WO2008062136A2 - Methode de diagnostic et de suivi d'une vaginose bacterienne par quantification moleculaire - Google Patents

Methode de diagnostic et de suivi d'une vaginose bacterienne par quantification moleculaire Download PDF

Info

Publication number
WO2008062136A2
WO2008062136A2 PCT/FR2007/052368 FR2007052368W WO2008062136A2 WO 2008062136 A2 WO2008062136 A2 WO 2008062136A2 FR 2007052368 W FR2007052368 W FR 2007052368W WO 2008062136 A2 WO2008062136 A2 WO 2008062136A2
Authority
WO
WIPO (PCT)
Prior art keywords
specific
sequence
dna
sequences
lactobacillus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FR2007/052368
Other languages
English (en)
French (fr)
Other versions
WO2008062136A9 (fr
WO2008062136A3 (fr
Inventor
Florence Bretelle
Florence Fenollar
Mireille Henry-Mary
Jean-Pierre Menard
Didier Raoult
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aix Marseille Universite
Original Assignee
Universite de la Mediterranee Aix Marseille II
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite de la Mediterranee Aix Marseille II filed Critical Universite de la Mediterranee Aix Marseille II
Priority to AT07866534T priority Critical patent/ATE519865T1/de
Priority to JP2009537684A priority patent/JP2010509932A/ja
Priority to EP07866534A priority patent/EP2087134B1/fr
Priority to US12/312,711 priority patent/US20100075306A1/en
Publication of WO2008062136A2 publication Critical patent/WO2008062136A2/fr
Publication of WO2008062136A3 publication Critical patent/WO2008062136A3/fr
Anticipated expiration legal-status Critical
Publication of WO2008062136A9 publication Critical patent/WO2008062136A9/fr
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • the present invention relates to a method for diagnosis and in vitro monitoring of the state of the vaginal bacterial flora with regard to the presence of a bacterial vaginosis (BV) or its evolution, if necessary for monitoring its taking into account. therapeutic load.
  • BV bacterial vaginosis
  • BV has been defined from a microbiological point of view by a virtual disappearance of the normal vaginal flora mainly composed of lactobacilli in favor of other bacteria, including Gardnerella vaginalis, Mobiluncus spp. and genital mycoplasmas [Spiegel CA, CMR 1991; Thorsen P, AJGO 1998].
  • BV is a frequent reason for medical consultation, it is particularly implicated in susceptibility to sexually transmitted infections such as HIV, and for large pregnancies in the prematurity and birth of children with small weights. Its prevalence in women, including during pregnancy, is between 8 and 23% [Guise JM, AJPM 2001] according to current methods of investigation.
  • the Nugent score is the most commonly reported method in the literature, considered by some to be the reference technique, although it is not routinely performed in clinical microbiology laboratories because of the tedious nature of its implementation. [Fredricks DN, NEJM 2005; Thomason JL, AJOG 1992; Ison CA, STD 2002; Nugent RP, JCM 1991].
  • the Nugent score identifies VB through semiquantitative morphological analysis of bacteria after Gram staining. It is therefore a subjective technique whose reproducibility has been called into question [Sha BE, CWY 2005; Schwebke JR, OG 1996].
  • Atopobium vaginae is the main new bacterial species characterized. Its presence has been correlated with BV in some articles without however, a reliable quantitative assessment of its relative place in relation to other microorganisms has been made [Bradshaw CS, JID 2006, Rodriguez JM, IJSB 1999; Ferris MJ, BMCID 2004; Ferris MJ, JCM 2004; Verhelst R, BMCM 2004].
  • JID 2006 a relationship between the detection of A. vaginae and G. vaginalis bacteria and VB is described, but these results are insufficient to perform BV diagnosis and / or follow-up of VB evolution. reliable. Indeed, the data presented in this work allow the detection of said bacteria and not their actual quantification. In addition, this screening showed good sensitivity, with A. vaginae and G. vaginalis detected in 96% and 99% of patients with BV, respectively. However, its specificity is poor because A. vaginae is detected in 12% of patients with normal flora and G. vaginalis in 60%.
  • vaginalis being detected in only 49% and 71%, respectively, of patients with BV (Table 1).
  • 16 patients (28%) with a relapse of BV after treatment had a G. vaginalis concentration below the given threshold (Table 3).
  • Forty patients (70%) with relapse of BV also had a concentration below the A.
  • the authors'"semi-quantitative" approach is therefore not applicable as a diagnostic tool and for immediate follow-up of patients.
  • the techniques used to obtain these results were insufficient on several points. Firstly, PCR techniques were not sufficiently sensitive because the molecular targets amplified too long fragments (430 bp ribosomal RNA fragment for ⁇ . Vaginae and 291 base pairs for G. vaginalis).
  • the object of the present invention is to provide a method of diagnosis and monitoring of BV that is both more reliable, more accurate and easier to implement routinely in clinical microbiological analysis laboratories.
  • the inventors studied the vaginal samples of 204 pregnant women, and looked for the presence of each microorganism involved in BV, by developing a real-time PCR method allowing the detection of specific DNA bacteria and determination of the bacterial load by means of an established plasmid range through the construction of a standard plasmid.
  • This plasmid comprises the DNA fragments specific for said bacteria to be amplified and quantified and the human albumin gene used as a control of the quality of the DNA sample and the molecular amplification as well as the richness of the DNA. biological sample.
  • the target microorganisms studied ⁇ l ⁇ Lactobacillus sp., G. vaginalis, mobiluncus curtisii, mobiluncus mulieris, Ureaplasma urealyticum, Mjcoplasma hominis ⁇ . vaginae, and Candida albicans) were those described as possibly involved in BV and / or prematurity.
  • the results of the quantification of the various microorganisms obtained by molecular biology were compared with the classification by the Nugent score.
  • bacteria of the genus Lactobacillus sp ⁇ l. Normally present in the vagina, have a concentration which decreases and it has been shown according to the present invention that, below a certain threshold concentration quantification of these bacteria l ⁇ Lactobacillus sp. reliably diagnoses BV. Finally, he has been shown that a change in the ratio of concentrations of Lactobacillus sp. The addition of A. vaginae and G. vaginalis concentrations makes it possible to reliably evaluate the evolution of BV.
  • the present invention provides a method for diagnosis and in vitro monitoring of the state of the vaginal bacterial flora with regard to the presence of bacterial vaginosis, and where appropriate for monitoring its therapeutic treatment, characterized in that
  • the detection and quantification of said amplified fragments being carried out using probes labeled with sequences distinct from those of the amplification primers for each of said specific sequences of said Atopobium vaginae and Gardnerella vaginalis bacteria and said sequence specific for a human gene present in any biological sample containing human cells, and - 2 / the presence of a bacterial vaginosis or the failure of the current therapeutic treatment is determined if the DNA fragment concentrations of the two so-called specific sequences of the bacteria Atopobium vaginae and Gardnerella vaginalis, respectively, in a sample of vaginal secretions of a patient containing at least 10 4 human cells / ml, are such that at least one of the following conditions 2 a) and b) is respected:
  • the Ca concentration of said DNA fragment to A.topobium vaginae is greater than or equal to 10 8 copies / ml
  • the Cg concentration in said Gardnerella vaginalis DNA fragment is greater than or equal to 10 9 copies / ml.
  • a concentration of Atopobium vaginae bacteria greater than or equal to the threshold of 108 can detect about 90% of vaginoses.
  • the quantification of the bacterium Gardnerella vaginalis comes in addition in the case where the concentration of Atopobium vaginae would be below the threshold of 10 8 bacteria / ml, to detect a vaginosis, because the threshold of detection of G. vaginalis greater than or equal to 10 bacteria / ml alone would detect only about half of the vaginoses. Therefore, according to the present invention, it is necessary to quantify DNA concentrations for both bacteria.
  • the development of bacterial vaginosis is confirmed if the Ca, Cg and Cl concentrations of at least three fragments of specific sequences present in a single copy in the DNA of bacteria ⁇ . vaginae (Ca), G. vaginalis (Cg) and respectively the Lactobacillus sp ⁇ . (Cl) in the DNA extracted from a female vaginal secretion sample are such that the ratio of Cl / (Ca + Cg) concentrations decreases between the 2 samples taken successively over time at a sufficient time interval, preferably at least 1 month.
  • vaginosis an aggravation of a vaginosis already detected or, in some cases, a risk of occurrence vaginosis, that is to say, an imbalance or abnormality of the vaginal flora may become pathological.
  • Cl / (Ca + Cg) decreases or does not increase between the 2 samples taken at sufficient time interval, preferably at least 1 month.
  • the Lactobacillus sp bacteria are further quantified. comprising at least the bacteria Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus jenseneii, Lactobacillus gasseri and Lactobacillus iners,
  • the detection and quantification of said amplified fragments being carried out using probes labeled with sequences distinct from those of the amplification primers for each of said specific sequences of said Atopobium vaginae, Gardnerella vaginalis and Lactobacillus sp. and said specific sequence of a human gene present in any biological sample containing human cells, and - b / in step 2 /, bacterial vaginosis is determined whether, in addition, the Cl concentration of the specific DNA fragment of the said bacteria Lactobacillus sp ⁇ . is less than or equal to 10 copies / ml, preferably less than or equal to 10 7 copies / ml.
  • the concentration of bacteria in the genus Lactobacillus sp ⁇ . is not sufficient to conclude the presence of bacterial vaginosis, but comes in addition or confirmation in the case where the conditions of A. vaginae and G. vaginalis are combined.
  • bacterial vaginosis is determined if said concentrations are such that the following 3 conditions are met:
  • said concentrations of Ca, Cg or Cl are determined by enzymatic amplification of PCR-type real-time quantification of the DNA of said DNA fragments of specific sequences bacteria respectively Atopobium vaginae, Gardnerella vaginalis and optionally the Lactobacillus sp ⁇ as well as, preferably, a human DNA fragment present in any human biological sample containing cells.
  • said specific sequences of said bacteria Atopobium respectively vaginae, Gardnerella vaginalis, and optionally l ⁇ Lactobacillus sp. have a size of 70 to 150 nucleotides, preferably 90 to 120 nucleotides. More preferably, real-time PCR amplification and quantification reactions are carried out, using specific hydrolysis probes respectively of each of said specific sequences of said bacteria and a sequence specific for a human gene present in any sample. containing human cells in the test sample.
  • the real-time PCR technique consists of conventional PCR using forward and reverse sequence primers, and includes amplified product detection based on fluorescence emission measurement proportional to the amount of amplified genes with a probe. called "hydrolysis".
  • said probe is labeled with a fluorescence emitter or 5 'fluorophore and a 3' fluorescence emission blocking agent.
  • This blocking agent absorbs the fluorescence emitted when the fluorophore and the blocking agent are close.
  • the fluorophore and the blocking agent are separated, the fluorescence emission is no longer absorbed by the blocking agent.
  • the Taq polymerase causes a hydrolysis of the probe and thus a release of the nucleotides and the fluorophore in solution.
  • the fluorescence emission will therefore be proportional to the number of amplifiers.
  • the principle of real-time PCR relies on the ability of Taq polymerase during the elongation step to hydrolyze a hybridized probe on the DNA to be copied, this hydrolysis allowing fluorescence emission, which allows quantification.
  • two different targets can be quantified by introducing into the reaction mixture two primers and one probe directed against a first target, and two other primers and probe directed against the other target. Both probes are labeled with different fluorophores.
  • a large synthetic DNA fragment is used as a DNA quantification calibration standard, said large synthetic DNA fragment grouping said specific sequences respectively of each of said bacteria whose concentrations are quantified, and said human DNA sequence specific of human cells.
  • the presence of several molecular targets on the same nucleic fragment makes it possible to quantify different targets in the same sample and to homogenize them homogeneously, the quantification using the same calibration range of several molecular species, allowing the comparison of the effectiveness of the different PCR reactions between them and from one determination to another over time and avoids biases related to the positive control.
  • specific sequence of said bacterium is meant a sequence of the genome of said bacterium that is not found in any other living organism genome.
  • DNA fragment is meant a DNA or oligonucleotide fragment whose sequences are written below in the 5 '-> 3' direction.
  • said specific sequences of said bacteria comprise:
  • l ⁇ Lactobacillus sp
  • a sequence common to the bacteria l ⁇ Lactobacillus crispatus, l ⁇ Lactobacillus jenseneii, l ⁇ Lactobacillus gasseri, the ⁇ Lactobacillus INERI and ⁇ Lactobacillus acidophilus within the gene / "/ encoding factor elongation at positions 253 to 343 of the Genebank reference gene AY 562191.1.
  • said specific sequences of said bacteria are the following sequences including probe sequences (underlined) flanked by primer sequences (in bold) or their reverse and complementary sequences for the antisense primers: - for A-topobium vaginae:
  • Seq. # 2 5'-CCCTATCCGCTCCTGATACCGGCAGGCTTGAGT CTGGTAGGGGAAGATGGAATTCCAAGTGTGAAATGCGCAGATATT TGG 3 '
  • Seq. # 3 5'-CGCATCTGCTAAGGATGTTGAAACATCGTTTAA GGCTACTGCAACTATTTCTGCAGCAGATCCTGAAGTTGGCGAAAAG ATTGCTG-3 '
  • quantification of the human cells present in said sample is carried out, as a control of the richness of the sample, of the quality of the extraction of the sample. DNA, and the potential presence of inhibitors of the PCR reaction.
  • this quantification is a means of normalization between two samples taken at different times. Indeed, the calculation of the number of microorganisms per million human cells allows a rigorous inter-sample comparison.
  • the albumin gene is present only in 2 copies in human cells and the measurement of the signal of this sequence thus allows the quantification of the number of initial human cells in the sample.
  • the present invention thus contains a quality molecular control allowing systematization of the diagnosis with reliable quantification.
  • Quantification of the cells also makes it possible to detect the absence of the limiters of the PCR reaction. Indeed, when the sample is tested by PCR at different dilutions, the amount of albumin detected increases when the dilutions are increased in the presence of the limiters, whereas it decreases when the dilutions are increased in the absence of the reaction limiters. PCR.
  • quantification of the human DNA contained in said sample is further carried out, and said large DNA fragment further comprises a specific sequence of human DNA in the test sample such as a specific sequence of the sample. albumin.
  • said specific sequence of human DNA in the test sample comprises the fragment of positions 16283- 16423 of exon 12 of the reference human albumin gene.
  • Seq. # 1 5 'GCTGTCATCTCTTGTGGGCTGTAATCATCGTTTA AGAGTAATATTGCAAAACCTGTCATGCCCACACAAATCTCTCCCTGG CATTGTTGTCTTTGCAGATGTCAGTGAAAGAACCAGCAGCTCCC ATGAGTTT-3', preferably a sequence Seq. No. 1 modified by insertion of a cleavage site, in particular the XhoI site (sequence in parentheses) outside the sequences corresponding to the primers (bold sequences) and probe sequence (underlined sequence) such as the Seq sequence. n ° 17.
  • amplification and quantification reactions are carried out by implementing sets of primers and hydrolysis probes specific for each of the different bacteria known as specific sequences of each of said bacteria to be tested, and where appropriate.
  • a specific sequence of human DNA in the sample to be tested such as a specific sequence of human albumin, and said specific sequence comprises a probe sequence flanked by sequences able to serve as a primer in an amplification reaction of the type PCR of said specific sequences.
  • Probe is understood here to mean an oligonucleotide, more preferably 20 to 30 nucleotides, which hybridises specifically with said specific sequence and thus makes it possible to detect and quantify it specifically by measuring the increase in bound fluorescence of the PCR reaction.
  • the probe makes it possible to detect the amplified specific DNA and to quantify it by comparing the intensity of the signal with that of the standard of quantification.
  • primer is meant herein an oligonucleotide of preferably 15 to 25 nucleotides which specifically hybridizes with one of the two ends of the sequence that the DNA polymerase will amplify in the PCR reaction.
  • Seq. # 5 5'-CCCTATCCGCTCCTGATACC-S '
  • Seq. # 8 5'-CGCATCTGCTAAGGATGTTG-S '
  • Seq. # 14 5'-GCTGTCATCTCTTGTGGGCTGT-S '
  • Seq. # 15 3'-AAACTCATGGGAGCTGCTGGTTC-S '
  • said large synthetic DNA fragment constituting the DNA of the standard quantization calibration sample is inserted into a plasmid.
  • a restriction enzyme cleavage site is advantageously introduced into at least one of the synthetic molecular targets. This site is missing on the natural sequence. So, by enzymatic cleavage and analysis of the amplified fragment on agarose gel, or using a real-time PCR probe that specifically recognizes the restriction site, it can thus detect the possible presence of the contaminating plasmid.
  • a PCR-type enzymatic amplification reaction of the DNA of at least one said specific sequence of at least one of said agents is carried out in the DNA extracted from said samples to be tested and in the DNA of the standard calibration sample, using at least one pair of primers capable of amplifying both said authentic specific sequence and said modified specific sequence,
  • Enzymatic digestion of the PCR product obtained with an enzyme corresponding to the cleavage site and agarose gel analysis of the digest was performed in comparison with the non-digested restriction enzyme PCR product.
  • the digested fragment is from the amplification of the molecular target inserted into the control plasmid, it contains the restriction site, and it will be smaller in size than the undigested fragment.
  • a real-time PCR reaction is carried out with direct and reverse primers of one of the molecular targets, and a probe specific for said exogenous sequence containing the restriction site.
  • a fragment from the control plasmid and containing the exogenous sequence can be amplified. More particularly, a so-called specific sequence of human DNA is used in the test sample which comprises the fragment of positions 16283- 16423 of exon 12 of the Genebank M12523.1 reference human albumin gene modified by insertion of a cleavage site, in particular the XhoI site, outside the sequences corresponding to the primers (sequences in bold) and probe sequence (underlined sequence) of the sequence of the following sequence listing:
  • Seq. # 17 5 'GCTGTCATCTCTTGTGGGCTGTAATCATCGT (C TC GAG) TTAAGAGTAATATTGCAAAAC CTGTCATGC C CACACAAATC TCTCCCTGGCATTGTTGTCTTTGCAGATGTCAGTGAAAGAACCA GCAGCTCCCATGAGTTT-3', comprising the XhoI site (in parentheses) outside the sequences corresponding to the primers (bold sequences) and probe sequence (underlined sequence).
  • a plurality of PCR enzyme amplification reactions, simultaneous or not, of each of said specific sequences of said bacteria are used with the same large standard synthetic DNA fragment, using a plurality of different sets of specific primers of each of the different said specific sequences of each of said bacteria, the sequences of the different primers not intersecting between the different said bacteria and said primers can be implemented in an enzymatic amplification reaction carried out according to the same protocol and, in particular, at the same hybridization temperature.
  • a large first synthetic double-stranded DNA fragment of determined sequence comprising: a sequence in a determined order of a plurality of n second contiguous small synthetic DNA fragments, consisting essentially of the dimerization of a plurality of n oligonucleotides by enzymatic amplification using a heat-resistant polymerase enzyme comprising:
  • a first PCR nucleic acid amplification reaction step in the presence of a said polymerase enzyme, a series of n oligonucleotides of defined sequences, without exogenous primers, comprising a series of cycles under temperature conditions; allowing the hybridization of said oligonucleotides, followed by an elongation of the complex obtained, intended to put said oligonucleotides in sequence, in sequence, the sequences of said oligonucleotides corresponding successively and alternately to the sense and antisense sequences of the so-called second synthetic fragments , and each said oligonucleotide containing in its 5 'and 3' regions sequences complementary to those of the following and previous oligonucleotides, if any, and
  • the construction technique thus consists, from the target sequences, of choosing the sequences of the oligonucleotides, with alternating oligonucleotides of direct (“sense") or inverse (also called “reverse” or “antisense”) sequences.
  • alternating oligonucleotides of direct (“sense") or inverse (also called “reverse” or “antisense") sequences In order to make it possible to put end to end of these oligonucleotides, care is taken to introduce in 3 'of the sequence of an oligonucleotide a nucleotide sequence complementary to the first nucleotides of the following oligonucleotide.
  • oligonucleotides will be hybridized by their complementary parts, and thanks to the activity
  • polymerase for example Taq polymerase
  • Taq polymerase is synthesized from 5 'to 3' in order to obtain double-stranded fragments.
  • the final (assembled) fragment is synthesized by PCR using a pair of forward and reverse primers corresponding to the end sequences of the desired first large double stranded synthetic DNA fragment.
  • said large synthetic DNA fragments are advantageously inserted into a plasmid.
  • This technique of generic construction of a synthetic nucleotide fragment allows the contiguity of several molecular targets of interest. It is a simple method to implement, fast and reliable, and does not require heavy equipment and expensive.
  • the present invention also relates to a diagnostic kit useful for the implementation of a method for diagnosing and monitoring a vaginosis according to the invention, characterized in that it comprises:
  • FIG. 1A represents the analysis of microbial loads of bacterial vaginosis defined by the Nugent score quantified by real-time PCR according to the present invention.
  • FIG. 1B represents the analysis of the microbial charges of 167 normal flora defined by the Nugent score quantified by real-time PCR according to the present invention.
  • FIG. 2 represents the analysis of the microbial charges of 44 intermediate flora identified by the Nugent score quantified by real-time PCR according to the present invention.
  • FIG. 3 shows 25 bacterial vaginoses identified on molecular and quantified criteria according to the present invention from the group of 44 intermediate flora defined by the Nugent score.
  • FIG. 4 shows 19 normal flora identified on molecular and quantified criteria according to the invention. the present invention after applying the molecular criteria of bacterial vaginosis to the group of 44 intermediate flora identified by the Nugent score.
  • a second is placed in a specific transport medium (R1 Urea-Arginine LYO 2, BioMérieux SA, Marcy l'Etoile, France) for the research of genital Mycoplasma (M. hominis and M. urealjticum).
  • a cytobrush is used for plating and staining of Gram.
  • MEM transport medium Minimum Essential Medium, Invitrogen Life Technologies, Carlsbad, CA, USA. It is frozen at -80 0 C from its arrival in the laboratory until its use.
  • Trichomonas vaginalis The search for Trichomonas vaginalis is performed by a fresh examination between slide and coverslip under an optical microscope (10X objective).
  • Gram staining is used to establish the Nugent score according to a semi-quantitative evaluation of 3 bacterial morphotypes (Table 1). Depending on the score, three vaginal flora are identified: a normal flora (FN) for a score of 0 to 3, an intermediate flora (FI) for a score of 4 to 6 and a BV for a score greater than 7.
  • vaginal samples are inoculated on 3 culture media: Columbia ANC agar plus 5% sheep blood (BioMérieux), PoIy Vitex PVX chocolate agar (BioMérieux), CHOC VCAT agar (BioMérieux) incubated at 37 ° C for 48 hours. hours.
  • the specimens are inoculated on a specific kit (Urea-Arginine LYO 2, BioMérieux) and then incubated at 37 ° C and then inoculated on anaerobic culture media (BioMérieux) for 48 hours.
  • the protocol is modified as follows: incubation for 12 hours at 56 ° C. of 200 ⁇ l of sample for 200 ⁇ l of lysis buffer and 20 ⁇ l of proteinase K. The lysate is treated according to the manufacturer's recommendations. The DNA is eluted in 100 ⁇ l of elution buffer and then stored at -20 ° C.
  • the inventors selected targets on all potential vaginosis agents, including agents with uncertain roles. Surprisingly, the most significant target Atopobium vaginae was not considered an essential agent.
  • the retained targets are located on the sequence of the gene coding for the chaperone protein of 60 KDa (Cp »60) for G. vaginahs and M. curtisn, on that of the 16S RNA for M. muhens and ⁇ . vaginae, the fts Y gene for M. hominis, the uretase gene for U. urealyticum, the topoisomerase III gene for C. albtcans.
  • the Lactobacillus sp For the Lactobacillus sp.
  • Target a sequence common to: cnspatus, Jensentt, Lactobacillus gassen, Lactobacillus iner, and Lactobacillus acidophilus are chosen, they are located on the gene coding for the elongation factor (tuf).
  • a sequence located in exon 12 of the human albumin gene is chosen to attest to the presence and amount of DNA in the test sample.
  • a couple primer senses and antisense are chosen on the previously defined target sequences using the Primer 3® program (http://frodo.wi.mit edu / p ⁇ mer3 / p ⁇ mer3_code .html).
  • the primers and probes are described in Appendix 1 below.
  • Each primer and probe are analyzed on the NBCI website (http://WWW.ncbi.nlm.nih.gov/BLAST/) to ensure their specificity. in sihco (Annex 1).
  • the recognition pairs of microorganisms are arbitrarily chosen: one of the probes being labeled FAM and the other being labeled VIC. Four pairs of PCR are thus defined.
  • VOC urealyticum
  • FAM human albumin
  • Mjcoplasma hominis (FAM) will be quantified alone.
  • the primers are synthesized by Eurogentec® (Seraing, Belgium), and the probes by Applied Biosystems (Warrington, Cheshire, UK).
  • the DNA extracted from reference bacterial strains was used in three dilutions (l / 10th, l / 100th, l / e 1000) for the development real-time PCR (determination of relative amounts of primers and probes, specificities, cross reactivities).
  • Each strain is tested with the primers and the specific probe but also with the probes and primers of the 7 other microorganisms and those of the human albumin.
  • CT cycle threshold
  • the quantities of primers and probes necessary for obtaining optimal amplification in single and double fluorescence are defined by testing the amplification reactions on a bacterial DNA mixture of the 8 equimolar reference strains, as well as 'with pure strains, for a final concentration of 1 / 10th in both cases.
  • the experimental conditions chosen are those for which the CT values are identical to those obtained in simple fluorescence.
  • the genomic DNA samples from 40 different bacterial strains (Annex) other than 8 reference bacterial strains are tested in dilution 1 / 10th. All of these tests are performed taking care to introduce during each amplification reaction negative controls containing no DNA or positive controls (DNA mixture of the 8 reference strains). Specificity is tested with all four PCR couples in real time as well as
  • the nucleotide sequence of the hybridizing quantization fragment is obtained by aligning the target sequences of the PCRs in real time for the 8 microorganisms as well as those of the human albumin. We obtain a hybrid fragment of 931 base pairs described in Appendix 2 below.
  • the sequence of the hybrid nucleotide fragment is divided into 6 consecutive oligonucleotide fragments described in Appendix 3.
  • 10 nucleotides complementary to the 3 'end on the upstream oligonucleotide are added to the 5 'end of the downstream oligonucleotide.
  • the sizes of the 6 oligonucleotide sequences range from 155 to 172 nucleotides.
  • the consecutive oligonucleotides are alternately in direct sequence and reverse. Thus, oligonucleotides 1, 3 and 5 are used in direct sequence form, while oligonucleotides 2, 4 and 6 are used in reverse sequence.
  • the double-stranded nucleotide fragment is constructed by amplification reaction thanks to the complementarity of the ends of two adjacent oligonucleotides. Two successful PCRs are needed.
  • the 6 oligonucleotides are introduced in equimolarity (0.2 mMol), with 1 X MgCl 2 polymerase buffer (1.5 mMol), the dNTPs (0.2 mMol), 0.2 ⁇ l of Taq Roche (Roche®) at 5 IU / ⁇ l, in a reaction volume of 50 ⁇ l.
  • the amplification program is: 95 ° C 2min, followed by 40 cycles comprising 94 ° C 30 sec (denaturation), 37 ° C 1 min (hybridization), 72 ° C 1 min 30 sec (elongation).
  • PCR fragment containing the expected oligonucleotide motifs end-to-end (Appendix 4).
  • One ⁇ l of amplification product of the first PCR is added to the following reaction mixture: Hotstar polymerase buffer (Qiagen®) 1 X MgCl 2 (1.5 mMol), dNTPs (0.2 mMol), 0.2 ⁇ l of Hotstar (Qiagen®) at 5 IU / ⁇ L, 0.2 mMol of sense and antisense construction primers.
  • the PCR program is: 95 ° C 15 min, followed by 95 ° C 30s, 58 ° C 45 sec, 72 ° C 2 min 40 cycles, 72 ° C 5 min.
  • the PCR fragment obtained is analyzed on a 1.5% BET agarose gel in 0.5 ⁇ TBE buffer. If the size of the fragment is consistent with the size it is purified using the QIAquick® PCR Kit Purification Kit 250 PCR Qiakit (Qiagen®).
  • Two ⁇ l of the previously obtained fragment are introduced into a ligation reaction mixture containing 5 ⁇ l of ligase buffer, 1 ⁇ l of ligase and 1 ⁇ l of PGEM plasmid (pGEM®-T Easy Vector System Kit 2 Promega®, Madison, Wiconsin, USA). linearized and dephosphorylated. The final volume is 1 ⁇ l.
  • the ligation product is incubated at 15 ° C overnight. Seven ⁇ l of the ligation product are mixed with 50 ⁇ l of competent cells (Escherichia coli JM 109) maintained for 20 minutes in ice and then incubated for 1 minute at 42 ° C.
  • the colonies of. coli recombinant are collected for analysis by PCR: 5 .mu.l of bacterial suspension in distilled water, the pair of M13 primers (10 .mu.m / .mu.l) and the PCR reaction medium described above.
  • the PCR program is identical to that used for the second stage of construction.
  • the PCR products obtained are analyzed on 1.5% Agarose gel in 0.5 X TBE buffer.
  • the fragments of the expected size are purified using the Qiaquick® PCR Kit Purification Kit 250 Qiakit (Qiagen®).
  • a first dilution of the initial plasmid solution at 1/2500 e makes it possible to adjust the concentration at the first stage of the plasmid range, ie the 7 copies / 5 ⁇ l point of plasmid solution.
  • a dilution cascade in steps of 10 makes it possible to create the successive steps of the range (from 10 7 copies to 1 copy for 5 ⁇ l of solution).
  • Quantification reactions are performed by PCR in real time on the DNA extracts of the vaginal samples.
  • 4 negative controls NTC
  • the plasmid calibration range (10 7-1 copies per well)
  • 24 samples to be tested pure and diluted 1/10 th and 1/100 th to search for inhibitors.
  • Negative controls as well as points in the plasma range are tested in duplicate.
  • 4 double fluorescence PCR plates and one single fluorescence plate are made.
  • the kit “Quantitect Probe PCR Kit” (Qiagen®) containing the reaction mixture 2X as associating Taq polymerase buffer and Taq polymerase (Hotstar), dNTP and dUTP.
  • the sense and antisense primers and the probes necessary for carrying out the PCR in single or double fluorescence according to the reported experimental conditions described in Appendix 6.
  • diluted or non-diluted samples and plasmid range points are 5 ⁇ l and 0.25 ⁇ l of UDG (Uracil DNA glycosylase at 100 units, Sigma-Aldrich, Lyon, France) is added to a final reaction volume of 25 ⁇ l.
  • PCR reactions are performed on Stratagene® MX 3000P (La Jolla, California). The amplification program was as follows: 2 minutes at 50 0 C, 15 minutes at 95 ° C, followed by 45 PCR cycles comprising denaturation at 95 ° C for 30 seconds then the hybridization phase and elongation 60 0 C for 1 minute.
  • the bacterial load is defined as follows.
  • the quantification in DNA copy number of each microorganism for 5 .mu.l of DNA extract is reported in number of bacteria per 1 ml of initial sample.
  • the volume of elution of the DNA 100 ⁇ l
  • the volume of the transport medium per initial sample 200 ⁇ l
  • the value obtained for each microorganism in terms of number of copies per 5 ⁇ l of DNA extract is multiplied by 10 2 to obtain a concentration in number of bacteria per ml of sample, since an elution volume of 100 ⁇ l of DNA extracted from 200 ⁇ l of sample.
  • each bacterial quantification threshold (from 10 3 / ml to 10 / ml) is studied according to the sensitivity, specificity, positive and negative predictive value calculated according to the identification by the FN and BV thresholds previously defined by the Nugent score. Quantification thresholds, taken singly or in combination, with the best sensitivity and specificity are retained as molecular criteria for identification of BV.
  • the culture makes it possible to isolate G. vaginalis, C. albicans, M. hominis, U. urealjticum as well as Streptococcus agalatiae (Table 1). None of the vaginal specimens examined showed T. vaginalis on direct examination.
  • Bacterial quantification for each sample is provided by the plasmid dilution range.
  • the 8 points of the plasmid range from 10 7 copies to 1 copy per 5 ⁇ l, are tested.
  • the range point 10 7 copies is identified early for a CT around 17.
  • 1 copy the detection is later with a CT at 37.
  • the amplification reaction is linear.
  • the graphical representation gives a line whose slope varies from -3.2 to -3.5. This linearity is confirmed by testing the pure strains diluted to 1 / 10th, 1 / 100th and e / 1000 e.
  • a threshold of positivity is defined above 10 copies (ie 10 3 bacteria / ml), regardless of the type of microorganism considered (Table 2). Indeed, statistically, the amplification of the point "1 copy” is as safe in 75% while it is 100% for the point "10 copies”.
  • each sample is tested undiluted solution, diluted to the tenth and hundredth. In a reproducible manner, the detection of the amplification product follows the dilution step, since a dilution to the tenth corresponds to a markup of 3 CT.
  • the median concentration of ⁇ Lactobacillus sp. is significantly lower (/> ⁇ 0.0001) for BV (median concentration of 3.10 3 / rnl) only for FN (median concentration of 5.7.10 / ml).
  • M. mulieris is not identified (positivity threshold ⁇ 10 3 / ml) in any of the BVs or FNs.
  • Quantification threshold analysis for A. vaginae and G. vaginalis taken alone has the best sensitivity, specificity, positive and negative predictive values for the molecular identification of VB and FN defined by the Nugent score (Table 1). 4).
  • vaginal flora in FN (71%), VB (10%) and FI (19%) according to the Nugent score is consistent with those reported in the literature in France [Goffinet F, EJOGR 2003], in Europe [Guise JM, AMJPM 2001] and the United States [Delaney ML, OG 2001].
  • the originality of the present invention is to have established a rational tool for identifying the vaginal flora by combining the specific detection technique by real-time PCR and the relative quantification by a calibration plasmid.
  • A. vaginae This bacterium was identified for the first time in 1999 by amplification and sequencing of 16S RNA from a vaginal sample of suj and healthy [Rodriguez JM, IJSB 1999].
  • A. vaginae was isolated by culture in a tubo-ovarian abscess specimen, suggesting a pathogenic role for the bacterium [Geis sdorfer W, JCM 2003].
  • a 16S RNA amplification approach coupled with cloning techniques enabled the detection of the bacterium in intraoperative specimens in patients with salpingitis [Hebb JK, JID 2004].
  • this bacterium is of frequent identification in 19 of VB (95%) and 1 of 167 FN (69%).
  • the most discriminating criterion for the diagnosis of BV and NF is a concentration of A. vaginae ⁇ 10 8 / ml with a sensitivity of 90% (1 8 cases out of 20 VB) and a specificity of 99% (1 case out of 167 FN).
  • A. vaginae is lacking in the Nugent score despite its prominent place in abnormalities of the vaginal flora. Its identification by morphological criteria is not adapted. Its variable morphology in the form of a small gram-positive coccobacillus (0.6-0.9 ⁇ m) sometimes grouped together in pairs or in short chains ensures camouflage in contact with other bacteria, thus making it undetectable [Verhelst R, BMCM 2004]. Its resemblance to the Lactobacillus sp ⁇ . and streptococci is therefore a source of misidentification [Rodriguez JM, IJSB 1999].
  • this association of A. vaginae and G. vaginalis is 90% (18 out of 20 VB) but taking into account the quantification of A. vaginae - ⁇ IO / mL and / or G. vaginalis> 10 / mL with a sensitivity of 95% (19 out of 20 VB) presents the best criteria for specificity (99%), VPP (95%) and VPN (99%) were obtained for the identification of BV.
  • a concentration of A is used.
  • Genital mycoplasmas are not taken into account by the Nugent score. They remain identifiable by culture or molecular biology.
  • a study of 203 VB and 203 FN targeting M. hominis by real-time PCR suggested involvement of M. hominis in VB [Zariffard MR, FEMS 2002].
  • an identical study on a smaller population (5 VB and 16 FN) did not highlight this link [Sha BE, CWY 2005].
  • According to the present invention only M. hominis is correlated with BV, but this correlation is insufficient to propose this microorganism as a diagnostic criterion for BV.
  • the originality of the present invention is to be able to propose for the first time a diagnostic tool of the VB based on the quantification of A. vaginae and G. vaginalis.
  • This diagnostic test has a sensitivity of 95% specificity of 99%, a PPV of 95% and a VPN of 99%.
  • the etiology of BV is still very mysterious, but for the first time we have an objective quantification tool that allows a rational diagnosis of BV.
  • the singularity of the present invention is to have shown both the capital position of A. vaginae in VB but also its use by quantification as the main diagnostic criterion of BV.
  • We understand all the better the therapeutic problem raised by the relatively resistant character of A. vaginae with metronidazole may explain in part the frequency of recurrence after treatment [ANAES 2001; Ferris MJ, BMC ID 2004; Secor AM, NOC 1997; Geis sdorfer W, JCM 2003; De Backer E, BMC ID 2006].
  • the molecular criteria used for the diagnosis of VB as share a concentration of A.
  • Seq.n 1 8 5 'GCCATGGAAAAGGTGGGTCAAGAGGGCGTCATCA CCGTGGAAGAACATCGTCTCGAGTTAAGGAGCCTCGAAGTCACCGA AGGTATGCGTTTCATTATGGATATGCGTGTGGATGGATTA (CTCGA G ⁇ CTGCCTGTTTTGGGTGGGGGCGCTATCGGGGTTTGGGCTTACAT CT GC GGC CTC C GCATCT GCTAAGGATGTT GAAACATC GT (CTC GAG) TTAAGGCTACTGCAACTATTTCTGCAGCAGATCCTGAAGTTGGCGA AAAGATTGCTGAATACATCCCAACTCCAGAACGTGATACTGACAAG CCATTCTTAATGCCAGTTGAAGACGTATTTACTATCACTGGTCGTGG TACTGTTGCTTCTATACTGGTGACCGTCCTATCCAAGTTGGATCAC
  • GAGCAGC GGCAGTTGAACAATTCATCGT TTAAGGAGTTG GGGCTGATATTGTAACACCAAACCCCTATCCGCTCCTGATACCGGC AGGCTTGAGTCTGGTAGGGGAAGATGGAATTC CAAGT (CTCGAG) G TGAAATGCGCAGATATTTGGAAGCCAACGCCAACGAAGACAAGGCA
  • CTTCAAAAAGC GATGGTAGTAGAAAACTGC GACATCGT (CTCGAG)
  • Oligonucleotide 1 sense. 178 nucleotides: sequences of M. curtisii and M. mulieris
  • Antisense oligonucleotide 2 183 nucleotides G. vaginalis and Lactobacillus sp ⁇ .
  • Seq. # 20 5 'CGACCAGTGATAGTAAATACGTCTTCAACTGGCAT TAAGAATGGCTTGTCAGTATCACGTTCTGGAGTTGGGATGTATTCA GCAATCTTTTCGCCAACTTCAGGATCTGCTGCAGAAATAGTTGCAGT AGCCTTAACTCGAGACGATGTTTCAACATCCTTAGCAGATGCGAGG GCCAGGCAT3'
  • Seq. # 21 5 'TCACTGGTCGTGGTACTGTTGCTTCTATACTGGTG ACCGTCCTATCCAAGTTGGATCACATCGTCTCGAGTTAAGAACAAAT AGTGCATTAGTATTCTTTGATGAAAAAGGAAACGAAGACAAAGAAC GTAAAGTTGCTTATGGA3'
  • Seq. # 22 5 'CTTGGAATTCCATCTTCCCCTACCAGACTCAAGCC TGCCGGTATCAGGAGCGGATAGGGGTTTGGTGTTACAATATCAGCC CCAACTCCTTAACTCGAGACGATGAATTGTTCAACTGCCGCTGCTCT AAATGTATCACCTGCAGCAATCAATTACCTGATGGAATATCGAAACG ACGTCCATAAGCA3'
  • Oligonucleotide 6 antisense 147 nucleotides: human albumin
  • Seq. # 24 5 'CCAAACTCATGGGAGCTGCTGGTTCTCTTTCACTG ACATCTGCAAAGACAACAATGCCAGGGAGAGATTTGTGTGGGCATG ACAGGTTTTGCAATATTACTCTTAACTCGAGACGATGATTACAGCCC ACAAGAGATGACAGCAA3'
  • Anti-sense Seq. No. 28 5'CCAAACTCATGGGAGCTGCT3 '
  • Appendix 4 Theoretical diagrams of construction of an insert by double PCR.
  • Appendix 5 Quantity of probe and sense and antisense primers required for the amplification reaction of 5 ⁇ l of DNA extract for each microorganism and human albumin.
  • Hauth JC Goldenberg RL, WW Andrews, DuBard MB, Copper RL.
  • Gardnerella vaginalis Mycoplasma hominis, and the Lactobacillus sp ⁇ . for diagnosis of bacterial vaginosis in human immunodeficiency virus-infected women. J
  • Verhelst R., H. Verstraelen, G. Claeys, G. Verschraegen, J. Delanghe, L. Van Simaey, C. De Ganck, M. Temmerman, and M. Vaneechoutte. 2004. Cloning of 16S rRNA genes amplified from normal and disturbed vaginal microflora suggests a strong association between Atopobium vaginae, Gardnerella vaginalis and bacterial vaginosis. BMC.Microbiol 2004; 4:16.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/FR2007/052368 2006-11-24 2007-11-20 Methode de diagnostic et de suivi d'une vaginose bacterienne par quantification moleculaire Ceased WO2008062136A2 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AT07866534T ATE519865T1 (de) 2006-11-24 2007-11-20 Verfahren zur diagnose und verfolgung von bakterieller vaginose mittels molekularer quantifizierung
JP2009537684A JP2010509932A (ja) 2006-11-24 2007-11-20 分子レベルの定量による細菌性膣炎の診断および追跡調査の方法
EP07866534A EP2087134B1 (fr) 2006-11-24 2007-11-20 Methode de diagnostic et de suivi d'une vaginose bacterienne par quantification moleculaire
US12/312,711 US20100075306A1 (en) 2006-11-24 2007-11-20 Method for diagnosis of and following a bacterial vaginosis by molecular quantification

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0610313 2006-11-24
FR0610313A FR2909099B1 (fr) 2006-11-24 2006-11-24 Methode de diagnostic et de suivi d'une vaginose bacterienne par quantification moleculaire.

Publications (3)

Publication Number Publication Date
WO2008062136A2 true WO2008062136A2 (fr) 2008-05-29
WO2008062136A3 WO2008062136A3 (fr) 2008-07-10
WO2008062136A9 WO2008062136A9 (fr) 2009-07-16

Family

ID=38229508

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2007/052368 Ceased WO2008062136A2 (fr) 2006-11-24 2007-11-20 Methode de diagnostic et de suivi d'une vaginose bacterienne par quantification moleculaire

Country Status (7)

Country Link
US (1) US20100075306A1 (https=)
EP (1) EP2087134B1 (https=)
JP (1) JP2010509932A (https=)
AT (1) ATE519865T1 (https=)
ES (1) ES2371202T3 (https=)
FR (1) FR2909099B1 (https=)
WO (1) WO2008062136A2 (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010207195A (ja) * 2009-03-12 2010-09-24 Toyo Suisan Kaisha Ltd 細菌測定用プライマーおよび細菌測定方法
WO2011068679A1 (en) * 2009-12-03 2011-06-09 Quest Diagnostics Investments Incorporated Methods for the diagnosis of bacterial vaginosis
WO2011103274A1 (en) * 2010-02-17 2011-08-25 Gen-Probe Incorporated Compositions and methods to detect atopobium vaginae nucleic acid
EP3286323A4 (en) * 2015-04-24 2018-12-26 Becton, Dickinson and Company Multiplex detection of vulvovaginal candidiasis, trichomoniasis and bacterial vaginosis
FR3075224A1 (fr) * 2017-12-18 2019-06-21 Fondation Mediterranee Infection Methode de diagnostic d'une vaginose bacterienne par detection de methanobrevibacter smithii
WO2023202027A1 (zh) * 2022-04-18 2023-10-26 北京起源聚禾生物科技有限公司 阴道微生态检测引物探针组合及试剂盒
US11970747B2 (en) 2022-04-18 2024-04-30 Beijing Origin-Poly Bio-Tec Co., Ltd. Primer-probe combination and kit for vaginal microecosystem detection

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2816311C (en) * 2010-11-01 2018-07-17 Becton, Dickinson And Company Gardnerella vaginalis assay
AU2012304327B2 (en) * 2011-09-08 2015-07-09 Gen-Probe Incorporated Compositions and methods for detecting BV-associated bacterial nucleic acid
US9970060B2 (en) * 2011-11-23 2018-05-15 Medical Diagnostic Laboratories, Llc Quantitation and profiling of vaginal microflora
US9057111B2 (en) 2012-02-20 2015-06-16 Laboratory Corporation Of America Holdings Diagnostic methods and markers for bacterial vaginosis
PL228161B1 (pl) 2013-05-21 2018-02-28 Univ Jagiellonski Sposób jednoczesnej detekcji bakterii i grzybów w preparacie biologicznym metoda PCR oraz zestaw do detekcji bakterii i grzybów w preparacie biologicznym metoda PCR
JP6383552B2 (ja) * 2014-03-27 2018-08-29 三菱重工業株式会社 スフィンゴモナス属細菌の検出方法及びそのプライマー、生物処理槽の活性予測方法
EA025042B1 (ru) * 2014-06-03 2016-11-30 Общество с ограниченной ответственностью "ИнтерЛабСервис" Способ дифференциальной диагностики нарушений баланса вагинальной микрофлоры
AU2016233298B2 (en) 2015-03-16 2021-09-02 Gen-Probe Incorporated Methods and compositions for detecting bacterial nucleic acid and diagnosing bacterial vaginosis
PL235777B1 (pl) 2015-07-10 2020-10-19 Univ Jagiellonski Startery, sposób i zestaw diagnostyczny do diagnozowania sepsy
KR101739749B1 (ko) 2015-11-24 2017-05-25 윤현규 리얼타임 pcr을 이용한 질염 검사 키트 및 방법
RU2670206C1 (ru) * 2017-12-26 2018-10-19 Общество с ограниченной ответственностью "НекстБио" Набор синтетических олигонуклеотидов для выявления ДНК Atopobium vaginae в слизистой оболочке влагалища
RU2670280C1 (ru) * 2017-12-26 2018-10-22 Общество с ограниченной ответственностью "НекстБио" Набор синтетических олигонуклеотидов для выявления ДНК Lactobacillus spp. в слизистой оболочке влагалища
RU2670207C1 (ru) * 2017-12-26 2018-10-19 ООО "НекстБио" Набор синтетических олигонуклеотидов для выявления ДНК Gardnerella vaginalis в слизистой оболочке влагалища
JP7445980B2 (ja) * 2018-05-22 2024-03-08 アートプレッド ビー. ブイ. 生殖補助医療手法の転帰の予測方法およびキット
EP4022091A1 (en) * 2019-08-30 2022-07-06 Janssen Biotech, Inc. B-cell maturation complex car t construct and primers
US20220205020A1 (en) * 2020-12-30 2022-06-30 Roche Molecular Systems, Inc. Compositions and methods for detection of bacteria and fungi associated with bacterial and candida vaginosis

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050095603A1 (en) * 2003-11-05 2005-05-05 Cepheid Universal control for nucleic acid amplification
CN101111596A (zh) * 2005-01-31 2008-01-23 株式会社益力多本社 以rRNA为标的的微生物定量分析方法
US7625704B2 (en) * 2005-08-31 2009-12-01 Fred Hutchinson Cancer Research Center Methods and compositions for identifying bacteria associated with bacteria vaginosis

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010207195A (ja) * 2009-03-12 2010-09-24 Toyo Suisan Kaisha Ltd 細菌測定用プライマーおよび細菌測定方法
US9481914B2 (en) 2009-12-03 2016-11-01 Quest Diagnostics Investments Incorporated Methods for the diagnosis of bacterial vaginosis
WO2011068679A1 (en) * 2009-12-03 2011-06-09 Quest Diagnostics Investments Incorporated Methods for the diagnosis of bacterial vaginosis
EP4276190A3 (en) * 2009-12-03 2023-12-27 Quest Diagnostics Investments Incorporated Methods for the diagnosis of bacterial vaginosis
US9200331B2 (en) 2009-12-03 2015-12-01 Quest Diagnostics Investments Incorporated Methods for the diagnosis of bacterial vaginosis
EP3321380A1 (en) * 2009-12-03 2018-05-16 Quest Diagnostics Investments Incorporated Methods for the diagnosis of bacterial vaginosis
US10138525B2 (en) 2010-02-17 2018-11-27 Gen-Probe Incorporated Compositions and methods to detect atopobium vaginae nucleic acid
EP3040425A1 (en) * 2010-02-17 2016-07-06 Gen-Probe Incorporated Compostions and methods to detect atopobium vaginae nucleic acid
US9181593B2 (en) 2010-02-17 2015-11-10 Gen-Probe Incorporated Compositions and methods to detect Atopobium vaginae nucleic acid
EP3604558A1 (en) * 2010-02-17 2020-02-05 Gen-Probe Incorporated Compositions and methods to detect atopobium vaginae nucleic acid
US10961594B2 (en) 2010-02-17 2021-03-30 Gen-Probe Incorporated Compositions to detect Atopobium vaginae nucleic acid
WO2011103274A1 (en) * 2010-02-17 2011-08-25 Gen-Probe Incorporated Compositions and methods to detect atopobium vaginae nucleic acid
EP3286323A4 (en) * 2015-04-24 2018-12-26 Becton, Dickinson and Company Multiplex detection of vulvovaginal candidiasis, trichomoniasis and bacterial vaginosis
US12037649B2 (en) 2015-04-24 2024-07-16 Becton, Dickinson And Company Multiplex detection of vulvovaginal candidiasis, trichomoniasis and bacterial vaginosis
EP4435119A3 (en) * 2015-04-24 2025-03-05 Becton, Dickinson and Company Multiplex detection of vulvovaginal candidiasis, trichomoniasis and bacterial vaginosis
FR3075224A1 (fr) * 2017-12-18 2019-06-21 Fondation Mediterranee Infection Methode de diagnostic d'une vaginose bacterienne par detection de methanobrevibacter smithii
WO2019122545A1 (fr) 2017-12-18 2019-06-27 Fondation Mediterranee Infection Méthode de diagnostic d'une vaginose bactérienne par détection de methanobrevibacter smithii
WO2023202027A1 (zh) * 2022-04-18 2023-10-26 北京起源聚禾生物科技有限公司 阴道微生态检测引物探针组合及试剂盒
US11970747B2 (en) 2022-04-18 2024-04-30 Beijing Origin-Poly Bio-Tec Co., Ltd. Primer-probe combination and kit for vaginal microecosystem detection

Also Published As

Publication number Publication date
ATE519865T1 (de) 2011-08-15
WO2008062136A9 (fr) 2009-07-16
FR2909099B1 (fr) 2012-10-19
JP2010509932A (ja) 2010-04-02
WO2008062136A3 (fr) 2008-07-10
US20100075306A1 (en) 2010-03-25
EP2087134B1 (fr) 2011-08-10
ES2371202T3 (es) 2011-12-28
FR2909099A1 (fr) 2008-05-30
EP2087134A2 (fr) 2009-08-12

Similar Documents

Publication Publication Date Title
EP2087134B1 (fr) Methode de diagnostic et de suivi d'une vaginose bacterienne par quantification moleculaire
Komanduri et al. Dysbiosis in pouchitis: evidence of unique microfloral patterns in pouch inflammation
Gonçalves et al. Levels of Selenomonas species in generalized aggressive periodontitis
Tannock et al. Comprehensive analysis of the bacterial content of stool from patients with chronic pouchitis, normal pouches, or familial adenomatous polyposis pouches
Siqueira Jr et al. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction
Rudkjøbing et al. Comparing culture and molecular methods for the identification of microorganisms involved in necrotizing soft tissue infections
Coolen et al. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes
Ingalagi et al. Detection and comparison of prevalence of Porphyromonas gingivalis through culture and Real Time-polymerase chain reaction in subgingival plaque samples of chronic periodontitis and healthy individuals
Schülin et al. The intra-and extraluminal appendiceal microbiome in pediatric patients: A comparative study
Shah et al. Migratory birds as the vehicle of transmission of multi drug resistant extended spectrum β lactamase producing Escherichia fergusonii, an emerging zoonotic pathogen
RU2420595C2 (ru) СПОСОБ КОЛИЧЕСТВЕННОГО АНАЛИЗА КОЛИЧЕСТВА КЛЕТОК ПРЕДСТАВЛЯЮЩЕЙ ИНТЕРЕС БАКТЕРИИ В ЖИВОМ СОСТОЯНИИ С ПРИМЕНЕНИЕМ рРНК В КАЧЕСТВЕ МИШЕНИ
EP3728644A1 (fr) Méthode de diagnostic d'une vaginose bactérienne par détection de methanobrevibacter smithii
EP0943010B1 (fr) Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire
Kato et al. Non-Helicobacter bacterial flora rarely develops in the gastric mucosal layer of children
Gonzales‐Marin et al. Levels of periodontal pathogens in neonatal gastric aspirates and possible maternal sites of origin
CN1942592B (zh) 淋病奈瑟氏球菌检测
WO2011039321A1 (fr) Methode de detection de microorganismes
Hashim et al. Putative periodontal pathogens in the subgingival plaque of Sudanese subjects with aggressive periodontitis
EP0943691A1 (fr) Procédé de diagnostic d'agents pathogènes respiratoires par biologie moleculaire
FR2844522A1 (fr) Procede et sequences nucleotidiques pour la detection et l'identification de microorganismes dans un melange complexe
WO2021152096A1 (fr) Procede de pcr multiplexe pour la detection de microorganismes et son utilisation
EP2723891B1 (en) Diagnostic methods for detecting clostridium difficile
JABER Evaluating the virulence factors of Salmonella typhi isolated from children suffering from severe diarrhea using molecular genetic techniques.
EP2392669B1 (fr) Méthode de détection des leptospires pathogènes basée sur le gène rpoB
Oree et al. Comparison of endocervical swabs to cultured isolates for the detection of antimicrobial resistance determinants in Neisseria gonorrhoeae

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07866534

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2009537684

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2007866534

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 12312711

Country of ref document: US