WO2009046375A2 - Biofuel production - Google Patents

Biofuel production Download PDF

Info

Publication number
WO2009046375A2
WO2009046375A2 PCT/US2008/078850 US2008078850W WO2009046375A2 WO 2009046375 A2 WO2009046375 A2 WO 2009046375A2 US 2008078850 W US2008078850 W US 2008078850W WO 2009046375 A2 WO2009046375 A2 WO 2009046375A2
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
hydroxyphenyl
hydroxy
indole
dimethyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/078850
Other languages
English (en)
French (fr)
Other versions
WO2009046375A3 (en
Inventor
Yasuo Yoshikuni
Yuki Kashiyama
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bio Architecture Lab Inc
Original Assignee
Bio Architecture Lab Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bio Architecture Lab Inc filed Critical Bio Architecture Lab Inc
Priority to CA2699929A priority Critical patent/CA2699929A1/en
Priority to BRPI0817754-6A2A priority patent/BRPI0817754A2/pt
Priority to CN2008801192815A priority patent/CN101889092A/zh
Priority to JP2010528192A priority patent/JP2010539988A/ja
Priority to MX2010003501A priority patent/MX2010003501A/es
Priority to AU2008308477A priority patent/AU2008308477A1/en
Priority to NZ584162A priority patent/NZ584162A/en
Priority to EP08834856A priority patent/EP2195440A2/en
Publication of WO2009046375A2 publication Critical patent/WO2009046375A2/en
Publication of WO2009046375A3 publication Critical patent/WO2009046375A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/02Preparation of hydrocarbons or halogenated hydrocarbons acyclic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10Nitrogen as only ring hetero atom
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/02Preparation of hydrocarbons or halogenated hydrocarbons acyclic
    • C12P5/026Unsaturated compounds, i.e. alkenes, alkynes or allenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06Ethanol, i.e. non-beverage
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/16Butanols
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/22Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/24Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26Ketones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/24Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26Ketones
    • C12P7/38Cyclopentanone- or cyclopentadione-containing products
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02TCLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO TRANSPORTATION
    • Y02T50/00Aeronautics or air transport
    • Y02T50/60Efficient propulsion technologies, e.g. for aircraft
    • Y02T50/678Aviation using fuels of non-fossil origin

Definitions

  • the present application relates generally to the use of microbial and chemical systems to convert biomass to commodity chemicals, such as biofuels/biopetrols.
  • Fuel producers are seeking substantially similar, low carbon fuels that can be blended and distributed through existing infrastructure (e.g., refineries, pipelines, tankers).
  • Figure 1 shows the Vibrio spectacularus genomic region of the fosmid clone described in Example 1. Genes are indicated with orange arrows. Labels show the numerical gene indices and the predicted function of the proteins.
  • Figure 2 illustrates the pathways involved in certain embodiment in which E. coli may be engineered to grow on alginate as a sole source of carbon.
  • Figure 3 illustrates the pathways involved in certain embodiment in which E. coli may be engineered to grow on pectin as a sole source of carbon.
  • Figure 4 shows the results of engineered or recombinant E. coli growing on alginate as a sole source of carbon ⁇ see solid circles).
  • Agrobacterium tumefaciens cells provide a positive control ⁇ see hatched circles).
  • the well to the immediate left of the of the A. tumefaciens positive control contains DHlOB E. coli cells, which provide a negative control.
  • Figure 5 shows the growth of recombinant strain of E. coli on galacturonates and pectin.
  • Figure 5 A shows the growth of E. coli on various lengths of galacturonate after 24hr.
  • the recombinant strain in Figure 5 A is the E. coli BL21(DE3) strain harboring pTrlogl-kdgR + pBBRGal3P, and the control strain is the BL21(DE3) strain harboring pTrc99A + pBBRlMCS-2, as described in Example 2.
  • Figure 5B shows the growth of recombinant E. coli on pectin after 3-4 days.
  • the recombinant strain in Figure 5B is E. coli DH5a strain containing pPEL74 (Ctrl) and pPEL74 and pROU2, as described in Example 2.
  • Figure 6 shows the degradation of alginate to form pyruvate.
  • Figure 6A illustrates a simplified metabolic pathway for alginate degradation and metabolism.
  • Figure 6B shows the results of in vitro degradation of alginate to form pyruvate by an enzymatic degradation route.
  • Figure 6C shows the results of in vitro degradation of alginate to form pyruvate by a chemical degradation route.
  • Figure 7 shows the biological activity of various alcohol dehydrogenases isolated from Agrobacterium tumefaciens C58.
  • Figure 7 A shows DEHU hydrogenase activity as monitored by NADPH consumption
  • Figure 7B shows mannuronate hydrogenase activity as monitored by NADPH consumption.
  • Figure 8 shows the GC-MS chromatogram results for the control sample ( Figure 8A) and for isobutyraldehyde, 3-methylpentanol, and 2-methylpentanal production from pBADalsS-ilvCD-leuABCD2 and pTrcBALK ( Figure 8B).
  • Figure 9 shows the GC-MS chromatogram results for the control sample ( Figure 9A) and for 4-hydroxyphenylethanol and indole-3-ethanol production from pBADtyrA-aroLAC-aroG-tktA-aroBDE and pTrcBALK ( Figure 9B).
  • Figure 10 shows the mass spectrometry results for isobutanal (Figure 10A), 3-methylpentanol (Figure 10B), and 2-methylpentanol (Figure 10C).
  • Figure 11 shows the mass spectrometry results for phenylethanol (Figure 1 IA), 4-hydroxyphenylethanol (Figure 1 IB), and indole-3-ethanol ( Figure HC).
  • Figure 12 shows the biological activity of diol dehydratases.
  • Figure 12A shows the reduction of butyroin by ddh ⁇ , ddhl, and ddh3 as monitored by NADH consumption.
  • Figure 12B shows the oxidation activity of ddh3 towards 1,2- cyclopentanediol and 1 ,2-cyclohexanediol as measured by NADH production.
  • Figure 13 summarizes the results of kinetic studies for various substrates in the oxidation reactions catalyzed by the DDH polypeptides. These reactions were NAD+ dependent.
  • Figure 14 shows the nucleotide sequence ( Figure 14A) (SEQ ID NO:97) and polypeptide sequence ( Figure 14B) (SEQ ID NO:98) of diol dehydrogenase DDHl isolated from Lactobaccilus brevis ATCC 367.
  • Figure 15 shows the nucleotide sequence (Figure 15A) (SEQ ID NO:99) and polypeptide sequence ( Figure 15B) (SEQ ID NO: 100) of diol dehydrogenase DDH2 isolated from Pseudomonas putida KT2440.
  • Figure 16 shows the nucleotide sequence ( Figure 16A) (SEQ ID NO:101) and polypeptide sequence ( Figure 16B) (SEQ ID NO:102) of diol dehydrogenase DDH3 isolated from Klebsiella pneumoniae MGH78578.
  • Figure 17 shows the sequential in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • a benzaldehyde lyase bal
  • Figure 18 shows the sequential in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • This Figure illustrates the sequential conversion of n-pentanal into 6-hydroxy-5-decanone and then 5,6- decanediol.
  • Figure 18A shows the detection of valeroin (6-hydroxy-5-decanone) at 8.22 minutes
  • Figure 18B shows the detection of 5,6 decanediol at 9.22 and 9.35 minutes.
  • Figure 19 shows the sequential in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • This Figure illustrates the sequential conversion of 3-methylbutanal into 2,7-dimethyl-5-hydroxy-4-octanone and then 2,7-dimethyl-4,5-octanediol.
  • Figure 19A shows the detection of isoveraloin (2,7- dimethyl-5-hydroxy-4-octanone) at 6.79 minutes
  • Figure 19B shows the detection of 2,7-dimethyl-4,5-octanediol at 7.95 and 8.15 minutes.
  • Figure 20 shows the sequential in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • This Figure illustrates the sequential conversion of n-hexanal into 7-hydroxy-6-dodecanone and then 6,7- dodecanediol.
  • Figure 2OA shows the detection of hexanoin (7-hydroxy-6-decanone) at 10.42 minutes
  • Figure 2OB shows the detection of 6,7 dodecanediol at 10.89 and 10.95 minutes.
  • Figure 21 shows the sequential in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • This Figure illustrates the sequential conversion of 4-methylpentanal into 2,9-dimethyl-6-hydroxy-5-decanone and then 2,9-dimethyl-5,6-decanediol.
  • Figure 21 A shows the detection of isohexanoin (2,9-Dimethyl-6-hydroxy-5-decanone) at 9.45 minutes
  • Figure 21 B shows the detection of 2,9-dimethyl-5,6-decanediol at 10.38 and 10.44 minutes.
  • Figure 22 shows the in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • This Figure illustrates the conversion of n-octanal into 9-hydroxy-8-hexadecanone by showing the detection of detection of octanoin (9- hydroxy-8- hexadecanone) at 12.35 minutes.
  • Figure 23 shows the in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • Figure 24 shows the sequential in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • This Figure illustrates the sequential conversion of n-propanal into 4-hydroxy-3-hexanone and then 3,4- hexanediol.
  • Figure 25 the in vivo biological activity of a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and a ddh gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (DDH3).
  • Figure 26 shows the sequential biological acdtivity of a diol dehydrogenase ddh from Klebsiella pneumoniae MGH 78578 (DDH3) and a diol dehydratase pduCDE from Klebsiella pneumoniae MGH 78578.
  • Figure 26A shows GC-MS data which confirms the presence of 4,5-octanediol in the sample extraction, which is the expected product resulting from the reduction of butyroin by ddhi.
  • Figure 26B shows GC-MS data confirming the presence of 4-octanone in the sample extraction, which is the expected product resulting from the sequential dehydrogenation of butyroin and dehydration of 4,5-octanediol by ddh3 andpduCDE, respectively.
  • Figure 27 shows the sequential biological acdtivity of a diol dehydrogenase ddh from Klebsiella pneumoniae MGH 78578 (DDH3) and a diol dehydratase pduCDE from Klebsiella pneumoniae MGH 78578.
  • Figures 27A and 27B show comparisons between the sample extraction gas chromatograph/mass spectrum and the 4-octanone standard gas chromatograph/mass spectrum, confirming that 4- octanone was produced from butyroin using the enzymes diol dehydrogenase (ddh3) and a diol dehydratase (pduCDE).
  • Figure 28 shows the nucleotide sequence (Figure 28A) (SEQ ID NO: 103) and polypeptide sequence (Figure 28B) (SEQ ID NO: 104) of a diol dehydratase large subunit (pduC) isolated from Klebsiella pneumoniae MGH78578.
  • Figure 29 shows the nucleotide sequence (Figure 29A) (SEQ ID NO: 105) and polypeptide sequence (Figure 29B) (SEQ ID NO: 106) of a diol dehydratase medium subunit isolated from Klebsiella pneumoniae MGH78578 (pduD), in addition to the nucleotide sequence ( Figure 29C) (SEQ ID NO: 107) and polypeptide sequence (Figure 29D) (SEQ ID NO: 108) of a diol dehydratase small subunit isolated from Klebsiella pneumoniae MGH78578 (pduE).
  • Figure 30 shows the oxidation of 4-octanol by secondary alcohol dehydrogenases as monitored by NADH production ( Figure 30A) and NADPH production ( Figure 30B).
  • Figure 31 shows the oxidation of 4-octanol by secondary alcohol dehydrogenases as monitored by NADH production ( Figure 31 A) and NADPH production ( Figure 31B).
  • Figure 32 shows the oxidation of 2,7-dimethyl octanol by secondary alcohol dehydrogenases as monitored by NADH production ( Figure 32A) and NADPH production ( Figure 32B).
  • Figure 33 shows the oxidation and reduction activity of 2ADH 11 and 2ADH16.
  • Figure 33A shows the reduction of 2,7-dimethyl-4-octanone as measured by NADPH consumption.
  • Figure 33B shows the reduction of 2,7-dimethyl-4-octanone, 4- octanone, and cycolypentanone.
  • Figure 34 shows the oxidation and reduction of cyclopentanol by secondary alcohol dehydrogenases.
  • Figure 34A shows the oxidation of cyclopentanol as monitored by NADH or NADPH formation.
  • Figure 34B shows the reduction of cyclopentanol as monitored by NADPH consumption.
  • Figure 35 shows the calculated rate constants for the illustrated reduction reactions for each substrate catalyzed by secondary alcohol dehydrogenase ADH- 16 (SEQ ID NO: 138).
  • Figure 36 shows the calculated rate constants for the illustrated oxidation reactions for each substrate catalyzed by secondary alcohol dehydrogenase ADH- 16 (SEQ ID NO: 138).
  • Figure 37 shows a list of alginate lyases genes/proteins that may be utilized according to the methods and recombinant microorganisms described herein.
  • Figure 38 shows a list of pectate lyase genes/proteins that may be utilized according to the methods and recombinant microorganisms described herein.
  • Figure 39A shows a list of rhamnogalacturonan lyase genes/proteins that may be utilized according to the methods and recombinant microorganisms described herein.
  • Figure 39B shows a list of rhamnogalacturonate hydrolase genes/proteins that may be utilized according to the methods and recombinant microorganisms described herein.
  • Figure 40 shows a list of pectin methyl esterase genes/proteins that may be utilized according to the methods and recombinant microorganisms described herein.
  • Figure 41 shows a list of pectin acetyl esterase genes/proteins that may be utilized according to the methods and recombinant microorganisms described herein.
  • Figure 42 shows the production of 2-phenyl ethanol (Figure 42A), 2-(4- hydroxyphenyl) ethanol ( Figure 42B), and 2-(indole-3-)ethanol ( Figure 42C) at 24 hours from the recombinant microorganisms described in Example 4, which comprise functional 2-phenylethanol, 2-(4-hydroxyphenyl)ethanol, and 2-(indole-3-)ethanol biosynthesis pathways.
  • Figure 43 shows the GC-MS chromatogram results that confirm the production of 2-phenyl ethanol (Figure 43B) at one week from the recombinant microorganisms described in Example 4 (pBADpheA-aroLAC-aroG-tktA-aroBDE and pTrcBALK).
  • Figure 43A shows the negative control cells (pBAD33 and pTrc99A).
  • Figure 44 shows the GC-MS chromatogram results that confirm the production of 2-(4-hydroxyphenyl) ethanol (9.36 min) and 2-(indole-3) ethanol (10.32 min) at one week from the recombinant microorganisms described in Example 4 (pBADtyrA-aroLAC-aroG-tktA-aroBDE and pTrcBALK).
  • Figure 45 confirms both the formation of 1 -propanal from 1 ,2- propanediol (Figure 45A), and the formation of 2-butanone from meso-2,3-butanediol (Figure 45B), both of which were catalyzed in vitro by an isolated Bl 2 independent diol dehydratase, as described in Example 9.
  • Figure 46A shows the in vivo production of 1 -propanol from 1 ,2- propanediol.
  • Figure 46B shows the in vivo production of 2-butanol from meso-2,3 butanediol.
  • Figure 46C shows the in vivo production of cyclopentanone from trans- 1,2- cyclopentanediol.
  • Figure 47 shows the results of the TBA assay, as performed in Example 10.
  • the left tube in Figure 47 represents media taken from an overnight culture of cells expressing Vs24254, showing secretion of an alginate lyase, while the right hand tube shows the TBA reaction using media from cells expressing Vs24259 (negative control).
  • the lack of pink coloration in the negative control indicates that little or no cleavage of the alginate polymer has occurred.
  • Figure 48 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized benzaldehyde lyase (BAL) catalyzed the in vivo production of 3-hydroxy-2-pentanone and 2-hydroxy-3-pentanone from a ligation reaction between acetaldehyde and propionaldehyde ( Figure 48A), and catalyzed the in vivo production of 4-hydroxy-3-heptanone and 3-hydroxy-4-heptanone from a ligation reaction between propionaldehyde and butyraldehyde ( Figure 48B).
  • BAL codon-optimized benzaldehyde lyase
  • Figure 49 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized BAL catalyzed the in vivo production of 3-hydroxy- 2-heptanone from a ligation reaction between acetaldehyde and pentanal ( Figure 49A), and catalyzed the in vivo production of 4-hydroxy-3-octanone and 3-hydroxy-4- octanone from a ligation reaction between pentanal and propionaldehyde ( Figure 49B).
  • Figure 50 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized BAL catalyzed the in vivo production of 5-hydroxy- 4-nonanone from ligation reaction between butyraldehyde and pentanal ( Figure 50A), and catalyzed the in vivo production of 2-methyl-5-hydroxy-4-decanone and 2-methyl- 4-hydroxy-5-decanone from ligation reaction between hexanal and 3- methylbutyraldehyde ( Figure 50B).
  • Figure 51 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized BAL catalyzed the in vivo production of 6-methyl-3- hydroxy-2-heptanone from ligation reaction between acetaldehyde and 4-methylhexanal ( Figure 51A), and catalyzed the in vivo production of 7-methyl-4-hydroxy-3-octanone from a ligation reaction between 4-methylhexanal and propionaldehyde ( Figure 51B).
  • Figure 52 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized BAL catalyzed the in vivo production of 8-methyl- 5-hydroxy-4-nonanone from ligation reaction between 4-methylhexanal and butyraldehyde ( Figure 52A), and catalyzed the in vivo production of 3-hydroxy-2- decanone from a ligation reaction between acetaldehyde and octanal ( Figure 52B).
  • Figure 53 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized BAL catalyzed the in vivo production of 4-hydroxy- 3-undecanone from ligation reaction between octanal and propionaldehyde ( Figure 53A), and catalyzed the in vivo production of 5-hydroxy-4-dodecanone from a ligation reaction between octanal and butyraldehyde ( Figure 53B).
  • Figure 54 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized BAL catalyzed the in vivo production of 6-hydroxy- 5-tridecanone ( Figure 54A) from ligation reaction between octanal and pentanal, and catalyzed the in vivo production of 2-methyl-5-hydroxy-4-dodecanone and 2-methyl-4- hydroxy-5-decanone from a ligation reaction between octanal and 3- methylbutyraldehyde ( Figure 54B).
  • Figure 55 shows the in vivo biological activity of a C-C ligase isolated from Pseudomonas fluorescens and cloned into E. coli.
  • the GC-MS chromatogram results show that codon-optimized BAL catalyzed the in vivo production of 2-methyl-6- hydroxy-5-tridecanone from a ligation reaction between octanal and 4-methylpentanal.
  • Figure 56 shows the growth of recombinant E. coli on alginate as a sole source of carbon ( Figure 56A), as described in Example 10. Growth on glucose ( Figure 56B) provides a positive control.
  • the cells were transformed with either no plasmid (BL21 - negative control), one plasmid (e.g., Da or 3a), or two plasmids ⁇ e.g., Dk3a and Da3k).
  • the plasmids are indicated by the lower case letter: "a” refers to the pET- DEST42 plasmid backbone and "k” refers to the pENTR/D/TOPO backbone.
  • D indicates that the plasmid contains the genomic region Vs24214-24249
  • 3 indicates that the plasmid contains the genomic region Vs24189-24209.
  • Da would be pET-DEST42-Vs24214-24249
  • Da3k would be P ET-DEST42-Vs24214- 24249 and pENTR/D/TOPO-Vs24189-24209 and so on.
  • Figure 57 shows the production of ethanol by E. coli growing on alginate, as performed in Example 1 1.
  • E. coli was transformed with either pBBRPdc- AdhA/B or pBBRPdc-AdhA/B + 1.5 FOS and allowed to grow in m9 media containing alginate.
  • Embodiments of the present invention include methods for converting a polysaccharide to a commodity chemical, comprising (a) contacting the polysaccharide, wherein the polysaccharide is optionally derived from biomass, with a polysaccharide degrading or depolymerizing metabolic system, wherein the metabolic system is selected from; (i) enzymatic or chemical catalysis, and (ii) a microbial system, wherein the microbial system comprises a recombinant microorganism, wherein the recombinant microorganism comprises one or exogenous genes that allow it to grow on the polysaccharide as a sole source of carbon, thereby converting the polysaccharide to a suitable monosaccharide or oligosaccharide; and (b) contacting the suitable monosaccharide or oligosaccharide with commodity chemical biosynthesis pathway, wherein the commodity chemical biosynthesis pathway comprises an aldehyde or ketone biosynthesis pathway, thereby converting the poly
  • the biomass is selected from marine biomass and vegetable/fruit/plant biomass.
  • the marine biomass is selected from kelp, giant kelp, sargasso, seaweed, algae, marine microflora, microalgae, and sea grass.
  • the vegetable/fruit/plant biomass comprises plant peel or pomace.
  • the vegetable/fruit/plant biomass is selected from citrus, potato, tomato, grape, gooseberry, carrot, mango, sugar-beet, apple, switchgrass, wood, and stover.
  • the polysaccharide is selected from alginate, agar, carrageenan, fucoidan, pectin, polygalacturonate, cellulose, hemicellulose, xylan, arabinan, and mannan.
  • the suitable monosaccharide or oligosaccharide is selected from 2-keto-3-deoxy D-gluconate (KDG), D-mannitol, guluronate, mannuronate, mannitol, lyxose, glycerol, xylitol, glucose, mannose, galactose, xylose, arabinose, glucuronate, galacturonates, and rhamnose.
  • KDG 2-keto-3-deoxy D-gluconate
  • D-mannitol guluronate
  • mannuronate mannitol
  • lyxose glycerol
  • xylitol glucose, mannose, galactose,
  • the commodity chemical is selected from methane, methanol, ethane, ethene, ethanol, n-propane, 1 -propene, 1 -propanol, propanal, acetone, propionate, n-butane, 1-butene, 1-butanol, butanal, butanoate, isobutanal, isobutanol, 2- methylbutanal, 2-methylbutanol, 3-methylbutanal, 3-methylbutanol, 2-butene, 2- butanol, 2-butanone, 2,3-butanediol, 3-hydroxy-2-butanone, 2,3-butanedione, ethylbenzene, ethenylbenzene, 2-phenylethanol, phenylacetaldehyde, 1 -phenylbutane, 4-phenyl- 1-butene, 4-phenyl-2-butene, 1 -phenyl-2-butene, 1 -
  • Certain embodiments of the present invention include methods for converting a polysaccharide to a suitable monosaccharide or oligosaccharide, comprising: (a) contacting the polysaccharide, wherein the polysaccharide is optionally obtained from biomass, with a microbial system for a time sufficient to convert the polysaccharide to a suitable monosaccharide or oligosaccharide, wherein the microbial system comprises, (i) at least one gene encoding and expressing an enzyme selected from a lyase and a hydrolase, wherein the lyase and/or hydrolase optionally comprises at least one signal peptide or at least one autotransporter domain; (ii) at least one gene encoding and expressing an enzyme selected from a monosaccharide transporter, a disaccharide transporter, a trisaccharide transporter, an oligosaccharide transporter, a polysaccharide transporter, and a superchannel; and (ii
  • Certain embodiments of the present invention include methods for converting a polysaccharide to a suitable monosaccharide or oligosaccharide, comprising: (a) contacting the polysaccharide, wherein the polysaccharide is optionally obtained from biomass, with a chemical or enzymatic catalysis pathway for a time sufficient to convert the polysaccharide to a first monosaccharide or oligosaccharide; and (b) contacting the first monosaccharide or oligosaccharide with a microbial system for a time sufficient to convert the first monosaccharide or oligosaccharide to the suitable monosaccharide or oligosaccharide, wherein the microbial system comprises, (i) at least one gene encoding and expressing an enzyme selected from a lyase and a hydrolase, (ii) at least one gene encoding and expressing an enzyme selected from a monosaccharide transporter, a disaccharide transporter,
  • the lyase is selected from an alginate lyase, a pectate lyase, a polymannuronate lyase, a polygluronate lyase, a polygalacturonate lyase and a rhamnogalacturonate lyase.
  • the hydrolase is selected from an alginate hydrolase, a rhamnogalacturonate hydrolase, a polymannuronate hydrolase, a pectin hydrolase, and a polygalacturonate hydrolase.
  • the transporter is selected from an ABC transporter, a symporter, and an outer membrane porin.
  • the ABC transporter is selected from Atu3021, Atu3022, Atu3023, Atu3024, algMl, algM2, AIgQl, AlgQ2, AIgS, OG2516_05558, OG2516_05563, OG2516_05568, OG2516_05573, TogM, TogN, TogA, TogB, and functional variants thereof.
  • the symporter is selected from V12B01 24239 (SEQ ID NO:26), V12B01 24194 (SEQ ID NO:8), and TogT, and functional variants thereof.
  • the outermembrane porin comprises a porin selected from Vl 2B01 24269, KdgM, and KdgN, and functional variants thereof.
  • Certain embodiments include a recombinant microorganism that is capable of growing on a polysaccharide as a sole source of carbon, wherein the polysaccharide is selected from alginate, pectin, tri-galacturonate, di-galacturonate, cellulose, and hemi-cellulose.
  • the polysaccharide is alginate.
  • the polysaccharide is pectin.
  • the polysaccharide is tri-galacturonate.
  • Certain embodiments include a recombinant microrganism, comprising (i) at least one gene encoding and expressing an enzyme selected from a lyase and a hydrolase, wherein the lyase or hydrolase optionally comprises at least one signal peptide or at least one autotransporter domain; (ii) at least one gene encoding and expressing an enzyme selected from a monosaccharide transporter, a disaccharide transporter, a trisaccharide transporter, an oligosaccharide transporter, a polysaccharide transporter, and a superchannel; and (iii) at least one gene encoding and expressing an enzyme selected from a monosaccharide dehydrogenase, an isomerase, a dehydratase, a kinase, and an aldolase.
  • the microorganism is capable of growing on a polysaccharide as a sole source of carbon.
  • the polysaccharide isomerase,
  • Certain embodiments include methods for converting a suitable monosaccharide or oligosaccharide to a first commodity chemical comprising, (a) contacting the suitable monosaccharide or oligosaccharide with a microbial system for a time sufficient to convert to the suitable monosaccharide or oligosaccharide to the commodity chemical, wherein the microbial system comprises a recombinant microorganism, wherein the microorganism comprises a commodity chemical biosynthesis pathway, thereby converting the suitable monosaccharide or oligosaccharide to the first commodity chemical.
  • the commodity chemical pathway comprises one or more genes encoding an aldehyde or ketone biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway is selected from one or more of an acetoaldehyde, a propionaldehyde, a butyraldehyde, an isobutyraldehyde, a 2 -methyl -butyraldehyde, a 3 -methyl -butyraldehyde, a 2-phenyl acetaldehyde, a 2-(4-hydroxyphenyl) acetaldehyde, a 2-Indole-3 -acetoaldehyde, a glutaraldehyde, a 5-amino-pentaldehyde, a succinate semialdehyde, and a succinate 4- hydroxyphenyl acetaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises an acetoaldehyde biosynthesis pathway and a biosynthesis pathway selected from a propionaldehyde, butyraldehyde, isobutyraldehyde, 2-methyl-butyraldehyde, 3-methyl-butyraldehyde, a 2-phenyl acetoaldehyde, a 2-(4-hydroxyphenyl) acetaldehyde, and a 2-Indole-3-acetoaldehyde biosynthesis pathway.
  • a biosynthesis pathway selected from a propionaldehyde, butyraldehyde, isobutyraldehyde, 2-methyl-butyraldehyde, 3-methyl-butyraldehyde, a 2-phenyl acetoaldehyde, a 2-(4-hydroxyphenyl) acetaldehyde, and a 2-Indole-3-acetoaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises a propionaldehyde biosynthesis pathway and a biosynthesis pathway selected from a butyraldehyde, isobutyraldehyde, 2-methyl-butyraldehyde, 3-methyl- butyraldehyde, and phenylacetoaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises a butyraldehyde biosynthesis pathway and a biosynthesis pathway selected from an isobutyraldehyde, 2-methyl- butyraldehyde, 3-methyl-butyraldehyde, a 2-phenyl acetoaldehyde, a 2-(4- hydroxyphenyl) acetaldehyde, and a 2-Indole-3-acetoaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises an isobutyraldehyde biosynthesis pathway and a biosynthesis pathway selected from a 2- methyl-butyraldehyde, 3-methyl-butyraldehyde, a 2-phenyl acetoaldehyde, a 2-(4- hydroxyphenyl) acetaldehyde, and a 2-Indole-3 -acetoaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises a 2-methyl-butyraldehyde biosynthesis pathway and a biosynthesis pathway selected from a 3-methyl-butyraldehyde, a 2-phenyl acetoaldehyde, a 2-(4- hydroxyphenyl) acetaldehyde, and a 2-Indole-3 -acetoaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises a 3-methyl- butyraldehyde biosynthesis pathway and a biosynthesis pathway selected from a 2- phenyl acetoaldehyde, a 2-(4-hydroxyphenyl) acetaldehyde, and a 2-Indole-3- acetoaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises a 2-phenyl acetoaldehyde biosynthesis pathway and a biosynthesis pathway selected from a 2-(4-hydroxyphenyl) acetaldehyde and a 2- Indole-3 -acetoaldehyde biosynthesis pathway.
  • the aldehyde or ketone biosynthesis pathway comprises a 2-(4-hydroxyphenyl) acetaldehyde biosynthesis pathway and a 2-Indole-3- acetoaldehyde biosynthesis pathway.
  • the first commodity chemical is further enzymatically and/or chemically reduced and dehydrated to a second commodity chemical.
  • Certain embodiments include methods for converting a suitable monosaccharide or oligosaccharide to a commodity chemical comprising, (a) contacting the suitable monosaccharide or oligosaccharide with a microbial system for a time sufficient to convert to the suitable monosaccharide or oligosaccharide to the commodity chemical, wherein the microbial system comprises; (i) one or more genes encoding and expressing an aldehyde biosynthesis pathway, wherein the aldehyde biosynthesis pathway comprises one or more genes encoding and expressing a decarboxylase enzyme; and (ii) one or more genes encoding and expressing an aldehyde reductase, thereby converting the suitable monosaccharide or oligosaccharide to the commodity chemical.
  • the decarboxylase enzyme is an indole- 3-pyruvate decarboxylase (IPDC).
  • IPDC comprises an amino acid sequence that is at least 80%, 90%, 95%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 312.
  • the aldehyde reductase enzyme is a phenylacetaldehyde reductase (PAR).
  • PAR comprises an amino acid sequence that is at least 80%, 90%, 95%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 313.
  • the commodity chemical is selected from 2-phenylethanol, 2-(4-hydroxyphenyl) ethanol, and indole-3-ethanol.
  • Certain embodiments include a recombinant microorganism, comprising (i) one or more genes encoding and expressing an aldehyde biosynthesis pathway, wherein the aldehyde biosynthesis pathway comprises one or more genes encoding and expressing a decarboxylase enzyme; and (ii) one or more genes encoding and expressing an aldehyde reductase.
  • the aldehyde biosynthesis pathway further comprises one or more genes encoding and expressing an enyzme selected from a CoA-linked aldehyde dehydrogenase, an aldehyde dehydrogenase, and an alcohol dehydrogenase.
  • the decarboxylase enzyme is an indole-3- pyruvate decarboxylase (IPDC).
  • the aldehyde reductase enzyme is a phenylacetoaldehyde reductase (PAR).
  • the microorganism is capable of converting a suitable monosaccharide or oligosaccharide to a commodity chemical.
  • the commodity chemical is selected from 2-phenylethanol, 2-(4- hydroxyphenyl) ethanol, and indole-3-ethanol.
  • Certain embodiments include a recombinant microorganism, wherein the microorganism comprises reduced ethanol production capability compared to a wild- type microorganism.
  • the microorganism comprises a reduction or inhibition in the conversion of acetyl-coA to ethanol.
  • the recombinant microorganism comprises a reduction of an ethanol dehydrogenase, thereby providing a reduced ethanol production capability.
  • the ethanol dehydrogenase is an adhE, homolog or variant thereof.
  • the microorganism comprises a deletion or knockout of an adhE, homolog or variant thereof.
  • the recombinant microorganism comprises one or more deletions or knockouts in a gene encoding an enzyme selected from an enzyme that catalyzes the conversion of acetyl-coA to ethanol, an enzyme that catalyzes the conversion of pyruvate to lactate, an enzyme that catalyzes the conversion of fumarate to succinate, an enzyme that catalyzes the conversion of acetyl-coA and phosphate to coA and acetyl phosphate, an enzyme that catalyzes the conversion of acetyl-coA and formate to coA and pyruvate, and an enzyme that catalyzes the conversion of alpha-keto acid to branched chain amino acids.
  • the microbial systems or recombinant microorgansims described herein comprise a microorganism selected from Acetobacter aceti, Achromobacter, Acidiphilium, Acinetobacter, Actinomadura, Actinoplanes, Aeropyrum pernix, Agrobacterium, Alcaligenes, Ananas comosus (M), Arthrobacter, Aspargillus niger, Aspergillus oryze, Aspergillus melleus, Aspergillus pulverulentus, Aspergillus saitoi, Aspergillus sojea, Aspergillus usamii, Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus lentus, Bacillus licheniformis, Bacillus macerans, Bacillus stearothermophilus, Bacillus subtilis, Bifi
  • Certain embodiments include a commodity chemical produced by the methods described herein. Certain aspects include a blended commodity chemical comprising a commodity chemical produced by the methods provided herein and a refinery-produced petroleum product.
  • the commodity chemical is selected from a C 10-Cl 2 hydrocarbon, 2-phenylethanol, 2-(4-hydroxyphenyl) ethanol, and indole-3 -ethanol.
  • the C 10-Cl 2 hydrocarbon is selected from 2,7-dimethyloctane and 2,9-dimethyldecane.
  • the refinery-produced petroleum product is selected from jet fuel and diesel fuel.
  • Certain embodiments include methods of producing a commodity chemical enriched refinery-produced petroleum product, comprising (a) blending the refinery-produced petroleum product with the commodity chemical produced by the methods described herein, thereby producing the commodity chemical enriched refinery-produced petroleum product.
  • Embodiments of the present invention relate to the unexpected discovery that microorganisms which are otherwise incapable of growing on certain polysaccharides derived from biomass as a sole source of carbon, can be engineered to grow on these polysaccharides as a sole source of carbon.
  • Such microorganisms can include both prokaryotic and eukaryotic microorganisms, such as bacteria and yeast.
  • certain laboratory and/or wild-type strains of E. coli can be engineered to grow on biomass derived from either alginate or pectin as a sole source of carbon to produce suitable monosaccharides or other molecules.
  • the monosaccharides and other molecules produced by the growth of these engineered or recombinant microorganisms on alginate or pectin may be utilized as feedstock in the production of various commodity chemicals, such as biofuels.
  • Alginate and pectin provide advantages over other biomass sources in the production of biofuel feedstocks.
  • large-scale aquatic-farming can generate a significant amount of biomass without replacing food crop production with energy crop production, deforestation, and recultivating currently uncultivated land, as most of hydrosphere including oceans, rivers, and lakes remains untapped.
  • the Pacific coast of North America is abundant in minerals necessary for large-scale aqua-farming.
  • Giant kelp which lives in the area, grows as fast as lm/day, the fastest among plants on earth, and grows up to 50 m.
  • aqua-farming has other benefits including the prevention of a red tide outbreak and the creation of a fish-friendly environment.
  • biomass derived from aquatic, fruit, plant and/or vegetable sources is easy to degrade.
  • Such biomass typically lacks lignin and is significantly more fragile than lignocellulolic biomass and can thus be easily degraded using either enzymes or chemical catalysts (e.g., formate).
  • aquatic biomass such as seaweed may be easily converted to monosaccharides using either enzymes or chemical catalysis, as seaweed has significantly simpler major sugar components (Alginate: 30%, Mannitol: 15%) as compared to lignocellulose (Glucose: 24.1-39%, Mannose: 0.2-4.6%, Galactose: 0.5- 2.4%, Xylose: 0.4-22.1%, Arabinose 1.5-2.8%, and Uronic acids: 1.2-20.7%, and total sugar contents are corresponding to 36.5-70% of dried weight).
  • biomass from plants such as fruit and/or vegetable contains pectin, a heteropolysaccharide derived from the plant cell wall.
  • the characteristic structure of pectin is a linear chain of ⁇ -(l-4)-linked D-galacturonic acid that forms the pectin-backbone, a homogalacturonan.
  • Pectin can be easily converted to oligosaccharides or suitable monosaccharides using either enzymes, chemical catalysis, and/or microbial systems designed to utilize pectin as a source of carbon, as described herein. Saccharification and fermentation using aquatic, fruit, and/or vegetable biomass is much easier than using lignocellulose.
  • embodiments of the present invention also relate to the surprising discovery that certain microorganisms can be engineered to produce various commodity chemicals, such as biofuels.
  • these biofuels may include alkanes, such as medium to long chain alkanes, which provide advantages over ethanol based biofuels.
  • the monosaccharides e.g., 2-keto-3-deoxy D- gluconate; KDG
  • KDG 2-keto-3-deoxy D- gluconate
  • other molecules produced by the growth of various engineered or recombinant microorganisms e.g., recombinant microorganisms growing on pectin or alginate as a source of carbon
  • KDG 2-keto-3-deoxy D- gluconate
  • other molecules produced by the growth of various engineered or recombinant microorganisms e.g., recombinant microorganisms growing on pectin or alginate as a source of carbon
  • suitable monosaccharides such as KDG may be utilized by recombinant microorganisms to produce alkanes, such as medium to long chain alkanes, among other chemicals.
  • alkanes such as medium to long chain alkanes
  • recombinant microorganisms may be utilized to produce such commodity chemical as 2,7 dimethyl octane and 2,9 dimethyl decane, among others provided herein and known in the art.
  • medium to long chain alkanes provide a number of important advantages over the existing common biofuels such as ethanol and butanol, and are attractive long-term replacements of petroleum-based fuels such as gasoline, diesels, kerosene, and heavy oils in the future.
  • medium to long chain alkanes and alcohols are major components in all petroleum products and jet fuel in particular, and hence alkanes we produce can be utilized directly by existing engines.
  • medium to long chain alcohols are far better fuels than ethanol, and have a nearly comparable energy density to gasoline.
  • n-alkanes are major components of all oil products including gasoline, diesels, kerosene, and heavy oils.
  • Microbial systems or recombinant microorganisms may be used to produce n-alkanes with different carbon lengths ranging, for example, from C7 to over C20: C7 for gasoline (e.g., motor vehicles), ClO-Cl 5 for diesels (e.g., motor vehicles, trains, and ships), and C8-C16 for kerosene (e.g., aviations and ships), and for all heavy oils.
  • the commodity chemicals produced by the methods and recombinant microorganisms described herein may be utilized by existing petroleum refineries for the purposes of blending with petroleum products produced by traditional refinery methods.
  • fuel producers are seeking substantially similar, low carbon fuels that can be blended and distributed through existing infrastructure (refineries, pipelines, tankers).
  • hydrocarbons the commodity chemicals produced according to the methods herein are substantially similar to petroleum derived fuels, reduce green house gas emissions by more than 80% from petroleum derived fuels, and are compatible with existing infrastructure in the oil and gas industry.
  • certain of the commodity chemicals produced herein including, for example, various C 10-Cl 2 hydrocarbons such as 2,7 dimethyloctane, 2,7 dimethyldecanone, among others, are blendable directly into refinery-produced petroleum products, such as jet and diesel fuels.
  • refineries may reduce Green House Gas emissions by more than 80%.
  • certain embodiments of the present invention relate generally to methods for converting biomass to a commodity chemical, comprising obtaining a polysaccharide from biomass; contacting the polysaccharide with a polysaccharide degrading or depolymerizing pathway, thereby converting the polysaccharide to a suitable monosaccharide.
  • the suitable monosaccharide obtained from such as process may be used for any desired purpose.
  • the suitable monosaccharide may then be converted to a commodity chemical (e.g., biofuel) by contacting the suitable monosaccharide with a biofuel biosynthesis pathway, whether as part of a recombinant microorganism, an in vitro enzymatic or chemical pathway, or a combination thereof, thereby converting the monosaccharide to a commodity chemical.
  • a commodity chemical e.g., biofuel
  • a suitable monosaccharide in producing a commodity chemical such as a biofuel, may be obtained directly from any available source and converted to a commodity chemical by contacting the suitable monosaccharide with a biofuel biosynthesis pathway, as described herein.
  • biofuels may then be blended directly with refinery produced petroleum products, such as jet and diesel fuels, to produce commodity chemical enriched, refinery-produced petroleum products.
  • an element means one element or more than one element.
  • biologically active fragment refers to a fragment that has at least about 0.1 , 0.5, 1, 2, 5, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, 100, 110, 120, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000% or more of the activity of a reference sequence.
  • reference sequence refers generally to a nucleic acid coding sequence, or amino acid sequence, of any enzyme having a biological activity described herein ⁇ e.g., saccharide dehydrogenase, alcohol dehydrogenase, dehydratase, lyase, transporter, decarboxylase, hydrolase, etc.), such as a "wild-type” sequence, including those reference sequences exemplified by SEQ ID NOS: 1-144, and 308-313.
  • a reference sequence may also include naturally-occuring, functional variants ⁇ i.e., orthologs or homologs) of the sequences described herein.
  • biologically active fragments of at least about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 500, 600 or more contiguous nucleotides or amino acid residues in length, including all integers in between, which comprise or encode a polypeptide having an enzymatic activity of a reference polynucleotide or polypeptide.
  • Representative biologically active fragments generally participate in an interaction, e.g., an intramolecular or an inter-molecular interaction.
  • An inter-molecular interaction can be a specific binding interaction or an enzymatic interaction.
  • enzymatic interactions or activities include saccharide dehydrogenase activities, alcohol dehydrogenase activities, dehydratases activities, lyase activities, transporter activities, isomerase activities, kinase activities, among others described herein.
  • Biologically active fragments typically comprise one or more active sites or enzymatic/binding motifs, as described herein and known in the art.
  • coding sequence is meant any nucleic acid sequence that contributes to the code for the polypeptide product of a gene.
  • non-coding sequence refers to any nucleic acid sequence that does not contribute to the code for the polypeptide product of a gene.
  • complementarity refers to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules.
  • sequence "A-G-T” is complementary to the sequence "T-C-A.”
  • Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.
  • derivative is meant a polypeptide that has been derived from the basic sequence by modification, for example by conjugation or complexing with other chemical moieties (e.g., pegylation) or by post-translational modification techniques as would be understood in the art.
  • derivative also includes within its scope alterations that have been made to a parent sequence including additions or deletions that provide for functionally equivalent molecules.
  • enzyme reactive conditions it is meant that any necessary conditions are available in an environment (i.e., such factors as temperature, pH, lack of inhibiting substances) which will permit the enzyme to function. Enzyme reactive conditions can be either in vitro, such as in a test tube, or in vivo, such as within a cell. As used herein, the terms “function” and “functional” and the like refer to a biological or enzymatic function.
  • gene is meant a unit of inheritance that occupies a specific locus on a chromosome and consists of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e., introns, 5' and 3' untranslated sequences).
  • Homology refers to the percentage number of amino acids that are identical or constitute conservative substitutions. Homology may be determined using sequence comparison programs such as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395) which is incorporated herein by reference. In this way sequences of a similar or substantially different length to those cited herein could be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.
  • host cell includes an individual cell or cell culture which can be or has been a recipient of any recombinant vector(s) or isolated polynucleotide of the invention.
  • Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change.
  • a host cell includes cells transfected, transformed, or infected in vivo or in vitro with a recombinant vector or a polynucleotide of the invention.
  • a host cell which comprises a recombinant vector of the invention is a recombinant host cell, recombinant cell, or recombinant microrganism.
  • isolated is meant material that is substantially or essentially free from components that normally accompany it in its native state.
  • an "isolated polynucleotide”, as used herein, refers to a polynucleotide, which has been purified from the sequences which flank it in a naturally-occurring state, e.g., a DNA fragment which has been removed from the sequences that are normally adjacent to the fragment.
  • an "isolated peptide” or an “isolated polypeptide” and the like, as used herein, refer to in vitro isolation and/or purification of a peptide or polypeptide molecule from its natural cellular environment, and from association with other components of the cell, i.e., it is not associated with in vivo substances.
  • is meant the ability of one or more recombinant microorganisms to produce a greater amount of a given product or molecule (e.g., commodity chemical, biofuel, or intermediate product therof) as compared to a control microorganism, such as an unmodified microorganism or a differently modified microorganism.
  • An “increased” amount is typically a “statistically significant” amount, and may include an increase that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (including all integers and decimal points in between, e.g., 1.5, 1.6, 1.7. 1.8, etc.) the amount produced by an unmodified microorganism or a differently modified microorganism.
  • a sample such as, for example, a polynucleotide extract or polypeptide extract is isolated from, or derived from, a particular source, such as a desired organism, typically a microorganism.
  • Obtained from can also refer to the situation in which a polynucleotide or polypeptide sequence is isolated from, or derived from, a particular organism or microorganism.
  • a polynucleotide sequence encoding a benzaldehyde lyase enzyme may be isolated from a variety of prokaryotic or eukaryotic microorganisms, such as Pseudomonas.
  • operably linked means placing a gene under the regulatory control of a promoter, which then controls the transcription and optionally the translation of the gene.
  • a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting; i.e., the genes from which it is derived.
  • Constutive promoters are typically active, i.e., promote transcription, under most conditions.
  • inducible promoters are typically active only under certain conditions, such as in the presence of a given molecule factor ⁇ e.g., IPTG) or a given environmental condition (e.g., CO 2 concentration, nutrient levels, light, heat). In the absence of that condition, inducible promoters typically do not allow significant or measurable levels of transcriptional activity.
  • polynucleotide or “nucleic acid” as used herein designates mRNA, RNA, cRNA, rRNA, cDNA or DNA.
  • the term typically refers to polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide.
  • the term includes single and double stranded forms of DNA.
  • polynucleotide sequences of this invention can include genomic sequences, extra-genomic and plasmid-encoded sequences and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, peptides and the like. Such segments may be naturally isolated, or modified synthetically by the hand of man.
  • Polynucleotides may be single-stranded (coding or antisense) or double- stranded, and may be DNA (genomic, cDNA or synthetic) or RNA molecules. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide of the present invention, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.
  • Polynucleotides may comprise a native sequence (i.e., an endogenous sequence) or may comprise a variant, or a biological functional equivalent of such a sequence.
  • Polynucleotide variants may contain one or more substitutions, additions, deletions and/or insertions, as further described below, preferably such that the enzymatic activity of the encoded polypeptide is not substantially diminished relative to the unmodified polypeptide, and preferably such that the enzymatic activity of the encoded polypeptide is improved (e.g., optimized) relative to the unmodified polypeptide.
  • the effect on the enzymatic activity of the encoded polypeptide may generally be assessed as described herein.
  • polynucleotides of the present invention regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a polynucleotide fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.
  • polynucleotide variant and “variant” and the like refer to polynucleotides that display substantial sequence identity with any of the reference polynucleotide sequences or genes described herein, and to polynucleotides that hybridize with any polynucleotide reference sequence described herein, or any polynucleotide coding sequence of any gene or protein referred to herein, under low stringency, medium stringency, high stringency, or very high stringency conditions that are defined hereinafter and known in the art. These terms also encompass polynucleotides that are distinguished from a reference polynucleotide by the addition, deletion or substitution of at least one nucleotide.
  • polynucleotide variant and “variant” include polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides.
  • certain alterations inclusive of mutations, additions, deletions and substitutions can be made to a reference polynucleotide whereby the altered polynucleotide retains the biological function or activity of the reference polynucleotide, or has increased activity in relation to the reference polynucleotide (i.e., optimized).
  • Polynucleotide variants include, for example, polynucleotides having at least 50% (and at least 51% to at least 99% and all integer percentages in between) sequence identity with a reference polynucleotide described herein.
  • polynucleotide variant and variant also include naturally- occurring allelic variants that encode these enzymes.
  • naturally-occurring variants include allelic variants (same locus), homologs (different locus), and orthologs (different organism).
  • Naturally occurring variants such as these can be identified and isolated using well-known molecular biology techniques including, for example, various polymerase chain reaction (PCR) and hybridization-based techniques as known in the art.
  • PCR polymerase chain reaction
  • Naturally occurring variants can be isolated from any organism that encodes one or more genes having a suitable enzymatic activity described herein (e.g., C-C ligase, diol dehyodrogenase, pectate lyase, alginate lyase, diol dehydratase, transporter, etc.).
  • a suitable enzymatic activity described herein e.g., C-C ligase, diol dehyodrogenase, pectate lyase, alginate lyase, diol dehydratase, transporter, etc.
  • Non-naturally occurring variants can be made by mutagenesis techniques, including those applied to polynucleotides, cells, or organisms.
  • the variants can contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in either or both the coding and non-coding regions.
  • non-naturally occurring variants may have been optimized for use in a given microorganism (e.g., E. coli), such as by engineering and screening the enzymes for increased activity, stability, or any other desirable feature.
  • the variations can produce both conservative and non-conservative amino acid substitutions (as compared to the originally encoded product).
  • conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of a reference polypeptide.
  • Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis but which still encode a biologically active polypeptide.
  • variants of a particular reference nucleotide sequence will have at least about 30%, 40% 50%, 55%, 60%, 65%, 70%, generally at least about 75%, 80%, 85%, 90% to 95% or more, and even about 97% or 98% or more sequence identity to that particular nucleotide sequence as determined by sequence alignment programs described elsewhere herein using default parameters.
  • hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions describes conditions for hybridization and washing.
  • Guidance for performing hybridization reactions can be found in Ausubel et al, "Current Protocols in Molecular Biology", John Wiley & Sons Inc, 1994-1998, Sections 6.3.1-6.3.6. Aqueous and non-aqueous methods are described in that reference and either can be used.
  • Low stringency conditions include and encompass from at least about 1% v/v to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization at 42°C, and at least about 1 M to at least about 2 M salt for washing at 42°C.
  • Low stringency conditions also may include 1% Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M NaHPO 4 (pH 7.2), 7% SDS for hybridization at 65°C, and (i) 2 x SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHPO 4 (pH 7.2), 5% SDS for washing at room temperature.
  • BSA Bovine Serum Albumin
  • One embodiment of low stringency conditions includes hybridization in 6 ⁇ sodium chloride/sodium citrate (SSC) at about 45°C, followed by two washes in 0.2 x SSC, 0.1% SDS at least at 50 0 C (the temperature of the washes can be increased to 55°C for low stringency conditions).
  • SSC sodium chloride/sodium citrate
  • Medium stringency conditions include and encompass from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization at 42°C, and at least about 0.1 M to at least about 0.2 M salt for washing at 55°C.
  • Medium stringency conditions also may include 1% Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M NaHPO 4 (pH 7.2), 7% SDS for hybridization at 65° C, and (i) 2 x SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHPO 4 (pH 7.2), 5% SDS for washing at 60-65 0 C.
  • BSA Bovine Serum Albumin
  • 1 mM EDTA 1 mM EDTA, 0.5 M NaHPO 4 (pH 7.2), 7% SDS for hybridization at 65° C
  • 2 x SSC 0.1% SDS
  • medium stringency conditions includes hybridizing in 6 x SSC at about 45°C, followed by one or more washes in 0.2 x SSC, 0.1% SDS at 60 0 C.
  • "High stringency" conditions include and encompass from at least about 31% v/v to at least about 50% v/v formamide and from about 0.01 M to about 0.15 M salt for hybridization at 42°C, and about 0.01 M to about 0.02 M salt for washing at 55°C.
  • High stringency conditions also may include 1% BSA, 1 mM EDTA, 0.5 M NaHPO 4 (pH 7.2), 7% SDS for hybridization at 65°C, and (i) 0.2 x SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHPO 4 (pH 7.2), 1% SDS for washing at a temperature in excess of 65°C.
  • One embodiment of high stringency conditions includes hybridizing in 6 ⁇ SSC at about 45°C, followed by one or more washes in 0.2 x SSC, 0.1% SDS at 65°C.
  • very high stringency conditions includes hybridizing in 0.5 M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2 x SSC, 1% SDS at 65°C.
  • T 111 81.5 + 16.6 (log ]0 M) + 0.41 (%G+C) - 0.63 (% formamide) - (600/length)
  • M is the concentration of Na + , preferably in the range of 0.01 molar to 0.4 molar
  • %G+C is the sum of guano sine and cytosine bases as a percentage of the total number of bases, within the range between 30% and 75% G+C
  • % formamide is the percent formamide concentration by volume
  • length is the number of base pairs in the DNA duplex.
  • the T m of a duplex DNA decreases by approximately 1°C with every increase of 1% in the number of randomly mismatched base pairs. Washing is generally carried out at T m - 15°C for high stringency, or T m - 30 0 C for moderate stringency.
  • a membrane e.g., a nitrocellulose membrane or a nylon membrane
  • immobilized DNA is hybridized overnight at 42° C in a hybridization buffer (50% deionizer formamide, 5 x SSC, 5 x Reinhardt's solution (0.1% fecal, 0.1% polyvinylpyrollidone and 0.1% bovine serum albumin), 0.1% SDS and 200 mg/mL denatured salmon sperm DNA) containing a labeled probe.
  • a hybridization buffer 50% deionizer formamide, 5 x SSC, 5 x Reinhardt's solution (0.1% fecal, 0.1% polyvinylpyrollidone and 0.1% bovine serum albumin), 0.1% SDS and 200 mg/mL denatured salmon sperm DNA
  • the membrane is then subjected to two sequential medium stringency washes (i.e., 2 x SSC, 0.1% SDS for 15 min at 45°C, followed by 2 x SSC, 0.1% SDS for 15 min at 50°C), followed by two sequential higher stringency washes (i.e., 0.2 x SSC, 0.1% SDS for 12 min at 55°C followed by 0.2 x SSC and 0.1% SDS solution for 12 min at 65-68°C.
  • 2 x SSC 0.1% SDS for 15 min at 45°C
  • 2 x SSC 0.1% SDS for 15 min at 50°C
  • two sequential higher stringency washes i.e., 0.2 x SSC, 0.1% SDS for 12 min at 55°C followed by 0.2 x SSC and 0.1% SDS solution for 12 min at 65-68°C.
  • Polynucleotides and fusions thereof may be prepared, manipulated and/or expressed using any of a variety of well established techniques known and available in the art.
  • polynucleotide sequences which encode polypeptides of the invention, or fusion proteins or functional equivalents thereof may be used in recombinant DNA molecules to direct expression of a selected enzyme in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences that encode substantially the same or a functionally equivalent amino acid sequence may be produced and these sequences may be used to clone and express a given polypeptide.
  • nucleotide sequences possessing non-naturally occurring codons codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce a recombinant RNA transcript having desirable properties, such as a half- life which is longer than that of a transcript generated from the naturally occurring sequence.
  • Such nucleotides are typically referred to as "codon-optimized.” Any of the nucleotide sequences described herein may be utilized in such a "codon-optimized” form.
  • the nucleotide coding sequence of the benzaldehyde lyase from Pseudomonas fluorescens may be codon-optimized for expression in E. coli.
  • polynucleotide sequences of the present invention can be engineered using methods generally known in the art in order to alter polypeptide encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, expression and/or activity of the gene product.
  • a nucleotide sequence encoding the polypeptide, or a functional equivalent may be inserted into appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • appropriate expression vector i.e., a vector that contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Polypeptide “polypeptide fragment,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally-occurring amino acid polymers.
  • polypeptides may include enzymatic polypeptides, or "enzymes,” which typically catalyze ⁇ i.e., increase the rate of) various chemical reactions.
  • polypeptide variant refers to polypeptides that are distinguished from a reference polypeptide sequence by the addition, deletion or substitution of at least one amino acid residue.
  • a polypeptide variant is distinguished from a reference polypeptide by one or more substitutions, which may be conservative or non-conservative.
  • the polypeptide variant comprises conservative substitutions and, in this regard, it is well understood in the art that some amino acids may be changed to others with broadly similar properties without changing the nature of the activity of the polypeptide.
  • Polypeptide variants also encompass polypeptides in which one or more amino acids have been added or deleted, or replaced with different amino acid residues.
  • the present invention contemplates the use in the methods described herein of variants of full-length polypeptides having any of the enzymatic activities described herein, truncated fragments of these full-length polypeptides, variants of truncated fragments, as well as their related biologically active fragments.
  • biologically active fragments of a polypeptide may participate in an interaction, for example, an intra-molecular or an inter-molecular interaction.
  • An inter-molecular interaction can be a specific binding interaction or an enzymatic interaction (e.g., the interaction can be transient and a covalent bond is formed or broken).
  • Bioly active fragments of a polypeptide/enzyme an enzymatic activity described herein include peptides comprising amino acid sequences sufficiently similar to, or derived from, the amino acid sequences of a (putative) full-length reference polypeptide sequence.
  • biologically active fragments comprise a domain or motif with at least one enzymatic activity, and may include one or more (and in some cases all) of the various active domains.
  • a biologically active fragment of a an enzyme can be a polypeptide fragment which is, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 450, 500, 600 or more contiguous amino acids, including all integers in between, of a reference polypeptide sequence.
  • a biologically active fragment comprises a conserved enzymatic sequence, domain, or motif, as described elsewhere herein and known in the art.
  • the biologically-active fragment has no less than about 1%, 10%, 25%, 50% of an activity of the wild-type polypeptide from which it is derived.
  • exogenous refers generally to a polynucleotide sequence or polypeptide that does not naturally occur in a wild-type cell or organism, but is typically introduced into the cell by molecular biological techniques, i.e., engineering to produce a recombinant microorganism.
  • exogenous polynucleotides include vectors, plasmids, and/or man-made nucleic acid constructs encoding a desired protein or enzyme.
  • endogenous refers generally to naturally occurring polynucleotide sequences or polypeptides that may be found in a given wild-type cell or organism.
  • certain naturally-occuring bacterial or yeast species do not typically contain a benzaldehyde lyase gene, and, therefore, do not comprise an "endogenous" polynucleotide sequence that encodes a benzaldehyde lyase.
  • an organism may comprise an endogenous copy of a given polynucleotide sequence or gene
  • the introduction of a plasmid or vector encoding that sequence such as to over-express or otherwise regulate the expression of the encoded protein, represents an "exogenous" copy of that gene or polynucleotide sequence.
  • Any of the of pathways, genes, or enzymes described herein may utilize or rely on an "endogenous" sequence, or may be provided as one or more "exogenous" polynucleotide sequences, and/or may be utilized according to the endogenous sequences already contained within a given microorganism.
  • a "recombinant" microorganism typically comprises one or more exogenous nucleotide sequences, such as in a plasmid or vector.
  • sequence identity or, for example, comprising a “sequence 50% identical to,” as used herein, refer to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison.
  • a "percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base ⁇ e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, GIy, VaI, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, GIu, Asn, GIn, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • the identical nucleic acid base e.g., A, T, C, G, I
  • the identical amino acid residue e.g., Ala, Pro, Ser, Thr, GIy, VaI, Leu, He, Phe, Tyr, Trp
  • references to describe sequence relationships between two or more polynucleotides or polypeptides include “reference sequence”, “comparison window”, “sequence identity”, “percentage of sequence identity” and “substantial identity”.
  • a “reference sequence” is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length.
  • two polynucleotides may each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides
  • sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
  • a “comparison window” refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • the comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Transformation refers generally to the permanent, heritable alteration in a cell resulting from the uptake and incorporation of foreign DNA into the host-cell genome; also, the transfer of an exogenous gene from one organism into the genome of another organism.
  • vector is meant a polynucleotide molecule, preferably a DNA molecule derived, for example, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned.
  • a vector preferably contains one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the genome of the defined host such that the cloned sequence is reproducible.
  • the vector can be an autonomously replicating vector, i.e., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome.
  • the vector can contain any means for assuring self-replication.
  • the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • Such a vector may comprise specific sequences that allow recombination into a particular, desired site of the host chromosome.
  • a vector system can comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vector is preferably one which is operably functional in a bacterial cell, such as a cyanobacterial cell.
  • the vector can include a reporter gene, such as a green fluorescent protein (GFP), which can be either fused in frame to one or more of the encoded polypeptides, or expressed separately.
  • the vector can also include a selection marker such as an antibiotic resistance gene that can be used for selection of suitable transformants.
  • wild-type and “naturally occurring” are used interchangeably to refer to a gene or gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • a wild type gene or gene product e.g., a polypeptide
  • a wild type gene or gene product is that which is most frequently observed in a population and is thus arbitrarily designed the "normal” or "wild-type” form of the gene.
  • biomass examples include aquatic or marine biomass, fruit-based biomass such as fruit waste, and vegetable-based biomass such as vegetable waste, among others.
  • aquatic or marine biomass examples include, but are not limited to, kelp, giant kelp, seaweed, algae, and marine microflora, microalgae, sea grass, and the like.
  • biomass does not include fossilized sources of carbon, such as hydrocarbons that are typically found within the top layer of the Earth's crust (e.g., natural gas, nonvolatile materials composed of almost pure carbon, like anthracite coal, etc).
  • fruit and/or vegetable biomass examples include, but are not limited to, any source of pectin such as plant peel and pomace including citrus, orange, grapefruit, potato, tomato, grape, mango, gooseberry, carrot, sugar-beet, and apple, among others.
  • polysaccharides, oligosaccharides, monosaccharides or other sugar components of biomass include, but are not limited to, alginate, agar, carrageenan, fucoidan, pectin, gluronate, mannuronate, mannitol, lyxose, cellulose, hemicellulose, glycerol, xylitol, glucose, mannose, galactose, xylose, xylan, mannan, arabinan, arabinose, glucuronate, galacturonate (including di- and tri-galacturonates), rhamnose, and the like.
  • alginate-derived polysaccharides include saturated polysaccharides, such as ⁇ -D-mannuronate, ⁇ -L-gluronate, dialginate, trialginate, pentalginate, hexalginate, heptalginate, octalginate, nonalginate, decalginate, undecalginate, dodecalginate and polyalginate, as well as unsaturated polysaccharides such as 4-deoxy-L-erythro-5-hexoseulose uronic acid, 4-(4-deoxy-beta-D-mann-4- enuronosyl)-D-mannuronate or L-guluronate, 4-(4-deoxy-beta-D-mann-4-enuronosyl)- dialginate, 4-(4-deoxy-beta-D-mann-4-enuronosyl)-trialginate, 4-(4-deoxy-beta-D- mann-4-enuronosyl
  • pectin-derived polysaccharides include saturated polysaccharides, such as galacturonate, digalacturonate, trigalacturonate, tetragalacturonate, pentagalacturonate, hexagalacturonate, heptagalacturonate, octagalacturonate, nonagalacturonate, decagalacturonate, dodecagalacturonate, polygalacturonate, and rhamnopolygalacturonate, as well as saturated polysaccharides such as 4-deoxy-L-threo-5-hexosulose uronate, 4-(4-Deoxy-alpha-D-gluc-4- enuronosyl)-D-galacturonate, 4-(4-Deoxy-alpha-D-gluc-4-enuronosyl)-D- digalacturonate, 4-(4-Deoxy-alpha-D-gluc-4-enuronosyl
  • polysaccharide or oligosaccharide components may be converted into “suitable monosaccharides” or other "suitable saccharides,' " such as “suitable oligosaccharides,” by the microorganisms described herein which are capable of growing on such polysaccharides or other sugar components as a source of carbon (e.g., a sole source of carbon).
  • suitable monosaccharide or “suitable saccharide” refers generally to any saccharide that may be produced by a recombinant microorganism growing on pectin, alginate, or other saccharide (e.g., galacturonate, cellulose, hemi-cellulose etc.) as a source or sole source of carbon, and also refers generally to any saccharide that may be utilized in a biofuel biosynthesis pathway of the present invention to produce hydrocarbons such as biofuels or biopetrols.
  • pectin, alginate, or other saccharide e.g., galacturonate, cellulose, hemi-cellulose etc.
  • Suitable monosaccharides or oligosaccharides include, but are not limited to, 2-keto-3-deoxy D-gluconate (KDG), D- mannitol, gluronate, mannuronate, mannitol, lyxose, glycerol, xylitol, glucose, mannose, galactose, xylose, arabinose, glucuronate, galacturonates, and rhamnose, and the like.
  • KDG 2-keto-3-deoxy D-gluconate
  • D- mannitol gluronate
  • mannuronate mannitol
  • lyxose glycerol
  • xylitol glucose, mannose, galactose, xylose, arabinose, glucuronate, galacturonates, and rhamnose
  • a "suitable monosaccharide” or “suitable saccharide” as used herein may be
  • composition chemical as used herein includes any saleable or marketable chemical that can be produced either directly or as a by-product of the methods provided herein, including biofuels and/or biopetrols.
  • general examples of “commodity chemicals” include, but are not limited to, biofuels, minerals, polymer precursors, fatty alcohols, surfactants, plasticizers, and solvents.
  • biofuels as used herein includes solid, liquid, or gas fuels derived, at least in part, from a biological source, such as a recombinant microorganism.
  • commodity chemicals include, but are not limited to, methane, methanol, ethane, ethene, ethanol, n-propane, 1-propene, 1-propanol, propanal, acetone, propionate, n-butane, 1-butene, 1-butanol, butanal, butanoate, isobutanal, isobutanol, 2-methylbutanal, 2-methylbutanol, 3-methylbutanal, 3- methylbutanol, 2-butene, 2-butanol, 2-butanone, 2,3-butanediol, 3-hydroxy-2-butanone, 2,3-butanedione, ethylbenzene, ethenylbenzene, 2-phenylethanol, phenylacetaldehyde, 1 -phenylbutane, 4-phenyl- 1-butene, 4-phenyl-2-butene, l-phenyl-2-butene, l-
  • optically refers to a pathway, gene, polypeptide, enzyme, or other molecule having an altered biological activity, such as by the genetic alteration of a polypeptide's amino acid sequence or by the alteration/modification of the polypeptide's surrounding cellular environment, to improve its functional characteristics in relation to the original molecule or original cellular environment (e.g., a wild- type sequence of a given polypeptide or a wild-type microorganism).
  • Any of the polypeptides or enzymes described herein may be optionally “optimized,” and any of the genes or nucleotide sequences described herein may optionally encode an optimized polypeptide or enzyme.
  • Any of the pathways described herein may optionally contain one or more "optimized” enzymes, or one or more nucleotide sequences encoding for an optimized enzyme or polypeptide.
  • the improved functional characteristics of the polypeptide, enzyme, or other molecule relate to the suitability of the polypeptide or other molecule for use in a biological pathway (e.g., a biosynthesis pathway, a C-C ligation pathway) to convert a monosaccharide or oligosaccharide into a biofuel.
  • a biological pathway e.g., a biosynthesis pathway, a C-C ligation pathway
  • An exemplary "optimized" polypeptide may contain one or more alterations or mutations in its amino acid coding sequence (e.g., point mutations, deletions, addition of heterologous sequences) that facilitate improved expression and/or stability in a given microbial system or microorganism, allow regulation of polypeptide activity in relation to a desired substrate (e.g., inducible or repressible activity), modulate the localization of the polypeptide within a cell (e.g., intracellular localization, extracellular secretion), and/or effect the polypeptide's overall level of activity in relation to a desired substrate (e.g., reduce or increase enzymatic activity).
  • a desired substrate e.g., inducible or repressible activity
  • modulate the localization of the polypeptide within a cell e.g., intracellular localization, extracellular secretion
  • effect the polypeptide's overall level of activity in relation to a desired substrate e.g., reduce or increase enzymatic
  • a polypeptide or other molecule may also be "optimized” for use with a given microbial system or microorganism by altering one or more pathways within that system or organism, such as by altering a pathway that regulates the expression (e.g., up-regulation), localization, and/or activity of the "optimized” polypeptide or other molecule, or by altering a pathway that minimizes the production of undesirable by-products, among other alterations.
  • a polypeptide or other molecule may be “optimized” with or without altering its wild-type amino acid sequence or original chemical structure. Optimized polypeptides or biological pathways may be obtained, for example, by direct mutagenesis or by natural selection for a desired phenotype, according to techniques known in the art.
  • "optimized" genes or polypeptides may comprise a nucleotide coding sequence or amino acid sequence that is 50% to 99% identical (including all integeres in between) to the nucleotide or amino acid sequence of a reference (e.g., wild-type) gene or polypeptide.
  • an "optimized" polypeptide or enzyme may have about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100 (including all integers and decimal points in between e.g., 1.2, 1.3, 1.4, 1.5, 5.5, 5.6, 5.7, 60, 70, etc.), or more times the biological activity of a reference polypeptide.
  • Certain aspects of the invention also include a commodity chemical, such as a biofuel, that is produced according to the methods and recombinant microorganisms described herein.
  • a biofuel e.g., medium to long chain alkane
  • Such a biofuel may be distinguished from other fuels, such as those fuels produced by traditional refinery from crude carbon sources, by radio-carbon dating techniques.
  • carbon has two stable, nonradioactive isotopes: carbon-12 ( 12 C), and carbon-13 ( 13 C).
  • Carbon- 14 has a half-life of 5730 years, and would have long ago vanished from Earth were it not for the unremitting impact of cosmic rays on nitrogen in the Earth's atmosphere, which create more of this isotope.
  • the neutrons resulting from the cosmic ray interactions participate in the following nuclear reaction on the atoms of nitrogen molecules (N 2 ) in the atmospheric air:
  • Plants and other photosynthetic organisms take up atmospheric carbon dioxide by photosynthesis. Since many plants are ingested by animals, every living organism on Earth is constantly exchanging carbon- 14 with its environment for the duration of its existence. Once an organism dies, however, this exchange stops, and the amount of carbon- 14 gradually decreases over time through radioactive beta decay.
  • the biofuels produced by the methods provided herein can be structurally distinguished from typical sources of hydrocarbon based fuels.
  • Embodiments of the present invention include methods for converting a polysaccharide to a suitable monosaccharide comprising, (a) obtaining the polysaccharide; and (b) contacting the polysaccharide with a recombinant microorganism or microbial system comprising such a microorgansim for a time sufficient to convert the polysaccharide to a suitable monosaccharide, wherein the microbial system comprises, (i) at least one gene encoding and expressing an enzyme selected from a lyase and a hydrolase, wherein the lyase and/or hydrolase optionally comprises at least one signal peptide or at least one autotransporter domain; (ii) at least one gene encoding and expressing an enzyme selected from a monosaccharide transporter, a disaccharide transporter, a trisaccharide transporter, an oligosaccharide transporter, and a polysaccharide transporter; and (iii) at least one
  • certain aspects may include methods for converting a polysaccharide to a suitable monosaccharide comprising, (a) obtaining the polysaccharide; and (b) contacting the polysaccharide with a microbial system for a time sufficient to convert the polysaccharide to a suitable monosaccharide, wherein the microbial system comprises, (i) at least one gene encoding and expressing an enzyme selected from a lyase and a hydrolase; (ii) at least one gene encoding and expressing a superchannel; and (iii) at least one gene encoding and expressing an enzyme selected from a monosaccharide dehydrogenase, an isomerase, a dehydratase, a kinase, and an aldolase, thereby converting the polysaccharide to a suitable monosaccharide.
  • a microbial system or isolated microorganism is capable of growing using a polysaccharide (e.g., alginate, pectin, etc.) as a sole source of carbon and/or energy.
  • a polysaccharide e.g., alginate, pectin, etc.
  • a "sole source of carbon” refers generally to the ability to grow on a given carbon source as the only carbon source in a given growth medium.
  • alginate approximately 50 percent of seaweed dry-weight comprises various sugar components, among which alginate and mannitol are major components corresponding to 30 and 15 percent of seaweed dry-weight, respectively.
  • pectin Although microorganisms such as E. coli are generally considered as a host organisms in synthetic biology, and although such microorganism are able to metabolize mannitol, they completely lack the ability to degrade and metabolize alginate. In this regard, many laboratory or wild-type microorganisms, such as E. coli, are unable to grow on alginate as a sole source of carbon. Similarly, many organisms such as E.
  • embodiments of the present application include engineered microorganisms, such as E. coli, or microbial systems containing such engineered microorganisms, that are capable of using polysaccharides, such as alginate and pectin, as a sole source of carbon and/or energy.
  • Alginate is a block co-polymer of ⁇ -D-mannuronate (M) and ⁇ -D- gluronate (G) (M and G are epimeric about the C5-carboxyl group).
  • Each alginate polymer comprises regions of all M (polyM), all G (polyG), and/or the mixture of M and G (polyMG).
  • certain aspects of the present invention provide an engineered or recombinant microorganism or microbial system that is able to degrade or de-polymerize alginate and to use it as a source of carbon and/or energy.
  • such recombinant microorganisms may incorporate a set of polysaccharide degrading or depolymerizing enzymes such as alginate lyases (ALs) to the microbial system.
  • ALs alginate lyases
  • ALs are mainly classified into two distinctive subfamilies depending on their acts of catalysis: endo- (EC 4.2.2.3) and exo-acting (EC 4.2.2.-) ALs. Endo-acting ALs are further classified based on their catalytic specificity; M specific and G specific ALs.
  • the endo-acting ALs randomly cleave alginate via a ⁇ -elimination mechanism and mainly depolymerize alginate to di-, tri- and tetrasaccharides.
  • the uronate at the non-reducing terminus of each oligosaccharide are converted to unsaturated sugar uronate, 4-deoxy- ⁇ -L-erythro-hex-4-ene pyranosyl uronates.
  • exo-acting ALs catalyze further depolymerization of these oligosaccharides and release unsaturated monosaccharides, which may be non-enzymatically converted to monosaccharides, including ⁇ -keto acid, 4-deoxy- ⁇ -L-erythro-hexosuccose uronate (DEHU).
  • Certain embodiments of an engineered microbial system or isolated, engineered microorganism may include endoM-, endoG- and exo-acting ALs to degrade or depolymerize aquatic or marine-biomass polysaccharides such as alginate to a monosaccharide such as DEHU.
  • Embodiments of the present invention may also include lyases such as alginate lyases isolated from various sources, including, but not limited to, marine algae, mollusks, and wide varieties of microbes such as genus Pseudomonas, Vibrio, and Sphingomonas. Many alginate lyases are endo-acting M specific, several are G specific, and few are exo-acting.
  • ALs isolated from Sphingomonas sp. strain Al include five endo-acting ALs, Al-I, Al-II, Al-IF, Al-III, and Al-IV and an exo-acting AL, Al-IV.
  • Al-I, Al-II, and Al-III have molecular weights of 66 kDa, 25 kDa, and 40 kDa, respectively.
  • AI-II and AI-III are self-splicing products of Al-I.
  • AI- II may be more specific to G and Al-III may be specific to M.
  • Al-I may have high activity for both M and G.
  • Al-IV has molecular weight of about 85 kDa and catalyzes exo-lytic depolymerization of oligoalginate.
  • Al-IF and Al-IV are functional homologies of Al-II and Al-IV.
  • AI-IF has endo-lytic activity and may have no preference to M or G.
  • Al-IV has primarily endo-lytic activity.
  • exo-lytic AL Atu3025 derived from Agrobacterium tumefaciens has high activity for depolymerization of oligoalginate, and may be used in certain embodiments of the present invention. Certain embodiments may incorporate into the microbial system or isolated microorganism the genes encoding Al-I, Al-IF, Al-IV, and Atu3025, and may include optimal codon usage for the suitable host organisms, such as E. coli.
  • alginate lyases or oligoalginate lyases that may be utilized herein include enzymes or polypeptides sharing at least 60%, 70%, 80%, 90%, 95%, 98%, or more sequence identity (including all integers in between) to SEQ ID NOS:67-68, which show the nucleotide (SEQ ID NO:67) and polyeptide (SEQ ID NO:68) sequences of oligoalginate lyase Atu3025 isolated from Agrobacterium tumefaciens.
  • alginate lyases that may be utilized herein include enzymes or polypeptides sharing at least 60%, 70%, 80%, 90%, 95%, 98%, or more sequence identity (including all integers in between) to the alginate lyase enyzmes described in Figure 37, as well as the secreted alginate lyase encoded by Vs24254 from Vibrio spectacularus.
  • a microbial system or recombinant microorganism may be engineered to secrete or display the lyases or alginate lyases (ALs) to the culture media, such as by incorporating a signal peptide or autotransporter domain into the lyase.
  • As alginate lyases
  • bacteria have at least four different types of protein secretion machinery (type I, II, III and IV).
  • type II secretion machinery is used for the secretion of recombinant proteins.
  • the type II secretion machinery may comprise a two-step process: the translocation of premature proteins tagged with signal peptides to the periplasm fraction and processing to the mature proteins followed by secretion to media.
  • the first process may proceed by any of three different pathways: secB- dependent pathway, signal recognition particle (SRP) pathway, or twin-arginine translocation (TAT) pathway.
  • Recombinant proteins may be secreted into periplasm fraction.
  • the fates of the mature proteins vary dependent on the type of proteins. For example, some proteins are secreted spontaneously by diffusion or passively by a secretion apparatus named secretion that consists of 12-16 proteins, and others stay in periplasm fraction and are eventually degraded.
  • proteins may also be secreted by an autotransporter apparatus, such as by utilizing an autotransporter domain.
  • the proteins secreted by autotransporter domains typically comprise an N-terminal signal peptide that plays a role in translocation to the periplasm, which may be mediated by secB or SRP pathways, passenger domain, and/or C-terminal translocation unit (UT) having a characteristic ⁇ - barrel structure.
  • the ⁇ -barrel portion of the UT builds an aqueous pore channel across the outer membrane and helps the transportation of passenger domain to media.
  • Autodisplayed passenger proteins are often cleaved by the autotransporter and set free to media.
  • the type I secretion machinery may also be used for the secretion of recombinant proteins in E. coli.
  • the type I secretion machinery may be used for the secretion of high-molecular-weight toxins and exoenzymes.
  • the type I secretion machinery consist of two inner membrane proteins (HIyB and HIyD) that are the member of the ATP binding cassette (ABC) transporter family, and an endogenous outer membrane protein (ToIC).
  • the secretion of recombinant proteins based on type I secretion machinery may utilize the C-terminal region of ⁇ -haemolysin (HIyA) as a signal sequence.
  • the recombinant proteins may readily pass through the inner membrane, periplasm, and outer membrane through the type I secretion machinery.
  • both autotransporter and type I secretion machinery can be altered to the cell surface display machinery.
  • a system specific to cell surface display may be used.
  • target proteins may be fused to PgsA protein (a poly- ⁇ -glutamate synthetase complex) that is natively displayed on the surface of Bacillus subtilis.
  • Certain embodiments may include lyases such as alginate lyases fused with various signal peptides and/or autotransporter domains found in proteins secreted by both type I and type II secretion machinery.
  • Other embodiments may include lyases such as alginate lyases fused with any combination of signal peptides and or autotransporter domains found in proteins secreted transport machinery as described herein or known to a person skilled in the art.
  • Embodiments may also include signal peptides or autotransporter domains that are experimentally redesigned to maximize the secretion of lyases such as alginate lyases to the culture media, and may also include the use of many different linker sequences that fuse signal peptides, lyases, and autotransporters that improve the efficiency of secretion or the cell surface presentation of lyases.
  • Certain embodiments may include a microbial system or isolated microorganism that comprise saccharide transporters, which are able to transport monosaccharides (e.g., DEHU) and oligosaccharides from the media to the cytosol to efficiently utilize these monosaccharides as a source of carbon and/or energy.
  • genes encoding monosaccharide permeases may be isolated from bacteria that grow on polysaccharides such as alginate as a source of carbon and/or energy, and may be incorporated into embodiments of the present microbial system or isolated microorganism.
  • embodiments may also include redesigned native permeases or transporters with altered specificity for monosaccharide (e.g., DEHU) transportation.
  • E.coli contains several permeases able to transport monosaccharides, which include, but are not limited to, KdgT for 2-keto-3-deoxy-D- gluconate (KDG) transporter, ExuT for aldohexuronates such as D-galacturonate and D-glucuronate transporter, GntT, GntU, GntP, and GntT for gluconate transporter, and KgtP for proton-driven ⁇ -ketoglutarate transporter.
  • KDG 2-keto-3-deoxy-D- gluconate
  • ExuT for aldohexuronates such as D-galacturonate and D-glucuronate transporter
  • GntT, GntU, GntP, and GntT for gluconate transporter
  • KgtP proton-driven ⁇ -ketoglutarate transporter
  • Microbial systems or recombinant microorganisms described herein may comprise any of these permeases, in addition to those permeases known to a person of skill in the art and not mentioned herein, and may also include permease enzymes redesigned to transport other monosaccharides, such as DEHU.
  • a microbial system or recombinant microorganism according to the present invention may also comprise permeases/transporters/superchannels/porins that catalyze the transport of monosaccharides (e.g., D-mannuronate and D-lyxose) from media to the periplasm or cytosol of a microorganism.
  • permeases/transporters/superchannels/porins that catalyze the transport of monosaccharides (e.g., D-mannuronate and D-lyxose) from media to the periplasm or cytosol of a microorganism.
  • genes encoding the permeases of D-mannuronate in soil Aeromonas may be incorporated into a microbial system as described herein.
  • a microbial system or microorganism may comprise native permeases/transporters that are redesigned to alter their specificity for efficient monosaccharide transportation, such as for D-mannuronate and D-lyxose transportation.
  • E.coli contains several permeases that are able to transport monosaccharides or sugars such as D-mannonate and D-lyxose, including KdgT for 2- keto-3-deoxy-D-gluconate (KDG) transporter, ExuT for aldohexuronates such as D- galacturonate and D-glucuronate transporter, GntPTU for gluconate/fructuronate transporter, uidB for glucuronide transporter, fucP for L-fucose transporter, galP for galactose transporter, yghK for glycolate transporter, dgoT for D-galactonate transporter, uhpT for hexose phosphate transporter, dctA for orotate/citrate transporter, gntUT for gluconate transporter, malEGF for maltose transporter: alsABC for D-allose transporter, idnT
  • a microbial system or recombinant microorganism may comprise permeases or transporters as described above, includedign those that are redesigned or optimized for improvided transport of certain monosaccharides, such as D- mannuronate, DEHU, and D-lyxose.
  • Certain aspects may employ a recombinant microorganism that comprises a "superchannel,” by which aquatic or marine-biomass polysaccharides such as alginate polymers, or fruit or vegetable biomass such as pectin polymers, may be directly incorporated into the cytosol and degraded inside the microbial system.
  • a group of bacteria characterized as Sphingomonads have a wide range in capability of degrading environmentally hazardous compounds such as polychlorinated polycyclic aromatics (dioxin). These bacteria contain characteristic large pleat-like molecules on their cell surfaces.
  • certain Sphingomonads have structures characterized as "superchannels" that enable the bacteria to directly take up macromolecules.
  • Sphingomonas sp. strain Al directly incorporates polysaccharides such as alginate through a superchannel.
  • Such superchannels may consist of a pit on the outer membrane (e.g., AIgR), alginate-binding proteins in the periplasm (e.g., AIgQl and AIg Q2), and an ATP-binding cassette (ABC) transporter (e.g., AIgMl, AlgM2, and AIgS).
  • AIgR alginate-binding proteins in the periplasm
  • ABS ATP-binding cassette
  • Incorporated polysaccharides such as alginate may be readily depolymerized by lyases such as alginate lyases produced in the cytosol.
  • certain embodiments may incorporate genes encoding a superchannel (e.g., ccpA, algS, algMl, algM2, algQl, algQl) to introduce this ability to the microbial system or recombinant microorganism.
  • Other embodiments may include microorganisms such as Sphingomonas subarctica IFO 16058 T , which harbor the plasmid containing genes that encode a superchannel, and which have significantly improved ability to utilize marine or aquatic biomass polysaccharides such as alginate as a source of carbon and/or energy.
  • Certain recombinant microorganisms may employ these superchannel encoding plasmid sequences contained within Sphingomonas subarctica IFO 16058 T .
  • alginate ABC transporters include ABC transporters Atu3021, Atu3022, Atu3023, Atu3024, algMl, algM2, AlgQl, AlgQ2, AIgS, OG2516 05558, OG2516 05563, OG2516 05568, and OG2516 05573, including functional variants thereof.
  • alginate symporters include symporters Vl 2B01 24239 and Vl 2B01 24194, among others, including functional variants thereof.
  • One additional example of an alginate porin includes V12B01 24269, and variants thereof.
  • certain embodiments may include recombinant microorgansims that comprise one or more monosaccharide dehydrogenases, isomerases, dehydratases, kinases, and aldolases.
  • monosaccharide dehyodrogenases certain microbial systems or recombinant microorganism may incorporate enzymes that reduce various monosaccharides (e.g., DEHU, mannuronate) to a monosaccharide that is suitable for biofuel biosynthesis, such as 2-keto-3-deoxy-D- gluconate (KDG) or D-mannitol.
  • Such exemplary enzymes include, for example, DEHU hydrogenases and mannuronate hydrogenases, in addition to various alcohol dehydrogenases having DEHU hydrogenase and/or mannuronate dehydrogenase activity, such as the novel ADHl through ADH 12 enzymes isolated from Agrobacterium tumefaciens C58 (see, e.g., SEQ ID NOS:69-92).
  • SEQ ID NO:69 shows the nucleotide
  • SEQ ID NO:70 shows the polypeptide sequence of ADHl Atul557 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:71 shows the nucleotide and SEQ ID NO:72 shows the polypeptide sequence of ADH2 Atu2022 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:73 shows the nucleotide and SEQ ID NO:74 shows the polypeptide sequence of ADH3 AtuO626 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:75 shows the nucleotide and SEQ ID NO:76 shows the polypeptide sequence of ADH4 Atu5240 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:77 shows the nucleotide and SEQ ID NO:78 shows the polypeptide sequence of ADH5 Atu3163 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:79 shows the nucleotide and SEQ ID NO:80 shows the polypeptide sequence of ADH6 Atu2151 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:81 shows the nucleotide and SEQ ID NO:82 shows the polypeptide sequence of of ADH7 Atu2814 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:83 shows the nucleotide and SEQ ID NO:84 shows the polypeptide sequence of ADH8 Atu5447 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:85 shows the nucleotide and SEQ ID NO:86 shows the polypeptide sequence of ADH9 Atu4087 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:87 shows the nucleotide and SEQ ID NO:88 shows the polypeptide sequence of ADHlO Atu4289 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:89 shows the nucleotide and SEQ ID NO:90 shows the polypeptide sequence of ADHI l Atu3027 isolated from Agrobacterium tumefaciens C58.
  • SEQ ID NO:91 shows the nucleotide and SEQ ID NO:92 shows the polypeptide sequence of ADH 12 Atu3026 isolated from Agrobacterium tumefaciens C58.
  • enzymes having dehydrogenase activity include Atu3026, Atu3027, OG2516 05543, OG2516_05538 and V12B01_24244.
  • the microorganisms and methods of the present invention may also utilize biologically active fragments and variants of these hydrogenase enzymes, including optimized variants thereof.
  • Pseudomonas grown using alginate as a sole source of carbon and energy comprises a DEHU hydrogenase enzyme that uses NADPH as a co-factor, is more stable when NADP + is present in the solution, and is active at ambient pH.
  • a microbial system or a recombinant microorganism as described herein may incorporate genes encoding hydrogenases such as DEHU or mannuronate hydrogenase derived or obtained from various microbes, in which these microbes may be capable of growing on polysaccharides such as alginate or pectin as a source of carbon and/or energy.
  • Certain embodiments may incorporate components of a microbial system or isolated microorganism that is capable of efficiently growing on monosaccharides such as D-mannuronate or D-lyxose as a source of carbon and energy.
  • a microbial system or isolated microorganism that is capable of efficiently growing on monosaccharides such as D-mannuronate or D-lyxose as a source of carbon and energy.
  • both Aeromonas and Aerobacter aerogenes PRL-R3 comprise genes encoding monosaccharide dehydrogenases such as D-mannuronate hydrogenase and D-lyxose isomerase.
  • certain microbial systems or recombinant microorganisms may comprise monosaccharide dehydrogenases such as D-mannuronate hydrogenase and D- lyxose isomerase from Aeromonas, Aerobacter aerogenes PRL-R3, or various other suitable microorganisms, including those microorganisms capable of growing on D- mannuronate or D-lyxose as a source of carbon and energy.
  • monosaccharide dehydrogenases such as D-mannuronate hydrogenase and D- lyxose isomerase from Aeromonas, Aerobacter aerogenes PRL-R3, or various other suitable microorganisms, including those microorganisms capable of growing on D- mannuronate or D-lyxose as a source of carbon and energy.
  • Certain embodiments may include a microbial system or isolated microorganism with enhanced efficiency for converting monosaccharides such as D- mannonate and D-xylulose into monosaccharides suitable for a biofuel biosynthesis pathway such as KDG.
  • D-mannonate and D-xylulose are metabolites in microbes such as E. coli.
  • D-mannonate is converted by a D- mannonate dehydratase to KDG.
  • D-xylulose enters the pentose phosphate pathway.
  • an exogenous or endogenous D- mannonate dehydratase ⁇ e.g., uxuA) gene may be over-expressed an a recombinant microorganism of the invention.
  • suitable endogenous or exogenous genes such as kinases (e.g., kdgK), nad, as well as KDG aldolases (e.g., kdgA and eda) may be either incorporated or overexpressed in a given recombinant microorganism (see SEQ ID NOS:93-96), including biologically active variants or fragments thereof, such as optimized variants of these genes.
  • SEQ ID NO:93 shows the nucleotide sequence and SEQ ID NO:94 shows the polypeptide sequence of a 2-keto- deoxy gluconate kinase (KdgK) from Escherichia coli DHlOB.
  • SEQ ID NO:95 shows the nucleotide sequence and SEQ ID NO:96 shows the polypeptide sequence of a 2- keto-deoxy gluconate-6-phosphate aldorase (KdgA) from Escherichia coli DHlOB.
  • a recombinant microorganism that is capable of growing on alginate or pectin as a sole source of carbon may utilize a naturally-occurring or endogenous copy of a dehyradratase, kinase, and/or aldolase.
  • E. coli contains endogenous dehydratases, kinases, and aldolases that are capable of catalyzing the appropriate steps in the conversion of polysaccharides to a suitable monosaccharide.
  • the naturally-occurring dehydratase or kinase may also be over-expressed, such as by providing an exogenous copy of the naturally-occurring dehydratase, kinase or aldolase operable linked to a highly constitutive or inducible promoter.
  • Vibrio spectacularus is known to be able to metabolize alginate to support growth.
  • SEQ ID NO: 1 shows a secretome region carrying certain Vibrio spectacularus genes (V12B01 02425 to Vl 2B01 02480), which encodes a type II secretion apparatus.
  • SEQ ID NO:2 shows the nucleotide sequence of an entire genomic region between V12B01 24189 to V12B01_24249, which was derived from Vibrio spectacularus, and which when transformed into E.
  • a recombinant microorganism e.g., E. coli
  • a recombinant microorganism that is able to grow on alginate as a sole source of carbon and/or energy may comprise one or more nucleotide or polypeptide reference sequences described in SEQ ID NOS: 1-64, including biologically active fragments or variants thereof, such as optimized variants.
  • a recombinant microorganism that is able to grow on alginate as a sole source of carbon may contain certain coding nucleotide or polypeptide sequences contained within SEQ ID NO:2, such as the sequences in SEQ ID NOS:3-64, or biologically active fragments or variants thereof, including optimized variants. These sequences are described in further detail below.
  • SEQ ID NO: 3 shows the nucleotide coding sequence of the putative protein V12B01_24184. This putative coding sequence is contained within the polynucleotide sequence of SEQ ID NO:2, and encodes a polypeptide that is similar to an autotransporter adhesion or type I secretion target ggxgxdxxx (SEQ ID NO: 145) repeat. SEQ ID NO:4 shows the polypeptide sequence of putative protein
  • V12B01 24184 encoded by the polynucleotide of SEQ ID NO:3.
  • This putative polypeptide is similar to autotransporter adhesion or type I secretion target ggxgxdxxx (SEQ ID NO: 145) repeat.
  • SEQ ID NO: 5 shows the nucleotide sequence that encodes the putative protein V12B01_24189.
  • SEQ ID NO:6 shows the polypeptide sequence of the putative protein Vl 2B01 24189, which is similar to cyclohexadienyl dehydratase.
  • SEQ ID NO:7 shows the nucleotide sequence that encodes the putative protein V12B01 24194.
  • SEQ ID NO:8 shows the polypeptide sequence of the putative protein Vl 2B01 24194, which is similar to a Na/proline transporter.
  • SEQ ID NO:9 shows the nucleotide sequence that encodes the putative protein V12B01 24199.
  • SEQ ID NO: 10 shows the polypeptide sequence of the putative protein V12B01 24199, which is similar to a &eto-deoxy-phosphogluconate aldolase.
  • SEQ ID NO:11 shows the nucleotide sequence that encodes the putative protein V12B01 24204.
  • SEQ ID NO:12 shows the polypeptide sequence of the putative protein Vl 2B01 24204, which is similar to 2-dehydro-3-deoxygluconokinase.
  • SEQ ID NO: 13 shows the nucleotide sequence that encodes the putative protein V12B01 241209.
  • SEQ ID NO:14 shows the polypeptide sequence of the putative protein V12B01 241209.
  • SEQ ID NO: 15 shows the nucleotide sequence that encodes the putative protein V12B01 24214.
  • SEQ ID NO:16 shows the polypeptide sequence of the putative protein Vl 2B01 24214, which is similar to a chondroitin AC/alginate lyase.
  • SEQ ID NO: 17 shows the nucleotide sequence that encodes the putative protein V12B01 24219.
  • SEQ ID NO:18 shows the polypeptide sequence of the putative protein Vl 2B01 24219, which is similar to a chondroitin AC/alginate lyase.
  • SEQ ID NO: 19 shows the nucleotide sequence that encodes the putative protein V12B01 24224.
  • SEQ ID NO:20 shows the polypeptide sequence of the putative protein Vl 2B01 24224, which is similar to a 2-£eto-4-pentenoate hydratase/2- oxohepta-3-ene-l,7-dioic acid hydratase.
  • SEQ ID NO:21 shows the nucleotide sequence that encodes the putative protein Vl 2B01 24229.
  • SEQ ID NO:22 shows the polypeptide sequence of the putative protein V12B01 24229, which is similar to a GntR-family transcriptional regulator.
  • SEQ ID NO:23 shows the nucleotide sequence that encodes the putative protein V12B01 24234.
  • SEQ ID NO:24 shows the polypeptide sequence of the putative protein V12B01_24234, which is similar to a Na + /proline symporter.
  • SEQ ID NO:25 shows the nucleotide sequence that encodes the putative protein V12B01 24239.
  • SEQ ID NO:26 shows the polypeptide sequence of the putative protein V12B01 24239, which is similar to an oligoalginate lyase.
  • SEQ ID NO:27 shows the nucleotide sequence that encodes the putative protein V12B01 24244.
  • SEQ ID NO:28 shows the polypeptide sequence of putative protein V12B01 24244, which is similar to a 3-hydroxyisobutyrate dehydrogenase.
  • SEQ ID NO:29 shows the nucleotide sequence that encodes the putative protein V12B01 24249.
  • SEQ ID NO:30 shows the polypeptide sequence of the putative protein V12B01 24249, which is similar to a methyl -accepting chemotaxis protein.
  • SEQ ID NO:31 shows the nucleotide sequence that encodes the putative protein V12B01 24254.
  • SEQ ID NO:32 shows the polypeptide sequence of putative protein V12B01 24254, which is similar to an alginate lyase.
  • SEQ ID NO:33 shows the nucleotide sequence that encodes the putative protein V12B01 24259.
  • SEQ ID NO:34 shows the polypeptide sequence of putative protein V12B01 24259, which is similar to an alginate lyase.
  • SEQ ID NO:35 shows the nucleotide sequence that encodes the putative protein V12B01 24264.
  • SEQ ID NO:36 shows the polypeptide sequence of putative protein V12B01 24264.
  • SEQ ID NO:37 shows the nucleotide sequence that encodes the putative protein V12B01 24269.
  • SEQ ID NO:38 shows the polypeptide sequence of putative protein V12B01 24269, which is similar to a putative oligogalacturonate specific porin.
  • SEQ ID NO:39 shows the nucleotide sequence that encodes the putative protein V12B01 24274.
  • SEQ ID NO:40 shows the polypeptide sequence of putative protein Vl 2B01 24274, which is similar to an alginate lyase.
  • Figure 32 shows the nucleotide coding sequence and polypeptide sequence of putative protein V12B01 02425.
  • Figure 32A shows the nucleotide sequence that encodes the putative protein V12B01 02425 (SEQ ID NO:41).
  • Figure 32B shows the polypeptide sequence of putative protein V12B01 02425 (SEQ ID NO:42), which is similar to a type II secretory pathway component EpsC.
  • SEQ ID NO:43 shows the nucleotide sequence that encodes the putative protein V12B01 02430.
  • SEQ ID NO:44 shows the polypeptide sequence of putative protein V12B01 02430, which is similar to a type II secretory pathway component EpsD.
  • SEQ ID NO:45 shows the nucleotide sequence that encodes the putative protein V12B01 02435.
  • SEQ ID NO:46 shows the polypeptide sequence of putative protein V12B01 02435, which is similar to a type II secretory pathway component EpsE.
  • SEQ ID NO:47 shows the nucleotide sequence that encodes the putative protein V12B01 02440.
  • SEQ ID NO:48 shows the polypeptide sequence of putative protein V12B01 02440, which is similar to a type II secretory pathway component EpsF.
  • SEQ ID NO:49 shows the nucleotide sequence that encodes the putative protein V12B01 02445.
  • SEQ ID NO:50 shows the polypeptide sequence of putative protein V12B01 02445, which is similar to a type II secretory pathway component EpsG.
  • SEQ ID NO:51 shows the nucleotide sequence that encodes the putative protein V12B01 02450.
  • SEQ ID NO:52 shows the polypeptide sequence of putative protein V12B01 02450, which is similar to a type II secretory pathway component EpsH.
  • SEQ ID NO:53 shows the nucleotide sequence that encodes the putative protein V12B01 02455.
  • SEQ ID NO:54 shows the polypeptide sequence of putative protein V12B01_02455, which is similar to a type II secretory pathway component Epsl.
  • SEQ ID NO:55 shows the nucleotide sequence that encodes the putative protein V12B01 02460.
  • SEQ ID NO:56 shows the polypeptide sequence of putative protein Vl 2B01 02460, which is similar to a type II secretory pathway component EpsJ.
  • SEQ ID NO:57 shows the nucleotide sequence that encodes the putative protein V12B01 02465.
  • SEQ ID NO:58 shows the polypeptide sequence of putative protein V12B01 02465, which is similar to a type II secretory pathway component EpsK.
  • SEQ ID NO:59 shows the nucleotide sequence that encodes the putative protein V12B01 02470.
  • SEQ ID NO:60 shows the polypeptide sequence of putative protein V12B01 02470, which is similar to a type II secretory pathway component EpsL.
  • SEQ ID NO:61 shows the nucleotide sequence that encodes the putative protein V12B01 02475.
  • SEQ ID NO:62 shows the polypeptide sequence of putative protein V12B01 02475, which is similar to a type II secretory pathway component EpsM.
  • SEQ ID NO:63 shows the nucleotide sequence that encodes the putative protein V12B01 02480.
  • SEQ ID NO:64 shows the nucleotide sequence that encodes the putative protein Vl 2B01 02480, which is similar to a type II secretory pathway component EpsC.
  • Agrobacterium tumefaciens C58 is able to metabolize relatively small sizes of alginate molecules (-1000 mers) as a sole source of carbon and energy. Since A. tumefaciens C58 has long been used for plant biotechnology, the genetics of this organism has been relatively well studied, and many genetic tools are available and compatible with other gram-negative bacteria such as E. coli. Thus, certain aspects may employ this microbe, or the genes therein, for the production of suitable monosaccharides.
  • the present disclosure provides a series of novel ADH genes having both DEHU and mannuronate hydrogenase activity that were obtained from Agrobacterium tumefaciens C58 ⁇ see SEQ ID NOS: 67-92).
  • Pectin is a linear chain of ⁇ -(l-4)-linked D-galacturonic acid that forms the pectin-backbone, a homogalacturonan. Into this backbone, there are regions where galacturonic acid is replaced by (l-2)-linked L-rhamnose. From rhamnose, side chains of various neutral sugars typically branch off. This type of pectin is called rhamnogalacturonan I. Over all, about up to every 25th galacturonic acid in the main chain is exchanged with rhamnose.
  • the neutral sugars mainly comprise D-galactose, L- arabinose and D-xylose; the types and proportions of neutral sugars vary with the origin of pectin. In nature, around 80% of carboxyl groups of galacturonic acid are esterified with methanol. Some plants, like sugar-beet, potatoes and pears, contain pectins with acetylated galacturonic acid in addition to methyl esters. Acetylation prevents gel- formation but increases the stabilising and emulsifying effects of pectin. Certain pectin degradation and metabolic pathways are exemplified in Figure 3.
  • certain recombinant microorganisms may incorporate features that are useful for growth on pectin as a sole source of carbon.
  • pectin methyl and acetyl esterases first catalyze the hydrolysis of methyl and acetyl esters on pectin.
  • pectin methyl esterases include, but are not limited to, pemA and pmeB.
  • pectin acetyl esterases include, but are not limited to, PaeX and PaeY.
  • pectin methyl esterases that may be utilized herein include enzymes or polypeptides sharing at least 60%, 70%, 80%, 90%, 95%, 98%, or more sequence identity (including all integers in between) to the pectate methyl esterases in Figure 40.
  • pectate acetyl esterases that may be utilized herein include enzymes or polypeptides sharing at least 60%, 70%, 80%, 90%, 95%, 98%, or more sequence identity (including all integers in between) to the pectate acetyl esterases described in Figure 41.
  • pectate lyases and hydrolases may catalyze the endolytic cleavage of pectate via ⁇ -elimination and hydrolysis, respectively, to produce oligopectates.
  • Other enzymes that may be utilized to metabolize pectin include Examples of pectate lyases include, but are not limited to, PeIA, PeIB, PeIC, PeID, PeIE, Pelf, Pell, PeIL, and PeIZ.
  • pectate hydrolases include, but are not limited to, PehA, PehN, PehV, PehW, and PehX.
  • Further examples of pectate lyases include polypeptides or enzymes sharing at least 60%, 70%, 80%, 90%, 95%, 98%, or more sequence identity (including all integers in between) to the pectate lyases described in Figure 38.
  • rhamnogalacturonan lyases may also be utilized herein to degrade and metabolize pectin.
  • rhamnogalacturonan lyases include polypeptides or enzymes sharing at least 60%, 70%, 80%, 90%, 95%, 98%, or more sequence identity (including all integers in between) to the rhamnoglacturonan lyases (i.e., rhamnogalacturonases) described in Figure 39A.
  • rhamnogalacturonate hydrolyases examples include polypeptides or enzymes sharing at least 60%, 70%, 80%, 90%, 95%, 98%, or more sequence identity (including all integers in between) to the rhamnogalacturonate hydrolases described in Figure 39B.
  • certain of the recombinant microorganisms and methods of the present invention may incorporate one or more of the above noted methy and acetyl esterases, lyases, and/or hydrolases, among others known in the art.
  • These may enzymes may be encoded and expressed by endogenous or exogenous genes, and may also include biologically active fragments or variants thereof, such as homologs, orthologs, and/or optimized variants of these enzymes.
  • oligopectates may be transported into the periplasm fraction of gram-negative bacteria by outer membrane porins, where they are further degraded into such components as di- and tri- galactonurates.
  • outer membrane porins include that can transport oligopectates into the periplasm include, but are not limited to, kdgN and kdgM. Certain recombinant microorganism may incorporate these or similar genes.
  • Di- and tri-galactonurates may then be transported into the cytosol for further degradation.
  • Bacteria contain at least two different transporter systems responsible for di- and tri-galacturonate transportation, including symporter and ABC transporter (e.g., TogT and TogMNAB, respectively).
  • symporter and ABC transporter e.g., TogT and TogMNAB, respectively.
  • certain of the recombinant microorganisms provided herein may comprise one or more a di- or tri-galacturonate transoporter systems, such as TogT and/or TogMNAB.
  • short pectate or galacturonate lyases break them down to D-galacturonate and (4S)-4,6- dihydroxy-2,5-dioxohexuronate.
  • short pectate or galacturonate lyases include, but are not limited to, PeIW and OgI, which genes may be either endogenously or exogenously incorporated into certain recombinant microorganisms provided herein.
  • D-galacturonate and (4S)-4,6-dihydroxy-2,5-dioxohexuronate are then converted to 5- dehydro-4-deoxy-D-glucuronate and further to KDG, which steps may be catalyzed by Kdul and KduD, respectively.
  • the Kdul enzyme has an isomerase activity
  • the KduD enzyme has a dehydrogenase activity, such as a 2-deoxy-D-gluconate 3- dehydrogenase activity.
  • certain recombinant microorgansms provided herein may comprise one or more short pectate or galacturonate lyases, such as PeIW and/or OgI, and may optionally comprise one or more isomerases, such as Kdul, as well as one or more dehydrogenases, such as KduD, to convert di- and trigalacturonates into a suitable monosaccharide, such as KDG.
  • short pectate or galacturonate lyases such as PeIW and/or OgI
  • isomerases such as Kdul
  • KduD dehydrogenases
  • a recombinant microorganism such as E. coli, that is able to grown on pectin or tri-galacturonate as a sole source of carbon and/or energy may comprise one or more of the gene sequences contained within SEQ ID NOS :65 and 66, including biologically active fragments or variants thereof, such as optimized variants.
  • SEQ ID NO:65 shows the nucleotide sequence of the kdgF-PaeX region from Erwinia carotovora subsp. Atroseptica SCRIl 043.
  • SEQ ID NO:66 shows the nucleotide sequence of ogl-kdgR from Erwinia carotovora subsp. Atroseptica SCRIl 043.
  • a recombinant microorganism such as E. coli
  • that is able to grown on pectin or tri-galacturonate as a sole source of carbon and/or energy may comprise one or more genomic regions of Erwinia chrysanthemi, comprising several genes (MgF, kdul, kduD,pelW, togM, togN, togA, togB, kdgM, paeX, ogl, and kdgR ) encoding enzymes (kdul, kduD, ogl, pelW, andpaeX), transporters (togM, togN, togA, togB, and kdgM), and regulatory proteins (kdgR) responsible for degradation of di- and trigalacturonate, as well as several genes (pelA, pelE, paeY, and pern) encoding pectate lyases (pelA and pelE), pect
  • isomerases that may be utilized herein include glucoronate isomerases, such as those in the family uxaC, as well as 4-deoxy-L-threo-5- hexulose uronate isomerases, such as those in the family Kdul.
  • reductases that may be utilized herein include tagaturonate reductases, such as those in the family uxaB.
  • dehyadratases include altronate dehydratases, such as those in the family uxaA.
  • dehydrogenases that may be utilized herein include 2-deoxy-D-gluconate 3- dehydrogenases, such as those in the family kduD.
  • KDG is a common metabolic intermediate in the degradation of hexuronates such as D- glucuronate and D-galacturonate and enters into Entner Doudoroff pathway where it is converted to pyruvate and glyceraldehyde-3-phosphate (G3P).
  • KDG KDG kinase
  • G3P glyceraldehyde-3-phosphate
  • KDPG 2-keto-3-deoxy-D-6-posphate-gluconate aldolase
  • the negative regulator KdgR may be removed.
  • exogenous copies of KdgK and KdgA may also be incorporated into a given recombinant microorganism.
  • a recombinant microorganism that is able to grow on a polysaccharide ⁇ e.g., alginate, pectin, etc) as a sole source of carbon may be capable of producing an increased amount of a given commodity chemical ⁇ e.g., ethanol) while growing on that polysaccharide.
  • a given commodity chemical e.g., ethanol
  • E. coli engineered to grown on alginate may be engineered to produced an increased amount of ethanol from alginate as compared to E. coli that is not engineered to grown on alginate (see Example 11).
  • certain aspects include a recombinant microorganism that is capable of growing on alginate or pectin as a sole source carbon, and that is capable of producing an increased amount of ethanol, such as by comprising one or more genes encoding and expressing a pyruvate decarboxylase (pdc) and/or an alcohol dehydrogenase, including functional variants thereof.
  • a recombinant microorganism may comprise a pyruvate decarboxylase ⁇ pdc) and two alcohol dehydrogenases (adhA and adhB) obtained from Zymomonas mobilis.
  • Embodiments of the present invention also include methods for converting polysaccharide to a suitable monosaccharide comprising, (a) obtaining a polysaccharide; (b) contacting the polysaccharide with a chemical catalysis or enzymatic pathway, thereby converting the polysaccharide to a first monosaccharide or oligosaccharide; and (c) contacting the first monosaccharide with a microbial system for a time sufficient to convert the first monosaccharide or oligosaccharide to the suitable monosaccharide, wherein the microbial system comprises, (i) at least one gene encoding and expressing an enzyme selected from a monosaccharide transporter, a disaccharide transporter, a trisaccharide transporter, an oligosaccharide transporter, and a polysaccharide transporter; and (ii) at least one gene encoding and expressing an enzyme selected from a monosaccharide dehydrogen
  • aquatic or marine-biomass polysaccharides such as alginate may be chemically degraded using chemical catalysts such as acids.
  • biomass-derived pectin may be chemically degraded.
  • the reaction catalyzed by chemical catalysts is typically through hydrolysis, as opposed to the ⁇ -elimination type of reactions catalyzed by enzymatic catalysts.
  • certain embodiments may include boiling alginate or pectin with strong mineral acids to liberate carbon dioxide from D-mannuronate, thereby forming D-lyxose, a common sugar metabolite utilized by many microorganisms.
  • Such embodiments may use, for example, formate, hydrochloric acid, sulfuric acid, in addition to other suitable acids known in the art as chemical catalysts.
  • An enzymatic pathway may utilized one or more enzymes described herein that are capable of catalyzing the degradation of polysaccharides, such as alginate or pectin.
  • the suitable monosaccharides or suitable oligosaccharides produced by the recombinant microorganisms and microbial systems of the present invention may be utilized as a feedstock in the production of commodity chemicals, such as biofuels, as well as commodity chemical intermediates.
  • certain embodiments of the present invention relate generally to methods for converting a suitable monosaccharide or oligosaccharide to a commodity chemical, such as a biofuel, comprising, (a) obtaining a suitable monosaccharide or oligosaccharide; (b) contacting the suitable monosaccharide or oligosaccharide with a microbial system for a time sufficient to convert to the suitable monosaccharide to the biofuel, thereby converting the suitable monosaccharide to the biofuel.
  • Certain aspects include methods for converting a suitable monosaccharide to a first commodity chemical such as a biofuel, comprising, (a) obtaining a suitable monosaccharide; (b) contacting the suitable monosaccharide with a microbial system for a time sufficient to convert to the suitable monosaccharide to the first commodity chemical, wherein the microbial system comprises one or more genes encoding a aldehyde or ketone biosynthesis pathway, thereby converting the suitable monosaccharide to the first commodity chemical.
  • the first commodity chemical may be further enzymatically and/or chemically reduced and dehydrated to a second commodity chemical.
  • second commodity chemicals include, but are not limited to, butene or butane; 1 -phenylbutene or 1 -phenylbutane; pentene or pentane; 2- methylpentene or 2-methylpentane; 1 -phenylpentene or 1 -phenylpentane; 1 -phenyl -4- methylpentene or 1 -phenyl -4-methylpentane; hexene or hexane; 2-methylhexene or 2- methylhexane; 3-methylhexene or 3-methylhexane; 2,5-dimethylhexene or 2,5- dimethylhexane; 1-phenylhexene or 1 -phenylhexane; 1 -phen
  • Certain embodiments of the present invention may also include methods for converting a suitable monosaccharide or oligosaccharide to a commodity chemical comprising (a) obtaining a suitable monosaccharide or oligosaccharide; (b) contacting the suitable monosaccharide or oligosaccharide with a microbial system for a time sufficient to convert to the suitable monosaccharide or oligosaccharide to the commodity chemical, wherein the microbial system comprises; (i) one or more genes encoding a biosynthesis pathway; (ii) one or more genes encoding and expressing a C-C ligation pathway; and (iii) one or more genes encoding and expressing a reduction and dehydration pathway, comprising a diol dehydrogenase, a diol dehydratase, and a secondary alcohol dehydrogenase, thereby converting the suitable monosaccharide or oligosaccharide to the commodity chemical.
  • Certain aspects also include recombinant microorganism that comprise (i) one or more genes encoding a biosynthesis pathway; (ii) one or more genes encoding and expressing a C-C ligation pathway; and (iii) one or more genes encoding and expressing a reduction and dehydration pathway, comprising a diol dehydrogenase, a diol dehydratase, and a secondary alcohol dehydrogenase. Certain aspects also include recombinant microorganisms that comprise the above pathways individually or in certain combinations, such as recombinant microorganism that comprises one or more genes encoding a biosynthesis pathway, as described herein.
  • Certain aspects may also include recombinant microorganisms that comprise one or more genes encoding and expressing a C-C ligation pathway, as described herein. Certain aspects may also include include recombinant microorganisms that comprise one or more genes encoding and expressing a reduction and dehydration pathway, comprising a diol dehydrogenase, a diol dehydratase, and a secondary alcohol dehydrogenase, as described herein.
  • certain aspects may include recombinant microorgansims that comprise (i) one or more genes encoding a biosynthesis pathway; and (ii) one or more genes encoding and expressing a C-C ligation pathway. Certain aspects may also include recombinant microorganisms that comprise (i) one or more genes encoding and expressing a C-C ligation pathway; and (ii) one or more genes encoding and expressing a reduction and dehydration pathway, comprising a diol dehydrogenase, a diol dehydratase, and a secondary alcohol dehydrogenase.
  • Certain aspects may also include recombinant microorganisms that comprise one or more individual components of a dehydration and reduction pathway, such as a recombinant microorganism that comprises a diol dehydrogenase, a diol dehydratase, or a secondary alcohol dehydrogenase.
  • a recombinant microorganism that comprises a diol dehydrogenase, a diol dehydratase, or a secondary alcohol dehydrogenase may be utilized, for example, to convert a suitable polysaccharide to a first commodity chemical, or an intermediate thereof, or to to convert a first commodity chemical, or an intermediate thereof, to a second commodity chemical.
  • a recombinant microorganism comprising a C-C ligation pathway may be utilized to convert butanal into a first commodity chemical, or an intermediate thereof, such as 5-hydroxy-4-octanone, which can then be converted into a second commodity chemical, or intermediate thereof, by any suitable pathway.
  • a recombinant microorganism comprising a C-C ligation pathway and a diol hydrogenase may be utilized for the sequential conversion of butanal into 5-hydroxy-4-octanone and then 4,5-octanonediol. Examples of recombinant microorganisms that comprise these and other various combinations of the individual pathways described herein, as well as various combinations of the individual components of those pathways, will be apparent to those skilled in the art, and may also be found in the Examples.
  • a recombinant microorganism comprising an exogenous C-C ligase (e.g., benzaldehyde lyase from Pseudomonas fluorescens) could be utilized in a method to convert a first commodity chemical such as 3-methylbutanal to a second commodity chemical such as 2,7- dimethyl-5-hydroxy-4-octanone.
  • an exogenous C-C ligase e.g., benzaldehyde lyase from Pseudomonas fluorescens
  • the same or different recombinant microorganism comprising a diol dehydrogenase could be utilized in a method to convert 2,7-dimethyl-5-hydroxy-4-octanone to another commodity chemical such as 2,7-dimethyl-4,5-octanediol (see Table 2 for other examples).
  • a recombinant microorganism comprising an exogenous secondary alcohol dehydrogenase could be utilized in a method to convert a first commodity chemical such as 2,7-dimethyl-4-octanone to a second commodity chemical such as 2,7-dimethyloctanol.
  • Embodiments of a microbial system or isolated microorganism of the present application may include a naturally-occuring biosynthesis pathway, and/or an engineered, reconstructed, or re-designed biosynthesis pathway that has been optimized for improved functionality.
  • Embodiments of a microbial system or recombinant microorganism of the present invention may include a natural or reconstructed biosynthesis pathway, such as a butyraldehyde biosynthesis pathway, as found in such microorganisms as Clostridium acetobutylicum and Streptomyces coelicolor.
  • a butyraldehyde biosynthesis pathway such as a butyraldehyde biosynthesis pathway
  • butyrate and butanol are the common fermentation products of certain bacterial species such as Clostridia, in which the production of butyrate and butanol is mediated by a synthetic thiolase dependent pathway characteristically similar to fatty acid degradation pathway.
  • Such pathways may be initiated with the condensation of two molecules of acetyl-CoA to acetoacetyl-CoA, which is catalyzed by thiolase.
  • Acetoacetyl-CoA is then reduced to ⁇ -hydroxy butyryl-CoA, which is catalyzed by NAD(P)H dependent ⁇ -hydroxy butyryl-CoA dehydrogenase (HBDH).
  • HBDH NAD(P)H dependent ⁇ -hydroxy butyryl-CoA dehydrogenase
  • Crotonase catalyzes dehydration from ⁇ -hydroxy butyryl-CoA to form crotonyl-CoA.
  • Further reduction catalyzed by NADH-dependent butyryl-CoA dehydrogenase (BCDH) saturates the double bond at C2 of crotonyl-CoA to form butyryl-CoA.
  • BCDH NADH-dependent butyryl-CoA dehydrogenase
  • thiolase the first enzyme in this pathway, may be overexpressed to maximize production.
  • thiolase may over- expressed in E. coli.
  • all three enzymes e.g., HBDH, crotonase, and BCDH
  • BDH, crotonase, and BCDH may be expressed or over-expressed in a suitable microorganism such as E. coli.
  • a short-chain aliphatic acyl-CoA dehydrogenase derived from Pseudomonas putida KT2440 may be utilized in other embodiments of a microbial system or isolated microorganism of the present application.
  • butyryl-CoA in Clostridia may be readily converted to butanol and/or butyrate by at least a few different pathways.
  • butyryl-CoA is directly reduced to butyraldehyde catalyzed by NADH dependent CoA- acylating aldehyde dehydrogenase (ALDH).
  • Butyraldehyde may be further reduced to butanol by NADH-dependent butanol dehydrogenase.
  • CoA-acylating ALDH catalyzes the one step reduction of butyryl-CoA to butyraldehyde
  • the incorporation of CoA-acylating ALDH to the microbial system may result in acetoaldehyde formation because of its promiscuous acetyl-CoA deacylating activity.
  • the formation of acetoaldehyde may be minimized by functionally redesigning the relevant enzyme(s).
  • Butyryl-CoA in other biosynthesis pathways is deacylated to form butyryl phosphate catalyzed by phosphotransbutyrylase. Butyryl phosphate is then hydrolyzed by reversible butyryl phosphate kinase to form butyrate. This reaction is coupled with ATP generation from ADP.
  • the butyrate formation through these enzymes is known to be significantly more specific. Certain embodiments may comprise phosphotransbutyrylase and butyryl phosphate kinase to the microbial system. In other embodiments, butyrate may be directly formed from butyryl-CoA by short chain acyl-CoA thioesterase.
  • Butyrate in Clostridia may also be sequentially reduced to butanol, which is catalyzed by a single alcohol/aldehyde dehydrogenase.
  • Certain embodiments may comprise short chain aldehyde dehydrogenase from other bacteria such as Pseudomonas putida to complement the production of butyraldehyde in the microbial system.
  • One potential concern in using short chain aldehyde dehydrogenase involves the possible formation of acetoaldehyde from acetate.
  • Certain embodiments may be directed to minimizing the acetate formation in the microbial system, for example, by deleting several genes encoding enzymes involved in the acetate production.
  • acetyl-CoA synthase which catalyses the acetyl-CoA formation from acetate is also known to significantly reduce the accumulation of acetate.
  • Certain embodiments may comprise a microbial system or isolated microorganism with deleted POXB, PTA, and/or ACKA genes, and other embodiments may also comprise, separately or together with the deleted genes, one or more genes encoding and expressing ACS.
  • a microbial system or recombinant microorganism provided herein may also comprise a glutaraldehyde biosynthesis pathway.
  • Saccharomyces cerevisiae has a lysine biosynthetic pathway in which acetyl-CoA is initially condensed to ⁇ -ketoglutarate, a common metabolite in citric acid cycle, to form homocitorate. This reaction is catalyzed by homocitrate synthase derived from Yeast, Thermus thermophilus, or Deinococcus radiodurans.
  • Homoaconitase derived from Yeast, Thermus thermophilus, or Deinococcus radiodurans catalyzes the conversion between homocitrate and homoisocitrate.
  • Homoisocitrate is then oxidatively decarboxylated to form 2-ketoadipate, which is catalyzed by homoisocitrate dehydrogenase derived from Yeast, Thermus thermophilus, or Deinococcus radiodurans.
  • Homoisocitrate is also oxidatively decarboxylated to form glutaryl-CoA, which may be catalyzed by homoisocitrate dehydrogenase.
  • certain embodiments may comprise a homocitrate synthase, a homoaconitase, and/or a homoisocitrate dehydrogenase.
  • 2- ketoadipate is reduced to 2-keto-adipicsemialdehyde.
  • This reaction can be catalyzed by dialdehyde dehydrogenase, which, for example, may be isolated from Agrobacterium tumefaciens C58.
  • dialdehyde dehydrogenases may incorporate dialdehyde dehydrogenases into a microbial system or recombinant microorganism.
  • Acyl-CoA thioesterases may also catalyze the hydrolysis of glutaryl-CoA.
  • the genes encoding ⁇ -carboxylic acyl- CoA specific peroxisomal ACOTs are found in many mammalian species; both ACOT4 and ACOT8 derived from mice have been previously expressed in E. coli and shown that both enzymes are highly active on the hydrolysis of glutaryl-CoA to form glutarate.
  • Certain embodiments may comprise one or more Acyl-CoA thioesterases.
  • Glutarate is sequentially reduced to glutaraldehyde.
  • This reaction can be catalyzed by glutaraldehyde dehydrogenase (CpnE), which, for example, may be isolated from Comomonas sp. Strain NCIMB 9872.
  • CpnE glutaraldehyde dehydrogenase
  • Certain embodiments may incorporate glutaraldehyde dehydrogenases such as CpnE into a microbial system or isolated microorganism.
  • Other embodiments may comprise both ACOT and CpnE enzymes.
  • Other embodiments may comprise CpnE enzymes redesigned to catalyze the reduction of 1 -hydroxy propanoate and succinate to 1 -hydroxy propanal and succinicaldehyde.
  • the biosynthesis pathway may include an aldehyde biosynthesis pathway, a ketone biosynthesis pathway, or both.
  • the biosynthesis pathway may be include one or more of an acetoaldehyde, propionaldehyde, butyraldehyde, isobutyraldehyde, 2-methyl-butyraldehyde, 3-methyl- butyraldehyde, 4-methylpentaldehyde, phenylacetoaldehyde, 2-phenyl acetoaldehyde, 2-(4-hydroxyphenyl) acetaldehyde, 2-Indole-3 -acetoaldehyde, glutaraldehyde, 5-amino- pentaldehyde, succinate semialdehyde, and/or succinate 4-hydroxyphenyl acetaldehyde biosynthesis pathway, including various combinations thereof.
  • a biosynthesis pathway may comprise an acetoaldehyde biosynthesis pathway in combination with at least one of a propionaldehyde, butyraldehyde, isobutyraldehyde, 2-methyl- butyraldehyde, 3 -methyl -butyraldehyde, or phenylacetoaldehyde biosynthesis pathway.
  • a biosynthesis pathway may comprise a propionaldehyde biosynthesis pathway in combination with at least one of a butyraldehyde, isobutyraldehyde, 2-methyl-butyraldehyde, 3 -methyl -butyraldehyde, or phenylacetoaldehyde biosynthesis pathway.
  • a biosynthesis pathway may comprise a butyraldehyde biosynthesis pathway in combination with at least one of an isobutyraldehyde, 2-methyl-butyraldehyde, 3 -methyl -butyraldehyde, or phenylacetoaldehyde biosynthesis pathway.
  • a biosynthesis pathway may comprise an isobutyraldehyde biosynthesis pathway in combination with at least one of a 2-methyl-butyraldehyde, 3-methyl-butyraldehyde, or phenylacetoaldehyde biosynthesis pathway.
  • a biosynthesis pathway may comprise a 2- methyl -butyraldehyde biosynthesis pathway in combination with at least one of a 3- methyl-butyraldehyde or a phenylacetoaldehyde biosynthesis pathway.
  • a biosynthesis pathway may comprise a 3-methyl-butyraldehyde biosynthesis pathway in combination with a phenylacetoaldehyde biosynthesis pathway.
  • a propionaldehyde biosynthesis pathway may comprise a threonine deaminase (ilvA) gene from an organism such as Escherichia coli and a keto-isovalerate decarboxylase (kivd) gene from an organism such as Lactococcus lactis, and/or functional variants of these enzymes, including homologs or orthologs thereof, as well as optimized variants.
  • ilvA threonine deaminase
  • Kivd keto-isovalerate decarboxylase
  • a butyraldehyde biosyntheis pathway may comprise at least one of a thiolase (atoB) gene from an organism such as E. coli, a ⁇ -hydroxy butyryl-CoA dehydrogenase (hbd) gene, a crotonase (crt) gene, a butyryl-CoA dehydrogenase (bed) gene, an electron transfer flavoprotein A (etfA) gene, and/or an electron transfer flavoprotein B (etfiB) gene from an organism such as Clostridium acetobutyricum ⁇ e.g., ATCC 824), as well as a coenzyme A-linked butyraldehyde dehydrogenase (aid) gene from an organism such as Clostridium beijerinckii acetobutyricum ATCC 824.
  • a coenzyme A-linked alcohol dehydrogenase (adhE2) gene from an organism such as Clos
  • an isobutyraldehyde biosynthetic pathway may comprise an acetolactate synthase (alsS) from an organism such as Bacillus subtilis or an als gene from an organism such as Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (codon usage may be optimized for E. coli protein expression).
  • Such a pathway may also comprise acetolactate reductoisomerase (UvC) and/or 2,3- dihydroxyisovalerate dehydratase (HvD) genes from an organism such as E. coli, as well as a keto-isovalerate decarboxylase (kivd) gene from an organism such as Lactococcus lactis.
  • a 3-methylbutyraldehyde and 2-methylbutyraldehyde biosynthesis pathway may comprise an acetolactate synthase (alsS) gene from an organism such as Bacillus subtilis or an (als) gene from an organism such as Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (codon usage may be optimized for E. coli protein expression).
  • alsS acetolactate synthase
  • Certain aspects of such a pathway may also comprise acetolactate reductoisomerase (HvC), 2,3-dihydroxyisovalerate dehydratase (HvD), isopropylmalate synthase (LeuA), isopropylmalate isomerase (LeuC and LeuD), and 3- isopropylmalate dehydrogenase (LeuB) genes from an organism such as E. coli, as well as a keto-isovalerate decarboxylase (kivd) from an organism such as Lactococcus lactis.
  • HvC acetolactate reductoisomerase
  • HvD 2,3-dihydroxyisovalerate dehydratase
  • LeuA isopropylmalate synthase
  • LeuC and LeuD isopropylmalate isomerase
  • Kivd keto-isovalerate decarboxylase
  • a phenylacetoaldehyde and A- hydroxyphenylacetoaldehyde biosynthesis pathway may comprise one or more of 3- deoxy-7-phosphoheptulonate synthase (aroF, aroG, and aroH), 3-dehydroquinate synthase (aroB), a 3-dehydroquinate dehydratase (aroD), dehydroshikimate reductase (aroE), shikimate kinase II (aroL), shikimate kinase I (aroK), 5-enolpyruvylshikimate- 3-phosphate synthetase (aroA), chorismate synthase (aroC), fused chorismate mutase P/prephenate dehydratase (pheA), and/or fused chorismate mutase T/prephenate dehydrogenase (tyrA) genes from an organism such as E.
  • a biosynthesis pathway may comprise one or more homocitrate synthase, homoaconitate hydratase, homoisocitrate dehydrogenase, and/or homoisocitrate dehydrogenase genes from an organism such as Deinococcus radiodurans and/or Thermus thermophilus, as well as a keto-adipate decarboxylase gene, a 2-aminoadipate transaminase gene, and a L-2-Aminoadipate-6-semialdehyde: NAD+ 6-oxidoreductase gene.
  • a biosynthesis pathway would be able to convert ⁇ -ketoglutarate to 5-amin
  • a ⁇ - ketoadipate semialdehyde biosynthesis pathway may comprise homocitrate synthase (hcs), homoaconitate hydratase, and homoisocitrate dehydrogenase genes from an organism such as Deinococcus radiodurans and/or Thermus thermophilus, and an ⁇ - ketoadipate semialdehyde dehydrogenase gene.
  • hcs homocitrate synthase
  • homoaconitate hydratase homoisocitrate dehydrogenase genes from an organism such as Deinococcus radiodurans and/or Thermus thermophilus
  • an ⁇ - ketoadipate semialdehyde dehydrogenase gene such as for one step in cyclopentanol production.
  • a biosynthesis pathway (e.g., aldehyde biosynthesis pathway) may optionally or further comprise one or more genes encoding a carboxylase enzyme, such as an indole-3-pyruvate decarboxylase (IPDC).
  • IPDC indole-3-pyruvate decarboxylase
  • An IPDC may be obtained, for example, from such microorganisms as Azospirillum brasilense and Paenibacillus polymyxa E681.
  • an IPDC may be utilized to more efficiently catalyze the dexarboxylation of various carboxylic acids to form the corresponding aldehyde, which can be further converted to a commodity chemical by a reductase or dehydrogenase, as detailed herein.
  • a 2-phenylethanol, 2-(4-hydroxyphenyl)ethanol, and 2-(indole-3-)ethanol biosynthesis pathway may comprise a transketolase (tktA), a 3- deoxy-7-phosphoheptulonate synthase (aroF, aroG, and aroH), 3-dehydroquinate synthase (aroB), a 3-dehydroquinate dehydratase (aroD), a dehydroshikimate reductase (aroE), a shikimate kinase II (aroL), a shikimate kinase I (aroK), a 5- enolpyruvylshikimate-3-phosphate synthetase (aroA), a chorismate synthase (aroC), a fused chorismate mutase P/prephenate dehydratase (pheA), and a fused chorismate mutase T/pre
  • keto-isovalerate decarboxylase (kivd) from Lactococcus lactis, alcohol dehydrogenase (adh2) from Saccharomyces cerevisiae, Indole-3 -pyruvate decarboxylase (ipdc) from Azospirillum brasilense, phenyl ethanol reductase (par) from Rhodococcus sp. ST-IO, and a benzaldehyde lyase (bal) from Pseudomonas fluorescence.
  • the components for each of the biosynthesis pathways described herein may be present in a recombinant microorganism either endogenously or exogenously.
  • endogenous genes for example, may be up-regulated or over-expressed, such as by introducing an additional ⁇ i.e., exogenous) copy of that endogenous gene into the recombinant microorganism.
  • Such pathways may also be optimized by altering via mutagenesis the endogenous version of a gene to improve functionality, followed by introduction of the altered gene into the microorganism.
  • the expression of endogenous genes may be up or down-regulated, or even eliminated, according to known techniques in the art and described herein.
  • exogenously provided genes may be regulated as desired, such as by using various constitutive or inducible promoters.
  • genes may also be "codon- optimized,” as described herein and known in the art.
  • a CC-ligation pathway may comprise a ThDP-dependent enzyme, such as a C-C ligase, or an optimized C-C ligase.
  • a C-C ligase For example, eight-carbon unit molecules (butyroins) may be made from condensing together two four-carbon unit molecules (butyraldehydes).
  • ThDP-dependent enzymes are a group of enzymes known to catalyze both breaking and formation of C-C bonds and have been utilized as catalysts in chemoenzymatic syntheses. The spectrum of chemical reactions that these enzymes catalyze ranges from decarboxylation of ⁇ -keto acids, oxidative decarboxylation, carboligation, and to the cleavage of C-C bonds.
  • benzaldehyde lyase from Pseudomoas fluorescens
  • benzoylformate decarboxylase BFD
  • PDC pyruvate decarboxylase
  • Zymomonas mobilis may catalyze a carboligation reaction between two aldehydes.
  • BAL accepts the broadest spectrum of aldehydes as substrates among these three enzymes ranging from substituted benzaldehyde to acetoaldehyde, among others, as shown herein.
  • BAL catalyzes stereospecif ⁇ c carboligation reaction between two aldehydes and forms ⁇ -hydroxy ketone swith over 99 %ee for R-configuration.
  • the benzoin formation from two benzaldehyde molecules is a favored reaction catalyzed by BAL and proceeds as fast as 320 ⁇ mol (benzoin) mg (protein) "1 min '1 .
  • the formation of ⁇ -hydroxy ketone may be carried out using many different aldehydes, including butyraldehyde.
  • BFD and PCD may also catalyze the carboligation reactions between two aldehyde molecules.
  • BFD and PCD accept relatively larger and smaller aldehyde molecules, respectively.
  • BFD catalyzes the formation of benzoin and (S)- ⁇ -hydroxy phenylpropanone (2S-HPP)
  • PCD catalyzes the formation of (R)- ⁇ -hydroxy phenylpropanone (2R-HPP) and (R)- ⁇ -hydroxy 2-butanone (acetoin).
  • certain microbial systems or isolated microorganisms of the present application may comprise natural or optimized C-C ligases (ThDP-dependent enzymes) selected from benzaldehyde lyase (BAL) from Pseudomoas fluorescens, benzoylformate decarboxylase (BFD) from Pseudomonas putida, and pyruvate decarboxylase (PDC) from Zymomonas mobilis.
  • ThDP-dependent enzymes selected from benzaldehyde lyase (BAL) from Pseudomoas fluorescens, benzoylformate decarboxylase (BFD) from Pseudomonas putida, and pyruvate decarboxylase (PDC) from Zymomonas mobilis.
  • BAL benzaldehyde lyase
  • BFD benzoylformate decarboxylase
  • PDC pyr
  • BAL benzaldehyde lyase
  • a C-C ligation pathway of the present invention typically comprises one or more C-C ligases, such as a lyase enzyme.
  • exemplary lyases include, but are not limited to, acetoaldehyde lyases, propionaldehyde lyases, butyraldehyde lyases, isobutyraldehyde lyases, 2-methyl-butyraldehyde lyases, 3-methyl-butyraIdehyde lyases (isoveraldehyde), phenylacetaldehyde lyases, ⁇ -keto adipate carboxylyases, pentaldehyde lyases, 4-methyl-pentaldehyde lyases, hexaldehyde lyases, heptaldehyde lyases, octaldehyde lyases, 4-hydroxyphenylacetaldehyde lyases, indoleace
  • a selected CC-ligase or lyase enzyme may have one or more of the above exemplified lyase activities, such as acetoaldehyde lyase activity, a propionaldehyde lyase activity, a butyraldehyde lyase activity, and/or an isobutyraldehyde lyase activity, among others.
  • a C-C ligase may comprise a benzaldehyde lyase, such as a benzaldehyde lyase isolated from Pseudomonas fluorescens (SEQ ID NOS: 143- 144), as well as biologically active fragments or variants of this reference sequence, such as optimized variants of a benzaldehyde lyase.
  • a benzaldehyde lyase such as a benzaldehyde lyase isolated from Pseudomonas fluorescens (SEQ ID NOS: 143- 144)
  • biologically active fragments or variants of this reference sequence such as optimized variants of a benzaldehyde lyase.
  • certain aspects may comprise nucleotide sequences or polypeptide sequences having 80%, 85%, 90%, 95%, 97%, 98%, 99% sequence identity to SEQ ID NOS:143-144, and which are capable of catalyzing a carboligation reaction, or which possess C-C lyase activity, as described herein.
  • a BAL enzyme will comprise one or more conserved amino acid residues, including G27, E50, A57, G155, P162, P234, D271, G277, G422, G447, D448, and/or G512.
  • Pseudomonas fluorescens is able to grow on R-benzoin as the sole carbon and energy source because it harbours the enzyme benzaldehyde lyase that cleaves the acyloin linkage using thiamine diphosphate (ThDP) as a cofactor.
  • ThDP thiamine diphosphate
  • benzaldehyde lyase catalyses the carboligation of two aldehydes with high substrate and stereospecificity. Structure-based comparisons with other proteins show that benzaldehyde lyase belongs to a group of closely related ThDP -dependent enzymes.
  • ThDP cofactors of these enzymes are fixed at their two ends in separate domains, suspending a comparatively mobile thiazolium ring between them. While the residues binding the two ends of ThDP are well conserved, the lining of the active centre pocket around the thiazolium moiety varies greatly within the group.
  • the active sites for BAL have been described, for example, in Kneen et al. ⁇ Biochimica et Biophysica Acta 1753:263-271, 2005) and Brandt et al. ⁇ Biochemistry 47:7734-43, 2008).
  • Benzaldehyde lyase derived from from Pseudomonas fluorescens has been demonstrated herein to at least have an acetoaldehyde lyase activity, a propionaldehyde lyase activity, a butyraldehyde lyase activity, a 3 -methyl - butyraldehyde lyase activity, a pentaldehyde lyase activity, a 4-methylpentaldehyde lyase activity, a hexaldehyde lyase activity, a phenylacetoaldehyde lyase activity, and an octaldehyde lyase activity ⁇ see Table 2), among other in vivo lyase activities ⁇ see Figures 48-55).
  • a C-C ligase such as BAL derived from Pseudomonas fluorescens, BFD derived from Pseudomonas putida, or PDC derived from from Zymomonas mobilis may comprise a lyase with a combination of lyase activities, such as a lyase having both a propionaldehyde lyase activity and a 3-methyl-butyraldehyde lyase activity, among other combinations and activities, such as those exemplary combinations detailed herein.
  • a lyase having a combination of lyase activities may be referred to herein as a propionaldehyde/3- methyl-butyraldehyde lyase.
  • a dehydration and reduction pathway comprising a diol dehydrogenase, a diol dehydratase, and a secondary alcohol dehydrogenase, may be utilized to further convert an aldehyde, ketone, or corresponding alcohol, to a commodity chemical, such as a biofuel.
  • a dehydration and reduction pathway may comprise one or more diol dehydrogenases.
  • a "diol dehydrogenase” refers generally to an enzyme that catalyzes the reversible reduction and oxidation of a ⁇ -hydroxy ketone and/or its corresponding diol.
  • Certain embodiments of a microbial system or isolated microorganism may comprise genes encoding a diol dehydrogenase that specifically catalyzes the reduction of ⁇ -hydroxy-ketones, including, for example, a 4, 5, octanediol dehydrogenase.
  • Diol dehydrogenases such as 4, 5, octanediol dehydrogenase, may be isolated from a variety of organisms and incorporated into a microbial system or isolated microorganism.
  • a particular group of alcohol dehydrogenases has a characteristic ability to oxidize various ⁇ -hydroxy alcohols and reduce various ⁇ - hydroxy ketones and ⁇ -keto ketones.
  • the recitation "diol dehydrogenase” may also encompass such alcohol dehydrogenases.
  • glycerol dehydrogenase isolated from Hansenula ofunaensis has broad substrate specificity and is capable of catalyzing the oxidation of various ⁇ -hydroxy alcohols, including 1, 2-octane, as well as the reduction of various ⁇ -hydroxy ketones and ⁇ -keto ketones, including 3-hydroxy-2-butanone and 3, 4-hexanedione, with the activity comparable to its native substrates, glycerol and dihydroxyaceton, respectively (40 - 200%).
  • glycerol dehydrogenase discovered in Hansenula polumorpha DI-I works similarly.
  • a microbial system or recombinant microorganism may comprise a glycerol dehydrogenase gene isolated from Hansenula ofunaensis, a glycerol dehydrogenase isolated from Hansenula polumorpha DI-I and/or a meso-2,3-butane diol dehydrogenase from Klebsiella pneumoniae.
  • a microbial system or isolated microorganism may comprise a 4, 5, octanediol dehydrogenase, among others detailed herein.
  • Diol dehyodregnases may also be obtained from Lactobaccilus brevis ATCC 367, Pseudomanas putida KT2440, and Klebsiella pneumoniae MGH78578), as described herein ⁇ see Example 5).
  • Exemplary diol dehydrogenases include, but are not limited to, 2,3- butanediol dehydrogenase, 3,4-hexanediol dehydrogenase, 4,5-octanediol dehydrogenase, 5,6-decanediol dehydrogenase, 6,7-dodecanediol dehydrogenase, 7,8- tetradecanediol dehydrogenase, 8,9-hexadecanediol dehydrogenase, 2,5-dimethyl-3,4- hexanediol dehydrogenase, 3,6-dimethyl-4,5-octanediol dehydrogenase, 2,7-dimethyl- 4,5-octanediol dehydrogenase, 2,9-dimethyl-5,6-decanediol dehydrogenase, 1,4- diphen
  • a selected diol dehydrogenase enzyme may have one or more of the above exemplified diol dehydrogenase activities, such as a 2,3- butanediol dehydrogenase activity, a 3,4-hexanediol dehydrogenase activity, and/or a 4,5-octanediol dehydrogenase activity, among others.
  • a recombinant microorganism may comprise a diol dehydrogenase encoded by a nucleotide reference sequence selected from SEQ ID NO:97, 99, and 101, or an enzyme having a polyeptide sequence selected from SEQ ID NO:98, 100, and 102, including biologically active fragments or variants thereof, such as optimized variants. Certain aspects may also comprises nucleotide sequences or polypeptide sequences having 80%, 85%, 90%, 95%, 97%, 98%, 99% sequence identity to SEQ ID NOS:97-102.
  • inventions may comprise re-designed diol dehydrogenases for reduction of 1 -hydroxy propanal, succinicaldehyde, and glutaraldehyde to 1,3- propanediol, 1,4-butanediol, and 1,5 pentanediol, respectively, among others.
  • a dehydration and reduction pathway may comprise one or more diol dehydratases.
  • a "diol dehydratase” refers generally to an enzyme that catalyzes the the irreversible dehydration of diols. For instance, this enzyme may serve to dehydrate octanediol to form 4-octane. It has been recognized that there are at least two different types of diol dehydratases: a group dependent on and independent of coenzyme B12 for its catalysis. Coenzyme B 12 dependent diol dehydratases are known to catalyze a radical mediated dehydration reaction from ⁇ - hydroxy alcohol to aldehydes or ketones.
  • a diol dehydratase from Klebsiella pneumoniae catalyzes the dehydration of glycerol to form ⁇ -hydroxypropyl aldehyde, accepts 2,3-butanediol as a substrate, and catalyzes the dehydration reaction to form 2-butanone.
  • Clostridium butylicum contains coenzyme B12 independent diol dehydratases.
  • Figure 46 shows the in vivo biological activity of coenzyme B12 independent diol dehydratase (dhaBl) and activator (dhaBI) islolated from Clostridium butylicum (see Example 9).
  • 46A shows the in vivo production of 1- propanol from 1,2-propanediol
  • Figure 46B shows the in vivo production of 2-butanol from meso-2,3 butanediol
  • Figure 46C shows the in vivo production of cyclopentanone from trans-l ⁇ -cyclopentanediol.
  • certain embodiments of the present invention may comprise optimized or redesigned diol dehydratases that accommodate various substrates, such as 4,5-octanediol as a substrate, and may include diol dehydratases isolated and/or optimized from Klebsiella pneumoniae and Clostridium butylicum, among other organisms described herein and known in the art.
  • Exemplary diol dehydratases include, but are not limited to, 2,3- butanediol dehydratase, 3,4-hexanediol dehydratase, 4,5-octanediol dehydratase, 5,6- decanediol dehydratase, 6,7-dodecanediol dehydratase, 7,8-tetradecanediol dehydratase, 8,9-hexadecanediol dehydratase, 2,5-dimethyl-3,4-hexanediol dehydratase, 3,6- dimethyl-4,5-octanediol dehydratase, 2,7-dimethyl-4,5-octanediol dehydratase, 2,9- dimethyl-5,6-decanediol dehydratase, l,4-diphenyl-2,3-butanediol dehydrat
  • a selected diol dehydratase enzyme may have one or more of the above exemplified diol dehydratase activities, such as a 2,3-butanediol dehydratase activity, a 3,4-hexanediol dehydratase activity, and/or a 4,5-octanediol dehydratase activity, among others.
  • diol dehydratases may be obtained from Klebsiella pneumoniae MGH 78578, including from the pduCDE gene of this and other microorganisms.
  • a recombinant microorganism may comprise one or more diol dehydratases encoded by a nucleotide reference sequence selected from SEQ ID NO: 103, 105, and 107, or an enzyme having a polyeptide sequence selected from SEQ ID NO: 104, 106, and 108, including biologically active fragments or variants thereof, such as optimized variants. Certain aspects may also comprises nucleotide sequences or polypeptide sequences having 80%, 85%, 90%, 95%, 97%, 98%, 99% sequence identity to SEQ ID NOS: 103-108.
  • polypeptides of SEQ ID NO: 104 may comprise certain conserved amino acid residues, including those chosen from D149, P151, A155, A159, G165, E168, E170, A183, G189, G196, Q200, E208, G215, Y219, E221, T222, S224, Y226, G227, T228, F232, G235, D236, D237, T238, P239, S241, L245, Y249, S251, R252, G253, K255, R257, S260, E265, M268, G269, S275, Y278, L279, E280, C283, G291, Q293, G294, Q296, N297, G298, G312, E329, S341, R344, G356, D371, N372, F374, S377, R392, D393, R412, L477, A486, G499, D500, S516, N522, D523, Y
  • a diol dehydratase may include a polypeptide that comprises an amino acid sequence having 0%, 85%, 90%, 95%, 97%, 98%, 99% sequence identity to SEQ ID NOS:308-311.
  • SEQ ID NO:308 shows the polypeptide sequence of PduG, a diol dehydratase reactivation large subunit derived from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • SEQ ID NO:309 shows the polypeptide sequence of PduH, diol dehydratase reactivation small subunit derived from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • SEQ ID NO:310 shows the polypeptide sequence of a B12-independent glycerol dehydratase from Clostridium Butyricum.
  • SEQ ID NO:311 shows the polypeptide sequence of a glycerol dehydratase activator from Clostridium Butyricum.
  • a B12-independent glycerol dehydratase may comprise conserved amino acid residues, such as T36, G74, P87, E88, E97, W126, R221, A263, Q265, R287, D289, E309, R317, G335, G345, G346, N356, P374, R379, G399, G401, P403, D408, G432, C433, N452, C529, G533, G539, G540, S559, G603, N604, A654, G658, R659, D676, N702, Q735, N737, A747, P751, R760, V761, A762, G763, Q776, 1780, and/or R782.
  • conserved amino acid residues such as T36, G74, P87, E88, E97, W126, R221, A263, Q265, R287, D289, E309, R317, G335, G345, G346, N356,
  • a B12-independent glycerol dehydratase activator may comprise certain conserved amino acid residues, including Dl 9, G20, G22, R24, F28, G31, C32, C36, W38, C39, N41, P42, C58, C64, C96, G129, Tl 32, Gl 35, Gl 36, Dl 85, Rl 87, N208, R222, and/or R264.
  • a dehydration and reduction pathway may comprise one or more alcohol dehydrogenases or secondary alcohol dehydrogenases.
  • An "alcohol dehydrogenase” or “secondary alcohol dehydrogenase” that is part of a dehydration and reduction pathway refers generally to an enzyme that catalyzes the conversion of aldehyde or ketone substituents to alcohols. For instance, 4-octanone may be reduced to 4-octanol by a secondary alcohol dehydrogenase one enzymatic step for the conversion of butyroin to a biofuel.
  • Pseudomonads express at least one secondary alcohol dehydrogenase that oxidizes 4-octanol to 4-octanone using NAD + as a co-factor.
  • Rhodococcus erythropolis ATCC4277 catalyzes oxidation of medium to long chain secondary fatty alcohols using NADH as a co-factor, using an enzyme that also catalyzes the oxidation of 3-decanol and 4-decanol.
  • Norcadia fusca AKU2123 contains an (S)-specific secondary alcohol dehydrogenase.
  • Genes encoding secondary alcohol dehydrogenases may be isolated from these and other organisms according to known techniques in the art and incorporated into the microbial systems recombinant organisms as described herein.
  • a microbial system or isolated microorganism may comprise natural or optimized secondary alcohol dehydrogenases from Pseudomonads, Rhodococcus erythropolis ATCC4277, Norcadia fusca AKU2123, or other suitable organisms.
  • secondary alcohol dehydrogenases include, but are not limited to, 2-butanol dehydrogenase, 3-hexanol dehydrogenase, 4-octanol dehydrogenase, 5-decanol dehydrogenase, 6-dodecanol dehydrogenase, 7-tetradecanol dehydrogenase, 8-hexadecanol dehydrogenase, 2,5-dimethyl-3-hexanol dehydrogenase, 3,6-dimethyl-4-octanol dehydrogenase, 2,7-dimethyl-4-octanol dehydrogenase, 2,9- dimethyl-4-decanol dehydrogenase, 1 ,4-diphenyl-2-butanol dehydrogenase, bis-l,4-(4- hydroxyphenyl)-2-butanol dehydrogenase, 1 ,4-diindole-2
  • a selected alcohol dehydrogenase or secondary alcohol dehydrogenase may have one or more of the above exemplified alcohol dehydrogenase activities, such as a 2-butanol dehydrogenase activity, 3-hexanol dehydrogenase activity, and/or a 4-octanol dehydrogenase activity, among others.
  • a recombinant microorganism may comprise one or more secondary alcohol dehydrogenases encoded by a nucleotide reference sequence selected from SEQ ID NO: 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, and 141, or an enzyme having a polyeptide sequence selected from SEQ ID NO:110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, and 142, including biologically active fragments or variants thereof, such as optimized variants. Certain aspects may also comprises nucleotide sequences or polypeptide sequences having 80%, 85%, 90%, 95%, 97%, 98%, 99% sequence identity to SEQ ID NOS: 109- 142.
  • SEQ ID NO: 109 is the nucleotide sequence and SEQ ID NO:110 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh- ⁇ : PP l 946) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO:111 is the nucleotide sequence and SEQ ID NO:112 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-2: PP l 817) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO:113 is the nucleotide sequence and SEQ ID NO:114 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-3: PP l 953) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO: 115 is the nucleotide sequence and SEQ ID NO:116 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-4: PP_3037) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO:117 is the nucleotide sequence and SEQ ID NO:118 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-5: PP l 852) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO:119 is the nucleotide sequence and SEQ ID NO: 120 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-6: PP_2723) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO: 121 is the nucleotide sequence and SEQ ID NO: 122 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-7: PP 2002) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO: 123 is the nucleotide sequence and SEQ ID NO: 124 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-S: PP l 914) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO: 125 is the nucleotide sequence and SEQ ID NO: 126 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-9: PP l 914) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO: 127 is the nucleotide sequence and SEQ ID NO: 128 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-10: PP 3926) isolated from Pseudomonas putida KT2440.
  • SEQ ID NO: 129 is the nucleotide sequence and SEQ ID NO: 130 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh- ⁇ ⁇ : PFL l 756) isolated from Pseudomonas fluorescens Pf-5.
  • SEQ ID NO: 131 is the nucleotide sequence and SEQ ID NO: 132 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh- ⁇ 2: KPN O 1694) isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • SEQ ID NO: 133 is the nucleotide sequence and SEQ ID NO: 134 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh- ⁇ 3: KPN 02061) isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • SEQ ID NO:135 is the nucleotide sequence and SEQ ID NO:136 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh- ⁇ 4: KPN 00827) isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • SEQ ID NO: 137 is the nucleotide sequence and SEQ ID NO: 138 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh- ⁇ 6: KPN 01350) isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • SEQ ID NO: 139 is the nucleotide sequence and SEQ ID NO: 140 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh- ⁇ 7: KPN 03369) isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • SEQ ID NO:141 is the nucleotide sequence and SEQ ID NO: 142 is the polypeptide sequence of a secondary alcohol dehydrogenase (2adh-l8: KPN_03363) isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578.
  • an alcohol dehydrogenase e.g., DEHU hydrogenase
  • a secondary alcohol dehydrogenase (2ADH) a fragment, variant, or derivative thereof, or any other enzyme that utilizes such an active site
  • the NAD+, NADH, NADP+, or NADPH binding motif may be selected from the group consisting of Y-X-G-G-X-Y, Y-X-X-G-G-X-Y, Y-X-X-X-G-G-X-Y, Y-X-G-X-Y, Y-X-X-G- G-X-X-Y, Y-X-X-X-G-X-X-Y, Y-X-G-X-Y, Y-X-X-G-X-Y, Y-X-X-X-G-X-Y, and Y- X-X-X-G-X-Y; wherein Y is independently selected from alanine, glycine, and serine, wherein G is glycine, and wherein X is independently selected from a genetically encoded amino acid.
  • ⁇ - hydroxy cyclopentanone may be reduced to 1,2-cyclopentanediol.
  • the glycerol dehydrogenase isolated from Hansenula ofunaensis favors the reduction of ⁇ - hydroxy ketones and ⁇ -keto ketones, and has very broad substrate specificity.
  • the similar alcohol dehydrogenase derived from Hansenula polumorpha and meso-2,3- butanediol dehydrogenase has similar properties.
  • Certain embodiments may incorporate a 1 ,2-cyclopentanediol dehydrogenase to the microbial system or isolated microorganism.
  • Other embodiments may incorporate a glycerol dehydrogenase from Hansenula ofunaensis, Hansenula polumorpha, Klebsiella pneumonia, or any other suitable organism.
  • a chemical or hydrocarbon such as 1,2- cyclopentanediol may be dehydrated to form cyclopentanone as one enzymatic step in a reduction and dehydration pathway.
  • diol dehydratases that may catalyze dehydration of chemicals such as 1,2-cyclopentanediol.
  • Certain embodiments of microbial system comprising a reduction and dehydration pathway will comprise diol dehydratases such as 1 ,2-cyclopentanediol dehydratase.
  • the conversion of such exemplary chemicals as ⁇ -hydroxy cyclopentanone to cyclopentanol may include the reduction of cyclopentanone to cyclopentanol.
  • This step may be catalyzed by cyclopentanol dehydrogenase, which is found in Comomonas sp. strain NCIMB 9872 and its gene (cpnA) has been isolated.
  • cyclopentanol dehydrogenase which is found in Comomonas sp. strain NCIMB 9872 and its gene (cpnA) has been isolated.
  • Certain embodiments of a microbial system or isolated microorganism may comprise a cyclopentanol dehydrogenase, such as that expressed by cpnA in Comomonas sp. strain NCIMB 9872, among others described herein.
  • selected C-C ligation pathways may be utilized in combination with selected components or enzymes of a reduction and dehydration pathway to produce a commodity chemical, or intermediate thereof.
  • certain embodiments include a method wherein the C-C ligation pathway may comprise an acetoaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,3-butanediol dehydrogenase, a 2,3-butanediol dehydratase, and a 2-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a propionaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,4-hexanediol dehydrogenase, a 3,4-hexanediol dehydratase, and a 3-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 4,5-octanediol dehydrogenase, a 4,5-octanediol dehydratase, and a 4-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 5,6-decanediol dehydrogenase, a 5,6-decanediol dehydratase, and a 5-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 6,7-dodecanediol dehydrogenase, a 6,7-dodecanediol dehydratase, and a 6-dodecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 7,8-tetradecanediol dehydrogenase, a 7,8-tetradecanediol dehydratase, and a 7-tetradecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 8,9-hexadecanediol dehydrogenase, a 8,9-hexadecanediol dehydratase, and a 8-hexadecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise an isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,5-dimethyl-3,4-hexanediol dehydrogenase, a 2,5- dimethyl-3,4-hexanediol dehydratase, and a 2,5-dimethyl-3-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a 2-methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,6-dimethyl-4,5-octanediol dehydrogenase, a 3,6-dimethyl-4,5-octanediol dehydratase, and a 3,6-dimethyl-4- octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a 3 -methyl -butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,7-dimethyl-4,5- octanediol dehydrogenase, a 2,7-dimethyl-4,5-octanediol dehydratase, and a 2,7- dimethyl-4-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a 3 -methyl -butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,9-dimethyl-5,6-decanediol dehydrogenase, a 2,9-dimethyl-4,5-decanediol dehydratase, and a 2,9-dimethyl-4- decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l,4-diphenyl-2,3-butanediol dehydrogenase, a l,4-diphenyl-2,3-butanediol dehydratase, and a 1 ,4-diphenyl-2- butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a bis-l,4-(4-hydroxyphenyl) -2,3- butanediol dehydrogenase, a bis-l,4-(4-hydroxyphenyl) -2,3-butanediol dehydratase, and a bis-l,4-(4-hydroxyphenyl)-2-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l,4-diindole-2,3-butanediol dehydrogenase, a 1,4-diindole- 2,3-butanediol dehydratase, and a 1 ,4-diindole-2-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise an ⁇ -keto adipate carboxylase, and wherein the reduction and dehydration pathway may comprise at least one of a 1, 2-cyclopentanediol dehydrogenase, a 1 , 2-cyclopentanediol dehydratase, and a cyclopentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/propiondehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,3- pentanediol dehydrogenase, a 2,3-pentanediol dehydratase, and a 2( or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,3- hexanediol dehydrogenase, a 2,3-hexanediol dehydratase, and a 2( or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,3- heptanediol dehydrogenase, a 2,3-heptanediol dehydratase, and a 2( or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/hexaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,3-octanediol dehydrogenase, a 2,3-octanediol dehydratase, and a 2( or 3)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/octaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,3-nonanediol dehydrogenase, a 2,3-nonanediol dehydratase, and a 2( or 3)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 4- methyl-2,3-pentanediol dehydrogenase, a 4-methyl-2,3-pentanediol dehydratase, and a 4-methyl-2(or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/2- methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 4-methyl-2,3-hexanediol dehydrogenase, a 4-methyl-2,3- hexanediol dehydratase, and a 4-methyl-2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/3 -methyl -butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 5- methyl-2,3-hexanediol dehydrogenase, a 5-methyl-2,3-hexanediol dehydrogenase, and a 5-methyl-2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/4- methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 6-methyl-2,3-heptanediol dehydrogenase, a 6-methyl-2,3- heptanediol dehydrogenase, and a 6-methyl-2(or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -phenyl -2,3-butanediol dehydrogenase, a 1 -phenyl -2,3-butanediol dehydratase, and a 1 -phenyl -2(or 3)-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/4- hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -(4-hydroxyphenyl) -2,3-butanediol dehydrogenase, a 1 -(4-hydroxyphenyl) -2,3-butanediol dehydratase, and a 1 -(4-hydroxyphenyl)-2(or 3)- butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an acetoaldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -indole -2,3-butanediol dehydrogenase, a 1 -indole -2,3-butanediol dehydratase, and a 1-indole- 2(or 3)-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,4-heptanediol dehydrogenase, a 3,4-heptanediol dehydratase, and a 3( or 4)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,4- octanediol dehydrogenase, a 3,4-octanediol dehydratase, and a 3( or 4)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/hexaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,4- nonanediol dehydrogenase, a 3,4-nonanediol dehydratase, and a 3( or 4)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/heptaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,4- decanediol dehydrogenase, a 3,4-decanediol dehydratase, and a 3( or 4)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/octaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,4- undecanediol dehydrogenase, a 3,4-undecanediol dehydratase, and a 3( or 4)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/ isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-3,4-hexanediol dehydrogenase, a 2-methyl-3,4-hexanediol dehydratase, and a 2- methyl-3( or 4)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/2- methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 5-methyl-3,4-heptanediol dehydrogenase, a 5-methyl-3,4- heptanediol dehydratase, and a 5-methyl-3(or 4)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/3-methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 6- methyl-3,4-heptanediol dehydrogenase, a 6-methyl-3,4-heptanediol dehydratase, and a 6-methyl-3(or 4)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/4- methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 7-methyl-3,4-octanediol dehydrogenase, a 7-methyl-3,4- octanediol dehydratase, and a 7-methyl-3(or 4)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde and a phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -phenyl -2,3-pentanediol dehydrogenase, a 1 -phenyl -2,3-pentanediol dehydratase, and a 1 -phenyl -2(or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehydeM-hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-(4-hydroxyphenyl) -2,3- pentanediol dehydrogenase, a l-(4-hydroxyphenyl)-2,3-pentanediol dehydratase, and a 1 -(4-hydroxyphenyl)-2(or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a propionaldehyde/indoleacetoaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1- indole-2,3-pentanediol dehydrogenase, a l-indole-2,3-pentanediol dehydratase, and a 1- indole-2(or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 4,5-nonanediol dehydrogenase, a 4,5-nonanediol dehydratase, and a 4( or 5)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/hexaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 4,5-decanediol dehydrogenase, a 4,5-decanediol dehydratase, and a 4( or 5)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/heptaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 4,5-undecanediol dehydrogenase, a 4,5-undecanediol dehydratase, and a 4( or 5)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/octaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 4,5-dodecanediol dehydrogenase, a 4,5-dodecanediol dehydratase, and a 4( or 5)-dodecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-3,4-heptanediol dehydrogenase, a 2-methyl-3,4-heptanediol dehydratase, and a 2-methyl-3( or 4)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/2 -methyl -butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3- methyl-4,5-octanediol dehydrogenase, a 3-methyl-4,5-octanediol dehydratase, and a 3- methyl-4(or 5)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/3- methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2-methyl-4,5-octanediol dehydrogenase, a 2-methyl-4,5- octanediol dehydratase, and a 2-methyl-4(or 5)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/4-methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of an 8- methyl-4,5-nonanediol dehydrogenase, an 8-methyl-4,5-nonanediol dehydratase, and an 8-methyl-4(or 5)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-phenyl-2,3-hexanediol dehydrogenase, a 1- phenyl -2,3-hexanediol dehydratase, and a 1 -phenyl -2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/4-hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -(4-hydroxyphenyl) -2,3-hexanediol dehydrogenase, a 1 -(4-hydroxyphenyl) -2,3- hexanediol dehydratase, and a 1 -(4-hydroxyphenyl) -2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a butyraldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-2,3- hexanediol dehydrogenase, a l-indole-2,3-hexanediol dehydratase, and a 1 -indole-2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/hexaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 5,6-undecanediol dehydrogenase, a 4,5-undecanediol dehydratase, and a 4( or 5)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/heptaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 5,6-undecanediol dehydrogenase, a 5,6-undecanediol dehydratase, and a 5( or 6)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/octaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 5,6-tridecanediol dehydrogenase, a 5,6-tridecanediol dehydratase, and a 5( or 6)-tridecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-3,4-octanediol dehydrogenase, a 2-methyl-3,4-octanediol dehydratase, and a 2- methyl-3( or 4)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/2-methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3- methyl-4,5-nonanediol dehydrogenase, a 3-methyl-4,5-nonanediol dehydratase, and a 3- methyl-4(or 5)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/3- methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2-methyl-4,5-nonanediol dehydrogenase, a 2-methyl-4,5- nonanediol dehydratase, and a 2-methyl-4(or 5)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/4-methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-5,6-decanediol dehydrogenase, a 2-methyl-5,6-decanediol dehydratase, and a 2- methyl-5(or 6)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-phenyl-2,3-heptanediol dehydrogenase, a 1- phenyl -2,3-heptanediol dehydratase, and a 1 -phenyl -2(or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/4-hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -(4-hydroxyphenyl) -2,3-heptanediol dehydrogenase, a 1 -(4-hydroxyphenyl) -2,3- heptanediol dehydratase, and a 1 -(4-hydroxyphenyl) -2(or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a pentaldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-2,3- heptanediol dehydrogenase, a l-indole-2,3-heptanediol dehydratase, and a l-indole-2(or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/heptaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 6,7-tridecanediol dehydrogenase, a 6,7-tridecanediol dehydratase, and a 6( or 7)-tridecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/octaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 6,7-tetradecanediol dehydrogenase, a 6,7-tetradecanediol dehydratase, and a 6( or 7)-tetradecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-3,4-nonanediol dehydrogenase, a 2-methyl-3,4-nonanediol dehydratase, and a 2- methyl-3( or 4)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/2- methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3-methyl-4,5-decanediol dehydrogenase, a 3-methyl-4,5- decanediol dehydratase, and a 3-methyl-4(or 5)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/3-methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-4,5-decanediol dehydrogenase, a 2-methyl-4,5-decanediol dehydratase, and a 2- methyl-4(or 5)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/4- methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2-methyl-5,6-undecanediol dehydrogenase, a 2-methyl-5,6- undecanediol dehydratase, and a 2-methyl-5(or 6)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 - phenyl-2,3-octanediol dehydrogenase, a 1 -phenyl -2,3-octanediol dehydratase, and a 1- phenyl -2(or 3)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/4- hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -(4-hydroxyphenyl) -2,3-octanediol dehydrogenase, a 1 -(4-hydroxyphenyl) -2,3-octanediol dehydratase, and a 1 -(4-hydroxyphenyl) -2(or 3)- octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a hexaldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 - indole-2,3-octanediol dehydrogenase, a l-indole-2,3-octanediol dehydratase, and a 1- indole-2(or 3)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/octaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 7,8-pentadecanediol dehydrogenase, a 7,8- pentadecanediol dehydratase, and a 7( or 8)-pentadecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-3,4-decanediol dehydrogenase, a 2-methyl-3,4-decanediol dehydratase, and a 2- methyl-3( or 4)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/2- methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3-methyl-4,5-undecanediol dehydrogenase, a 3-methyl-4,5- undecanediol dehydratase, and a 3-methyl-4(or 5)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/3 -m ethyl -butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-4,5-undecanediol dehydrogenase, a 2-methyl-4,5-undecanediol dehydratase, and a 2-methyl-4(or 5)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/4-methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2-methyl-5,6-dodecanediol dehydrogenase, a 2- methyl-5,6-dodecanediol dehydratase, and a 2-methyl-5(or 6)-dodecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1- phenyl-2,3-nonanediol dehydrogenase, a 1 -phenyl -2,3-nonanediol dehydratase, and a 1 -phenyl -2(or 3)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/4- hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -(4-hydroxyphenyl) -2,3-nonanediol dehydrogenase, a l-(4-hydroxyphenyl) -2,3-nonanediol dehydratase, and a 1 -(4-hydroxyphenyl) -2 (or 3)- nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a heptaldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1- indole-2,3-nonanediol dehydrogenase, a l-indole-2,3-nonanediol dehydratase, and a 1- indole-2(or 3)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an octaldehyde/isobutyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2-methyl-3,4-undecanediol dehydrogenase, a 2-methyl- 3,4-undecanediol dehydratase, and a 2-methyl-3( or 4)-undecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an octaldehyde/2 -methyl -butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3- methyl-4,5-dodecanediol dehydrogenase, a 3-methyl-4,5-dodecanediol dehydratase, and a 3-methyl-4(or 5)-dodecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an octaldehyde/3 -methyl -butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2-methyl-4,5-dodecanediol dehydrogenase, a 2- methyl-4,5-dodecanediol dehydratase, and a 2-methyl-4(or 5)-dodecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an octaldehyde/4-methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2- methyl-5,6-tridecanediol dehydrogenase, a 2-methyl-5,6-tridecanediol dehydratase, and a 2-methyl-5(or 6)-tridecanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an octaldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-phenyl-2,3-decanediol dehydrogenase, a 1- phenyl -2,3-decanediol dehydratase, and a 1 -phenyl -2(or 3)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an octaldehyde/4-hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1 -(4-hydroxyphenyl) -2,3-decanediol dehydrogenase, a 1 -(4-hydroxyphenyl) -2,3- decanediol dehydratase, and a 1 -(4-hydroxyphenyl) -2 (or 3)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an octaldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-2,3- decanediol dehydrogenase, a l-indole-2,3-decanediol dehydratase, and a 1 -indole-2(or 3)-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an isobutyraldehyde/2-methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,5-dimethyl-3,4-heptanediol dehydrogenase, a 2,5-dimethyl-3,4-heptanediol dehydratase, and a 2,5-dimethyl-3(or 4)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an isobutyraldehyde/3-methyl-butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,6-dimethyl-3,4-heptanediol dehydrogenase, a 2,6-dimethyl-3,4-heptanediol dehydratase, and a 2,6-dimethyl-3(or 4)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an isobutyraldehyde/4-methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,7- dimethyl-3,4-octanediol dehydrogenase, a 2,7-dimethyl-3,4-octanediol dehydratase, and a 2,7-dimethyl-3(or 4)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an isobutyraldehyde/ phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-phenyl-4-methyl-2,3-pentanediol dehydrogenase, a l-phenyl-4-methyl-2,3-pentanediol dehydratase, and a l-phenyl-4- methyl-2(or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an isobutyraldehyde/ A- hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-(4-hydroxyphenyl)-4-methyl-2,3-pentanediol dehydrogenase, a l-(4-hydroxyphenyl)-4-methyl-2,3-pentanediol dehydratase, and a 1- (4-hydroxyphenyl)-4-methyl-2(or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of an isobutyraldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-4-methyl-2,3-pentanediol dehydrogenase, a l-indole-4-methyl-2,3-pentanediol dehydratase, and a l-indole-4- methyl-2(or 3)-pentanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 2-methyl-butyraldehyde/3-methyl- butyraldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,6-dimethyl-4,5-octanediol dehydrogenase, a 2,6-dimethyl-4,5- octanediol dehydratase, and a 2,6-dimethyl-4(or 5)-octanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 2-methyl-butyraldehyde/4-methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 3,8-dimethyl-4,5- nonanediol dehydrogenase, a 3,8-dimethyl-4,5-nonanediol dehydratase, and a 3,8- dimethyl-4(or 5)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 2-methyl-butyraldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-phenyl-4-methyl-2,3-hexanediol dehydrogenase, a l-phenyl-4-methyl-2,3- hexanediol dehydratase, and a l-phenyl-4-methyl-2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 2-methyl-butyraldehyde/4-hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1- (4-hydroxyphenyl)-4-methyl-2,3-hexanediol dehydrogenase, a 1 -(4-hydroxyphenyl)-4- methyl-2,3-hexanediol dehydratase, and a 1 -(4-hydroxyphenyl)-4-methyl-2 (or 3)- hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 2-methyl-butyraldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-4-methyl-2,3-hexanediol dehydrogenase, a l-indole-4-methyl-2,3-hexanediol dehydratase, and a 1 -indole-4-methyl-2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 3-methyl-butyraldehyde/4-methyl-pentaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 2,8-dimethyl-4,5- nonanediol dehydrogenase, a 2,8-dimethyl-4,5-nonanediol dehydratase, and a 2,8- dimethyl-4(or 5)-nonanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 3-methyl-butyraldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-phenyl-5-methyl-2,3-hexanediol dehydrogenase, a l-phenyl-5-methyl-2,3- hexanediol dehydratase, and a 1 -phenyl-5-methyl-2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 3 -methyl -butyraldehyde/4-hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a 1- (4-hydroxyphenyl)-5-methyl-2,3-hexanediol dehydrogenase, a l-(4-hydroxyphenyl)-5- methyl-2,3-hexanediol dehydratase, and a l-(4-hydroxyphenyl)-5-methyl-2(or 3)- hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 3-methyl-butyraldehyde/indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-5-methyl-2,3-hexanediol dehydrogenase, a l-indole-5-methyl-2,3-hexanediol dehydratase, and a 1 -indole-5-methyl-2(or 3)-hexanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 4-methyl-pentaldehyde/phenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-phenyl-6-methyl-2,3- heptanediol dehydrogenase, a l-phenyl-6-methyl-2,3-heptanediol dehydratase, and a 1- phenyl-6-methyl-2(or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 4-methyl-pentaldehyde/4- hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-(4-hydroxyphenyl)-6-methyl-2,3-heptanediol dehydrogenase, a l-(4-hydroxyphenyl)-6-methyl-2,3-heptanediol dehydratase, and a 1- (4-hydroxyphenyl)-6-methyl-2(or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 4-methyl-pentaldehyde/Indoleacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-6-methyl-2,3- heptanediol dehydrogenase, a l-indole-6-methyl-2,3-heptanediol dehydratase, and a 1- indole-6-methyl-2(or 3)-heptanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a phenylacetaldehyde/4- hydroxyphenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-(4-hydroxyphenyl)-4-phenyl-2,3-butanediol dehydrogenase, a l-(4-hydroxyphenyl)-4-phenyl-2,3-butanediol dehydratase, and a 1- (4-hydroxyphenyl)-4-phenyl-2(or 3)-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a phenylacetaldehyde/indolephenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-4-phenyl-2,3-butanediol dehydrogenase, a l-indole-4-phenyl-2,3-butanediol dehydratase, and a l-indole-4- phenyl-2(or 3)-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise at least one of a 4- hydroxyphenylacetaldehyde/indolephenylacetaldehyde lyase and wherein the reduction and dehydration pathway may comprise at least one of a l-indole-4-(4-hydroxyphenyl)- 2,3-butanediol dehydrogenase, a l-indole-4-(4-hydroxyphenyl)-2,3-butanediol dehydratase, and a 1 -indole-4-(4-hydroxyphenyl)-2(or 3)-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a 5-amino-pantaldehyde lyase, and wherein the reduction and dehydration pathway may comprise at least one of a l,10-diamino-5,6-decanediol dehydrogenase, a l,10-diamino-5,6-decanediol dehydratase, and a l,10-diamino-5-decanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a 4-hydroxyphenyl acetaldehyde lyase, and wherein the reduction and dehydration pathway may comprise at least one of a l,4-di(4- hydroxyphenyl)-2,3-butanediol, a l,4-di(4-hydroxyphenyl)-2,3-butanediol dehydratase, and a 1 ,4-di(4-hydroxyphenyl)-2-butanol dehydrogenase.
  • Additional embodiments include a method wherein the C-C ligation pathway may comprise a succinate semialdehyde lyase, and wherein the reduction and dehydration pathway may comprise at least one of a 2,3-hexanediol-l,6-dicarboxylic acid dehydrogenase, a 2,3-hexanediol- 1 ,6-dicarboxylic acid dehydratase, and a 2-hexanol-l,6-dicarboxylic dehydrogenase.
  • Certain embodiments of a microbial system or recombinant microorganism may comprise genes encoding enzymes that are able to catalyze (e.g., reduction and dehydration) the conversion of 4-octanol to octene or octane.
  • Other embodiments may comprise redesigned or de novo designed enzymes for this reduction and dehydration pathway.
  • three redesigned enzymes could convert A- octanone to either 3- and 4-octene.
  • the first step could be catalyzed by redesigned isocitrate dehydrogenase.
  • This enzyme could catalyze the formation of 4-hydroxy-3(or 5)-carboxylic octane.
  • the 4-hydroxy group could be phosphorylated by redesigned kinase.
  • redesigned mevalonate diphosphate decarboxylase catalyzes the formation of 3 (or 4)-octene.
  • several redesigned enzymes could convert A- octanone to octane.
  • the 4-hydroxy- 3 (or 5)-carboxylic octane is sequentially reduced and dehydrated to form 3(or 5)-carboxylic octane.
  • Redesigned enzymes involved in fatty acid metabolism can catalyze these reactions.
  • the 3(or 5)- carboxylic octane can be reduced to corresponding aldehyde by aldehyde dehydrogenase and the product may be decarbonylated to form octane catalyzed by a redesigned decarbonylase.
  • a biosynthesis pathway (e.g., aldehyde biosynthesis pathway) may optionally or further comprise one or more genes encoding a decarboxylase enzyme, such as an indole-3-pyruvate decarboxylase (IPDC), to produce an aldehyde.
  • IPDC indole-3-pyruvate decarboxylase
  • an IPDC may comprise an amino acid sequence that is at least 80%, 90%, 95%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO:312.
  • An IDPC enzyme may comprise certain conserved amino acid residues, such as G24, D25, E48, A55, R60, G75, E89, Hl 13, G252, G405, G413, G428, G430, and/or N456.
  • a recombinant microorganism may comprise an aldehyde reductase, such as a phenylacetoaldehyde reductase (PAR), to convert an aldehyde to a commodity chemical.
  • a PAR may comprise an amino acid sequence that is at least 80%, 90%, 95%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO:313, which shows the sequence of a PAR enzymed derived from Rhodococcus sp. ST-IO.
  • a PAR enzyme may comprise at least one of a nicotinamide adenine dinucleotide (NAD+), NADH, nicotinamide adenine dinucleotide phosphate (NADP+), or NADPH binding motif.
  • NAD+ nicotinamide adenine dinucleotide
  • NADP+ nicotinamide adenine dinucleotide phosphate
  • NADPH binding motif NADPH binding motif
  • the NAD+, NADH, N ADP+, or NADPH binding motif may be selected from the group consisting of Y-X-G-G-X-Y, Y-X-X-G-G-X-Y, Y-X-X-X-G- G-X-Y, Y-X-G-X-X-Y, Y-X-X-G-G-X-X-Y, Y-X-X-G-X-X-Y, Y-X-G-X-Y, Y-X-X-G-X-Y, Y-X-X-X-G-X-Y, and Y-X-X-X-X-G-X-Y; wherein Y is independently selected from alanine, glycine, and serine, wherein G is glycine, and wherein X is independently selected from a genetically encoded amino acid.
  • such a recombinant microorganism may also or alternatively comprise a secondary alcohol dehydrogenase having an activity selected from at least one of a phenylethanol dehydrogenase activity, a 4-hydroxyphenylethanol dehydrogenase activity, and an Indole-3-ethanol dehydrogenase activity, to reduce the aldehyde to its corresponding alcohol (e.g. 2-phenylethanol, 2-(4-hydroxyphenyl) ethanol, and indole-3-ethanol).
  • a secondary alcohol dehydrogenase having an activity selected from at least one of a phenylethanol dehydrogenase activity, a 4-hydroxyphenylethanol dehydrogenase activity, and an Indole-3-ethanol dehydrogenase activity, to reduce the aldehyde to its corresponding alcohol (e.g. 2-phenylethanol, 2-(4-hydroxyphenyl) ethanol, and indole-3-ethanol).
  • Embodiments of the present invention also include methods for converting a suitable monosaccharide to a commodity chemical comprising, (a) obtaining a suitable monosaccharide; (b) contacting the suitable monosaccharide with a microbial system for a time sufficient to convert to the suitable monosaccharide to the biofuel, wherein the microbial system comprises, (i) one or more genes encoding and expressing a fatty acid biosynthesis pathway, an amino acid biosynthetic pathway, and/or a short chain alcohol biosynthetic pathway; (ii) one or more genes encoding and expressing a keto-aci ⁇ decarboxylase, aldehyde dehydrogenase, and/or alcohol dehydrogenase ; and (iii) an enzymatic reduction pathway selected from (1) an enzymatic long chain alcohol reduction pathway, (2) an enzymatic decarbonylation pathway, (3) an enzymatic decarboxylation pathway, and (4) an enzymatic reduction pathway comprising (1)
  • Embodiments of the present invention may comprise one or more genes encoding and expressing enzymes in a fatty acid synthesis pathway, which may be used, as one example, to produce biofuels in the form of alkanes, such as medium to long chain alkanes.
  • the specificity of the fatty acid biosynthesis pathway in the microbial system may be recalibrated or redesigned.
  • microorganisms generally produce a mixture of long chain fatty acids (e.g., E. coli naturally produce large quantities of long chain fatty acids (C16-C19: ⁇ 95% in whole cells) and small quantity of medium chain fatty acids (C12: 2 % and C14: 5% in whole cells)).
  • the recalibration or re-engineering may be directed to increasing production of medium chain alkanes, including, but not limited to, caprylate (C8), caprate (ClO), laurate (C 12), myristate (C 14), and palmitate (C 16), as alkanes produced from these fatty acids are major components of gasoline, diesels, and kerosene.
  • medium chain alkanes including, but not limited to, caprylate (C8), caprate (ClO), laurate (C 12), myristate (C 14), and palmitate (C 16)
  • alkanes produced from these fatty acids are major components of gasoline, diesels, and kerosene.
  • other embodiments may be directed to increased production of long chain fatty acids, including, but not limited to, stearate (C 18), arachidonate (C20), behenate (C22) and longer fatty acids, as n-alkanes produced from these fatty acids are one of major components in heavy oils.
  • Cuphea mainly accumulate medium chain fatty acids as major components in their seed oils, and these compositions alter depending on species.
  • Cuphea pulcherrima accumulates caprylate (C8:0) 96 %
  • Cuphea koehneana accumulates caprate (Cl 0:0) 95.3 %
  • Cuphea polymorpha accumulates laurate (C12:0) 80.1%.
  • Embodiments of the microbial systems or isolated microorganisms according to the present application may incorporate genes from various Cuphea species encoding enzymes involved in a fatty acid biosynthesis pathway, and these microorganisms may be directed in part to the production of middle chain fatty acids.
  • acyl-acyl carrier protein (ACP) thioesterases derived from various species including Cuphea hookeriana, Cuphea palustris, Umbellularia californica, and Cinnamomum camphorum may be over-expressed in such microorganisms as E. coli, wherein the specific activity for the formation of each medium chain fatty acids, caprylate (C8), caprate (ClO), laurate (C 12), myristate (C 14), and palmitate (C 16) is improved over the wild type.
  • Certain embodiments may include other enzyme components involved in fatty acid biosynthesis as known to a person skilled in the arts, including, but not limited to, ACP and ⁇ -ketoacyl ACP synthase (KAS) IV.
  • Microbial systems and isolated microorganisms of the present application may also incorporate fatty aldehyde dehydrogenases to reduce fatty acids to fatty aldehydes.
  • fatty aldehyde dehydrogenases to reduce fatty acids to fatty aldehydes.
  • the conversion of fatty acids to fatty aldehydes may be catalyzed by medium and/or long chain fatty aldehyde dehydrogenases isolated from various suitable organisms.
  • Certain embodiments may incorporate, for example, a fatty aldehyde dehydrogenase derived from Vibrio harveyi.
  • Microbial systems and isolated microorganisms of the present application may also incorporate one or more enzymes that catalyze the conversion of fatty aldehydes to biofuels such as n-alkanes, including, for example, enzymes comprising an enzymatic long chain alcohol reduction pathway.
  • Certain embodiments may incorporate genes from various other sources that encode enzymes capable of catalyzing the reduction and dehydration of fatty acids to biofuels, such as alkanes.
  • bacterial strain HD-I is able to produce biofuels, such as n-alkanes, with various chain lengths, and also produces both odd and even numbered alkanes.
  • Certain embodiments of the microbial systems and recombinant microorganisms provided herein may incorporate the HD-I genes encoding the enzymes involved in this pathway.
  • embodiments of the present invention may include a redesigned isocitrate dehydrogenase, which may catalyze the formation of 2-carboxy-l -alcohols.
  • the 2-carboxy-l -alcohols may be sequentially reduced and dehydrated to form 2-carboxy-alkanes, which may be catalyzed by redesigned enzymes involved in fatty acid metabolism.
  • the 2-carboxy- alkanes can be reduced to corresponding aldehyde by aldehyde dehydrogenase and then decarbonylated to form n-alkanes catalyzed by the redesigned decarbonylase as discussed below.
  • Certain embodiments of these microbial systems may produce either even numbered ⁇ -alkanes, odd numbered n-alkanes, or both.
  • Certain embodiments of the present application may incorporate the genes encoding enzymes catalyzing decarbonylation, or an enzymatic decarbonylation pathway.
  • green colonial alga Botyrococcus braunii, race A produces linear odd-numbered C27, C29, and C31 hydrocarbons that total up to 32 % of the alga's dry weight.
  • Microsomal preparations of this organism have decarbonylation activity.
  • This decarbonylase from B. braunii culture is a cobalt-protoporphyrin IX containing enzyme.
  • Certain microbial systems of isolated microorganisms may incorporate the gene encoding fatty aldehyde decarbonylase from Botyrococcus braunii.
  • Other embodiments may include redesigned decarbonylase enzymes, for example, wherein the N-terminal membrane sequence is substituted.
  • the functional activity of a similar enzyme, cytochrome P450 containing Fe-protopolphyrin IX (heme) is improved by substituting N-terminal membrane associated sequence, and the functional activity of decarbonylases of the present microbial systems may comprise similar substitutions or improvements.
  • inventions may incorporate the genes encoding a Co-porphyrin synthase.
  • decarbonylase enzymes may use Co-protoporphyrin IX as a co-factor, and Clostridium tetranomorphum is able to incorporate cobalt into incubated protopolphyrin IX.
  • Certain embodiments may incorporate the Co-porphyrin synthase from Clostridium tetranomorphum, or from other suitable microorganisms.
  • Other embodiments may incorporate de novo designed decarbonylation enzymes using inorganic metals such as Co 2+ , Fe 2+ , and Ni 2+ as catalysts.
  • Certain embodiments may comprise genes encoding the enzymes responsible for the formation of alkenes, or an enzymatic decarboxylation pathway. These genes may be derived or isolated from various sources, such as higher plants and insects. For example, higher plants such as germinating safflower (Carthamus tinctorius L.) produce a number of odd numbered 1 -alkenes, including 1 -pentadecene, 1 -heptadecene, 1,8-heptadecadiene and 1,8,11 -heptadecatriene besides about 80-90 % 1,8,11,14-heptadecatetraene by decarboxylation from their corresponding fatty acids. Certain embodiments may incorporate the genes from higher plants such as Carthamus tinctorius.
  • Other embodiments may incorporate the genes encoding the enzymes responsible for the formation of alkenes (e.g., an enzymatic decarboxylation pathway) from microorganisms, including, but not limited to, such as bacterial strain DH-I.
  • bacterial strain DH-I produces n-alkenes in addition to n-alkanes.
  • Other embodiments may incorporate the genes from de novo designed enzymes for an enzymatic decarboxylation pathway.
  • these redesigned enzymes convert ⁇ -hydroxy fatty acids to rc-alkenes.
  • the first step is catalyzed by a redesigned kinase, which catalyzes the phosphorylation of a ⁇ -hydroxy group.
  • a redesigned mevalonate diphosphate decarboxylase then catalyzes the formation of n- alkenes, such as n-1-alkene.
  • a microorganism is a eukaryotic or prokaryotic microorganism.
  • a microrganism is a yeast, such as S. cerevisiae.
  • a microorganism is a bacteria, such as a gram-positive bacteria or a gram-negative bacteria. Given its rapid growth rate, well-understood genetics, the variety of available genetic tools, and its capability in producing heterologous proteins, genetically modified E.
  • coli may be used in certain embodiments of a microbial system as described herein, whether for the degradation amd metabolism of a polysaccharide, such as alginate or pectin, or the formation or biosynthesis of commodity chemicals, such as biofuels.
  • a polysaccharide such as alginate or pectin
  • commodity chemicals such as biofuels.
  • Other microorganisms may be used according to the present invention, based in part on the compatibility of enzymes and metabolites to host organisms.
  • Acetobacter aceti Achromobacter, Acidiphilium, Acinetobacter, Actinomadura, Actinoplanes, Aeropyrum pernix, Agrobacterium, Alcaligenes, Ananas comosus (M), Arthrobacter, Aspargillus niger, AspargUlus oryze, Aspergillus melleus, Aspergillus pulverulentus, Aspergillus saitoi, Aspergillus sojea, Aspergillus usamii, Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus lentus, Bacillus licheniformis, Bacillus macerans, Bacillus stearothermophilus, Bacillus subtilis, Bifidobacterium, Brevibacillus brevis, Burkholderia cepacia, Candida
  • Wild type E. coli cannot use alginate polymer or degraded alginate as its sole carbon source (see Figure 4). Vibrio spectacularus, however, is known to be able to metabolize alginate to support growth. To generate recombinant E. coli that use degraded alginate as its sole carbon source, a Vibrio spectacularus fosmid library was constructed and cloned into E. coli.
  • Vibrio splendidus fosmid library genomic DNA was isolated from Vibrio Splendidus BOl (gift from Dr. Martin PoIz, MIT) using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). A fosmid library was then constructed using Copy Control Fosmid Library Production Kit (Epicentre, Madison, WI). This library consisted of random genomic fragments of approximately 40kb inserted into the vector pCClFOS (Epicentre, Madison, WI).
  • the fosmid library was packaged into phage, and E. coli DHlOB cells harboring a pDONR221 plasmid (Invitrogen, Carlsbad, CA) carrying certain Vibrio spectacularus genes (Vl 2B01 02425 to V12B01_02480; encoding a type II secretion apparatus; see SEQ ID NO:1) were transfected with the phage library.
  • This secretome region encodes a type II secretion apparatus derived from Vibrio spectacularus, which was cloned into a pDONR221 plasmid and introduced into E. coli strain DHlOB (see Example 1).
  • Transformants were selected for chloroamphenicol resistance and then screened for their ability to grow on degraded alginate. The resultant transformants were screened for growth on degraded alginate media.
  • Degraded alginate media was prepared by incubating 2% Alginate (Sigma- Aldrich, St. Louis, MO) 10 mM Na- Phosphate buffer, 50 mM KCl, 400 mM NaCl with alginate lyase from Flavobacterium sp. (Sigma-Aldrich, St. Louis, MO) at room temperature for at least one week.
  • This degraded alginate was diluted to a concentration of 0.8% to make growth media that had a final concentration of IX M9 salts, 2 mM MgSO4, 100 ⁇ M CaC12, 0.007% Leucine, 0.01% casamino acids, 1.5% NaCl (this includes all sources of sodium: M9, diluted alginate and added NaCl).
  • fosmid-containing E. coli clone was isolated that grew well on this media.
  • the fosmid DNA from this clone was isolated and prepared using FosmidMAX DNA Purification Kit (Epicentre, Madison,WI). This isolated fosmid was transferred back into DHlOB cells, and these cells were tested for the ability to grown on alginate.
  • the isolated fosmid sufficient to confer growth alginate as a sole source of carbon was sequenced by Elim Biopharmaceuticals (Hayward, CA) using the following primers: Uni R3 - GGGCGGCCGCAAGGGGTTCGCGTTGGCCGA (SEQ ID NO: 147) and PCClFOS uni_F -GGAGAAAAT ACCGCATCAGGCG (SEQ ID NO: 148). Sequencing showed that the vector contained a genomic DNA section that contained the full length genes V12B01 24189 to V12B01 24249 ⁇ see SEQ ID NOS:2- 64). SEQ ID NO:2 shows the nucleotide sequence of entire region between V12B01 24189 to V12B01 24249.
  • SEQ ID NOS:3-64 show the individual putative genes contained within SEQ ID NO:2.
  • the large gene V12B01 24184 is a putative protein with similarity to autotransporters and belongs to COG3210, which is a cluster of orthologous proteins that include large exoproteins involved in heme utilization or adhesion.
  • V12B01 24184 is N-terminally truncated such that the first 5893 bp are missing from the predicted open reading frame (which is predicted to contain 22889 bp in total).
  • Wild type E. coli is not capable of growing on pectin, di-, or tri- galacturonates as a sole source of carbon.
  • an E.coli strain BL21(DE3) harboring both the pBBRGaBP plasmid and the pTrcogl-kdgR plasmid was engineered and tested for the ability to grown on these polysaccharides.
  • the pBBRGaBP plasmid was engineered to contain certain genomic region oiErwinia carotovora subsp.
  • Atroseptica SCRI 1043 comprising several genes (kdgF, kdul, kduD, pelW, togM, togN, togA, togB, kdgM, andpaeX) encoding certain enzymes ⁇ kdul, kduD, ogl, pelW, andpaeX), transporters (togM, togN, togA, togB, and kdgM), and regulatory proteins (kdgR) responsible for the degradation of di- and trigalacturonate.
  • SEQ ID NO:65 shows the nucleotide sequence of the kdgF-PaeX region from Erwinia carotovora subsp.
  • Atroseptica SCRI 1043 was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 6 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CGGGATCC AAGTTGCAGGATATGACGAAAGCG-S ') (SEQ ID NO: 149) and reverse (5'- GCTCTAGA AGATTATCCCTGTCTGCGGAAGCGG-3') (SEQ ID NO: 150) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Erwinia carotovora subsp. Atroseptica SCRI 1043 genome (ATCC) in 50 ⁇ l.
  • NEB Phusion buffer
  • ATCC Atroseptica SCRI 1043 genome
  • the vector pBBRlMCS-2 was then amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72 0 C for 2.5 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- GCTCTAGA GGGGTGCCTAATGAGTGAGCTAAC-3') (SEQ ID NO:151) and reverse (5'- CGGGATCC GCGTTAATATTTTGTTAAAATTCGC-S') (SEQ ID NO: 152) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng pBBRlMCS-2 in 50 ⁇ l. Both amplified DNA fragments were digested with BamHI and Xbal and ligated.
  • the pTrcogl-kdgR plasmid was engineered to contain certain genomic regions of Erwinia carotovora subsp.
  • Atroseptica SCRI 1043 comprising two genes (ogl and kdgR) encoding an enzyme (ogl) and a regulatory protein (kdgR) responsible for degradation of di- and trigalacturonate.
  • SEQ ID NO:66 shows the nucleotide sequence of ogl-kdgR from Erwinia carotovora subsp.
  • Atroseptica SCRIl 043 shows the nucleotide sequence of ogl-kdgR from Erwinia carotovora subsp.
  • Atroseptica SCRI 1043 was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 4 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- GCTCTAGA GTTTATGTCGCACCCGCCGTTGG-3') (SEQ ID NO: 153) and reverse (5'- CCCAAGC TTAGAAAGGGAAATTGTGGTAGCCC-S') (SEQ ID NO: 154) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Erwinia carotovora subsp. Atroseptica SCRI 1043 genome (ATCC) in 50 ⁇ l. The amplified DNA fragment was digested with Xbal and HindIII and ligated into pTrc99A pre-digested with the same restriction enzymes.
  • the plasmids pBBRGal3P and pTrcogl-kdgR were co-transformed into E. coli strain BL21(DE3).
  • a single colony was inoculated into LB media containing 50 ug/ml kanamycin and 100 ug/ml ampicillin, and the culture was grown in incubation shaker with 200rpm at 37C.
  • 500 ul of culture was transferred to eppendorf tube and centrifuged to pellet the cells.
  • the cells were resuspended into50 ul of M9 media containing 2 mM MgSO 4 , 100 uM CaCl 2 , 0.4 % di- or trigalacturonate, and 5 ul of this solution was inoculated into 500 ul of fresh M9 media containing 2 mM MgSO 4 , 100 uM CaCl 2 , 0.4 % di- or trigalacturonate.
  • the culture was grown in incubation shaker with 200 rpm at 37 C.
  • E. coli strain DH5 ⁇ bacterial cells were engineered to contain both the pROU2 plasmid and the pPEL74 plasmid.
  • the pROU2 plasmid contains certain genomic regions of Erwinia chrysanthemi, comprising several genes (kdgF, kdul, kduD,pelW, togM, togN, togA, togB, kdgM, paeX, ogl, and kdgR ) encoding enzymes (kdul, kduD, ogl, pelW, and paeX), transporters (togM, togN, togA, togB, and kdgM), and regulatory proteins (kdgR) responsible for degradation of di- and trigalacturonate.
  • genes kdgF, kdul, kduD,pelW, togM, togN, togA, togB, kdgM, paeX, ogl, and kdgR
  • encoding enzymes kdul, kduD, ogl, pelW, and pa
  • the pPEL74 plasmid contains certain genomic regions of Erwinia chrysanthemi, comprising several genes (pelA, pelE, paeY, and pern) encoding pectate lyases (pel A andpelE), pectin acetyl esterases (paeY), and pectin methylesterase (pern).
  • E. coli DH5 ⁇ engineered with pROU2 and pPEL74 was able to grow on pectin as a sole source of carbon, showing that the genes contained within these plasmids are sufficient to confer this property on an organism that is otherwise incapable of growing on pectin as a sole source of carbon.
  • ADHs novel alcohol dehydrogenases
  • Alginate can be degraded by at least two different methodologies: enzymatic and chemical methodologies.
  • Atu3025 is an exolytically acting enzyme and yields DEHU from alginate polymer.
  • DEHU is converted to the common hexuronate metabolite, KDG. This reaction is catalyzed by alcohol dehydrogenases ⁇ e.g., DEHU hydrogenases).
  • mannuronate dehydrogenase mannuronate reductase activity.
  • mannonate dehydratase UxuA catalyzes dehydration from mannuronate to form KDG.
  • KDG is readily metabolized to form of pyruvate and glyceraldehydes-3- phosphate (G3P).
  • KDG is first phosphorylated to KDG-6-phosphate (KDGP), which is catalyzed by KDG kinase, and then broken down to pyruvate and G3P, which is catalyzed by KDGP aldolase.
  • KDGP KDG-6-phosphate
  • oligoalginate lyase Atu3025 derived from Agrobacterium tumefaciens C58.
  • pETAtu3025 was constructed based on pET29 plasmid backbone (Novagen).
  • the oligoalginate lyase Atu3025 was amplified by PCR: 98°C for 10 sec, 55°C for 15 sec, and 72°C for 60 sec, repeated for 30 times.
  • the reaction mixture contained 1 x Phusion buffer, 2 mM dNTP, 0.5 ⁇ M forward (5'- GGAATTCCATATGCGTCCCTCTGCCCCGGCC-3') (SEQ ID NO: 155) and reverse (5'- CGGGATCCTTAGAACTGCTTGGGAAGGGAG-S') (SEQ ID NO: 156) primers, 2.5 U Phusion DNA polymerase (Finezyme), and an aliquot of Agrobacterium tumefaciens C58 (gift from Professor Eugene Nester, University of Washington) cells as a template in total volume of 100 ⁇ l.
  • the amplified fragment was digested with Ndel and BamHI and ligated into pET29 pre-digested with the same enzymes using T4 DNA ligase to form pETAtu3025.
  • the constructed plasmid was sequenced (Elim Biophamaceuticals) and the DNA sequence of the insert was confirmed.
  • the nucleotide sequence of the Atu3025 insert is provided in SEQ ID NO:67.
  • the polypeptide sequence encoded by the Atu3025 insert is provided in SEQ ID NO:68.
  • the pETAtu3025 was transformed into Escherichia coli strain BL21(DE3).
  • a colony of BL21(DE3) containing pETAtu3025 was inoculated into 50 ml of LB media containing 50 ⁇ g/ml kanamycin (Km 50 ).
  • This strain was grown in an orbital shaker with 200 rpm at 37 °C.
  • the 0.2 mM IPTG was added to the culture when the OD 6 oonm reached 0.6, and the induced culture was grown in an orbital shaker with 200 rpm at 20 0 C.
  • the cells were harvested by centrifugation at 4,000 rpm x g for 10 min and the pellet was resuspended into 2 ml of Bugbuster (Novagen) containing 10 ⁇ l of LysonaseTM Bioprocessing Reagent (Novagen). The solution was again centrifuged at 4,000 rpm x g for 10 min and the supernatant was obtained.
  • Bugbuster Novagen
  • LysonaseTM Bioprocessing Reagent Novagen
  • DNA sequences of ADH1-12 of Agrobacterium tumefaciens C58 were amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (Table 1) and reverse (Table 1) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Agrobacterium tumefaciens C58 genome in 50 ⁇ l.
  • Amplified DNA fragment was digested with Ndel and BamHI and ligated into pET28 pre-digested with the same restriction enzymes.
  • ADHl-IO expression and Puricication of ADHl-IO. All plasmids were transformed into Escherichia coli strain BL21(DE3). The single colonies of BL21(DE3) containing respective alcohol dehydrogenase (ADH) genes were inoculated into 50 ml of LB media containing 50 ⁇ g/ml kanamycin (Km 50 ). These strains were grown in an orbital shaker with 200 rpm at 37 0 C. The 0.2 mM IPTG was added to each culture when the OD 60Omn reached 0.6, and the induced culture was grown in an orbital shaker with 200 rpm at 20 0 C.
  • ADH alcohol dehydrogenase
  • the cells were harvested by centrifugation at 4,000 rpm x g for 10 min and the pellet was resuspended into 2 ml of Bugbuster (Novagen) containing 10 ⁇ l of LysonaseTM Bioprocessing Reagent (Novagen). The solution was again centrifuged at 4,000 rpm x g for 10 min and the supernatant was obtained.
  • Bugbuster Novagen
  • LysonaseTM Bioprocessing Reagent Novagen
  • DEHU solution was enzymatically prepared.
  • a 2% alginate solution was prepared by adding 10 g of low viscosity alginate into the 500 ml of 20 mM Tris-HCl (pH7.5) solution.
  • An approximately 10 mg of alginate lyase derived from Flavobacterium sp. (purchased from Sigma-aldrich) was added to the alginate solution. 250 ml of this solution was then transferred to another bottle and the E. coli cell lysate containing Atu3025 prepared above section was added.
  • the alginate degradation was carried out at room temperature over night. The resulting products were analyzed by thin layer chromatography, and DEHU formation was confirmed.
  • D-mannuronate solution was chemically prepared based on the protocol previously described by Spoehr (Archive of Biochemistry, 14: ppl53-155). Fifty milligram of alginate was dissolved into 800 ⁇ L of ninety percent formate. This solution was incubated at 100 °C for over night. Formate was then evaporated and the residual substances were washed with absolute ethanol twice. The residual substance was again dissolved into absolute ethanol and filtrated. Ethanol was evaporated and residual substances were resuspended into 20 mL of 20 mM Tris-HCl (pH 8.0) and the solution was filtrated to make a D-mannuronate solution. This D-mannuronate solution was diluted 5-fold and used for assay.
  • Assay for DEHU hydrogenase To identify DEHU hydrogenase, a NADPH dependent DEHU hydrogenation assay was performed. 20 ⁇ l of prepared cell lysate containing each ADH was added to 160 ⁇ l of 20-fold deluted DEHU solution prepared in the above section. 20 ⁇ l of 2.5 mg/ml of NADPH solution (20 mM Tris- HCl, pH 8.0) was added to initiate the hydrogenation reaction, as a preliminary study using cell lysate of A. tumefaciens C58 have shown that DEHU hydrogenation requires NADPH as a co-factor.
  • D-mannuronate hydrogenase Assay for D-mannuronate hydrogenase. To identify D-mannuronate hydrogenase, a NADPH dependent D-mannuronate hydrogenation assay was performed. 20 ⁇ l of prepared cell lysate containing each ADH was added to 160 ⁇ l of D-mannuronate solution prepared in the above section. 20 ⁇ l of 2.5 mg/ml of NADPH solution (20 mM Tris-HCl, pH 8.0) was added to initiate the hydrogenation reaction. The consumption of NADPH was monitored an absorbance at 340 nm for 30 min using the kinetic mode of ThermoMAX 96 well plate reader (Molecular Devises). E. coli cell lysate containing alcohol dehydrogenase (ADH) 10 lacking a portion of N-terminal domain was used in a control reaction mixture.
  • ADH alcohol dehydrogenase
  • telomere sequence of kdgK of Escherichi coli encoding 2-&eto-deoxy gluconate kinase was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- AGGTACGGTGAAATAA AGGAGG ATATACAT
  • ATGTCCAAAAAGATTGCCGT -3' (SEQ ID NO:157) and reverse (5'- TTTTCCTTTTGCGGCCGCCCCGCTGGCATCGCCTCAC -3') (SEQ ID NO:158) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli DHlOB genome in 50 ⁇ l. Amplified DNA fragment was digested with Ndel and Notl and ligated into pET29 pre-digested with the same restriction enzymes.
  • telomere sequence of kdgA Escherichi coli encoding 2-keto- ⁇ Qoxy gluconate-6-phosphate aldolase was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- GGCGATGCCAGCGTAA AGGAGG ATATACAT ATGAAAAACTGGAAAACAAG -3') (SEQ ID NO:159) and reverse (5'- TTTTCCTTTTGCGGCCGCCCCAGCTTAGCGCCTTCTA -3') (SEQ ID NO: 160) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli DHlOB genome in 50 ⁇ l. Amplified DNA fragment was digested with Ndel and Notl and ligated into pET29 pre-digested with the same restriction enzymes.
  • All plasmids (pETAtu3025, pETADHl l, pETADH12, pETkdgA, pETkdgK, and pETuxuA) were transformed into Escherichia coli strain BL21(DE3).
  • the single colonies of BL21(DE3) containing respective plasmids were inoculated into 50 ml of LB media containing 50 ⁇ g/ml kanamycin (Km 50 ). These strains were grown in an orbital shaker with 200 rpm at 37 0 C.
  • the 0.2 mM IPTG was added to each culture when the OD 6 oo n m reached 0.6, and the induced culture was grown in an orbital shaker with 200 rpm at 20 0 C. 24 hours after the induction, the cells were harvested by centrifugation at 4,000 rpm x g for 10 min and the pellet was resuspended into 2 ml of Bugbuster (Novagen) containing 10 ⁇ l of LysonaseTM Bioprocessing Reagent (Novagen) and suggested amount of protease inhibitor cocktail (SIGMA). The solution was again centrifuged at 4,000 rpm x g for 10 min and the supernatant was obtained. The supernatant was applied to Nickel-NTA spin column (Qiagen) to purify His-tagged proteins.
  • the reaction mixture contained 1 % alginate or -0.5 % mannuronate, ⁇ 5ug of purified Atu3026 (ADH 12) or Atu3027 (ADHI l), and ⁇ 5ug of purified oligoalginate lyase (Atu3025), UxuA, KdgK, and KdgA, 2 mM of ATP, and 0.6 mM of NADPH in 2OmM Tris-HCl pH7.0.
  • the reaction was carried out over night and the pyruvate formation was monitored by the pyruvate assay kit (Bio Vision, Inc).
  • a propionaldehyde biosynthetic pathway comprising a threonine deaminase (ilvA) gene from Escherichia coli and keto-isovalerate decarboxylase (kivd) from Lactococcus lactis is constructed and tested for the ability to convert L-threonine to propionaldehyde.
  • ilvA threonine deaminase
  • Kivd keto-isovalerate decarboxylase
  • a butyraldehyde biosynthetic pathway comprising a thiolase ⁇ atoE) gene from E. coli, ⁇ -hydroxy butyryl-CoA dehydrogenase (hbd) ,crotonase (crt), butyryl- CoA dehydrogenase (bed), electron transfer flavoprotein A (etfA), and electron transfer fiavoprotein B (e(/B)genes from Clostridium acetobutyricum ATCC 824, and a coenzyme A-linked butyraldehyde dehydrogenase (aid) gene from Clostridium beijerinckii acetobutyricum ATCC 824 was constructed in E.
  • coli and tested for the ability to produce butyraldehyde.
  • a coenzyme A-linked alcohol dehydrogenase (adhET) gene from Clostridium acetobutyricum ATCC 824 was used as an alternative to aid and tested for the ability to produce butanol.
  • An isobutyraldehyde biosynthetic pathway comprising an acetolactate synthase (alsS) from Bacillus subtilis or (als) from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (codon usage was optimized for E. coli protein expression) and acetolactate reductoisomerase (UvC) and 2,3-dihydroxyisovalerate dehydratase (UvD), genes from E. coli and keto-isovalerate decarboxylase (kivd) from Lactococcus lactis was constructed and tested for the ability to produce isobutyraldehyde, as measured by isobutanal production.
  • alsS acetolactate synthase
  • UvC acetolactate reductoisomerase
  • UvD 2,3-dihydroxyisovalerate dehydratase
  • 3-methylbutyraldehyde and 2-methylbutyraldehyde biosynthesis pathways comprising an acetolactate synthase (alsS) from Bacillus subtilis or (als) from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (codon usage was optimized for E. coli protein expression), acetolactate reductoisomerase (UvQ, 2,3- dihydroxyisovalerate dehydratase (HvD), isopropylmalate synthase (LeuA), isopropylmalate isomerase (LeuC and LeuD), and 3 -isopropylmalate dehydrogenase (LeuB) genes from E. coli and keto-isovalerate decarboxylase (kivd) from Lactococcus lactis were constructed and tested for the ability to produce 3-isovaleraldehyde and 2- isovaleraldehyde.
  • Phenylacetoaldehyde and 4-hydroxyphenylacetoaldehyde biosynthesis pathways comprising a transketolase (tktA), a 3-deoxy-7-phosphoheptulonate synthase (aroF, aroG, and aroH), 3-dehydroquinate synthase (aroB), a 3-dehydroquinate dehydratase (aroD), a dehydroshikimate reductase (aroE), a shikimate kinase II (aroL), a shikimate kinase I (aroK), a 5-enolpyruvylshikimate-3-phosphate synthetase (aroA), a chorismate synthase (aroC), a fused chorismate mutase P/prephenate dehydratase (pheA), and a fused chorismate mutase T/prephenate dehydrogenase (tyr
  • keto-isovalerate decarboxylase (kivd) from Lactococcus lactis were constructed and tested for the ability to produce phenylacetoaldehyde and/or A- hydroxyphenylacetoaldehyde.
  • a 2-phenylethanol, 2-(4-hydroxyphenyl)ethanol, and 2-(indole-3- )ethanol biosynthesis pathway comprising a transketolase (tktA), a 3-deoxy-7- phosphoheptulonate synthase (aroF, aroG, and aroH), 3-dehydroquinate synthase (aroB), a 3-dehydroquinate dehydratase (aroD), a dehydroshikimate reductase (aroE), a shikimate kinase II (aroL), a shikimate kinase I (aroK), a 5-enolpyruvylshikimate-3- phosphate synthetase (aroA), a chorismate synthase (aroC), a fused chorismate mutase P/prephenate dehydratase (pheA), and a fused chorismate mutase T/prephenate
  • keto-isovalerate decarboxylase (kivd) from Lactococcus lactis, alcohol dehydrogenase (adh2) from Saccharomyces cerevisiae, Indole-3 -pyruvate decarboxylase ⁇ ipdc) from Azospirillum brasilense, phenyl ethanol reductase (par) from Rhodococcus sp. ST-IO, and benzaldehyde lyase (bal) from Pseudomonas fluorescence was constructed and tested for the ability to produce 2- phenylethanol, 2-(4-hydroxyphenyl)ethanol and/or 2-(indole-3)ethanol.
  • TTATTTTGAATAATCGTAGAAACC-S' SEQ ID NO: 162 primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Clostridium acetobutyricum ATCC 824 genome (ATCC) in 50 ⁇ l. Amplified DNA fragment was digested with BamHI and Xbal and ligated into pBAD33 pre-digested with the same restriction enzymes.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- GCTCTAGAGGAGGATATATATATGAAAAATTGTGTCATCGTC-S') (SEQ ID NO: 163) and reverse (5'-AA CTGCAGTTAATTCAACCGTTCAATCACC-3') (SEQ ID NO: 164) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli DHlOB genome in 50 ⁇ l. Amplified DNA fragment was digested with Xbal and Pstl and ligated into pBADButP pre-digested with the same restriction enzymes.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-CGAGCTC AGGAGGATATATATATGAAAAATTGTGTCATCGTCAGTG-S ') (SEQ ID NO:168) and reverse (5'-CCCAAGCTTAGCCGGCAAGTACACATCTTC-S') (SEQ ID NO: 169) primers, IU Phusion High Fidelity DNA polymerase (NEB).
  • the spliced fragment was digested with Sad and HindIII and ligated into pBADButP pre-digested with the same restriction enzymes.
  • pBADButP-atoB-ALD Construction of pBADButP-atoB-ALD.
  • PCR polymerase chain reaction
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-AAGGAAAAAAGCGGCCGCCCCTGAACCGACGACCGGGTCG-S') (SEQ ID NO:170) for fragment 1 and 5'- CGGGGTACCACTTTTCATACTCCCGCC ATTCAG-3' (SEQ ID NO:274) for fragment 2, and reverse (5'-
  • ACATGCATGCTTAACCCCCCAGTTTCGATT-S (SEQ ID NO: 176) for HvD) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli DHlOB genome (ATCC) in 50 ⁇ l.
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen). 5 ul from each DNA solution was combined and each DNA fragment was spliced by another round of PCR: 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 2 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • pneumoniae MGH 78578 of its codon usage optimized for over-expression in E.coli was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60°C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CCCGAGCTCAGGAGGATATATATATGGATAAACAGTATCCGGT-S') (SEQ ID NO:179) and reverse (5'-GCTCTAGATTACAGAATTTGACTCAGGT-S') (SEQ ID NO: 180) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng pETals in 50 ⁇ l.
  • the amplified DNA fragment was digested with Sad and Xbal and ligated into pBADilvCD pre-digested with the same restriction enzymes.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CCCGAGCTCAGGAGGATATATATATGTTGACAAAAGCAACAAAAG-S') (SEQ ID NO: 184) and reverse (5 ' -GCTCT AGATTAGAG AGCTTTCGTTTTC ATG- 3') (SEQ ID NO: 185) primers, IU Phusion High Fidelity DNA polymerase (NEB).
  • the spliced fragment was internal Xbal site free and thus was digested with Sad and Xbal and ligated into pBADilvCD pre-digested with the same restriction enzymes.
  • AAAACTGCAGCGTTTGATGACGTGGACGATAGCGG-3' (SEQ ID NO: 187) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli BL21(DE3) genome in 50 ⁇ l.
  • the amplified DNA fragment was digested with Sad and Xbal and ligated into pBAD33 pre-digested with the same restriction enzymes.
  • the DNA fragment 1 encoding leuA and leuB and the DNA fragment 2 encoding leuC and leuD of Escherichia coli BL21(DE3) were amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • AAAACTGCAGCGTTTGATGACGTGGACGATAGCGG-S') (SEQ ID NO:191) for fragment 2 primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli BL21(DE3) genome in 50 ⁇ l, respectively.
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen). 5 ul from each DNA solution was combined and each DNA fragment was spliced by another round of PCR: 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 3 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5 '-CGAGCTCAGGAGGATATATATATGAGCCAGC AAGTC ATTATTTTCG-3') (SEQ ID NO: 192) and reverse (5'-
  • AAAACTGCAGCGTTTGATGACGTGGACGATAGCGG-3' (SEQ ID NO: 193) primers, IU Phusion High Fidelity DNA polymerase (NEB).
  • the spliced fragment was digested with Sad and Xbal and ligated into pBAD33 pre-digested with the same restriction enzymes.
  • pBADLeuABCD4 The DNA fragments encoding leuA, leuB, leuC and leuD of Escherichia coli BL21(DE3) were amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72 0 C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen). 5 ul from each DNA solution was combined and each DNA fragment was spliced by another round of PCR: 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 3 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-CGAGCTCAGGAGGATATATATATGAGCCAGCAAGTCATTATTTTCG-S ') (SEQ ID NO:202) and reverse (5'-
  • AAAACTGCAGCGTTTGATGACGTGGACGATAGCGG-3' (SEQ ID NO:203) primers, IU Phusion High Fidelity DNA polymerase (NEB).
  • the spliced fragment was digested with Sad and Xbal and ligated into pBAD33 pre-digested with the same restriction enzymes.
  • pneumoniae MGH 78578 of its codon usage optimized for over-expression in E.coli or alsS of Bacillus subtilis B26 and HvC and HvD of E. coli DHlOB were amplified separately by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 4 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • TTTGCCTTTCGGCGCGTGCAGACGGCCTTTG-3' (SEQ ID NO:208) for front and (5'-ACATGCATGCCGTTTGATGACGTGGACGATAGCGG-S') (SEQ ID NO:209) for bottom halves, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng pBADleuABCD, pBADleuABCD2, and pBADleuABCD4 in 50 ⁇ l, respectively.
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen).
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CCCGAGCTCAGGAGGATATATAT ATGAATTATCAGAACGACGATTTAC-S') (SEQ ID NO:212) for aroG, (5'- GCGTCGCGGGTAAGGAGGAAAATTTTATGTCCTCACGTAAAGAGCTTGCC- 3') (SEQ ID NO:213) for tktA, (5'--
  • ACATGCATGCTTACGCGGAC AATTCCTCCTGC AA-3') (SEQ ID NO:221) for aroE, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli BL21(DE3) genome in 50 ⁇ l, respectively.
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen). 5 ul from each DNA solution was combined and each DNA fragment was spliced by another round of PCR: 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 3 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CCCGAGCTCAGGAGGATATATATATGAATTATCAGAACGACGATTTAC-S') (SEQ ID NO:222) and reverse (5'-
  • pBADpheA-aroLAC Construction of pBADpheA-aroLAC.
  • the DNA fragments encoding pheA, aroL, aroA, and aroC of Escherichia coli DHlO were amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CCCGAGCTCAGGAGGATATATATATGACATCGGAAAACCCGTTACTGG-S') (SEQ ID NO:224) for pheA, (5'--
  • ACATGCATGCTTACCAGCGTGGAATATC AGTCTTC-3' (SEQ ID NO:231) for aroC primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli BL21(DE3) genome in 50 ⁇ l, respectively.
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen). 5 ul from each DNA solution was combined and each DNA fragment was spliced by another round of PCR: 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 4 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5 ' -CCCGAGCTCAGGAGGATATATATATGACATCGGAAAACCCGTTACTGG- 3') (SEQ ID NO:232) and reverse (5'-
  • pBADtyrA-aroLAC Construction of pBADtyrA-aroLAC.
  • the DNA fragments encoding pheA, aroL, aroA, and aroC of Escherichia coli DHlO were amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • ACATGCATGCTTACCAGCGTGGAATATCAGTCTTC-3' (SEQ ID NO:241) for aroC, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Escherichia coli BL21(DE3) genome in 50 ⁇ l, respectively.
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen). 5 ul from each DNA solution was combined and each DNA fragment was spliced by another round of PCR: 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 4 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CCCGAGCTCAGGAGGATATATATATGGTTGCTGAATTGACCGCATTAC-S') (SEQ ID NO:242) and reverse (5'-
  • PCR polymerase chain reaction
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-AAGGAAAAAAGCGGCCGCCCCTGAACCGACGACCGGGTCG-S') (SEQ ID NO:244) for fragment 1 and 2 and (5'-
  • GCTCT AGAACTTTTC ATACTCCCGCC ATTCAG-3 ' (SEQ ID NO:245) for fragment 3, and reverse (5'- GCTCTAGAGCGGATACATATTTGAATGTATTTAG- 3') (SEQ ID NO:246) for fragment 1 and 2 and (5'-
  • pTrcBAL Construction of pTrcBAL.
  • a DNA sequence encoding benzaldehyde lyase (bal) of Pseudomonas fluorescens of its codon usage optimized for over- expression in E. coli was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • PCR polymerase chain reaction
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CATGCC ATGGCTATGATTACTGGTGG-3 ' ) (SEQ ID NO:248) and reverse (5'- CCCCGAGCTCTTACGCGCCGGATTGGAAATACA-3') (SEQ ID NO:249) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng pETBAL in 50 ⁇ l. Amplified DNA fragment was digested with Ncol and Sad and ligated into pTrc99A pre-digested with the same restriction enzymes. Construction of pTrcAdhE2.
  • a DNA sequence encoding Co-A linked alcohol/aldehyde dehydrogenase (adhEI) of Clostridium acetobutyricum ATCC824 was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60°C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • CATGCCATGGCCAAAGTTAC AAATC AAAAAG-3 ' (SEQ ID NO:250) and reverse (5'-CGAGCTCTTAAAATGATTTTATATAGATATCC-B ') (SEQ ID NO:251) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Clostridium acetobutyricum ATCC824 genome in 50 ⁇ l. Amplified DNA fragment was digested with Ncol and Sad and ligated into pTrc99A pre-digested with the same restriction enzymes.
  • pTrcAdh2 A DNA sequence encoding alcohol dehydrogenase (adh.2) of Saccharomyces cerevisiae was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • PCR polymerase chain reaction
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-CATGCCATGGGTATTCCAGAAACTCAAAAAG-S') (SEQ ID NO:252)and reverse (5'- CCCGAGCTCTTATTT AG AAGTGTC AAC AACG-3') (SEQ ID NO:253) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng genome of Saccharomyces cerevisiae in 50 ⁇ l. Amplified DNA fragment was digested with Ncol and Sad and ligated into pTrc99A pre-digested with the same restriction enzymes.
  • telomere sequence encoding CoA-linked aldehyde dehydrogenase (aid) of Clostridium beijerinckii was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-CCCCGAGCTCAGGAGG
  • ATATACATATGAATAAAGACACACTAATACC-S' (SEQ ID NO:254) and reverse (5'- CCCAAGCTTAGCCGGCAAGTACACATCTTC-S') (SEQ ID NO:255) primers, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng pETBAL in 50 ⁇ l. Amplified DNA fragment was digested with Sad and HndIII and ligated into pTrcBAL pre-digested with the same restriction enzymes.
  • pTrcBALK Construction of pTrcBALK.
  • a DNA sequence encoding ketoisovalerate decarboxylase (kivd) of Lactococcus lavtis was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • telomere sequence encoding ketoisovalerate decarboxylase (kivd) of Lactococcus lavtis was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CGAGCTCAGGAGGATATATATATGAAAAAAGTCGCACTTGTTACCG-S') (SEQ ID NO:260) for front half of ddh, (5'-
  • GTCGAACTCATCCATCGAGCCCTCCGCAAGG-3' (SEQ ID NO:266) for front half of 2adh, and (5'-CCCAAGCTTAGATCGCGGTGGCCCCGCCGTCG-3') (SEQ ID NO:267) for bottom half of 2adh, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng Klebsiella pneumoniae subsp. pneumoniae MGH 78578 for ddh and Pseudomanas fluorescens genome for 2adh in 50 ⁇ l, respectively.
  • the amplified DNA fragments were gel purified and eluted into 30ul of EB buffer (Qiagen).
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'- CGAGCTCAGGAGGATATATATATGAAAAAAGTCGCACTTGTTACCG-S') (SEQ ID NO:268) and reverse (5'-
  • pBBRPduCDEGH Construction of pBBRPduCDEGH.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • a DNA sequence encoding propanediol dehydratase large subunit (pduC) of Klebsiella pneumoniae subsp. pneumoniae MGH 78578 was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 1 min, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward (5'-
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward primers (5"- CATGCCATGGGACTGGCTGAGGCACTGCTGC-3' (SEQ ID NO:314) for ipdc and 5'-CGAGCTCAGGAGGATATATATATGAAAGCTATCCAGTACACCCGTAT ⁇ ' (SEQ ID NO:315) for par, and reverse primers (5'- CGAGCTCTTATTCGCGCGGTGCCGCGCGTGCAGG-S' (SEQ ID NO:316) for ipdc and 5'-GCTCTAGATTACAGGCCCGGAACCACAACGGCGC-S' (SEQ ID NO:317) for par, IU Phusion High Fidelity DNA polymerase (NEB), and 50 ng pTrcIpdc and pTrcPar, respectively, in 50 ⁇ l. Amplified DNA fragment of ipdc and par were digested with Ncol/Sacl
  • DHlOB harboring pBADButP-atoB/pTrcBALD and pBADButP-atoB-
  • ALD/pTrcB2DH/pBBRpduCDEGH were grown overnight in LB media containing 50 ug/ml chroramphenicol (Cm 50 ) and 100 ug/ml ampicillin (Amp 100 ) at 37 C, 200 rpm.
  • An aliquot of each seed culture was inoculated into fresh TB media containing Cm 50 and Amp 100 and was grown in incubation shaker at 37 C, 200 rpm. Three hours after inoculation, the cultures were induced with 13.3 mM arabinose and 1 mM IPTG and were grown for overnight. 700 ul of this culture was extracted with equal volume of ethylacetate and analyzed by GC-MS.
  • DHlOB cells harboring pBADals-ilvCD/pTrcBALK or pBADalsS-ilvCD/pTrcBALK were grown overnight in LB media containing 50 ug/ml chroramphenicol (Cm 50 ) and 100 ug/ml ampicillin (Amp 100 ) at 37 C, 200 rpm.
  • An aliquot of each seed culture was inoculated into fresh TB media containing Cm 50 and Amp 100 and was grown in incubation shaker at 37 C, 200 rpm.
  • the cultures were induced with 13.3 mM arabinose and 1 mM IPTG and were grown for overnight. 700 ul of this culture was extracted with equal volume of ethylacetate and analyzed by GC-MS for the production of isobutyraldehyde.
  • Figure 8B shows the production of isobutanal from these cultures.
  • DHlOB harboring pBADals-ilvCD-LeuABCD/pTrcBALK, pBADals-ilvCD-LeuABCD2/pTrcBALK, pBADals-ilvCD-LeuABCD/pTrcBALK4, pBADalsS-LeuABCD/pTrcBALK, pBADalsS-LeuABCD2/pTrcBALK, or pBADalsS- LeuABCD4/pTrcBALK were grown overnight in LB media containing 50 ug/ml chloramphenicol (Cm 50 ) and 100 ug/ml ampicillin (Amp 100 ) at 37 C, 200 rpm.
  • DHlOB cells harboring pBADpheA-aroLAC/pTrcBALK, pBADtyrA-aroLAC/pTrcBALK, pBADaroG-tktA-aroBDE/pTrcBALK, pBADpheA- aroLAC-aroG-tktA-aroBDE/pTrcBALK, and pBADpheA-aroLAC-aroG-tktA- aroBDE/pTrcBALK were grown overnight in LB media containing 50 ug/ml chroramphenicol (Cm 50 ) and 100 ug/ml ampicillin (Amp 100 ) at 37 C, 200 rpm.
  • Cm 50 chroramphenicol
  • Amp 100 ampicillin
  • DHlOB harboring pBADpheA-aroLAC-aroG-tktA- aroBDE/pTrcBALK, pBADpheA-aroLAC-aroG-tktA-aroBDE/pTrcBALK, pBADpheA-aroLAC-aroG-tktA-aroBDE/pTrcAdh2-Kivd, pBADpheA-aroLAC-aroG- tktA-aroBDE/pTrcAdh2-Kivd, pBADpheA-aroLAC-aroG-tktA-aroBDE/pTrcIpdc-Par, and pBADpheA-aroLAC-aroG-tktA-aroBDE/pTrcIpdc-Par, and pBADpheA-aroLAC-aroG-tktA
  • FIG. 42 A shows the production of 2-phenylethanol from these cultures at 24 hours.
  • Figure 42B shows the production of 2-(4-hydroxyphenyl)ethanol from these cultures at 24 hours.
  • Figure 42C shows the production of 2-(indole-3-)ethanol from these cultures at 24 hours.
  • Figure 43 A shows the GC-MS chromatogram for control (pBAD33 and pTrc99A) at one week.
  • Figure 43B shows the GC-MS chromatogram for 2- phenylethanol (5.97 min) production from pBADpheA-aroLAC-aroG-tktA-aroBDE and pTrcBALK at one week.
  • Figure 44 shows the GC-MS chromatogram for 2-(4- hydroxyphenyl) ethanol (9.36 min) and 2-(indole-3) ethanol (10.32 min) production from pBADtyrA-aroLAC-aroG-tktA-aroBDE and pTrcBALK at one week.
  • genomic DNA from several species of bacteria were obtained from ATCC ⁇ Lactobaccilus brevis ATCC 367, Pseudomanas putida KT2440, and Klebsiella pneumoniae MGH78578), PCR-amplified (using Phusioin with polymerase with IX Phusion buffer, 0.2 mM dNTP, 0.5 ⁇ L Phusion enzyme, 1.5 ⁇ M primers, and 20 pg template DNA in a 50 ⁇ L reaction) utilizing the following protocol: 30 cylces, 98 °C/10 sees (denaturing), 60 °C/15 sees (annealing), 72 °C/30 sees (elongation).
  • Polymerase chain reaction products were then digested using restriction enzymes Ndel and BamHI, then ligated into Ndel/BamHI digested pET28 vectors.
  • the 6X His-tagged enzymes were purified using Ni-NTA spin columns following suggested protocols by QIAGEN, yelding purified protein concentrations in the range of 1.1 - 6.5 mg/mL (determined by Bradford assay).
  • Diol dehydrogenase ddhl was isolated from Lactobaccilus brevis ATCC 367, diol dehydrogenase ddhl was isolated from Pseudomonas putida KT2440, and diol dehydrogenase ddhl was isolated from Klebsiella pneumoniae MGH78578.
  • nucleotide sequence encoding and polypeptide sequence of ddhl are shown in SEQ ID NOS :97 and 98, respectively; nucleotide sequence encoding and polypeptide sequence of ddhl are shown in SEQ ID NOS:99 and 100, respectively; and nucleotide sequence encoding and polypeptide sequence of ddhh are shown in SEQ ID NOS: 101 and 102, respectively.
  • Reactions to measure biological activity of DDH polypeptides were performed in a final volume of 200 ⁇ L as follows: 25mM substrate, 0.04 mg/mL DDH polypeptide, 0.25 mg/mL nicotinamide co factor, 200 mM imidazole, 14 mM Tris-HCl, and 1.5% by volume DMSO.
  • Biological activity was assayed using a Molecular Devices Thermomax 96 well plate reader, monitoring absorbance at 340 nm, which corresponds to NADH or NADPH concentration.
  • Figure 12A shows the biological activity ofddhl, ddh2, and ddhZ using butyroin as a substrate (triangles reprseent ddh3 activity).
  • Figure 12B shows the oxidation activity of ddh3 towards 1 ,2-cyclopentanediol and 1 ,2-cyclohexanediol as measured by NADH production.
  • Figure 13 summarizes the results of kinetic studies for various substrates in the oxidation reactions catalyzed by the DDH polypeptides. These reactions were NAD+ dependent.
  • a pathway comprising a benzaldehyde lyase (bal) gene isolated from Pseudomonas fluorescens (codon usage was optimized for E. coli protein expression) and meso-2,3-butanediol dehydrogenase (ddh) gene isolated from Klebsiella pneumoniae subsp. pneumoniae MGH 78578 was constructed in E.
  • bal benzaldehyde lyase
  • ddh meso-2,3-butanediol dehydrogenase
  • acetoaldehyde, propionaldehyde, butyraldehyde, isobutyraldehyde, 2 -methyl -butyraldehyde, 3 -methyl -butyraldehyde, phenylacetaldehyde, and 4-hydroxyphenylacetaldehyde, or their corresponding alcohols to form ⁇ -hydroxyketone and the corresponding diol in vivo.
  • the production of various ⁇ -hydroxyketones and diols was monitored by gas chromatography-mass spectrometry (GC-MS).
  • E. coli DHlOB strains harboring pTrc99A (Ctrl vector) or pTrcBAL were inoculated into 0.75 x M9/ 0.5% LB containing 0.ImM CaCl 2 , 2 mM MgSO 4 , ImM KCl, 1% galacturonate, 5 ⁇ g/mL thiamine, Amp.
  • the cultures were grown up to an optical density (60On nm) of 0.8 and induced with 0.25 mM IPTG.
  • the cells were allowed to express the proteins for 2.5 hours at 37 0 C, then aldehyde substrate was added to a concentration of 5mM, the culture vial was capped tightly and incubated for 72 hours at 37 0 C w/ shaking 200 rpm. 1 mL of the final culture was extracted with 0.75 mL of ethyl acetate, centrifuged facilitate phase separation, then analyzed via GCMS using the following method.
  • Figure 17 shows the sequential conversion of butanal into 5-hydroxy-4-octanone and then 4,5-octanonediol.
  • Figure 18 shows the sequential conversion of «-pentanal into 6-hydroxy-5-decanone and then 5,6-decanediol.
  • Figure 19 shows the conversion of 3-methylbutanal into 2,7- dimethyl-5-hydroxy-4-octanone and then 2,7-Dimethyl-4,5-octanediol.
  • Figure 20 shows the sequential conversion of n-hexanal into 7-hydroxy-6-dodecanone and then 6,7-dodecanediol.
  • Figure 21 shows the conversion of 4-methylpentanal into 2,9- dimethyl-6-hydroxy-5-decanone and then 2,9-dimethyl-5,6-decanediol.
  • Figure 22 shows the conversion of n-octanal into 9-hydroxy-8- hexadecanone.
  • Figure 23 shows the conversion of acetaldehyde into 3-hydroxy-2-butanone.
  • Figure 24 shows the sequential conversion of ⁇ -propanal into 4-hydroxy-3-hexanone and then 3,4- hexanediol.
  • Figure 25 shows the conversion of phenylacetoaldehyde into 1 ,4-diphenyl- 3-hydroxy-2-butanone.
  • diol dehydrogenases and diol dehydratases were used as a substrate in a sequential reaction to produce 4-octanone.
  • the enzyme diol dehydrogenase ⁇ e.g., ddh) catalyzes the reversible reduction and oxidation of ⁇ -hydroxy ketones and its corresponding diol, such as 5-hydroxy-4-octanone and 4,5-octanediol
  • the enzyme diol dehydratase ⁇ e.g., pduCDE catalyzes the irreversible dehydration of diols, such as 4,5-octanediol.
  • Diol dehydrogenase ddh from Klebsiella pneumoniae MGH 78578 and diol dehydratase pdu CDE from Klebsiella pneumoniae MGH 78578 were cloned into a bacterial expression vector and expressed and purified on a Ni-NTA column, as described in Example X except that 1 mM of 1 ,2-propanediol was added at all time during the expression and purification of diol dehydratase.
  • the large, medium, and small subunits of the pduCDE polyeptide are encoded by the nucleotide sequences of SEQ ID NOs: 103, 105, and 107, respectively, and the polypeptide sequence are set forth in SEQ ID NOs: 104, 106, and 108, respectively.
  • the ddh3 and pduCDE polypeptides were incubated with butyroin and their appropriate cofactors, then assayed using gas chromatography-mass spectrometry (GC-MS) for their ability to perform sequential reactions resulting in the product A- octanone. Reaction conditions are given in Table 3 below.
  • the reaction mixture was incubated at 37 0 C for 40 hours in a 0.6 rtiL eppendorf tube with minimal head space.
  • the reaction product was extracted with an equivalent volume of ethyl acetate, stored in a glass vial, and sent to Thermo Fischer Scientific Instruments Division for compositional analysis by GC-MS.
  • Figure 26 A shows GC-MS data which confirms the presence of 4,5- octanediol in the sample extraction.
  • the mass-spectra of the peaks, retention time, at 5.36 was identified as butyroin (substrate), and at 6.01, 6.09, and 6.12 min were identified as different isomers of 4,5-octanediol.
  • This compound is the expected product resulting from the reduction of butyroin by ddh3.
  • Figure 26B shows GC-MS data confirming the presence of 4-octanone in the sample extraction.
  • the mass-spectra of the peak, retention time, at 4.55 was identified as 4-octanone.
  • This compound is the expected product resulting from the sequential dehydrogenation of butyroin and dehydration of 4,5-octanediol by ddh3 and pduCDE, respectively.
  • Figures 27A and 27B show comparisons between the sample extraction gas chromatograph/mass spectrum and the 4-octanone standard gas chromatograph/mass spectrum. These results demonstrate that 4-octanone was produced from butyroin using the enzymes diol dehydrogenase (ddhi) and a diol dehydratase (pduCDE). GC-MS analysis of the incubated reaction mixture confirmed starting material, intermediate and product, demonstrating that these enzymes can be reappropriated for these specific substrates.
  • ddhi diol dehydrogenase
  • pduCDE diol dehydratase
  • Example 8 Isolation and Biological Activity of Secondary Alcohol Dehydrogenases
  • Substrates such as 4-octanone, 2,7-dimethyl-4-octanone, cyclopentanone and corresponding alcohols were utilized to measure the ability of secondary alcohol dehydrogenases (2ADHs) to catalyze the reduction of large saturated ketones to secondary alcohols.
  • An example of a reaction catalyzed by secondary alcohol dehydrogenases is illustrated below (reduction of 4-octanone to 4-octanol is shown):
  • Various secondary alcohol dehydrogenases (2ADHs) were isolated from Pseudomonas putida KT2440, Pseudomonas fluorescens Pf-5, and Klebsiella pneumoniae MGH 78578. All vectors were transformed in BL21(DE3) competent cells and expression of the genes encoding the proteins of interest was induced with IPTG (via the T7 promoter). The cells were lysed, proteins were extracted and then purified on Ni-NTA columns. Final protein concentration in the Ni-NTA eluate was diluted to 0.15 mg/mL prior to assays.
  • 2ADHs secondary alcohol dehydrogenases
  • NADPH/NADPH consumption and production assays were performed using a THERMOmax microplate reader in the kinetic mode, monitoring the NADPH absorbance peak at 340 nm until the reaction reached equilibrium.
  • 2ADH-2, 2ADH-5, 2ADH-8, and 2ADH-10 were tested for their ability to either catalyze the oxidation of 4-octanol or catalyze the reduction of 4- octanone. These reaction conditions are found in Table 4 below.
  • Figure 30A shows the results from the NADH Production Assay of Table 3, in which 2ADH-2 catalyzes the oxidation of 4-octanol in the presence of NAD+, as measured by NADH production.
  • Figure 30B shows the results of the NADPH Production Assay of Table 3, in which 2ADH-5, 2ADH-8, and 2ADH-10 catalyze the oxidation of 4-octanol in the presence of NADP+, as measured by NADPH production.
  • Figure 31 shows the oxidation of 4-octanol by by 2 ADH-11 (Figure 31A) and 2ADH-16 ( Figure 31B), as measured by NADH and NADPH production, respectively.
  • Figure 32 shows the oxidation of 2,7-dimethyloctanol by 2ADH-11 and others ( Figure 32A) and 2ADH-16 ( Figure32B), as measured by NADH and NADPH production, respectively.
  • Figure 33 A shows the reduction of 2,7-dimethyl octanol by 2ADH 11 and 2ADH16 as monitored by NADPH consumption.
  • Figure 33B shows the reduction activity of both 2ADH 11 and 2ADH 16 towards various substrates.
  • Figure34 shows the oxidation ( Figure 34A) and reduction ( Figure 34B) of cyclopentanol by 2ADH-16.
  • Substrates such as 1,2 -propanediol, meso-2,3-butanediol, and trans- ⁇ ,2- cyclopentanediol were utilized to test both the in vitro and in vivo biological activity of a Bl 2 independent diol dehydratase in a dehydration and reduction pathway.
  • Diol dehydratases catalyzes the irreversible dehydration of diols, such as 1,2-propanediol.
  • the cells were lysed and proteins of interest were purified on a Ni-NTA spin column. Purification of all three dehydratase subunits was accomplished by adding 5 mM 1 ,2-propanediol to the lysis and wash buffers.
  • the Ni-NTA purification yielded approximately 660 ⁇ L of protein mixture at a concentration of 2.2 mg/mL. Protein concentration assays were conducted using a Bradford reagent protocol.
  • the purified PduCDE was used to set up in vitro diol dehydratase reactions. Three assays were conducted with 1,2-propanediol and meso-2,3-butanediol. Control reactions were also set up with elution buffer added in place of purifiedPduCDE. In vitro reactions were conducted under semi-anaerobic conditions in 2 mL screw cap glass vials. Reaction components and concentrations are given in Table 6.
  • Figure 45 The results are shown in Figure 45.
  • Figure 45 A confirms the formation of 1-propanal from 1 ,2-propanediol
  • Figure 45B confirms the formation of 2- butanone from meso-2,3-butanediol, both of which were catalyzed by B12 independent diol dehydratase.
  • the pBBRDhaBl/2 plasmid was constructed as follows: the DNA sequence encoding B12-independent glycerol dehydratase (dhaBl) and activator (dhaB2) of Clostridium butyricum was amplified by polymerase chain reaction (PCR): 98°C for 10 sec, 60 0 C for 15 sec, and 72°C for 2 min for dhaBl and lmin for dhaB2, repeated 30 times.
  • the reaction mixture contained 1 x Phusion buffer (NEB), 2 mM dNTP, 0.5 ⁇ M forward primers (5'-
  • Figure 46 shows the in vivo production of 1-propanol from 1,2- propanediol.
  • Figure 46B shows the in vivo production of 2-butanol from meso-2,3 butanediol.
  • Figure 46C shows the in vivo production of cyclopentanone from trans- 1,2- cyclopentanediol .
  • Vs24214-24249 genomic region corresponding to gene id between V12B01_24214 and V12B01_24249 ⁇ see Example 1).
  • Vs24189-24209 genomic region corresponding to gene id between V12B01 24189 and V12B01 24209 ⁇ see Example 1).
  • Vs24214-24239 genomic region corresponding to gene id between V12B01_24214 and V12B01 24239 ⁇ see Example 1).
  • the entry vectors were recombined with the destination vector pET- DEST42 (Invitrogen) using the LR recombinase enzyme (Invitrogen). These destination vectors were then put into electrocompetent DHlOB or BL21 cells.
  • alginate lyase clones were then made by digesting (using enzymes Nde I and Bam HI) the PCR products that were generated using Vibrio spectacularus 12B01 genomic DNA as a template and amplified with the following primer pairs:
  • the digested PCR products were then ligated into cut pET28 vector. Certain of the cloned genomic regions of Vibrio spectacularus BOl were tested for the presence of secreted alginate lyases, and the above-described constructs were tested in various combinations for the ability to confer growth on alginate as a sole source of carbon.
  • the Vs24254 (SEQ ID NO: 32) region of Vibro spendidus encodes a functional external alginate lyase.
  • BL21 cells expressing Vs24254 from the pET28 vector were capable of breaking down alginate in the growth medium.
  • IPTG Isopropyl ⁇ -D-1-thiogalactopyranoside
  • only cells expressing the Vs24254 gene give a positive TBA assay result of pink color. This assay was performed by spinning down an overnight culture grown on the above mentioned media.
  • Figure 47 shows the results of this assay.
  • the left tube in Figure 47 represents media taken from an overnight culture of cells expressing Vs24254, while the right hand tube shows the TBA reaction using media from cells expressing Vs24259 (negative control).
  • the lack of pink coloration in the negative control indicates that little or no cleavage of the alginate polymer has occurred.
  • Wildtype E. coli cells not expressing any recombinant proteins show the same coloration as the negative control Vs24259 (data not shown).
  • transformed cells were grown for 19 hours at 30 degrees Celsius with mild shaking in a 96-well plate. Each well held 222 ⁇ l of minimal media (see growth conditions for explanation of minimal media) with the 0.66% carbon source in the form of either degraded alginate or glucose (positive control for growth). All cells were either BL21 with no plasmid (BL21 - negative control), one plasmid (Da or 3a), or two plasmids (Dk3a and Da3k).
  • the plasmids are indicated by the lower case letter: "a” refers to the plasmid backbone pET-DEST42 and “k” refers to the pENTR/D/TOPO backbone. "D” indicates that the plasmid contains the genomic region Vs24214-24249, while “3” indicates that the plasmid contains the genomic region Vs24189-24209. Thus, Da would be pET-DEST42-Vs24214-24249, Da3k would be pET-DEST42- Vs24214-24249 and pENTR/D/TOPO-Vs24189-24209 and so on.
  • telomere sequences encoding pyruvate decarboxylase (pdc), and two alcohol dehydrogenase (adhA and adhB) of Zymomonas mobilis were amplified by polymerase chain reaction (PCR). These amplified fragments were gel purified and spliced together by another round of PCR. The final amplified DNA fragment was digested with BamHI and Xbal ligated into pBBRlMCS-2 pre-digested with the same restriction enzymes. The resulting plasmid is referred to as pBBRPdc-AdhA/B.
  • E. coli was transformed with either pBBRPdc-AdhA/B or pBBRPdc- AdhA/B + 1.5 Fos (fosmid clone containing genomic region between V12B01 24189 and V12B01 24249; these sequences confer on E. coli the ability to use alginate as a sole source of carbon, see Examples 1 and 10), grown in m9 media containing alginate, and tested for the production of ethanol.
  • Figure 57 which demonstrates that the strain harboring pBBRPdc-AdhA/B + 1.5 FOS showed significantly higher ethanol production when growing on alginate.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Saccharide Compounds (AREA)
PCT/US2008/078850 2007-10-04 2008-10-03 Biofuel production Ceased WO2009046375A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA2699929A CA2699929A1 (en) 2007-10-04 2008-10-03 Biofuel production
BRPI0817754-6A2A BRPI0817754A2 (pt) 2007-10-04 2008-10-03 Produção de biocombustível
CN2008801192815A CN101889092A (zh) 2007-10-04 2008-10-03 生物燃料生产
JP2010528192A JP2010539988A (ja) 2007-10-04 2008-10-03 生物燃料製品
MX2010003501A MX2010003501A (es) 2007-10-04 2008-10-03 Produccion de biocombustible.
AU2008308477A AU2008308477A1 (en) 2007-10-04 2008-10-03 Biofuel production
NZ584162A NZ584162A (en) 2007-10-04 2008-10-03 Biofuel production
EP08834856A EP2195440A2 (en) 2007-10-04 2008-10-03 Biofuel production

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US97762807P 2007-10-04 2007-10-04
US60/977,628 2007-10-04

Publications (2)

Publication Number Publication Date
WO2009046375A2 true WO2009046375A2 (en) 2009-04-09
WO2009046375A3 WO2009046375A3 (en) 2009-09-24

Family

ID=40227859

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2008/078850 Ceased WO2009046375A2 (en) 2007-10-04 2008-10-03 Biofuel production
PCT/US2008/078844 Ceased WO2009046370A2 (en) 2007-10-04 2008-10-03 Biofuel production

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2008/078844 Ceased WO2009046370A2 (en) 2007-10-04 2008-10-03 Biofuel production

Country Status (12)

Country Link
US (8) US20090139134A1 (https=)
EP (1) EP2195440A2 (https=)
JP (1) JP2010539988A (https=)
KR (1) KR20100091162A (https=)
CN (1) CN101889092A (https=)
AU (1) AU2008308477A1 (https=)
BR (1) BRPI0817754A2 (https=)
CA (1) CA2699929A1 (https=)
CL (2) CL2008002961A1 (https=)
MX (1) MX2010003501A (https=)
NZ (1) NZ584162A (https=)
WO (2) WO2009046375A2 (https=)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH1069865A (ja) * 1996-07-31 1998-03-10 Chuka Eikan Kofun Yugenkoshi ビデオディスプレイ装置
WO2009086811A3 (de) * 2008-12-23 2009-10-29 Schmack Biogas Ag Paenibacillus macerans zur erzeugung von biogas
WO2010072220A1 (de) * 2008-12-23 2010-07-01 Schmack Biogas Ag Paenibacillus macerans zur behandlung von biomasse
WO2010068944A3 (en) * 2008-12-12 2010-09-23 Celexion, Llc Biological synthesis of difunctional alkanes from alpha ketoacids
WO2010149859A2 (en) 2009-06-24 2010-12-29 Neste Oil Oyj Method for the production of fat
WO2010102618A3 (de) * 2009-03-07 2011-02-24 Schmack Biogas Gmbh Mikroorganismen zur verflüssigung von biomasse
WO2011044279A3 (en) * 2009-10-06 2011-10-20 Bio Architecture Lab, Inc. Microbial systems for producing commodity chemicals
WO2011133111A1 (en) * 2010-04-19 2011-10-27 Ngee Ann Polytechnic Trichoderma viride strain for cellulolytic enzyme production
EP2390341A1 (en) 2010-05-25 2011-11-30 Neste Oil Oyj Process and microorganisms for production of lipids
US8198056B2 (en) 2007-10-04 2012-06-12 Bio Architecture Lab, Inc. Biofuel production
CN102666862A (zh) * 2009-08-21 2012-09-12 马斯科马公司 在联合生物加工生物体中生产丙醇、醇和多元醇
EP2463374A3 (en) * 2008-01-28 2012-12-26 Bio Architecture Lab, Inc. Isolated alcohol dehydrogenase enzymes and uses thereof
US8404465B2 (en) 2009-03-11 2013-03-26 Celexion, Llc Biological synthesis of 6-aminocaproic acid from carbohydrate feedstocks
JP2013529088A (ja) * 2010-05-24 2013-07-18 ザイレコ,インコーポレイテッド バイオマス処理
WO2015041265A1 (ja) 2013-09-17 2015-03-26 味の素株式会社 海藻由来バイオマスからのl-アミノ酸の製造方法
US9023627B2 (en) 2010-09-15 2015-05-05 University Of Washington Through Its Center For Commercialization Systems and methods for biotransformation of carbon dioxide into higher carbon compounds
CN104630279A (zh) * 2009-07-09 2015-05-20 焦耳无限科技公司 用于正烷烃重组生物合成的方法和组合物
US9169182B2 (en) 2011-02-25 2015-10-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Chrysophaentin analogs that inhibit FtsZ protein
WO2016094604A1 (en) * 2014-12-10 2016-06-16 Dow Global Technologies Llc Genetically modified phenylpyruvate decarboxylase, processes to prepare, and uses thereof
US20170058222A1 (en) * 2010-02-08 2017-03-02 Fulcrum Bioenergy, Inc. Fuels and fuel additives that have high biogenic content derived from renewable organic feedstock
US9951356B2 (en) 2013-12-12 2018-04-24 Dow Global Technologies Llc Processes to prepare elongated 2-ketoacids and C6-C10 compounds therefrom via genetic modifications to microbial metabolic pathways
CN110551654A (zh) * 2019-09-05 2019-12-10 中国农业科学院农业资源与农业区划研究所 阿氏芽孢杆菌、其代谢产物及其应用
US10995322B2 (en) 2016-09-30 2021-05-04 Dow Global Technologies Llc Processes to prepare elongated 2-ketoacids and C5-C10 compounds therefrom via genetic modifications to microbial metabolic pathways
US11230705B2 (en) 2017-09-29 2022-01-25 Dow Global Technologies Llc Genetically modified isopropylmalate isomerase enzyme complexes and processes to prepare elongated 2-ketoacids and C5-C10 compounds therewith

Families Citing this family (96)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7685737B2 (en) 2004-07-19 2010-03-30 Earthrenew, Inc. Process and system for drying and heat treating materials
US7024800B2 (en) 2004-07-19 2006-04-11 Earthrenew, Inc. Process and system for drying and heat treating materials
US7610692B2 (en) 2006-01-18 2009-11-03 Earthrenew, Inc. Systems for prevention of HAP emissions and for efficient drying/dehydration processes
US8309323B2 (en) * 2007-11-13 2012-11-13 Synthetic Genomics, Inc. Dimethyloctane as an advanced biofuel
US20100120111A1 (en) * 2008-11-13 2010-05-13 Robert Petcavich Method of producing hydrocarbon biofuels using genetically modified seaweed
MY176050A (en) 2009-04-30 2020-07-22 Genomatica Inc Organisms for the production of 1,3-butanediol
EP2440669A4 (en) * 2009-06-10 2013-08-28 Genomatica Inc MICROOGANISMS AND PROCEDURES FOR THE CARBON EFFECTIVE BIOSYNTHESIS MEK AND 2-BUTANOL
EA201270058A1 (ru) * 2009-06-22 2012-07-30 Джул Анлимитед Текнолоджиз, Инк. Биосинтез 1-алкенов в сконструированных микроорганизмах
US7955820B1 (en) * 2009-07-09 2011-06-07 Joule Unlimited, Inc. Methods and compositions for the recombinant biosynthesis of n-alkanes
US8987539B1 (en) * 2009-07-29 2015-03-24 The United States Of America As Represented By The Secretary Of The Navy Acyclic monoterpenes as biofuels based on linalool and method for making the same
US8969636B2 (en) 2009-07-29 2015-03-03 The United States Of America As Represented By The Secretary Of The Navy Homogeneous metallocene ziegler-natta catalysts for the oligomerization of olefins in aliphatic-hydrocarbon solvents
US9242226B2 (en) 2009-07-29 2016-01-26 The Government Of The United States Of America As Represented By The Secretary Of The Navy Process for the dehydration of aqueous bio-derived terminal alcohols to terminal alkenes
US9649626B2 (en) 2009-07-29 2017-05-16 The United States Of America As Represented By The Secretary Of The Navy Process for the dehydration of aqueous bio-derived terminal alcohols to terminal alkenes
US8785702B2 (en) 2009-07-29 2014-07-22 The United States Of America As Represented By The Secretary Of The Navy Turbine and diesel fuels and methods for making the same
US9266792B2 (en) 2009-07-29 2016-02-23 The United States Of America As Represented By The Secretary Of The Navy Process and apparatus for the selective dimerization of terpenes and alpha-olefin oligomers with a single-stage reactor and a single-stage fractionation system
US8912373B2 (en) 2009-07-29 2014-12-16 The United States Of America As Represented By The Secretary Of The Navy Process for the dehydration of aqueous bio-derived terminal alcohols to terminal alkenes
BR112012003241A2 (pt) * 2009-08-12 2015-09-01 Gevo Inc Localização de via de isobutanol citosólico para a produção de isobutanol
AU2010292910B2 (en) * 2009-09-09 2014-12-18 Braskem S.A. Microorganisms and process for producing n-propanol
EP2483401B1 (en) 2009-09-29 2017-06-21 Butamax (TM) Advanced Biofuels LLC Improved yeast production host cells
WO2011053584A1 (en) * 2009-10-26 2011-05-05 University Of Maine System Board Of Trustees Energy densification of biomass-derived organic acids
US8211677B2 (en) * 2009-10-26 2012-07-03 Saudi Arabian Oil Company Visible light-enhanced enzymatic promotion of hydrocarbon reactions
US8362306B2 (en) * 2009-10-26 2013-01-29 University Of Maine System Board Of Trustees Energy densification of biomass-derived organic acids
US8969635B2 (en) * 2009-10-27 2015-03-03 The United States Of America, As Represented By The Secretary Of The Navy Alkane enhancement of waste using microbial pre-treatement
WO2011057288A2 (en) * 2009-11-09 2011-05-12 The Regents Of The University Of California Isobutanol production with corynebacterium glutamicum
WO2011062987A2 (en) * 2009-11-17 2011-05-26 Ls9, Inc. Methods and compositions for producing hydrocarbons
KR20120120493A (ko) * 2009-12-10 2012-11-01 게노마티카 인코포레이티드 합성 가스 또는 기타 가스상 탄소원 및 메탄올을 1,3-부탄디올로 변환하는 방법 및 변환용 유기체
NZ600585A (en) 2009-12-29 2014-07-25 Butamax Tm Advanced Biofuels Expression of hexose kinase in recombinant host cells
WO2011088425A2 (en) * 2010-01-15 2011-07-21 The Regents Of The University Of California Electro-autotrophic synthesis of higher alcohols
JP2013517796A (ja) * 2010-01-29 2013-05-20 ジェノマティカ・インコーポレイテッド p−トルイル酸およびテレフタル酸を生合成するための方法および微生物
MX2012009362A (es) 2010-02-12 2013-05-28 Gevo Inc Microorganismos de levadura con acumulación reducida de subproductos para una producción mejorada de combustibles, químicos y aminoácidos.
US8728550B2 (en) 2010-05-07 2014-05-20 Menon Renewable Resources, Inc. Animal meal that includes fungal biomass
CA2801576A1 (en) 2010-06-17 2011-12-22 Butamax(Tm) Advanced Biofuels Llc Yeast production culture for the production of butanol
US8871488B2 (en) 2010-06-18 2014-10-28 Butamax Advanced Biofuels Llc Recombinant host cells comprising phosphoketolases
BR112012032999B1 (pt) 2010-06-26 2022-11-29 Virdia, Llc Hidrolisado lignocelulósico e métodos de hidrólise ácida e desacidificação para gerar misturas de açúcar a partir de lignocelulose
IL206678A0 (en) 2010-06-28 2010-12-30 Hcl Cleantech Ltd A method for the production of fermentable sugars
WO2012015949A2 (en) * 2010-07-29 2012-02-02 Joule Unlimited Technologies, Inc. Methods and compositions for improving yields of reduced products of photosynthetic microorganisms
WO2012021735A2 (en) 2010-08-11 2012-02-16 Menon & Associates, Inc. Pharmaceutical products from gungal strains
US8932602B2 (en) 2010-08-11 2015-01-13 Menon Renewable Products, Inc. Pharmaceutical products from fungal strains
WO2012027642A1 (en) * 2010-08-27 2012-03-01 Gevo, Inc. Balanced four-step pathways to renewable butanols
IL207945A0 (en) 2010-09-02 2010-12-30 Robert Jansen Method for the production of carbohydrates
CN103339260A (zh) * 2011-01-04 2013-10-02 诺维信公司 从含果胶和木素纤维素的材料产生生物气的方法
US8652804B2 (en) * 2011-02-18 2014-02-18 The Regents Of The University Of California Transcription factor-based biosensors for detecting dicarboxylic acids
US9029124B2 (en) 2011-03-23 2015-05-12 Joule Unlimited Technologies, Inc. Photoalkanogens with increased productivity
GB2524906B8 (en) 2011-04-07 2016-12-07 Virdia Ltd Lignocellulose conversion processes and products
CN102286382B (zh) * 2011-05-20 2013-03-13 桂林理工大学 一种降解叶绿素的菌株及降解方法
JP2013005764A (ja) * 2011-06-24 2013-01-10 National Institute Of Advanced Industrial Science & Technology 大腸菌において混合糖から有機物質を生産する方法
RS54444B1 (sr) 2011-07-12 2016-06-30 Scientist Of Fortune S.A. Rekombinantni mikroorganizmi za proizvodnju korisnih metabolita
US20140342420A1 (en) * 2011-08-22 2014-11-20 Suganit Systems, Inc. Production of bio-butanol and related products
US9617608B2 (en) 2011-10-10 2017-04-11 Virdia, Inc. Sugar compositions
WO2013115959A1 (en) * 2012-02-02 2013-08-08 Bio Architecture Lab, Inc. Methods and compositions for growth of yeast on alginate
CN104245947B (zh) * 2012-02-29 2018-01-05 杜克大学 用于对映选择性反应的新的氧化还原酶
RU2012112651A (ru) 2012-04-02 2013-10-10 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО "АГРИ") САМОИНДУЦИРУЕМАЯ ЭКСПРЕССИОННАЯ СИСТЕМА И ЕЕ ПРИМЕНЕНИЕ ДЛЯ ПОЛУЧЕНИЯ ПОЛЕЗНЫХ МЕТАБОЛИТОВ С ПОМОЩЬЮ БАКТЕРИИ СЕМЕЙСТВА Enterobacteriaceae
EP2862890A1 (en) 2012-05-03 2015-04-22 Virdia Ltd. Method for the extraction of lignin from biomass
KR101522682B1 (ko) * 2012-05-16 2015-05-26 한국생명공학연구원 로도코커스속 bfi332로부터 분리한 인돌-3-아세트알데하이드를 포함하는 생물막 형성 방지 또는 억제제 및 이를 이용한 생물막 형성 방지 또는 억제 방법
WO2013188858A2 (en) 2012-06-15 2013-12-19 Microvi Biotech Inc. Novel biocatalyst compositions and processes for use
US9469574B2 (en) * 2012-07-10 2016-10-18 Los Alamos National Security, Llc Conversion of oligomeric starch, cellulose, or sugars to hydrocarbons
US9751815B2 (en) 2012-07-10 2017-09-05 Los Alamos National Security, Llc Conversion of oligomeric starch, cellulose, hydrolysates or sugars to hydrocarbons
IN2015DN01365A (https=) * 2012-08-28 2015-07-03 Lanzatech New Zealand Ltd
CN103014075B (zh) * 2012-09-20 2014-07-16 江南大学 利用一株安全菌株发酵生物柴油副产物粗甘油生产2,3-丁二醇
MX362055B (es) 2012-12-20 2019-01-07 Archer Daniels Midland Co Productos de hidrogenación obtenidos a partir de ésteres de ácidos carboxílicos derivados biológicamente.
US20160083742A1 (en) * 2013-04-11 2016-03-24 Washington State University Modified Plants for Producing Aroma/Fine/Specialty Chemicals
WO2015002913A1 (en) 2013-07-03 2015-01-08 Butamax Advanced Biofuels Llc Partial adaptation for butanol production
CN103451112B (zh) * 2013-09-02 2015-06-17 中国农业科学院农业资源与农业区划研究所 一株耐盐碱长枝木霉及其应用
US12104160B2 (en) 2013-09-17 2024-10-01 Zymochem, Inc. Production of 4,6-dihydroxy-2-oxo-hexanoic acid
WO2015042201A2 (en) * 2013-09-17 2015-03-26 Zymochem Inc. A high yield route for the production of compounds from renewable sources
CN104561135B (zh) * 2013-10-15 2020-06-26 丰益(上海)生物技术研发中心有限公司 里氏木霉生产芳香物质的方法
MX2016010409A (es) * 2014-02-11 2016-11-30 Pharnext Combinacion de baclofeno, acamprosato y trigliceridos de cadena media para el tratamiento de trastornos neurologicos.
CN107208117A (zh) * 2014-12-16 2017-09-26 新派克股份公司 异丁醇生产的酶促方法
US11078548B2 (en) 2015-01-07 2021-08-03 Virdia, Llc Method for producing xylitol by fermentation
US9770045B2 (en) 2015-02-05 2017-09-26 Board Of Regents, The University Of Texas System Preservation of animal feed and hydrolysis of polysaccharides using amino acids as salts or with acids
CN107849620B (zh) 2015-05-27 2022-01-11 威尔迪亚有限责任公司 用于处理木质纤维素材料的综合方法
JP6907538B2 (ja) * 2015-06-10 2021-07-21 東レ株式会社 3−ヒドロキシアジピン酸の製造方法
CN106398780A (zh) * 2015-07-28 2017-02-15 北京特生物化工有限公司 一种低凝生物柴油及其制备方法
WO2018008787A1 (ko) * 2016-07-04 2018-01-11 서울대학교산학협력단 알지네이트를 이용한 당알코올 형성 방법
EP3577220A2 (en) 2017-02-06 2019-12-11 Zymergen, Inc. Engineered biosynthetic pathways for production of tyramine by fermentation
US11613768B2 (en) 2017-07-25 2023-03-28 Arizona Board Of Regents On Behalf Of Arizona State University Microbial production of 2-phenylethanol from renewable substrates
AU2018356517B2 (en) * 2017-10-23 2024-03-07 Nutrileads B.V. Method of producing a pectic polysaccharide isolate enriched in rhamnogalacturonan-l
KR102093546B1 (ko) * 2017-12-20 2020-04-23 건국대학교 산학협력단 에탄올에서 아세토인의 생산방법
CN109205795A (zh) * 2017-12-21 2019-01-15 向勇 一种复合硝化菌及其生产方法
CN108285881B (zh) * 2018-01-04 2021-06-08 广州大学 一种具有同步产电和反硝化活性的分支杆菌及其应用
MY208453A (en) 2019-04-25 2025-05-09 Zymochem Inc Production of chemicals from renewable sources
WO2021012959A1 (zh) * 2019-07-24 2021-01-28 江南大学 一种褐藻胶裂解酶及其应用
CN110923041A (zh) * 2019-12-17 2020-03-27 沈阳中科腐蚀控制工程技术中心 生物质rna异构氢化酶半烃化稻壳锅炉燃料的方法
CN111187738B (zh) * 2020-02-11 2021-08-20 江南大学 产2,3-戊二酮的嗜热链球菌及其在制备豆乳中应用
CN111334459B (zh) * 2020-03-12 2022-11-25 中国科学院上海高等研究院 一种提高1,3-丙二醇产量的克雷伯氏工程菌构建方法及应用
JP2023518045A (ja) * 2020-03-18 2023-04-27 ランザテク,インコーポレイテッド ガス基質からの2-フェニルエタノールの発酵産生
JP2023518197A (ja) * 2020-03-20 2023-04-28 センビタ ファクトリー、インコーポレイテッド 組換え微生物から有機生成物を生成するためのバイオマニュファクチャリングシステム及び方法
CN112048449A (zh) * 2020-07-31 2020-12-08 南京农业大学 一种堆肥复合菌剂及其应用
KR102191206B1 (ko) * 2020-08-20 2020-12-15 주은바이오주식회사농업회사법인 감귤박의 수분함량을 조절하는 신규 발효공정 및 이를 통하여 제조된 사료 조성물
CN115261293B (zh) * 2021-04-29 2024-02-02 北京化工大学 一种产羟基己二酸的基因工程菌
CN113652366A (zh) * 2021-07-26 2021-11-16 北京联合大学 一种用于厨余垃圾降解的复合微生物菌剂的组合方法
GEAP202416468A (en) 2021-08-31 2024-05-10 Swedish Biofuels Ab Method for producing motor fuel from ethanol
CN114437988B (zh) * 2022-02-28 2023-05-23 贵州医科大学 纤维素降解菌及菌剂、制备方法、应用和降解酒糟的方法
CN114686541A (zh) * 2022-02-28 2022-07-01 北京焉支山科技有限公司 一种化妆品级己糖-6-磷酸组合物的生物酶法合成方法及其应用
EP4540397A2 (en) * 2022-06-14 2025-04-23 Arzeda Corp. Compositions and methods for producing dihydrofurans from keto-sugars
CN115572744B (zh) * 2022-06-30 2025-04-04 中国科学院天津工业生物技术研究所 一种1,4-二羟基-2-丁酮化合物的生物合成方法

Family Cites Families (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US566797A (en) * 1896-09-01 Hannibal w
US785118A (en) * 1904-05-02 1905-03-21 Charles A Pettie Vehicle-tire.
US5162516A (en) * 1988-05-31 1992-11-10 University Of Florida Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis
US5424202A (en) * 1988-08-31 1995-06-13 The University Of Florida Ethanol production by recombinant hosts
US5487989A (en) * 1988-08-31 1996-01-30 Bioenergy International, L.C. Ethanol production by recombinant hosts
US5028539A (en) * 1988-08-31 1991-07-02 The University Of Florida Ethanol production using engineered mutant E. coli
US5000000A (en) * 1988-08-31 1991-03-19 University Of Florida Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes
US5554520A (en) * 1988-08-31 1996-09-10 Bioenergy International, L.C. Ethanol production by recombinant hosts
US5482846A (en) * 1988-08-31 1996-01-09 University Of Florida Ethanol production in Gram-positive microbes
US6849434B2 (en) * 1988-08-31 2005-02-01 University Of Florida Research Foundation, Inc. Ethanol production in recombinant hosts
US7192772B1 (en) * 1988-08-31 2007-03-20 The University Of Florida Research Foundations, Inc. Recombinant cells that highly express chromosomally-integrated heterologous gene
US5821093A (en) * 1988-08-31 1998-10-13 University Of Florida Research Foundation, Inc. Recombinant cells that highly express chromosomally-integrated heterologous genes
US5298421A (en) * 1990-04-26 1994-03-29 Calgene, Inc. Plant medium-chain-preferring acyl-ACP thioesterases and related methods
US5344771A (en) * 1990-04-26 1994-09-06 Calgene, Inc. Plant thiosterases
US5455167A (en) * 1991-05-21 1995-10-03 Calgene Inc. Medium-chain thioesterases in plants
US5424846A (en) * 1993-05-05 1995-06-13 Ohio Electronic Engravers, Inc. Cylinder support apparatus and method for use in an engraver
ATE298799T1 (de) * 1996-03-15 2005-07-15 Max Planck Gesellschaft Exportsysteme für rekombinante proteine
US6102690A (en) * 1997-04-07 2000-08-15 Univ. Of Florida Research Foundation, Inc. Recombinant organisms capable of fermenting cellobiose
US6280986B1 (en) * 1997-12-01 2001-08-28 The United States Of America As Represented By The Secretary Of Agriculture Stabilization of pet operon plasmids and ethanol production in bacterial strains lacking lactate dehydrogenase and pyruvate formate lyase activities
GB9726398D0 (en) * 1997-12-12 1998-02-11 Isis Innovation Polypeptide and coding sequences
WO2002070645A2 (en) * 2001-03-02 2002-09-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Functional surface display of polypeptides
DE10142467A1 (de) * 2001-08-31 2003-03-20 Basf Ag Neue Pyruvatdecarboxylase, ihre Herstellung und Verwendung
US7060217B2 (en) * 2003-06-12 2006-06-13 General Electric Company Composite articles comprising resorcinol arylate polyester and method for making thereof
GB0403992D0 (en) * 2004-02-23 2004-03-31 Isis Innovation Oxidation by hydrogen peroxide
US7413882B2 (en) * 2004-03-25 2008-08-19 Novozymes, Inc. Methods for degrading or converting plant cell wall polysaccharides
US7439034B2 (en) * 2004-06-01 2008-10-21 University Of Maryland Alginases, systems containing alginases and methods of cloning, purifying and/or utilizing alginases
EP2080769A3 (en) 2004-07-02 2010-12-01 Metanomics GmbH Process for the production of fine chemicals
PT103331A (pt) * 2005-08-05 2007-02-28 Fundacao Da Faculdade De Cienc Expressão dum transportador activo de xilose em saccharomyces cerevisiae modificada geneticamente
MX359740B (es) * 2005-10-26 2018-10-09 Du Pont Produccion fermentativa de alcoholes de cuatro atomos de carbono.
US7682811B2 (en) * 2006-01-27 2010-03-23 University Of Massachusetts Systems and methods for producing biofuels and related materials
CA2650773C (en) 2006-05-19 2014-12-02 Jay D. Keasling Microorganisms transformed with acetyl-coa carboxylase and wax synthase for production of fatty acid derivatives
AU2008213200B2 (en) * 2007-02-08 2012-02-16 Gs Caltex Corporation Method for preparing butanol through butyryl-CoA as an intermediate using yeast
CL2008002961A1 (es) * 2007-10-04 2009-05-08 Bio Arch Lab Inc Metodo para convertir un monosacarido u oligosacarido apropiado en un quimico generico que comprende contactar dichos moleculas con un sistema microbiano que comprende uno o mas genes que codifican y expresan una via de biosintesis.
EP2463374A3 (en) * 2008-01-28 2012-12-26 Bio Architecture Lab, Inc. Isolated alcohol dehydrogenase enzymes and uses thereof
WO2010068921A2 (en) 2008-12-11 2010-06-17 Bio Architecture Lab, Inc. Biosynthesis of commodity chemicals
WO2011044279A2 (en) 2009-10-06 2011-04-14 Bio Architecture Lab, Inc. Microbial systems for producing commodity chemicals

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH1069865A (ja) * 1996-07-31 1998-03-10 Chuka Eikan Kofun Yugenkoshi ビデオディスプレイ装置
US8318473B2 (en) 2007-10-04 2012-11-27 Bio Architecture Lab, Inc. Biofuel production
US8211689B2 (en) 2007-10-04 2012-07-03 Bio Architecture Lab, Inc. Biofuel production
US8318464B2 (en) 2007-10-04 2012-11-27 Bio Architecture Lab, Inc. Biofuel production
US8198056B2 (en) 2007-10-04 2012-06-12 Bio Architecture Lab, Inc. Biofuel production
EP2463374A3 (en) * 2008-01-28 2012-12-26 Bio Architecture Lab, Inc. Isolated alcohol dehydrogenase enzymes and uses thereof
US9062314B2 (en) 2008-12-12 2015-06-23 Celexion, Llc Biological synthesis of difunctional alkanes from carbohydrate feedstocks
US8778642B2 (en) 2008-12-12 2014-07-15 Celexion, Llc Biological synthesis of difunctional alkanes from carbohydrate feedstocks
RU2496880C2 (ru) * 2008-12-12 2013-10-27 СЕЛЕКСИОН, ЭлЭлСи Биологический синтез дифункциональных алканов из альфа-кетокислот
US8133704B2 (en) 2008-12-12 2012-03-13 Celexion, Llc Biological synthesis of difunctional alkanes from carbohydrate feedstocks
JP2012511910A (ja) * 2008-12-12 2012-05-31 セレクション, エルエルシー 炭水化物原料からの二官能性アルカンの生物学的合成
US8192976B2 (en) 2008-12-12 2012-06-05 Celexion, Llc Biological synthesis of difunctional alkanes from carbohydrate feedstocks
WO2010068944A3 (en) * 2008-12-12 2010-09-23 Celexion, Llc Biological synthesis of difunctional alkanes from alpha ketoacids
WO2010072220A1 (de) * 2008-12-23 2010-07-01 Schmack Biogas Ag Paenibacillus macerans zur behandlung von biomasse
WO2009086811A3 (de) * 2008-12-23 2009-10-29 Schmack Biogas Ag Paenibacillus macerans zur erzeugung von biogas
WO2010102618A3 (de) * 2009-03-07 2011-02-24 Schmack Biogas Gmbh Mikroorganismen zur verflüssigung von biomasse
US8722385B2 (en) 2009-03-11 2014-05-13 Celexion, Llc Biological synthesis of difunctional hexanes and pentanes from carbohydrate feedstocks
US8404465B2 (en) 2009-03-11 2013-03-26 Celexion, Llc Biological synthesis of 6-aminocaproic acid from carbohydrate feedstocks
US9102961B2 (en) 2009-03-11 2015-08-11 Celexion, Llc Biological synthesis of difunctional hexanes and pentanes from carbohydrate feedstocks
WO2010149859A2 (en) 2009-06-24 2010-12-29 Neste Oil Oyj Method for the production of fat
CN104630279A (zh) * 2009-07-09 2015-05-20 焦耳无限科技公司 用于正烷烃重组生物合成的方法和组合物
US11634735B2 (en) 2009-08-21 2023-04-25 Lallemand Hungary Liquidity Management Llc Production of propanols, alcohols, and polyols in consolidated bioprocessing organisms
US9957530B2 (en) 2009-08-21 2018-05-01 Lallemand Hungary Liquidity Management Llc Production of propanols, alcohols, and polyols in consolidated bioprocessing organisms
CN102666862A (zh) * 2009-08-21 2012-09-12 马斯科马公司 在联合生物加工生物体中生产丙醇、醇和多元醇
WO2011044279A3 (en) * 2009-10-06 2011-10-20 Bio Architecture Lab, Inc. Microbial systems for producing commodity chemicals
US20170058222A1 (en) * 2010-02-08 2017-03-02 Fulcrum Bioenergy, Inc. Fuels and fuel additives that have high biogenic content derived from renewable organic feedstock
WO2011133111A1 (en) * 2010-04-19 2011-10-27 Ngee Ann Polytechnic Trichoderma viride strain for cellulolytic enzyme production
JP2013529088A (ja) * 2010-05-24 2013-07-18 ザイレコ,インコーポレイテッド バイオマス処理
US9206453B2 (en) 2010-05-24 2015-12-08 Xyleco, Inc. Processing biomass
US8697403B2 (en) 2010-05-25 2014-04-15 Neste Oil Oyj Process and microorganisms for production of lipids from lignocellulosic wastes or residues
EP2390341A1 (en) 2010-05-25 2011-11-30 Neste Oil Oyj Process and microorganisms for production of lipids
US9023627B2 (en) 2010-09-15 2015-05-05 University Of Washington Through Its Center For Commercialization Systems and methods for biotransformation of carbon dioxide into higher carbon compounds
US9169182B2 (en) 2011-02-25 2015-10-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Chrysophaentin analogs that inhibit FtsZ protein
EP3048172A4 (en) * 2013-09-17 2017-05-17 Ajinomoto Co., Inc. Method for producing l-amino acid from seaweed-derived biomass
WO2015041265A1 (ja) 2013-09-17 2015-03-26 味の素株式会社 海藻由来バイオマスからのl-アミノ酸の製造方法
US9951356B2 (en) 2013-12-12 2018-04-24 Dow Global Technologies Llc Processes to prepare elongated 2-ketoacids and C6-C10 compounds therefrom via genetic modifications to microbial metabolic pathways
WO2016094604A1 (en) * 2014-12-10 2016-06-16 Dow Global Technologies Llc Genetically modified phenylpyruvate decarboxylase, processes to prepare, and uses thereof
US10260060B2 (en) 2014-12-10 2019-04-16 Dow Global Technologies Llc Genetically modified phenylpyruvate decarboxylase, processes to prepare, and uses thereof
CN107231807B (zh) * 2014-12-10 2021-03-16 陶氏环球技术有限责任公司 基因修饰苯丙酮酸脱羧酶、其制备方法和用途
CN107231807A (zh) * 2014-12-10 2017-10-03 陶氏环球技术有限责任公司 基因修饰苯丙酮酸脱羧酶、其制备方法和用途
US10995322B2 (en) 2016-09-30 2021-05-04 Dow Global Technologies Llc Processes to prepare elongated 2-ketoacids and C5-C10 compounds therefrom via genetic modifications to microbial metabolic pathways
US11236310B2 (en) 2016-09-30 2022-02-01 Dow Global Technologies Llc Process to prepare elongated 2-ketoacids and C-5-C10 compounds therefrom via genetic modifications to microbial metabolic pathways
US11230705B2 (en) 2017-09-29 2022-01-25 Dow Global Technologies Llc Genetically modified isopropylmalate isomerase enzyme complexes and processes to prepare elongated 2-ketoacids and C5-C10 compounds therewith
US11898181B2 (en) 2017-09-29 2024-02-13 Dow Global Technologies Llc Genetically modified isopropylmalate isomerase enzyme complexes and processes to prepare elongated 2-ketoacids and C5-C10 compounds therewith
CN110551654A (zh) * 2019-09-05 2019-12-10 中国农业科学院农业资源与农业区划研究所 阿氏芽孢杆菌、其代谢产物及其应用

Also Published As

Publication number Publication date
CN101889092A (zh) 2010-11-17
AU2008308477A1 (en) 2009-04-09
US20110269215A1 (en) 2011-11-03
CA2699929A1 (en) 2009-04-09
US20110236938A1 (en) 2011-09-29
US8211689B2 (en) 2012-07-03
US20110244553A1 (en) 2011-10-06
WO2009046370A8 (en) 2009-07-23
EP2195440A2 (en) 2010-06-16
NZ584162A (en) 2012-05-25
CL2008002960A1 (es) 2009-05-08
WO2009046375A3 (en) 2009-09-24
US8318464B2 (en) 2012-11-27
US20090155873A1 (en) 2009-06-18
WO2009046370A3 (en) 2009-10-29
WO2009046370A2 (en) 2009-04-09
BRPI0817754A2 (pt) 2014-11-25
CL2008002961A1 (es) 2009-05-08
US8318473B2 (en) 2012-11-27
US20090139134A1 (en) 2009-06-04
US20110256595A1 (en) 2011-10-20
US20130252312A1 (en) 2013-09-26
KR20100091162A (ko) 2010-08-18
US20110236939A1 (en) 2011-09-29
MX2010003501A (es) 2010-06-09
US8198056B2 (en) 2012-06-12
JP2010539988A (ja) 2010-12-24

Similar Documents

Publication Publication Date Title
US8211689B2 (en) Biofuel production
US8003365B2 (en) Biosynthesis of commodity chemicals
US9834795B2 (en) Recombinant microorganisms and uses therefor
AU2012221176B2 (en) Recombinant microorganisms and uses therefor
US20090203089A1 (en) Isolated alcohol dehydrogenase enzymes and uses thereof
WO2011044279A2 (en) Microbial systems for producing commodity chemicals
NZ614459B2 (en) Recombinant microorganisms and uses therefor

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880119281.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08834856

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2699929

Country of ref document: CA

Ref document number: 2008834856

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2008308477

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 584162

Country of ref document: NZ

Ref document number: 12010500619

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 1713/CHENP/2010

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: MX/A/2010/003501

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2010528192

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2008308477

Country of ref document: AU

Date of ref document: 20081003

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20107009150

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PI 2010001306

Country of ref document: MY

ENP Entry into the national phase

Ref document number: PI0817754

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20100405