases |
| WO2014130922A1 (en) | 2013-02-25 | 2014-08-28 | Trustees Of Boston University | Compositions and methods for treating fungal infections |
| WO2014131773A3 (de) * | 2013-02-27 | 2014-10-23 | Friedrich-Schiller-Universität Jena | Verfahren zur gezielten abtötung von zellen durch zur mrna-anbindung ausgerichtete nukleotid-moleküle sowie nukleotid-moleküle und applikationskit für solche verwendung |
| US11261444B2 (en) | 2013-02-28 | 2022-03-01 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat EPAS1-related diseases |
| US9868949B2 (en) | 2013-02-28 | 2018-01-16 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat EPAS1-related diseases |
| US10538765B2 (en) | 2013-02-28 | 2020-01-21 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat EPAS1-related diseases |
| WO2014134255A2 (en) | 2013-02-28 | 2014-09-04 | Novartis Ag | Organic compositions to treat epas1-related diseases |
| WO2014182661A2 (en) | 2013-05-06 | 2014-11-13 | Alnylam Pharmaceuticals, Inc | Dosages and methods for delivering lipid formulated nucleic acid molecules |
| WO2015050990A1 (en) | 2013-10-02 | 2015-04-09 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
| WO2015051135A2 (en) | 2013-10-04 | 2015-04-09 | Novartis Ag | Organic compositions to treat hepcidin-related diseases |
| EP3693463A1 (en) | 2013-10-04 | 2020-08-12 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the alas1 gene |
| EP3736334A1 (en) | 2014-07-16 | 2020-11-11 | Arrowhead Pharmaceuticals, Inc. | Rnai compositions to treat apoc3-related diseases |
| US10342761B2 (en) | 2014-07-16 | 2019-07-09 | Novartis Ag | Method of encapsulating a nucleic acid in a lipid nanoparticle host |
| WO2016011123A1 (en) | 2014-07-16 | 2016-01-21 | Arrowhead Research Corporation | Organic compositions to treat apoc3-related diseases |
| WO2016038550A1 (en) | 2014-09-11 | 2016-03-17 | Novartis Ag | Inhibition of prmt5 to treat mtap-deficiency-related diseases |
| WO2016089883A1 (en) | 2014-12-01 | 2016-06-09 | Novartis Ag | Compositions and methods for diagnosis and treatment of prostate cancer |
| WO2016193945A2 (en) | 2015-06-05 | 2016-12-08 | Novartis Ag | Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders |
| AU2017286980B2 (en) * | 2016-06-30 | 2023-10-26 | Arbutus Biopharma Corporation | Compositions and methods for delivering messenger RNA |
| US11191849B2 (en) | 2016-06-30 | 2021-12-07 | Arbutus Biopharma Corporation | Compositions and methods for delivering messenger RNA |
| WO2018006052A1 (en) * | 2016-06-30 | 2018-01-04 | Protiva Biotherapeutics, Inc. | Compositions and methods for delivering messenger rna |
| WO2018047148A1 (en) | 2016-09-12 | 2018-03-15 | Novartis Ag | Compounds for the inhibition of mirna |
| WO2018083606A1 (en) | 2016-11-01 | 2018-05-11 | Novartis Ag | Methods and compositions for enhancing gene editing |
| EP4085919A2 (en) | 2017-07-21 | 2022-11-09 | Novartis AG | Compositions and methods to treat cancer |
| WO2019016772A2 (en) | 2017-07-21 | 2019-01-24 | Novartis Ag | COMPOSITIONS AND METHODS FOR TREATING CANCER |
| WO2019094578A1 (en) | 2017-11-09 | 2019-05-16 | Alnylam Pharmaceuticals Inc. | Assays and methods for determining expression of the lect2 gene |
| WO2019150309A1 (en) | 2018-02-02 | 2019-08-08 | Hammack Scott | Modulators of gpr68 and uses thereof for treating and preventing diseases |
| WO2019213276A1 (en) | 2018-05-02 | 2019-11-07 | Novartis Ag | Regulators of human pluripotent stem cells and uses thereof |
| WO2020037125A1 (en) | 2018-08-16 | 2020-02-20 | Alnylam Pharmaceuticals Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
| WO2020132346A1 (en) | 2018-12-20 | 2020-06-25 | Vir Biotechnology, Inc. | Combination hbv therapy |
| EP4656656A2 (en) | 2018-12-20 | 2025-12-03 | Humabs BioMed SA | Combination hbv therapy |
| EP4285929A2 (en) | 2018-12-20 | 2023-12-06 | Humabs Biomed SA | Combination hbv therapy |
| US12221610B2 (en) | 2019-01-09 | 2025-02-11 | Arrowhead Pharmaceuticals, Inc. | RNAi agents for inhibiting expression of HIF-2 alpha (EPAS1), compositions thereof, and methods of use |
| WO2021046122A1 (en) | 2019-09-03 | 2021-03-11 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
| US12503699B2 (en) | 2019-10-04 | 2025-12-23 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing UGT1a1 gene expression |
| WO2021067747A1 (en) | 2019-10-04 | 2021-04-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing ugt1a1 gene expression |
| WO2021087325A1 (en) | 2019-11-01 | 2021-05-06 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing dnajb1-prkaca fusion gene expression |
| WO2021163066A1 (en) | 2020-02-10 | 2021-08-19 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing vegf-a expression |
| WO2021202443A2 (en) | 2020-03-30 | 2021-10-07 | Alnylam Pharmaceucticals, Inc. | Compositions and methods for silencing dnajc15 gene expression |
| WO2021207167A1 (en) | 2020-04-06 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing myoc expression |
| WO2021207189A1 (en) | 2020-04-07 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing scn9a expression |
| WO2021237097A1 (en) | 2020-05-21 | 2021-11-25 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting marc1 gene expression |
| WO2021262840A1 (en) | 2020-06-24 | 2021-12-30 | Vir Biotechnology, Inc. | Engineered hepatitis b virus neutralizing antibodies and uses thereof |
| US12416006B2 (en) | 2021-08-31 | 2025-09-16 | Alnylam Pharmaceuticals, Inc. | Cell death-inducing DFFA-like effector B (CIDEB) iRNA compositions and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160115483A1 (en) | 2016-04-28 |
| CA2710713C (en) | 2017-09-19 |
| ES2535419T3 (es) | 2015-05-11 |
| JP2011507534A (ja) | 2011-03-10 |
| EP2238251A1 (en) | 2010-10-13 |
| EP2238251B1 (en) | 2015-02-11 |
| EP2238251A4 (en) | 2011-09-21 |
| AU2008342535B2 (en) | 2015-02-05 |
| JP5697988B2 (ja) | 2015-04-08 |
| US20090291131A1 (en) | 2009-11-26 |
| US9006191B2 (en) | 2015-04-14 |
| AU2008342535A1 (en) | 2009-07-09 |
| CA2710713A1 (en) | 2009-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2238251B1 (en) | Silencing of polo-like kinase expression using interfering rna | |
| EP2281041B1 (en) | Silencing of csn5 gene expression using interfering rna | |
| US9074208B2 (en) | Modified siRNA molecules and uses thereof | |
| CA2721333C (en) | Novel lipid formulations for nucleic acid delivery | |
| US8598333B2 (en) | SiRNA silencing of genes expressed in cancer | |
| US20110224418A1 (en) | MODIFIED sIRNA MOLECULES AND USES THEREOF | |
| AU2013203219A1 (en) | MODIFIED siRNA MOLECULES AND USES THEREOF | |
| AU2013202970A1 (en) | Silencing of polo-like kinase expression using interfering RNA | |
| HK1126785B (en) | Modified sirna molecules and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08867007 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010539978 Country of ref document: JP Ref document number: 2710713 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008342535 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008867007 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2008342535 Country of ref document: AU Date of ref document: 20081223 Kind code of ref document: A |