Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
  • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
  • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/35—Nature of the modification
  • C12N2310/351—Conjugate
  • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
  • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

• the present invention relates to a system for delivering in vivo nucleic acids such as an siRNA for suppressing a target gene expression, and to an expression-suppressing agent and a pharmaceutical composition utilizing the system.
• siRNA capable of suppressing the expression of a specific gene is widely used as a research tool.
• An siRNA is also receiving attention for applications to therapeutic agents for a wide variety of diseases including tumors, infectious diseases, and hereditary diseases.
• the most critical problem in the clinical applications of an siRNA lies in the fact that an siRNA should be delivered specifically and efficiently to a target cell in vivo.
• a delivery method is known in which an siRNA is delivered in vivo by means of a high-pressure and high- volume intravenous injection of a synthetic siRNA, utilizing a viral vector.
• This method uses a viral vector, and a restriction is imposed on the clinical applications of such method from the viewpoint of safety and the like. Consequently, various non-viral systems have been developed that can deliver an siRNA in vivo to the liver, tumor, or other tissues.
• non- viral delivery systems examples include the ones using: a cholesterol-siRNA complex (non-patent document 1); stable nucleic acid lipid particles (SNALP) (non-patent document 2); interfering nanoparticles (iNOP) (non-patent document 3) and the like.
• SNALP has brought about a great improvement in that the use of SNALP for injecting a clinically appropriate amount of siRNAs has enabled the knockdown of a target mRNA in the liver.
• RVG-9R siRNA vector
• Non-patent document 4 an siRNA vector that can transfer an siRNA via a receptor
• Non-patent document 5 "Dynamic PolyConjugate TR" (Mirus)
• RVG-9R is a short peptide derived from a glycoprotein of rabies virus, added with 9 arginine residues.
• an siRNA can be transferred to a nerve cell via an acetylcholine receptor.
• the Dynamic PolyConjugate contains a membrane- active form of polymer to which an N- acetylgalactosamine (NAG) is bound, as a ligand targeting a hepatic cell. While the use of these receptor-mediated delivery systems such as RVG-9R and Dynamic Poly- Conjugate can improve efficiency and specificity of an in vivo siRNA delivery to a target cell, artificially synthesized vector molecules used in these systems still possess hazardous nature that could cause serious side-effects particularly when the dose is increased.
• NAG N- acetylgalactosamine
• a delivery method which comprises extracting endogenous lipoprotein, allowing LDL and HDL ex vivo to take in an siRNA to which a cholesterol molecule in the lipoprotein is bound, and introducing the siRNA to the liver via a lipoprotein receptor (non-patent document 6).
• This complex is taken in by the liver 5 to 8 times more effectively as compared to a free cholesterol-siRNA.
• the complex is effective only to the extent that it can suppress the target gene in the liver by about 55% with a 13 mg/kg intravenous siRNA administration, which is far from sufficient.
• Non Patent Citation 1 Nature 432: 173-178, 2004
• Non Patent Citation 2 Nature 441 : 111 - 114, 2006
• Non Patent Citation 3 ACS Chem Biol. 2:237-241, 2007
• Non Patent Citation 4 Nature 448 : 39-43 , 2007
• Non Patent Citation 5 Proc Natl Acad Sci USA. 104: 12982-12987, 2007
• Non Patent Citation 6 Nature Biotechnology 25 : 1149- 1157 , 2007 Disclosure of Invention Technical Problem
• the object of the present invention is to provide a system that can in vivo deliver nucleic acids such as an siRNA for suppressing a target gene expression in vivo more safely and efficiently, and to provide an expression-suppressing agent and a pharmaceutical composition utilizing the system.
• the present inventors administered a vitamin E-bound siRNA under the condition where the production of endogenous chylomicron is induced in vivo, and successfully delivered the siRNA in vivo more safely and efficiently. Consequently, the present inventors discovered that a target-gene expression can be suppressed very efficiently, and thus completed the present invention.
• the present invention relates to an agent for suppressing a target gene expression, comprising nucleic acids for suppressing the target gene expression, wherein an introduction substance into chylomicron or chylomicron remnant is bound to the nucleic acids, and wherein the agent is administered to a vertebrate under a condition in which a production of endogenous chylomicron is induced in the vertebrate (1); the agent according to (1), wherein the condition is a condition of within 12 hours after a lipid is administered to the vertebrate (2); the agent according to (2), wherein the lipid is administered in a form of an oral intake (3); the agent according to (1), wherein LPL inhibitor is administered to a vertebrate before a production of endogenous chylomicron is induced in the vertebrate (4); The agent according to(l), wherein LPL and/or heparin is administered to a vertebrate before nucleic acids are administered to the vertebrate.
• the agent according to (1), wherein the nucleic acids to which an introduction substance into chylomicron is bound are administered to a vertebrate, with the nucleic acids being mixed with concentrated chylomicron obtained from a vertebrate (7); the agent according to (1), wherein the substance is a lipophilic vitamin or cholesterol (8); the agent according to (8), wherein the lipophilic vitamin is vitamin E (9);
• the present invention also relates to a pharmaceutical composition
• a pharmaceutical composition comprising the agent according to (1) as an active ingredient (14).
• the present invention further relates to a method for delivering in vivo nucleic acids for suppressing a target gene expression, comprising administering the nucleic acids to a vertebrate under a condition in which a production of endogenous chylomicron or chylomicron remnant is induced in the vertebrate, wherein an introduction substance into chylomicron is bound to the nucleic acids (15).
• the present invention still further relates to a method for treating a disease that is ameliorated by suppressing a target gene expression, comprising administering nucleic acids for suppressing the target gene expression to a vertebrate under a condition in which a production of endogenous chylomicron or chylomicron remnant is induced in the vertebrate, wherein an introduction substance into chylomicron is bound to the nucleic acids (16); the method according to (15) or (16), wherein the condition is a condition of within 12 hours after a lipid is administered to a vertebrate (17); the method according to (17), wherein the lipid is administered in a form of an oral intake (18); the method according to (15) or (16), comprising administering LPL inhibitor to a vertebrate before a production of endogenous chylomicron is induced in the vertebrate.
• nucleic acids are one or more kinds of nucleic acids selected from the group consisting of siRNA, shRNA, antisense oligonucleotide, antagomir, nucleic-acid aptamer, ribozyme, and decoy (26); the method according to (26), wherein the nucleic acids are siRNA (27); and the method according to (15) or (16), wherein the nucleic acids are RNA subjected to an anti-RNase treatment (28).
• FIG.1 This figure shows a general outline of the in vivo delivery of an alpha- tocopherol (vitamin E)-bound siRNA (Toc-siRNA).
• FIG.3 This figure shows the stability and the expression-suppressing activity of an siRNA chemically modified by a thiophosphorylation of the skeletal bond and 2'-O-methylation of the ribose of the nucleotides.
• A This figure shows the Toc-siRNA sequence targeted to the mouse apoB mRNA and the chemical modification of the sequence.
• B This figure shows the stability of the modified siRNA in a serum.
• C This figure shows the in vitro expression-suppressing efficiency of the modified siRNA.
• FIG.4 This figure shows the chemical structure of an alpha-tocopherol (vitamin E)-bound siRNA.
• FIG.5 This figure shows the interaction of an siRNA with a lipoprotein.
• FIG.6 This figure shows that the Toc-siRNA intravenously injected to the mouse has been taken into the liver.
• A This figure shows the result of a fluorescence microscopic observation of a liver- tissue segment after a Cy3-labeled Toc-siRNA administration.
• B This figure shows that a 27/29-mer Toc-siRNA taken into the liver was cleaved by a dicer to produce a 21-mer siRNA.
• B This figure shows the temporal change of the apoB-gene expression by a Toc-siRNA administration.
• C This figure shows that a Toc-siRNA has a dose-dependent expression-suppressing activity.
• FIG.8 This figure shows that a 27/29-mer Toc-siRNA/LP taken into a Hepa 1-6 cell line was cleaved by a dicer to produce a 21-mer siRNA.
• A This figure shows the reduction in the apoB mRNA expression in the liver due to a Toc-siRNA/LP administration.
• B This figure shows that a Toc-siRNA/LP targeted to the apoB gene reduces the mRNA expression in the apoB-gene specific manner.
• C This figure shows that an apoB-siRNA/LP has a dose-dependent expression-suppressing activity.
• FIG.1 l This figure shows the results of a pathological analysis of the liver after a Toc- siRNA/LP administration.
• FIG.l2 This figure shows the Toc-siRNA's expression-suppressing activity for the liver apoB mRNA and the comparisons with other known non- viral vectors (however, the value for the HDL vector (Swiss) is taken from the data of the amount of the liver- apoB protein).
• the agent for suppressing a target gene expression of the present invention is characterized in that the agent contains nucleic acids for suppressing a target gene expression, to which nucleic acids an introduction substance into chylomicron is bound (hereinafter also referred to as nucleic acids to which an introduction substance into chylomicron is bound), and that the agent is administered to a vertebrate under a condition where the production of endogenous chylomicron is induced in the vertebrate.
• Lipoproteins are categorized into chylomicron, VLDL, LDL, and HDL according to their specific gravities. Hepatic cells have receptors for the above lipoproteins. These receptors are: an LRP-I receptor that binds a chylomicron remnant which is a chylomicron metabolite; an LDL receptor that binds LDL; and an SR-Bl receptor that binds HDL. Each lipoprotein is taken into cells by receptor-mediated endocytosis.
• Endogenous lipids are constantly taken in by LDL-LDL receptors and HDL-SR-B 1 receptors, whereas exogenous lipids including vitamin E absorbed in large amounts in a short time postprandially are taken in mainly by chylomicrons, metabolized by LPLs (lipoprotein lipase) into chylomicron remnants, and subsequently taken in by hepatic cells via chylomicron-remnant receptors (LDL receptor-related protein 1; LRP-I receptor).
• LRP-I receptor LRP-I receptor on a hepatic cell moves to the cell surface postprandially to become activated.
• nucleic acids to which an introduction substance into chylomicron is bound When nucleic acids to which an introduction substance into chylomicron is bound is administered under a condition where the production of endogenous chylomicron is induced after a lipid ingestion, the introduction substance into chylomicron of the nucleic acids to which an introduction substance into chylomicron is bound, interacts with a chylomicron or the like, to form a complex of the nucleic acids to which the introduction substance into chylomicron is bound and the chylomicron.
• This complex of nucleic acids to which an introduction substance into chylomicron is bound and the chylomicron is taken into a cell via an LRP-I receptor, thereby the nucleic acids for suppressing a target gene expression are taken into a cell in vivo, particularly into a hepatic cell very sufficiently.
• Fig. 1 shows the outline of the delivery of the present invention in the case where vitamin E is used as an introduction substance into chylomicron and an siRNA for suppressing the expression of the mouse apoB gene as nucleic acids for suppressing a target gene expression.
• the above nucleic acids for suppressing a target gene expression can be any of natural nucleotides, modified natural nucleotides, or synthetic nucleotides as long as the nucleic acids have an activity of suppressing a target gene expression (hereinafter also referred to as "an expression-suppressing activity").
• the nucleic acids can be a DNA, RNA, or their chimeric forms, while by way of specific exemplifications, the nucleic acids are an siRNA, shRNA (short hairpin RNA), antisense, oligonucleotide, antagomir, nucleic acid ap tamer, ribozyme, or decoy (a decoy molecule), among which an siRNA can be preferably exemplified.
• siRNA short hairpin RNA
• shRNA short hairpin RNA
• antisense oligonucleotide
• antagomir antisense
• nucleic acid ap tamer ribozyme
• decoy a decoy molecule
• an siRNA that is targeted to the mouse apoB gene is the siRNA consisting of the sense strand consisting of SEQ ID NO: 1 (GUCAUCACACUGAAUACCAAUGCUGGA) (27 mer) and the antisense strand consisting of SEQ ID NO: 2 (UCCAGCAUUGGUAUUCAGUGUGAUGACAC) (29 mer).
• nucleic acids are modified so that they are not easily degraded in vivo.
• nucleic acids when the nucleic acids are an RNA, it is preferable that the nucleic acids have been subjected to an anti-RNase treatment such as a methylation treatment or thiophosphorylation treatment so that the nucleic acids are not easily degraded by RNases in a cell.
• an anti-RNase treatment such as a methylation treatment or thiophosphorylation treatment so that the nucleic acids are not easily degraded by RNases in a cell.
• a nucleic-acid ribose is methylated at its 2' position or the skeletal binding of a nucleic acid is thiophos- phorylated.
• the number and the position of nucleotide subjected to a methylation or thiophosphorylation may slightly affect the expression-suppressing activity of the nucleic acids and therefore, there is a preferred mode as to the number, position and the like of nucleotide that is subjected to a methylation or thiophosphorylation.
• This preferred mode may vary depending on the nucleic-acid sequence that is to be modified and thus can not be stated categorically, while such preferred mode can be found out easily by confirming the expression-suppressing activity of the modified nucleic acids.
• a preferred mode of an anti- RNase treatment of the siRNA consisting of the above-mentioned SEQ ID NO: 1 and 2 comprises: the mathylations of the nucleotides of nucleotide numbers 2, 5, 11, 15, 21, 24 and 25 of the sense strand (SEQ ID NO: 1) and the nucleotides of nucleotide numbers 1, 2, 5, 12, 14, 21, 24, 25, and 26 of the antisense strand (SEQ ID NO: 2) at their 2' position of the ribose; the thiophosphorylation of the skeletal binding of the nucleotide of nucleotide number 26 of the sense strand (SEQ ID NO: 1); and further methylations of the nucleotides of nucleotide numbers 3, 4, 6, 27, and 28 of the antisense strand (SEQ ID NO: 2) at their 2' position of the ribose as well as the thiophosphorylation of their skeletal bindings.
• an activity of suppressing a target gene expression means the activity that reduces the intracellular expression of the target gene when the nucleic acids were introduced into the cell as compared to the case without such an introduction.
• the reduced intracellular expression of the target gene can be examined by quantifying the target gene mRNA or the protein encoded by the target gene.
• the intracellular expression of the target gene is 80% or less, more preferably 60% or less, even more preferably 40% or less, and still more preferably 20% or less at the mRNA level or at the protein level, as compared to the case without such an introduction.
• the number of nucleotides of the sense strand and/or the antisense strand may be 21, while it is preferable that the number is more than 21, since an intracellular dicer cleaves between the above introduction substance into chylomicron with a part of the siRNA and the siRNA (of 21 nucleotides), thereby the siRNA of 21 nucleotides can efficiently exercise its expression- suppressing effect.
• nucleic acids for suppressing a target gene expression can be designed by a known method based on the information on the target gene sequence, or the part of the target gene sequence to which a transcription factor can bind.
• nucleic acids for suppressing a target gene expression can be designed using the method described in Japanese Laid-Open Patent Application No.
• nucleic acids are an siRNA
• the method described in Nature, 1990, 346(6287):818-22 when the nucleic acids are a nucleic-acid aptamer and the methods described in FEBS Lett, 1988, 239, 285; Tanpakushitsu-kakusan-kouso (protein-nucleic acid enzyme), 1990, 35, 2191; and Nucl Acids Res, 1989, 17, 7059 when the nucleic acids are a ribozyme.
• an antisense oligonucleotides, antagomir, or a decoy can be designed easily respectively based on the information on the target gene sequence, and the part of the target gene sequence to which a transcription factor can bind.
• nucleic acids can be prepared using a known method or the like.
• antisense oligonucleotide or a ribozyme can be prepared by determining the target sequence of an mRNA or early transcription product based on the cDNA sequence or genomic DNA sequence of the target gene and synthesizing the sequence complementary to the target sequence using a commercially available DNA/RNA automatic synthesizer (Applied Biosystems, Beckman and the like).
• a decoy or siRNA can be prepared by synthesizing a sense strand and an antisense strand respectively with a DNA/RNA automatic synthesizer, denaturing the strands in an appropriate annealing buffer solution at about 90degC to about 95degC for about 1 minute, and annealing at about 30degC to about 70 degC for about 1 to about 8 hours and the like.
• a nucleic-acid aptamer can be prepared by the method described in Japanese Laid-Open Patent Application No. 2007-014292.
• the above introduction substance into chylomicron is not particularly limited as long as the substance can be taken into lipoproteins such as a chylomicron, and the preferred introduction substances are: fat-soluble substances such as carbon hydrides, higher alcohols, higher alcohol esters, higher fatty acids, higher fatty acid esters, sterols (in particular, cholesterols) and sterol esters; peptides such as cell permeable peptides apolipoproteinsconjugate; and lipid-like molecules such as addition of alky- lacrylatesor alkyl-acrylamides to primary or secondary amines.
• a fat- soluble vitamin which is an exogenous lipid that cannot be synthesized in vivo is more preferred, and vitamin E is particularly preferred because it is safer.
• tocopherols represented by the following general formula (1) or tocotrienols represented by the following general formula (2), or mixtures containing two or more kinds of these compounds can be preferably exemplified:
• R 1 and R 2 represent a hydrogen atom or a methyl group
• R 3 represents a hydrogen atom or a carboxylic acid residue
• R 3 hydrogen atom
• R 2 methyl group
• R 3 hydrogen atom
• sigma- tocopherol in general formula (1), R !
• acetate esters and succinates of the above compounds in
• the introduction substance into chylomicron may be either a natural substance or a synthetic substance.
• the bond between the above introduction substance into chylomicron and the nucleic acids may be a direct bond or an indirect bond by another substance mediating between them.
• the bond is directly formed by a chemical bond such as a covalent bond, ionic bond, or hydrogen bond, among which a covalent bond provides a more stable bond and therefore can be exemplified particularly preferably.
• the method of binding the introduction substance into chylomicron and the nucleic acids is not particularly limited.
• the covalent bond is formed according to the method described in Tetrahedron Letters 33; 2729-2732, 1992, and when an ionic bond or a hydrogen bond is utilized, it is preferable to allow an arginine residue having a positive charge to bind to an introduction substance into chylomicron and to utilize an ionic bond or hydrogen bond between this positive charge of the arginine residue and a negative charge of the nucleic acids such as an siRNA to form the bond.
• the number of arginine residues bound to an introduction substance into chylomicron is preferably at least two, more preferably at least three, and even more preferably at least four.
• the expression-suppressing agent of the present invention can be formulated with components used in medicinal products as needed, such as lipoprotein, water, oil solution, wax, silicone, surfactant, alcohol, polyhydric alcohol, water-soluble high-molecular thickener, pH adjuster, flavor, antioxidant, chelating agent, pigment, antiseptic agent, and other medicinal components as well as inorganic or organic components, within the qualitative and quantitative range that does not affect the effect of the present invention.
• components used in medicinal products such as lipoprotein, water, oil solution, wax, silicone, surfactant, alcohol, polyhydric alcohol, water-soluble high-molecular thickener, pH adjuster, flavor, antioxidant, chelating agent, pigment, antiseptic agent, and other medicinal components as well as inorganic or organic components, within the qualitative and quantitative range that does not affect the effect of the present invention.
• the expression-suppressing agent of the present invention can be formulated using the above essential components and optional components as needed according to a common method, into various dosage forms including solid formulations such as powder, granules, tablets, and capsules; liquid formulations such as syrup, emulsion, and injections (including a subcutaneous injection, intravenous injection, intramuscular injection, and infusion); sustained-release formulations such as sublingual tablets, buccals, troches, and microcapsules; intraoral rapid-disintegrant; and suppository, among which injections can be preferably exemplified.
• solid formulations such as powder, granules, tablets, and capsules
• liquid formulations such as syrup, emulsion, and injections (including a subcutaneous injection, intravenous injection, intramuscular injection, and infusion)
• sustained-release formulations such as sublingual tablets, buccals, troches, and microcapsules
• intraoral rapid-disintegrant and suppository, among which injections can be
• the expression-suppressing agent of the present invention is administered to a vertebrate under a condition where the production of endogenous chylomicron is induced in the vertebrate with a view to improving the intake efficiency into a cell, of nucleic acids to which an introduction substance into chylomicron is bound and thus increasing the suppression efficiency of a target gene expression.
• the condition where the production of endogenous chylomicron is induced in the vertebrate is not limited as long as the above object can be achieved, while a preferred condition is within 12 hours (for example, within 10 hours, within 8 hours, within 6 hours, within 4 hours, within 2 hours, and within 1 hour) after an oral lipid administration to a vertebrate.
• the lipid can be orally administered either as a lipid itself or in the form of a lipid- containing meal. It is preferable that the subject of administration is allowed to be in a state of starvation prior to an induction of endogenous chylomicron.
• the detailed action mechanism has not been revealed how a lipid administration, and what is more, allowing the subject of administration to be in a state of starvation, improve the intake efficiency into a cell, of nucleic acids to which an introduction substance into chylomicron is bound.
• an LRP-I receptor on a hepatic cell which is involved in lipoprotein intake, is known to be expressed at a higher level on cell membranes and to be activated due to an oral lipid ingestion or by insulin (MoI Pharmacol. 2007 JuI 3; 17609417), it is believed that a lipid ingestion or the like causes the receptor involved in lipoprotein intake to be expressed at a higher level as well as activated, resulting in the increased chylomicron introduction into a hepatic cell and thereby improves the intake efficiency into a hepatic cell, of nucleic acids to which an introduction substance into chylomicron is bound.
• a state of starvation refers to a state in which no food or drink (except a calorie-free drink or food such as water) has been ingested for a certain period of time including, for example, a state in which the subject of administration has not been given any food at least for 6 hours, preferably for at least 8 hours, more preferably at least for 12 hours, and even more preferably at least for 24 hours.
• LPL inhibitor such as triton (for example, by an intravenous injection) before administering lipid (or a lipid-containing product) to increase the concentration of chylomicrons.
• LPLs act on hepatic cells and causes them to take in vitamin E. With an administration of heparin, LPLs bound to heparan sulfate on the endothelial cell surface can be freed into the blood. Therefore, it is preferable to administer LPL and/or heparin to a vertebrate before nucleic acids are administered.
• the expression-suppressing agent of the present invention can be administered by mixing ex vivo with a chylomicoron-rich lipoprotein.
• the lipoprotein is not particularly limited as long as the lipoprotein contains a lipid and apoprotein, and can be taken into a cell through any lipoprotein receptors.
• a preferred lipoprotein contains cholesterol, triglyceride, phospholipid and apoprotein.
• the lipoprotein may be collected from a living body, a recombinant, or chemically synthesized, while a living body-derived lipoprotein is preferred from the viewpoint of achieving a higher level of safety.
• the lipoprotein is collected from an individual who is the subject of administration itself or from an individual of the same species as the subject of administration of the expression-suppressing agent.
• the above living body-derived lipoprotein is: a chylomicron formed on the intestinal moucosa by a lipid absorbed in vivo together with an apoprotein; or a chylomicron remnant produced from the chylomicron degraded by vascular endothelial lipoprotein lipase.
• the chylomicron is preferably exemplified.
• the above apoprotein is not particularly limited and by way of preferred exemplification, the apoprotein is an apoB protein or apoE protein.
• a lipoprotein containing a chylomicron used in the present invention may be collected from a living body, prepared from a synthetically-obtained substance, or a mixture thereof.
• the blood may be collected several hours after a lipid ingestion, while by way of preferred exemplification, 0.08 to 0.4 g/kg of Triton is injected intravenously, subsequently 5 to 25 ml/kg of high-protein/lipid solution (10 mg/ml of albumin, 40 mg/ml of triolein, and 40mg/ml sodium taurocholate) is administered orally to a living body, and then blood is collected after 3 to 12 hours.
• the method of preparing the above chylomicron-rich lipoprotein from a living body is, for example, a method where serum collected from a living body several hours after a lipid ingestion is added with a solution (a solution containing 11.4 g of NaCl, 0.1 g of EDTA, and 1 ml of IN NaOH per 1 liter of water; specific gravity 1.006) in the same volume as the serum, and the solution is centrifuged to provide a suspension from which the supernatant is collected.
• a solution a solution containing 11.4 g of NaCl, 0.1 g of EDTA, and 1 ml of IN NaOH per 1 liter of water; specific gravity 1.006
• the expression-suppressing agent of the present invention can be administered orally or parenterally depending on the type of the above-mentioned formulations, while from the viewpoint of achieving the expression-suppressing effect more quickly and efficiently, the expression-suppressing agent is preferably administered parenterally, more preferably administered by an injection, and even more preferably administered by an intravenous injection.
• the applied dose of the expression-suppressing agent of the present invention varies depending on age, weight, symptom of the subject of administration, the kind of disease affecting the subject of administration, and the sequence of siRNA or the like contained in the expression-suppressing agent. Generally, 0.1 to 30 mg/kg (siRNA weight basis) can be administered by dividing the amount into 1 to 3 separate doses a day.
• the target disease of the expression-suppressing agent of the present invention is not particularly limited as long as the suppression of a particular gene could lead to the treatment of the disease.
• the above disease is caused by the expression of a particular pathologic target gene, and by way of particularly preferred exemplification, the disease is viral hepatitis caused by an elevated expression of hepatitis virus gene or the familial amyloid neuropathy caused by the expression of a transthyretin gene variant.
• the subject of administration in the present invention is not particularly limited as long as the subject is an animal.
• the subject of administration is vertebrates, while animals belonging to mammals or birds are more preferably exemplified, among which, humans, rats, mice, pigs, rabbits, dogs, cats, monkeys, horses, cows, goats, and sheep can be even more preferably exemplified and human is particularly preferably exemplified.
• the expression-suppressing agent of the present invention can be used as an active ingredient of the pharmaceutical composition of the present invention.
• the pharmaceutical composition of the present invention is characterized in that it contains the expression-suppressing agent of the present invention as an active ingredient.
• the delivery method of the present invention is characterized in that the method comprises process (C) of administering to a vertebrate nucleic acids for suppressing a target gene expression, to which nucleic acids an introduction substance into chylomicron is bound, under a condition where the production of endogenous chylomicron is induced in the vertebrate.
• nucleic acids to which an introduction substance into chylomicron are bound are administered to a vertebrate under a condition where the production of endogenous chylomicron is induced in the vertebrate
• the introduction substance into chylomicron of the nucleic acids to which an introduction substance into chylomicron is bound interacts with a lipoprotein to form a complex of the nucleic acids to which an introduction substance into chylomicron is bound and the lipoprotein.
• This complex of the nucleic acids to which an introduction substance into chylomicron is bound and the lipoprotein is taken into a cell via a lipoprotein receptor, and therefore has enabled a very efficient in vivo intracellular delivery of nucleic acids for suppressing a target gene expression.
• nucleic acids for suppressing a target gene expression to which nucleic acids an introduction substance into chylomicron is bound
• a lipoprotein in the delivery method of the present invention have meanings as described above.
• the method of administering to a vertebrate nucleic acids to which an introduction substance into chylomicron is bound, under a condition where the production of endogenous chylomicron is induced in the vertebrate is not particularly limited, and the nucleic acids can be administered by the same method as the expression-suppressing agent of the present invention.
• Tissues that can be delivered nucleic acids to which an introduction substance into chylomicron is bound by the delivery method of the present invention is not par- ticularly limited, and the nucleic acids to which an introduction substance into chylomicron is bound can be delivered in vivo to any tissues such as liver, brain, peripheral nerves, lungs, intestinal tract, pancreas, kidneys, cardiac muscles, and skeletal muscles.
• Fig. 2 shows a diagram of an alpha-tocopherol transportation in the body to show that nucleic acids to which a lipid-soluble substance is bound can be delivered in vivo to each tissue by the delivery method of the present invention.
• an alpha-tocopherol contained in food or drink is absorbed by small intestines and further, mainly taken into a chylomicron which is a kind of lipoprotein.
• This chylomicron is metabolized into a chylomicron remnant by lipoprotein lipase (LPL) and is transported to the liver by this chylomicron remnant.
• LPL lipoprotein lipase
• an alpha-tocopherol is taken into a VLDL (very low-density lipoprotein) by an alpha- TTP (alpha-Tocopherol Transfer Protein). Subsequently, the VLDL containing an alpha-tocopherol is secreted into the blood and metabolized into an LDL (low-density lipoprotein) or HDL (high-density lipoprotein cholesterol) to form an alpha-tocopherol-containing LDL or HDL.
• VLDL very low-density lipoprotein
• TTP alpha-Tocopherol Transfer Protein
• LDL and HDL are transported by blood to each tissue so that the alpha-tocopherol is efficiently taken into various tissues through a receptor-mediated endocytosis that is mediated by a lipoprotein receptor existing on each tissue (for example, an LRP-I receptor, LDL receptor, HDL receptor or the like).
• a lipoprotein receptor existing on each tissue
• nucleic acids to which an introduction substance into chylomicron is bound of the present invention together with a lipoprotein are efficiently taken into a cell of each tissue through an endocytosis mediated by a lipoprotein receptor.
• the delivery method of the present invention is not particularly limited as long as the method comprises the above process (C), while from the viewpoint of enhancing the delivery efficiency of the nucleic acids so as to achieve an increased suppression efficiency of a target-gene expression, it is preferable that, before an administration of the nucleic acids to a vertebrate under a condition where the production of endogenous chylomicron is induced, the method comprises administering heparin and/or LPL to a subject of administration (process (B)); and that, before process (C), the method further comprises allowing a vertebrate to be in a state of starvation (process (A)).
• a state of starvation refers to a state where no food or drink is ingested for a certain period of time (except calorie-free food or drink such as water).
• the above state of starvation comprises the state where no food is given to the subject of administration, for example, at least for 6 hours, preferably at least for 8 hours, more preferably at least for 12 hours, and even more preferably at least for 24 hours.
• the method for treating a disease of the present invention (hereinafter also referred to as the treatment method of the present invention) is characterized in that the method comprises process (C) of administering to a vertebrate nucleic acids for suppressing a target gene expression, to which nucleic acids an introduction substance into chylomicron in bound, under the condition where the production of the endogenous chylomicron is induced in the vertebrate.
• nucleic acids to which an introduction substance into chylomicron is bound are administered to a vertebrate under a condition where the production of endogenous chylomicron is induced in the vertebrate, as mentioned above, the nucleic acids to which a lipid-soluble substance is bound are taken into a cell in vivo very efficiently, thereby an effect of suppressing the target gene expression is sufficiently exhibited in an appreciably safer manner as compared to conventional methods. Consequently, a superior therapeutic effect is obtained against the disease.
• the phrases "nucleic acids for suppressing a target gene expression, to which nucleic acids an introduction substance into chylomicron is bound” and "a chylomicron-rich lipoprotein" have meanings as described above.
• the method of administering to a vertebrate nucleic acids to which an introduction substance into chylomicron is bound, under a condition where the production of endogenous chylomicron is induced in the vertebrate is not particularly limited, and the nucleic acids can be administered by the same method as the expression-suppressing agent of the present invention.
• the target disease of the treatment method of the present invention is not particularly limited as long as the disease is caused by an elevated expression of a given gene. By way of specific exemplification, the disease is same as the above target diseases of the expression suppressing agent of the present invention.
• mice hepatic-cancer cell line (Hepa 1-6 cell line) used in the experiment described hereinbelow was maintained in the following manner.
• a mouse hepatic-cancer cell line (Hepa 1-6 cell line) was maintained under the condition of 37degC and 5%-by-mass of CO 2 , using a growth medium (DMEM: Sigma) added with 10% -by-mass of bovine fetal serum, 100 units/ml of penicillin and 100 micro-g of streptomycin.
• DMEM growth medium
• mice 10 minutes after the injection, the above mice were orally administered with 0.5 ml of protein-rich fluid food containing 5 mg of bovine serum albumin (Sigma), 20 mg of triolein (Wako Pure Chemical Industries, Ltd.: Tokyo, Japan), and 20 mg of sodium taurocholate (Wako Pure Chemical Industries, Ltd.: Tokyo, Japan).
• a solution a solution containing 11.4 g of NaCl, 0.1 g of EDTA, 1 ml of IN NaOH per 1 liter of water; specific gravity 1.006 was added in the same volume as the serum, which was then centrifuged at 26,000 g for 30 minutes under the condition of 16degC.
• the liver of the mice administered with Toc-siRNA and the like used in the experiment described hereinbelow was prepared in the following manner.
• mice 4-week old ICR mice (Charles River Laboratories: U.S. A) were provided. The above mice were fasted for 24 hours prior to the administration of Toc-siRNA and the like. Then, the mice were intravenously injected at the tail with 0.08 to 0.2 g/kg of Triton. Subsequently, the above mice were orally administered with 0.5 ml of protein- rich fluid food containing 250 micro-g of bovine serum albumin (Sigma) and 1 mg of triolein (Wako Pure Chemical Industries, Ltd.: Tokyo, Japan).
• mice were given at the tail a single intravenous administration of 0.25 ml of a 10%-by-mass maltose solution containing Toc-siRNA or the like.
• Toc-siRNA Ten minutes before administration of Toc-siRNA, the mice were intravenously injected at the tail with 8 to 10 units of heparin. Then, the mice were anesthetized as desired by an intraperitoneal administration of 60 mg/kg of pentobarbital, killed by perfusing a PBS solution transcardially, and the liver was taken out.
• Example 4 Example 4
• RNA was extracted from the cultured cells or tissues of the mice using Isogen (Nippon Gene Co., Ltd.: Tokyo).
• Isogen Natural Gene Co., Ltd.: Tokyo
• Superscript III and Random hexamers (Invitrogen) as directed by the accompanying protocol
• the above RNA was reversely transcripted to obtain the DNA which is complementary to the RNA.
• a quantitative RT-PCR was performed using 0.5 micro-1 of the above-mentioned complementary DNA, a predetermined primer and TaqMan Universal PCR Master Mix (Applied Biosystems) as directed by the accompanying protocol.
• the amplification was performed using ABI PRISM 7700 Sequence Detector (Applied Biosystems) by repeating 40 cycles each consisting of a denatu- ralization at 95degC for 15 seconds and an annealing at 60degC for 60 seconds.
• the primer for the mouse apoB gene, the primer for the GAPDH gene, and the primer for the TTR (Transthyretin) gene used as the above-mentioned predetermined primers were designed by Applied Biosystems. [0053] (Example 5)
• RNA was extracted from the Hepa 1-6 cell line or the mouse liver.
• the extracted RNA was concentrated using Ethachinmete (Nippon Gene Co., Ltd.: Tokyo, Japan). From the obtained RNA, 2 micro-g was electrophoretically separated with 14%-by-mass polyacrylamide gel (containing urea) and then transferred onto a Hybond-N+ membrane (Amersham Bio- sciences, Inc.: Piscataway, New Jersey, U.S.A).
• siRNA antisense strand fluo- rescently labeled with Gene Images 3'-oligo labeling kit (Amersham Biosciences, Inc.), was provided.
• siRNA targeted to the mouse apoB gene was designed.
• the nucleotide sequence of the sense strand (27 mer) of this siRNA is shown in SEQ ID NO: 1 (GUCAUCACACUGAAUACCAAUGCUGGA) and the nucleotide sequence of the antisense strand (29 mer) in SEQ ID NO:2 (UCCAGCAUUGGUAUUCAGUGUGAUGACAC).
• SEQ ID NO: 1 The nucleotide sequence of the sense strand and the antisense strand was synthesized in accordance with a common method. [0055] Subsequently, these nucleotide sequences were modified for an improved stability to in vivo RNases.
• nucleotides of nucleotide numbers 2, 5, 11, 15, 21, 24, and 25 of the siRNA sense strand (SEQ ID NO: 1) and the nucleotides of nucleotide numbers of 1, 2, 5, 12, 14, 21, 24, 25, and 26 of the antisense strand (SEQ ID NO: 2) were subjected to 2'-O-ribose methylation; the skeletal bond of the nucleotide of nucleotide number 26 of the sense strand (SEQ ID NO: 1) was subjected to thio- phosphorylation; and further, the nucleotides of nucleotide numbers 3, 4, 6, 27, and 28 of the antisense strand (SEQ ID NO: 2) were subjected to 2'-ribose methylation as well as thiophosphorylation of their skeletal bond.
• siRNA targeted to the mouse apoB gene and chemically modified in the above Example 6 (hereinafter also referred to as "a modified siRNA") was prepared (2 micro-g).
• This siRNA was incubated at 37degC for 24 hours in distilled water (DW) or in the above lipoprotein-rich serum prepared in accordance with the method described in Example 2.
• a given quantity was taken from each of the obtained solutions, treated with protainase K for 1 hour, and subjected to an electorophoresis with 2%-by-mass agarose gel, respectively.
• an siRNA same as the above siRNA except that it had not been modified (hereinafter also referred to as "an unmodified siRNA") (2 micro-g) was used to perform an electrophoresis in the same manner.
• Fig. 3B The result of the electrophoresis is shown in Fig. 3B.
• the modified siRNA shows a significantly improved stability in the serum as compared to the unmodified siRNA (Naked siRNA). This demonstrates that the modified siRNA is more stable to RNAases contained in the serum as compared to the unmodified siRNA. [0058] (Example 8)
• a chemical modification of an siRNA sometimes impairs the expression-suppressing activity (silencing activity) of the siRNA.
• the following experiment was performed.
• the above modified siRNA (2 micro-g) targeted to the mouse apoB gene was prepared.
• a Hepa 1-6 cell line was transfected with 10 nM of the above modified siRNA using Lipofect Amine RNAiMAX (Invitrogen). The transfected cell line was cultured for 24 hours after the transfection. From the resultant cell line, the total RNA was extracted and measured for the amount of endogenous apoB mRNA by the above quantitative RT-PCR described in Example 4.
• control siRNA an unmodified siRNA or an siRNA to a non-targeted gene (control siRNA) in place of the above modified siRNA
• Toc-siRNA is taken into a lipoprotein (LP) -rich serum with high chylomicron content.
• Toc-siRNA/LP alpha-tocopherol-bound siRNA-containing lipoprotein
• This Toc-siRNA/LP solution was filtered with a centrifugal filtration unit, Micron YM- 100 (Millipore) that blocks a material having the molecular weight of 100,000 or above.
• the solution obtained by the filtration was subjected to an electrophoresis with 2% -by-mass agarose gel and the RNA was dyed with ethidium bromide.
• Fig. 5 The results of these experiments are shown in Fig. 5.
• the upper row in Fig. 5 shows the results of an electrophoresis of a solution obtained by eluting the fraction left on the filter (in centrifugal device) and the lower row shows the results of an electr- tophoresis of a solution obtained by filtration (Filtered un-conjugated siRNA).
• siRNA is trapped by the above filter only in the case where the siRNA has been bound to an alpha-tocopherol (Tocopherol-conjugation+) and incubated with a lipoprotein-rich serum (lipoproteins+).
• a Toc-siRNA labeled with Cy3 fluorescence dye was administered to a mouse. After a lapse of 1 hour, the mouse was killed and the liver was taken out.
• liver was fixed in a 4%-by-mass paraformaldehyde/PBS solution for 6 hours, and immersed in a 30% sucrose/PBS solution overnight at 4degC.
• OCT compound Sakura Finetek Japan Co., Ltd.: Tokyo, Japan
• Leica Leica: Germany
• the frozen segment was moved onto Super Frost plus Microscope glass slide (Fisher Scientific: Pittsburg, Pennsylvania, U.S.A), counterstained for 20 minutes using 13 nM Alexa-488 Phalloidin (Invitrogen)/PBS solution and 40 nM Topro-3 (Invitrogen)/PBS solution. Then the segment was enclosed in a vector shield (Vector: Burlingame, California, U.S.A) and observed with LSM 510 confocal scanning microscopy (Zeiss: Germany) (Fig. 6A).
• Fig. 6A is an observation of the neighboring area of the liver sinusoid.
• the Cy3 fluorescence-dye signals were generally detected intensely on the part surrounding the blood vessel (the right part of the image divided by the dashed line in Fig. 6A), and it was confirmed that siRNAs were introduced into the hepatic cells (by way of example, the cells shown by triangles in Fig. 6A) and nonparenchymal cells (by way of example, the cells shown by arrows in Fig. 6A).
• This demonstrates that a Toc-siRNA is capable of conveying its siRNA to the liver.
• the mouse was administered with the Toc-siRNA, killed after a lapse of 24 hours, and the liver was taken out.
• a quantitative RT-PCR was performed, and mRNA expressions were measured for each of the apoB gene, GAPDH gene, and TTR gene. The results are shown in Fig. 7A. As can be seen from Fig.
• the Toc-siRNA (apoB-1 Toc-siRNA) specifically reduces only the target gene expression in the liver and that it does not affect non-specific gene expressions, i.e., that the Toc-siRNA does not have an off- target effect.
• the timings of the samplings from the Toc-siRNA-administered mice were staggered and the time-dependent change was measured. The results are shown in Fig 7B. As can be seen from Fig.
• WBC white blood cell count
• Pit blood platelet count
• BUN blood urea nitrogen level
• interferon (IFN) induction was examined in the mice 3 hours after the administration of 2 mg/kg Toc-siRNA/LP.
• an ELISA kit with the detection limit of 12.5 pg/ml PBL Biochemical Laboratories, Biosource
• IFN alpha interferon- alpha
• a lipoprotein-rich serum with high chylomicron content provided in accordance with the above method described in Example 2 was adjusted with 10% -by-mass maltose solution to obtain a triglyceride concentration of 20 g/L.
• Toc-siRNA (1 micro- g/micro-1, in terms of the amount of siRNA) was mixed with the same volume of the lipoprotein-rich serum (20 g/L triglyceride concentration). The mixture was incubated at 37degC for 1 hour, and an alpha-tocopherol-bound-siRNA-containing lipoprotein was obtained (hereinafter also referred to as "Toc-siRNA/LP").
• a Hepa 1-6 cell line having been cultured in a medium without a transfection reagent was added with 100 nM Toc-siRNA/LP and then further cultured for 6 hours.
• a northern blot analysis was performed in accordance with the above method described in Example 5. The result is shown in Fig. 8. As can be seen from Fig. 8, a processed 21-mer siRNA was confirmed to exist in addition to the original 27/29-mer siRNA. This shows that a Toc-siRNA/LP can be taken into a cell of the Hepa 1-6 cell line and that the 27/29-mer siRNA was cleaved into a 21-mer siRNA by a dicer existing in the cytoplasm. [0069] (Example 16)
• a mouse was administered with a Toc-siRNA/LP and killed after a lapse of 2 days and the liver was taken out.
• a quantitative RT-PCR was performed in accordance with the above method described in Example 4, and mRNA expressions were measured for each of the apoB gene, GAPDH gene, and TTR gene. The results are shown in Fig. 9. As can be seen from Fig. 9, Fig.
• the relative mRNA expressions (relative expression based on the total RNA) of other endogenous genes (GAPDH gene, TTR gene) expressed on the liver were in the same range as compared to the case of administering LP only.
• liver was taken out from the Toc-siRNA/LP-administered mouse in the above method described in Example 3.
• a part of the liver was fixed in 4% -by-mass paraformaldehyde, embedded in paraffin, and a 4 micro-m-thick segment was produced.
• the segment was subjected to a hematoxylin-eosin staining for a pathologic analysis. Further, as a control, results of a hematoxylin-eosin staining are shown for the liver segment of a mouse administered with LP only in place of Toc-siRNA/LP (Fig. 11).
• the value of apoB-1 Toc-siRNA (1 day after the administration of 2.0 mg/kg) in the above Fig. 7B of Example 12 are used, and as the data for the Toc-siRNA/LP of the present invention, the value of Toe- si RNA/LP (2 days after the administration of 1.0 mg/kg) in the above Fig. 9C of Example 16 were used.
• nucleic acids such as an siRNA for suppressing a target gene expression can be delivered in vivo more safely and efficiently.
• the expression-suppressing agent and pharmaceutical composition utilizing the delivery method of the present invention, the expression of a specific gene that causes a disease can be suppressed in vivo more safely and efficiently.
• the expression of a specific gene that causes a disease can be suppressed in vivo more safely and efficiently and consequently, the disease can be treated more safely and efficiently.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• General Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Medicinal Chemistry (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Biochemistry (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Epidemiology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Inorganic Chemistry (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicinal Preparation (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (5)

Applications Claiming Priority (2)

Related Child Applications (1)

Publications (1)

Family

ID=40678225

Family Applications (1)

Country Status (5)

Cited By (2)

Families Citing this family (8)

Citations (5)

Family Cites Families (1)

• 2008
  • 2008-11-28 CN CN200880117687XA patent/CN101874111B/zh not_active Expired - Fee Related
  • 2008-11-28 WO PCT/JP2008/003523 patent/WO2009069313A1/en not_active Ceased
  • 2008-11-28 JP JP2010520356A patent/JP5429884B2/ja active Active
  • 2008-11-28 EP EP08853348.4A patent/EP2215229B1/en not_active Not-in-force
• 2010
  • 2010-05-26 US US12/787,552 patent/US8329670B2/en active Active
• 2012
  • 2012-11-05 US US13/668,668 patent/US8507458B2/en active Active

Patent Citations (5)

Non-Patent Citations (15)

Also Published As

Similar Documents

Legal Events