WO2004096016A2 - Modulation of glucagon receptor expression - Google Patents
Modulation of glucagon receptor expression Download PDFInfo
- Publication number
- WO2004096016A2 WO2004096016A2 PCT/US2004/013120 US2004013120W WO2004096016A2 WO 2004096016 A2 WO2004096016 A2 WO 2004096016A2 US 2004013120 W US2004013120 W US 2004013120W WO 2004096016 A2 WO2004096016 A2 WO 2004096016A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- glucagon receptor
- seq
- nucleic acid
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
- C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
Definitions
- the present invention provides compositions and methods for modulating the expression of glucagon receptor.
- this invention relates to compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid " " molecules encoding glucagon receptor. Such compounds are shown herein to modulate the expression of glucagon receptor.
- Glucagon the 29-amino acid peptide responsible for maintaining blood glucose levels in the postabsorbative state, increases glucose release from the liver by activating hepatic glycogenolysis, gluconeogenesis, stimulating lipolysis in adipose tissue, and stimulating insulin secretion.
- insulin reverses the glucagon-mediated enhancement of glycogenolysis and gluconeogenesis.
- insulin is either not available or not fully effective. While treatment for diabetes has traditionally focused on increasing insulin levels, antagonism of glucagon function has been considered as an alternative therapy.
- the glucagon receptor As glucagon exerts its physiological effects by signaling through the glucagon receptor, the glucagon receptor has been proposed as a potential therapeutic target for diabetes (Madsen et al . , Curr. Pharm . Des . , 1999, 5, 683-691).
- Glucagon receptor is belongs to the superfamiiy of G-protein-coupled receptors having seven transmembrane domains. It is also a member of the smaller sub-family of homologous receptors which bind peptides that are structurally similar to glucagon.
- the gene encoding human glucagon receptor was cloned in 1994 and analysis of the genomic sequence revealed multiple introns and an 82% identity to the rat glucagon receptor gene (Lok et al., Gene, 1994, 140, 203-209.; MacNeil et al . , Biochem . Biophys . Res . Commun . , 1994, 198 , 328-334). Cloning of the rat glucagon receptor gene also led to the description of multiple alternative splice variants (Maget et al . , FEBS Lett . , 1994, 351 , 271-275).
- US Patent 5,776,725 is an isolated nucleic acid sequence encoding a human or rat glucagon receptor (Kindsvogel et al . , 1998) .
- the human glucagon receptor gene is localized to chromosome 17q25 (Menzel et al . , Genomics, 1994, 20, 327-328).
- a missense mutation of Gly to Ser at codon 40 in the glucagon receptor gene leads to a 3 -fold lower affinity for glucagon (Fujisawa et al .
- agonists or antagonists of glucagon receptor agents that modulate the function, expression or activity of a glucagon receptor gene, methods of identifying such agents, methods of ameliorating conditions associated with impaired glucose tolerance, methods of identifying agents that affect obesity, weight gain, diabetes, methods of treating obesity or diabetic conditions, and phenotypic data associated with a transgenic mouse comprising a mutation in a glucagon receptor gene.
- a glucagon-neutralizing monoclonal antibody has been described that antagonizes glucagon-stimulated signal transduction in part by binding to the glucagon binding site of the glucagon receptor (Buggy et al . , Horm. Metab. Res . , 1996, 28 , 215-219).
- An antibody which specifically binds to the amino acid sequence of a glucagon receptor has been disclosed and claimed in US Patent 5,770,445 (Kindsvogel et al . , 1998).
- N-terminal modifications were designed to have a higher affinity than glucagon for the glucagon receptor (Zechel et al., Int . J. Pept . Protein Res . , 1991, 38 , 131-138).
- Two somatostatin analogs have been reported to be inhibitors of glucagon secretion (Rossowski and Coy, Biochem . Biophys . Res . Commun . , 1994, 205, 341-346).
- glucagon receptor antagonists including: [(+)-3,5 diisopropyl-2- (1-hydroxyethyl) -6-propyl-4' -fluoro-1, 1' -biphenyl (Bay27- 9955) (Petersen and Sullivan, Diabetologia, 2001, 44 , 2018-2024) , a series of alkylidene hydrazides (Ling et al., Bioorg. Med . Chem. Lett . , 2002, 12, 663-666), a series of 4-aryl-pyridines containing both a 3-[(lR)- hydroxyethyl] and a 2'-hydroxy group (Ladouceur et al .
- the present invention is directed to compounds, especially nucleic acid and nucleic acid-like oligomers, which are targeted to a nucleic acid encoding glucagon receptor, and which modulate the expression of glucagon receptor.
- Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of screening for modulators of glucagon receptor and methods of modulating the expression of glucagon receptor in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention. Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of glucagon receptor are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment .
- the present invention employs compounds, preferably oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules encoding glucagon receptor. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding glucagon receptor.
- target nucleic acid and “nucleic acid molecule encoding glucagon receptor” have been used for convenience to encompass DNA encoding glucagon receptor, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA.
- antisense inhibition The hybridization of a compound of this invention with its target nucleic acid is generally referred to as "antisense” . Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as “antisense inhibition.” Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
- the functions of DNA to be interfered with can include replication and transcription.
- Replication and transcription for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise.
- the functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
- One preferred result of such interference with target nucleic acid function is modulation of the expression of glucagon receptor.
- modulation and modulation of expression mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
- hybridization means the pairing ' of complementary strands of oligomeric compounds.
- the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds.
- nucleobases complementary nucleoside or nucleotide bases
- adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
- Hybridization can occur under varying circumstances.
- An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid nonspecific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vi tro assays.
- the phrase "stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences.
- Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, "stringent conditions" under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
- “Complementary, as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound) , is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position.
- oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other.
- “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
- an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
- an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure).
- the antisense compounds of the present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise 90% sequence complementarity and even more preferably comprise 95% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted.
- an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity.
- the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
- Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al . , J " . Mol . Biol . , 1990, 215, 403-410; Zhang and Madden, Genome Res . , 1997 , 7, 649-656) .
- compounds ' include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
- these compounds may be introduced in the form of single- stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops .
- the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.
- RNAse H a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single- stranded antisense compounds which are "DNA-like" elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
- antisense compound is a single-stranded antisense oligonucleotide
- double-stranded RNA (dsRNA) molecules has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.
- dsRNA double-stranded RNA
- RNA interference RNA interference
- oligomeric compound refers to a polymer or oligomer comprising a plurality of monomeric units.
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof.
- This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly.
- modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases .
- oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those described herein.
- the compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides) .
- nucleobases i.e. from about 8 to about 80 linked nucleosides.
- the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.
- the compounds of the invention are 12 to 50 nucleobases in length.
- this embodies compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length.
- the compounds of the invention are 15 to 30 nucleobases in length.
- One having ordinary skill in the art will appreciate that this embodies compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
- Particularly preferred compounds are oligonucleotides from about 12 to about 50 nucleobases, even more preferably those comprising from about 15 to about 30 nucleobases.
- Antisense compounds 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well .
- Exemplary preferred antisense compounds include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5' -terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5' -terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases) .
- preferred antisense compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3' -terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3' -terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases) .
- One having skill in the art armed with the preferred antisense compounds illustrated herein will be able, without undue experimentation, to identify further preferred antisense compounds.
- Targeting an antisense compound to a particular nucleic acid molecule can be a multistep process.
- the process usually begins with the identification of a target nucleic acid whose function is to be modulated.
- This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
- the target nucleic acid encodes glucagon receptor.
- the targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result.
- region is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.
- the translation initiation codon is typically 5 ' -AUG (in transcribed mRNA molecules; 5 ' -ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the “start codon” or the “AUG start codon”.
- a minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5 ' -UUG or 5 ' -CUG, and
- translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes) . It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
- start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding glucagon receptor, regardless of the sequence (s) of such codons. It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5 ' -UAA, 5 ' -UAG and 5 ' -UGA (the corresponding DNA sequences are 5 ' -TAA, 5 ' -TAG and 5'-TGA, respectively).
- start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
- stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3 ' ) from a translation termination codon. Consequently, the "start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense compounds of the present invention.
- a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
- target regions include the 5 ' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5 ' direction from the translation initiation codon, and thus including nucleotides between the 5 ' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene) , and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3 ' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene) .
- 5'UTR 5 ' untranslated region
- 3'UTR 3' untranslated region
- the 5' cap site of an mRNA comprises an N7- methylated guanosine residue joined to the 5 ' -most residue of the mRNA via a 5' -5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.
- introns regions which are excised from a transcript before it is translated.
- exons regions which are excised from a transcript before it is translated.
- targeting splice sites i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites.
- fusion transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre- mRNA.
- RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants”. More specifically, "pre-mRNA variants" are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence. Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants".
- the pre-mRNA variant is identical to the mRNA variant . It is also known in the art that variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon. Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as "alternative stop variants" of that pre-mRNA or mRNA.
- polyA variant in which the multiple transcripts produced result from the alternative selection of one of the “polyA stop signals” by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
- the types of variants described herein are also preferred target nucleic acids .
- preferred target segments The locations on the target nucleic acid to which the preferred antisense compounds hybridize are hereinbelow referred to as "preferred target segments.”
- preferred target segment is defined as at least an 8-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
- Target segments 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
- Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5' -terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5' -terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases) .
- preferred target segments are represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3 '-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3' -terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases) .
- preferred target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments .
- antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- the "preferred target segments” identified herein may be employed in a screen for additional compounds that modulate the expression of glucagon receptor.
- “Modulators” are those compounds that decrease or increase the expression of a nucleic acid molecule encoding glucagon receptor and which comprise at least an 8-nucleobase portion which is complementary to a preferred target segment.
- the screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding glucagon receptor with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding glucagon receptor. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g.
- the modulator may then be employed in further investigative studies of the function of glucagon receptor, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
- the preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides .
- double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processsing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature, 1998, 391 , 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al . , Gene, 2001, 263 , 103-112; Tabara et al . , Science, 1998, 282, 430-431; Montgomery et al . , Proc . Natl . Acad . Sci . USA, 1998, 95, 15502-15507; Tuschl et al .
- the compounds of the present invention can also be applied in the areas of drug discovery and target validation.
- the present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships that exist between glucagon receptor and a disease state, phenotype, or condition.
- These methods include detecting or modulating glucagon receptor comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of glucagon receptor and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention.
- the compounds of the present invention can be utilized for diagnostics, therapeutics (including prophylaxis) and as research reagents and kits.
- antisense oligonucleotides which are able to inhibit gene expression with extraordinar specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathwa .
- the compounds of the present invention can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
- expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns .
- methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett . , 2000, 480, 17-24; Celis, et al . , FEBS Lett .
- the compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding glucagon receptor.
- oligonucleotides that are shown to hybridize with such efficiency and under such conditions as disclosed herein as to be effective glucagon receptor inhibitors will also be effective primers or probes under conditions favoring gene amplification or detection, respectively.
- These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding glucagon receptor and in the amplification of said nucleic acid molecules for detection or for use in further studies of glucagon receptor.
- Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid encoding glucagon receptor can be detected by means known in the art .
- Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of glucagon receptor in a sample may also be prepared.
- antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans.
- Antisense oligonucleotide drugs including ribozymes, have been safely and ' effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
- an animal preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of glucagon receptor is treated by administering antisense compounds in accordance with this invention.
- the methods comprise the step of administering to an animal a therapeutically effective amount of a glucagon receptor inhibitor.
- the glucagon receptor inhibitors of the present invention effectively inhibit the activity of the glucagon receptor protein or inhibit the expression of the glucagon receptor protein.
- the activity or expression of glucagon receptor in an animal is inhibited by about 10%.
- the activity or expression of glucagon receptor in an animal is inhibited by about 30%.
- the activity or expression of glucagon receptor in an animal is inhibited by 50% or more.
- the compounds herein are inhibitors of glucagon receptor, they are believed to be useful in lowering blood glucose, for example, and in treating conditions associated with glucagon receptor activity, such as high blood glucose and other metabolic conditions such as diabetes (including Type 2 diabetes) , obesity, and insulin resistance.
- use of an aforementioned compound is provided in the manufacture of a medicament for treating a subject afflicted with a disease associated with glucagon receptor activity, diabetese, obesity, metabolic disease, insulin deficiency or insulin resistance, primary hyperglucagonemia, increased blood glucose levels, increased blood triglyceride levels or increased blood cholesterol levels .
- the reduction of the expression of glucagon receptor may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal.
- the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding glucagon receptor protein and/or the glucagon receptor protein itself.
- the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
- nucleoside is a base-sugar combination.
- the base portion of the nucleoside is normally a heterocyclic base.
- the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
- linear compounds are generally preferred.
- linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound.
- the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
- the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
- oligonucleotides containing modified backbones or non-natural internucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
- modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides .
- Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl- phosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates, 5 ' -alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates , thionoalkylphosphonates , thionoalkylphosphotriesters , selenophosphates and boranophosphates having normal 3' -5' linkages, 2' -5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3 ' to 3 '
- Preferred oligonucleotides having inverted polarity comprise a single 3 ' to 3 ' linkage at the 3 ' -most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof) .
- Various salts, mixed salts and free acid forms are also included.
- Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones siloxane backbones
- sulfide, sulfoxide and sulfone backbones formacetyl and thioformacetyl backbones
- methylene formacetyl and thioformacetyl backbones riboacetyl backbones
- alkene containing backbones sulfamate backbones; methyleneimino and methylenehydrazino backbones
- sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts .
- both the sugar and the internucleoside linkage (i.e. the backbone) , of the nucleotide units are replaced with novel groups.
- the nucleobase units are maintained for hybridization with an appropriate target nucleic acid.
- an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) .
- PNA peptide nucleic acid
- the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al . , Science, 1991, 254, 1497-1500.
- Preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones.
- oligonucleosides with heteroatom backbones and in particular -CH 2 -NH-0-CH 2 - , -CH 2 -N (CH 3 ) -0-CH 2 - [known as a methylene (methylimino) or MMI backbone] , -CH 2 -0- N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 ) -N(CH 3 ) -CH 2 - and -0-N (CH 3 ) -CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as -0-P-0-CH 2 -] of the above referenced U.S.
- Modified oligonucleotides may also contain one or more substituted sugar moieties.
- Preferred oligonucleotides comprise one of the following at the 2 ' position: OH; F; 0- , S-, or N-alkyl; 0-, S-, or N- alkenyl; 0-, S- or N-alkynyl; or 0-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C x to C ⁇ 0 alkyl or C 2 to C 10 alkenyl and alkynyl.
- n and m are from 1 to about 10.
- oligonucleotides comprise one of the following at the 2' position: C x to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl , aralkyl, O-alkaryl or 0-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , 0CF 3 , S0CH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- a preferred modification includes 2'- methoxyethoxy (2 ' -0-CH 2 CH 2 0CH 3 , also known as 2'-0-(2- methoxyethyl ) or 2 ' -MOE) (Martin et al . , Helv. Chim . Acta, 1995, 18, 486-504) i.e., an alkoxyalkoxy group.
- a further preferred modification includes 2'- dimethylaminooxyethoxy, i.e., a 0 (CH 2 ) 2 0N(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2 ' -dimethylaminoethoxyethoxy (also known in the art as 2 ' -O-dimethyl-amino-ethoxy-ethyl or 2 ' -DMAEOE) , i.e., 2 ' -0-CH 2 -0-CH 2 -N(CH 3 ) 2 , also described in examples hereinbelow.
- 2'- dimethylaminooxyethoxy i.e., a 0 (CH 2 ) 2 0N(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples hereinbelow
- 2 ' -dimethylaminoethoxyethoxy also known in the art as 2 ' -O-
- Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
- a further preferred modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2'- hydroxyl group is linked to the 3 ' or 4 ' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.
- the linkage is preferably a methylene (-CH 2 -) n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2.
- LNAs and preparation thereof . are described in WO 98/39352 and WO 99/14226.
- Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- base nucleobase
- unmodified or “natural” nucleobases include the purine bases adenine (A) and guanine (G) , and the pyrimidine bases thymine (T) , cytosine (C) and uracil (U) .
- Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine , 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil
- nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (1H- pyrimido [5, 4-b] [1,4] benzoxazin-2 (3H) -one) , phenothiazine cytidine (lH-pyrimido [5, 4-b] [1, 4] benzothiazin-2 (3H) -one) , G-clamps such as a substituted phenoxazine cytidine (e.g.
- nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
- nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al . , Angewandte Chemie, International Edition, 1991, 30 , 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications , pages 289-302, Crooke, S.T. and Lebleu, B. , ed. , CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention.
- 5-substituted pyrimidines include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine .
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C and are presently preferred base substitutions.
- oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
- moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups.
- Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
- Typical conjugate groups include cholester- ols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine , anthraquinone , acridine, fluoresceins, rhodamines, coumarins, and dyes.
- Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence- specific hybridization with the target nucleic acid.
- Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196 , filed October 23, 1992, and
- Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, ' e.g .
- Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) -pranoprofen, carprofen, dansylsarcosine, 2 , 3 , 5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- active drug substances for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) -pranoprofen
- Oligonucleotide-drug conjugates and their preparation are described in United States Patent Application 09/334,130 (filed June 15, 1999) which is incorporated herein by reference in its entirety.
- Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S.: 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335 4,904,582; 4,958,013; 5,08
- the present invention also includes antisense compounds which are chimeric compounds.
- "Chimeric” antisense compounds or “chimeras, " in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
- These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid.
- RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression.
- the cleavage of RNA: RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers .
- the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
- Sodium salts are especially suitable salts of the compounds of the present invention.
- the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- the present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention.
- the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral.
- Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
- Oligonucleotides with at least one 2 ' -O-methoxyethyl modification are believed to be particularly useful for oral administration.
- Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
- the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier (s) or excipient (s) . In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers .
- compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations.
- the pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
- Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase.
- Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
- Formulations of the present invention include liposomal formulations.
- liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
- Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
- sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one ox more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- PEG polyethylene glycol
- compositions of the present invention may also include surfactants .
- surfactants used in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
- the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides.
- penetration enhancers also enhance the permeability of lipophilic drugs.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants .
- Penetration enhancers and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
- formulations are routinely designed according to their intended use, i.e. route of administration.
- Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
- a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
- Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g.
- oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids.
- Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in United States patent application 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
- compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators.
- Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
- bile acids/salts and fatty acids and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
- penetration enhancers for example, fatty acids/salts in combination with bile acids/salts.
- a particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA.
- Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene- 20-cetyl ether.
- Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles . Oligonucleotide complexing agents and their uses are further described in U.S.
- Patent 6,287,860 which is incorporated herein in its entirety.
- Oral formulations for oligonucleotides and their preparation are described in detail in United States applications 09/108,673 (filed July 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed February 8, 2002, each of which is incorporated herein by reference in their entirety.
- compositions and formulations for parenteral, intra- thecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other pharmaceutical agents which function by a non-antisense mechanism. Examples of such pharmaceutical agents include but are not limited to cancer chemotherapeutic drugs, anti-inflammatory drugs, anti-viral drugs, and compounds for treatment of metabolic diseases such as diabetes, high blood sugar or obesity, or cardiovascular conditions such as elevated blood cholesterol or blood pressure.
- Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
- such pharmaceutical agents may be used individually ⁇ e . g. , rosiglitazone and oligonucleotide), sequentially ⁇ e . g. , 5-fluorouracil and oligonucleotide for a period of time followed by methotrexate and oligonucleotide) , or in combination with one or more other treatments ⁇ e .g. , 5- fluorouracil, methotrexate and oligonucleotide, or 5- fluorouracil, radiotherapy and oligonucleotide).
- compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target.
- compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
- use of an aforementioned compound is provided in the manufacture of a medicament ⁇ for treating a subject afflicted with a disease associated with glucagon receptor activity, diabetes, obesity, insulin deficiency or insulin resistance, primary hyperglucagonemia, increased blood glucose levels, increased blood triglyceride levels or increased blood cholesterol levels.
- compositions and their subsequent administration are believed to be within the skill of those in the art. Dosing is . dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 s found to be effective in in vi tro and in vivo animal models.
- dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
- Oligonucleotide and oligonucleoside synthesis The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA) . Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives .
- oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH 4 0Ac solution.
- Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference.
- Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference.
- 3' -Deoxy-3' -methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein incorporated by reference.
- Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference.
- Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively) , herein incorporated by reference .
- 3 ' -Deoxy-3 ' -amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incorporated by reference .
- Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incorporated by reference.
- Borano phosphate oligonucleotides are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein incorporated by reference .
- Formacetal and thioformacetal linked oligonucleo- sides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference.
- Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein incorporated by reference.
- RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions.
- a useful class of protecting groups includes silyl ethers.
- bulky silyl ethers are used to protect the 5 '-hydroxyl in combination with an acid-labile orthoester protecting group on the 2 '-hydroxyl.
- This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps.
- the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2' hydroxyl .
- RNA oligonucleotides were synthesized. RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3'- to 5 '-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3 '-end of the chain is covalently attached to a solid support.
- the nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5 '-end of the first nucleoside.
- the support is washed and any unreacted 5 '-hydroxyl groups are capped with acetic anhydride to yield 5'-acetyl moieties.
- the linkage is then oxidized to the more stable and ultimately desired P (V) linkage.
- the 5 '-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
- the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-l, 1-dithiolate trihydrate (S 2 Na 2 ) in DMF.
- the deprotection solution is washed from the solid support-bound oligonucleotide using water.
- the support is then treated with 40% methylamine in water for 10 minutes at 55 °C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2'- groups.
- the oligonucleotides can be analyzed by anion exchange HPLC at this stage .
- the 2 '-orthoester groups are the last protecting groups to be removed.
- the ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, CO), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters .
- the resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor.
- the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
- RNA antisense compounds of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, CO) . Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds.
- duplexes can be formed by combining 30 ⁇ l of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 ⁇ l of 5X annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90°C, then 1 hour at 37°C.
- 5X annealing buffer 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate
- Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides . Oligonucleotides of the second type are also known in the art as “hemimers” or "wingmers” .
- Oligonucleotides are synthesized using the automated synthesizer and 2' -deoxy-5 ' -dimethoxytrityl-3 ' -O- phosphoramidite for the DNA portion and 5 ' -dimethoxytrityl-2 ' -O-methyl-3 ' -O-phosphoramidite for 5' and 3' wings.
- the standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5 ' -dimethoxytrityl-2 ' -O-methyl-3 ' -0- phosphoramidite.
- the fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH 4 0H) for 12-16 hr at 55 °C.
- the deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry .
- chimeric oligonucleotides are prepared as per the above procedure for the 2'-0-methyl chimeric oligonucleotide with the substitution of 2 ' -O- (methoxyethyl) amidites for the 2'-0-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
- chimeric oligonucleotides chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to United States patent 5,623,065, herein incorporated by reference .
- a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target glucagon receptor.
- the nucleobase sequence of the antisense strand of the duplex comprises at least an 8-nucleobase portion of an oligonucleotide in Table 1.
- the ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang.
- the sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini .
- a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two- nucleobase overhang of deoxythymidine (dT) would have the following structure: cgagaggcggacgggaccgTT Antisense Strand
- a duplex comprising an antisense strand having the same sequence CGAGAGGCGGACGGGACCG may be prepared with blunt ends (no single stranded overhang) as shown: cgagaggcggacgggaccg Antisense Strand
- RNA duplex can be unimolecular or bimolecular; i.e, the two strands can be part of a single molecule or may be separate molecules .
- RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, CO) . Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15uL of a 5X solution of annealing buffer.
- the final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate.
- the final volume is 75 uL.
- This solution is incubated for 1 minute at 90 °C and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are used in experimentation.
- the final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (-20°C) and freeze-thawed up to 5 times.
- duplexed antisense compounds are evaluated for their ability to modulate glucagon receptor expression.
- cells reached 80% confluency, they are treated with duplexed antisense compounds of the invention.
- OPTI-MEM-1 reduced-serum medium Gibco BRL
- 130 ⁇ L of OPTI-MEM-1 containing 12 ⁇ g/mL LIPOFECTIN Gibco BRL
- the desired duplex antisense compound at a final concentration of 200 nM.
- the medium is replaced with fresh medium.
- Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.
- the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NHOAc with >3 volumes of ethanol.
- Synthesized oligonucleotides are analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material.
- the relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis is determined by the ratio of correct molecular weight relative to the -16 amu product (+/-32 +/-48).
- oligonucleotides are purified by HPLC, as described by Chiang et al . , J. Biol . Chem. 1991, 266, 18162-18171. Results obtained with HPLC- purified material are similar to those obtained with non- HPLC purified material .
- Oligonucleotide Synthesis - 96 Well Plate Format Oligonucleotides are synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages are afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
- Standard base-protected beta- cyanoethyl-diiso-propyl phosphoramidites are purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ) .
- Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites .
- Oligonucleotides are cleaved from support and deprotected with concentrated NH 4 OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo . The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors .
- the concentration of oligonucleotide in each well is assessed by dilution of samples and UV absorption spectroscopy.
- the full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96-well format
- the effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR.
- the human transitional cell bladder carcinoma cell line T-24 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA) . T-24 cells are routinely cultured in complete McCoy's 5A basal media
- A549 cells The human lung carcinoma cell line A549 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA) .
- A549 cells are routinely cultured in DMEM basal media (Invitrogen Corporation, Carlsbad, CA) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, CA) , penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, CA) . Cells are routinely passaged by trypsinization and dilution when they reach 90% confluence.
- NHDF cells are routinely passaged by trypsinization and dilution when they reach 90% confluence.
- NHDF Human neonatal dermal fibroblast
- HEK Human embryonic keratinocytes
- Clonetics Corporation Walkersville, MD
- HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, MD) formulated as recommended by the supplier.
- Cells are routinely maintained for up to 10 passages as recommended by the supplier.
- HepG2 cells The human hepatoblastoma cell line HepG2 is obtained from the American Type Culture Collection (Manassas, VA) . HepG2 cells are routinely cultured in Eagle's MEM supplemented with 10% fetal calf serum, non-essential amino acids, and 1 mM sodium pyruvate (Gibco/Life Technologies, Gaithersburg, MD) . Cells are routinely passaged by trypsinization and dilution when they reach 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. •
- Primary mouse hepatocytes are prepared from CD-I mice purchased from Charles River Labs. Primary mouse hepatocytes are routinely cultured in Hepatocyte Attachment Media (Gibco) supplemented with 10% Fetal
- Bovine Serum Gibco/Life Technologies, Gaithersburg, MD
- 250nM dexamethasone Sigma
- lOnM bovine insulin Sigma
- Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 10000 cells/well for use in RT-PCR analysis.
- cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
- oligonucleotide When cells reached 65-75% confluency, they are treated with oligonucleotide. For cells grown in 96-well plates, wells are washed once with 100 ⁇ L 0PTI-MEMTM-1 reduced-serum medium (Invitrogen Corporation, Carlsbad, CA) and then treated with 130 ⁇ L of 0PTI-MEMTM-1 containing 3.75 ⁇ g/mL LIPOFECTINTM (Invitrogen Corporation, Carlsbad, CA) and the desired concentration of oligonucleotide. Cells are treated and data are obtained in triplicate. After 4-7 hours of treatment at 37°C, the medium is replaced with fresh medium. Cells are harvested 16-24 hours after oligonucleotide treatment .
- the concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
- the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 2) which is targeted to human Jun-N-terminal kinase-2 (JNK2) .
- Both controls are 2 ' -O-methoxyethyl gapmers (2 ' -O-methoxyethyls shown in bold) with a phosphorothioate backbone .
- the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO : 3, a 2 ' -O-methoxyethyl gapmer (2 ' -0-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf.
- the concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of c-H- ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments.
- concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM.
- glucagon receptor mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR) , or real-time PCR (RT- PCR) .
- Real-time quantitative PCR is presently preferred.
- RNA analysis can be performed on total cellular RNA or poly (A) + mRNA.
- the preferred method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art.
- Northern blot analysis is also routine in the art.
- Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according ' to manufacturer's instructions.
- Protein levels of glucagon receptor can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting) , enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS) .
- Antibodies directed to glucagon receptor can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation,
- Birmingham, MI can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art .
- glucagon receptor inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition.
- Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of glucagon receptor in health and disease.
- phenotypic assays which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA) , protein-based assays including enzymatic assays (Panvera, LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA) , cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ) .
- enzymatic assays Panvera, LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ
- cells determined to be appropriate for a particular phenotypic assay i.e., MCF- 7 cells selected for breast cancer studies; adipocytes for obesity studies
- glucagon receptor inhibitors identified from the in vi tro studies as well as control compounds at optimal concentrations which are determined by the methods described above.
- treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
- Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest. Analysis of the geneotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the glucagon receptor inhibitors . Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.
- the individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, which includes humans .
- the clinical trial is subjected to rigorous controls to ensure that individuals are not unnecessarily put at risk and that they are fully informed about their role in the study.
- volunteers are randomly given placebo or glucagon receptor inhibitor.
- glucagon receptor inhibitor a glucagon receptor inhibitor or a placebo.
- each volunteer has the same chance of being given either the new treatment or the placebo.
- Volunteers may receive either the glucagon receptor inhibitor or placebo for eight week period with biological parameters associated with the indicated disease state or condition being measured at the beginning (baseline measurements before any treatment) , end (after the final treatment) , and at regular intervals during the study period.
- Such measurements may include the levels of nucleic acid molecules encoding glucagon receptor or glucagon receptor protein levels in body fluids, tissues or organs compared to pre-treatment levels.
- Other measurements may include, but are not limited to, indices of the disease state or condition being treated, body weight, blood pressure, serum titers of pharmacologic indicators of disease or toxicity as well as ADME (absorption, distribution, metabolism and excretion) measurements.
- Information recorded for each patient may include age (years) , gender, height (cm) , family history of disease state or condition (yes/no) , motivation rating (some/moderate/great) and number and type of previous treatment regimens for the indicated disease or condition.
- Volunteers taking part in this study are healthy adults (age 18 to 65 years) and, typically, roughly an equal number of males and females participate in the study. Volunteers with certain characteristics are equally distributed for placebo and glucagon receptor inhibitor treatment. In general, the volunteers treated with placebo have little or no response to treatment, whereas the volunteers treated with the glucagon receptor inhibitor show positive trends in their disease state or condition index at the conclusion of the study.
- Poly (A) + mRNA was isolated according to Miura et al . , ( Clin . Chem. , 1996, 42, 1758-1764). Other methods for poly (A) + mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ⁇ L cold PBS. 60 ⁇ L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl- ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 ⁇ L of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT
- Total RNA Isola tion Total RNA was isolated using an RNEASY 96 TM kit and buffers purchased from Qiagen Inc. (Valencia, CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ⁇ L cold PBS. 150 ⁇ L Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 150 ⁇ L of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY 96 TM well plate attached to a QIAVAC TM manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 1 minute.
- the repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA) . Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
- oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
- a reporter dye e.g., FAM or JOE, obtained from either PE- Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA
- a quencher dye e.g., TAMRA, obtained from either PE- Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA
- reporter dye emission is quenched by the proximity of the 3' quencher dye.
- annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5 ' -exonuclease activity of Taq polymerase.
- cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
- additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISMTM Sequence Detection System.
- a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
- primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction.
- multiplexing both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample.
- mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ( "single-plexing") , or both (multiplexing).
- standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples.
- the primer-probe set specific for that target is deemed multiplexable .
- Other methods of PCR are also known in the art .
- PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, CA) .
- RT-PCR reactions were carried out by adding 20 ⁇ L PCR cocktail (2.5x PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM ® Taq, 5 Units MuLV reverse transcriptase, and 2.5x ROX dye) to 96-well plates containing 30 ⁇ L total RNA solution (20-200 ng) .
- RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C to activate the PLATINUM ® Taq, 40 cycles of a two-step PCR protocol were carried out: 95°C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes (annealing/extension).
- Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes, Inc. Eugene, OR) .
- GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately.
- RNA quantification reagent Molecular Probes, Inc. Eugene, OR. Methods of RNA quantification by RiboGreenTM are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374) .
- RiboGreenTM working reagent 170 ⁇ L of RiboGreenTM working reagent (RiboGreenTM reagent diluted 1:350 in lOmM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 ⁇ L purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485nm and emission at 530nm.
- CytoFluor 4000 PE Applied Biosystems
- Probes and primers to human glucagon receptor were designed to hybridize to a human glucagon receptor sequence, using published sequence information (GenBank accession number NM_000160.1, incorporated herein as SEQ ID NO.-4) .
- the PCR primers were : forward primer: GACACCCCCGCCAATACC (SEQ ID NO: 5) reverse primer: CCGCATCTCTTGAACACGAA (SEQ ID NO: 6) and the PCR probe was: FAM-TTGGCACCACAAAGT-TAMRA
- PCR primers were : forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 8) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 9) and the PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC- TAMRA 3' (SEQ ID NO: 10) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
- Probes and primers to mouse glucagon receptor were designed to hybridize to a mouse glucagon receptor sequence, using published sequence information (GenBank accession number NM_008101.1, incorporated herein as SEQ ID NO: 11) .
- the PCR primers were : forward primer: ATTTCCTGCCCCTGGTACCT (SEQ ID NO: 12) reverse primer: CGGGCCCACACCTCTTG (SEQ ID NO:. 13) and the PCR probe was: FAM-CCACAAAGTGCAGCACCGCCTAGTGT-TAMRA (SEQ ID NO: 14) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye.
- PCR primers were : forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 15) reverse primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO: 16) and the PCR probe was: 5' JOE-AAGGCCGAGAATGGGAAGCTTGTCATC- TAMRA 3' (SEQ ID NO: 17) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
- RNAZOLTM TEL-TEST "B” Inc., Friendswood, TX
- Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, OH).
- a human glucagon receptor specific probe was prepared by PCR using the forward primer GACACCCCCGCCAATACC (SEQ ID NO: 5) and the reverse primer CCGCATCTCTTGAACACGAA (SEQ ID NO: 6) .
- GACACCCCCGCCAATACC SEQ ID NO: 5
- CCGCATCTCTTGAACACGAA SEQ ID NO: 6
- membranes were stripped and probed for human glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA) .
- mouse glucagon receptor specific probe was prepared by PCR using the forward primer ATTTCCTGCCCCTGGTACCT (SEQ ID NO: 12) and the reverse primer CGGGCCCACACCTCTTG (SEQ ID NO: 13) .
- GPDH mouse glyceraldehyde-3 -phosphate dehydrogenase
- Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGERTM and IMAGEQUANTTM Software V3.3 (Molecular Dynamics, Sunnyvale, CA) . Data was normalized to GAPDH levels in untreated controls.
- NM_000160.1 incorporated herein as SEQ ID NO: 4
- GenBank accession number AC069004.2 incorporated herein as SEQ ID NO: 18, and GenBank accession number AJ245489.1, incorporated herein as SEQ ID NO: 19
- the compounds are shown in Table 1. "Target site” indicates the first (5' -most) nucleotide number on the particular target sequence to which the compound binds.
- All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2 ' -deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings".
- the wings are composed of 2 ' -methoxyethyl (2 ' - MOE) nucleotides .
- the compounds were analyzed for their effect on human glucagon receptor mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from three experiments in which HepG2 cells were treated with the antisense oligonucleotides of the present invention.
- the positive control for each datapoint is identified in the table by sequence ID number. If present, "N.D.” indicates "no data”.
- SEQ ID NO: 183, 184, 231, 249, 254, 346, 365 and 392 are presently more preferred.
- the target regions to which the preferred sequences are complementary are herein referred to as "preferred target segments” and are therefore preferred for targeting by compounds of the present invention. These preferred target segments are shown in Table 3. These sequences are shown to contain thymine (T) but one of skill in the art will appreciate that thymine (T) is generally replaced by uracil (U) in RNA sequences. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 1. "Target site” indicates the first (5 '-most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 3 is the species in which each of the preferred target segments was found.
- a second series of antisense compounds were designed to target different regions of the mouse glucagon receptor RNA, using published sequences (GenBank accession number NM_008101.1, incorporated herein as SEQ ID NO: 11, an mRNA sequence derived from GenBank accession number AF229079.1 with an alternate promoter, incorporated herein as SEQ ID NO: 400, GenBank accession number AF229079.1, incorporated herein as SEQ ID NO: 401, a second mRNA sequence derived from GenBank accession number AF229079.1 with an alternate promoter, incorporated herein as SEQ ID NO: 402, and GenBank accession number AA920726.1, incorporated herein as SEQ ID NO: 403).
- the compounds are shown in Table 2. "Target site” indicates the first (5' -most) nucleotide number on the particular target nucleic acid to which the compound binds. All compounds in Table 2 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap” region consisting of ten 2'- deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2 ' -methoxyethyl (2 ' -MOE) nucleotides .
- the compounds were analyzed for their effect on mouse glucagon receptor mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from three experiments in which mouse primary hepatocytes were treated with the antisense oligonucleotides of the present invention. The positive control for each datapoint is identified in the table by sequence ID number. If present, "N.D.” indicates "no data”.
- target regions to which these preferred sequences are complementary are herein referred to as "preferred target segments” and are therefore preferred for targeting by compounds of the present invention.
- These preferred target segments are shown in Table 3. These sequences are shown to contain thymine (T) but one of skill in the art will appreciate that thymine (T) is generally replaced by uracil (U) in RNA sequences .
- the sequences represent the reverse complement of the preferred antisense compounds shown in Tables 1 and 2.
- “Target site” indicates the first (5'- most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 3 is the species in which each of the preferred target segments was found. Table 3 Sequence and position of preferred target segments identified in glucagon receptor.
- antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other short oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
- GCS external guide sequence
- mice Effects of antisense inhibition of glucagon receptor in mice on plasma glucose levels and glucagon receptor mRNA reduction: Lean animals, db/db mice and ob/ob mice
- two antisense oligonucleotides targeted to the mouse glucagon receptor ISIS 148359 (agcaggctta ggttgtggtg, SEQ ID NO: 408) and ISIS 180475 (gagctttgcc ttcttgccat, SEQ ID NO: 452) , were evaluated for therapeutic efficacy in art- accepted mouse models of obesity and diabetes.
- Ob/ob mice have mutations in the leptin gene and are leptin- deficient, while db/db mice have mutations in the leptin receptor gene.
- the two strains exhibit obesity and diabetes strongly resembling Type 2 diabetes in humans . Tsang, S.H., 1998, P & S Medical Review, Vol. 5, No. 1.
- Db/db and ob/ob mice were evaluated over the course of 4 weeks for the effects of ISIS 148359 and ISIS 180475 on serum glucose levels and glucagon receptor mRNA levels, while normoglycemic mice were evaluated for 2 weeks.
- Control animals received saline treatment (50 mg/kg) .
- the normoglycemic mice were dosed subcutaneously twice a week for 2 weeks with 50 mg/kg of ISIS 148359, ISIS 180475 or saline.
- mice were dosed subcutaneously twice a week for 6 weeks with 25 mg/kg of ISIS 148359, ISIS 180475, saline, the positive control oligonucleotide ISIS 116847 (ctgctagcc tctggatttga, SEQ ID NO: 817) or the negative control oligonucleotide ISIS 141923 (ccttccctga aggttcctcc, SEQ ID NO: 818) .
- the mice were monitored weekly for fed or fasted plasma glucose levels (fasted glucose measured 16hr after last feeding) and upon termination of the experiment the level of glucagon receptor mRNA in the liver was determined.
- the data are summarized in Table 4.
- Glucagon receptor antisense oligonucleotides lower plasma glucose in ob/ob diabetic mice - 4 week study
- mice C57Bl/e0laHsd-Lep O b ⁇ ob/ob male mice were purchased from Harlan (Indianapolis, Indiana, USA) . Animals were acclimated for one week prior to study initiation. Mice were housed five per cage in polycarbonate cages with filter tops. Animals were maintained on a 12:12 hr light- dark cycle (lights on at 6:00 AM) at 21°C All animals received de-ionized water ad libi tum, ob/ob mice received Purina Diet 5015 ad libi tum. Antisense compounds were prepared in normal saline, and the solution was sterilized through a 0.2 ⁇ m filter.
- mice were dosed two times per week with antisense inhibitors of glucagon receptor [ISIS 148359 (SEQ ID NO: 408) or ISIS 180475 (SEQ ID NO: 452)], a generic control oligonucleotide (ISIS 141923; SEQ ID NO: 818) whose sequence does not match any known transcripts in the mouse or rat genomes, a mismatch oligonucleotide (ISIS 298682; GCGATTTCCCGTTTTGACC ; SEQ ID NO: 819) whose sequence is identical to ISIS 180475 except for 7 internal bases, or saline twice a week (every 3.5 days) for 4 weeks.
- ISIS 148359 SEQ ID NO: 408
- ISIS 180475 SEQ ID NO: 452
- oligonucleotides were administered at 25 mg/kg. Data are the mean values (+_ SEM where shown) of 8 mice per treatment group. Plasma glucose levels in all mice were approximately 330-370 mg/dl day zero. Whereas hyperglycemia worsened over time in saline- and control oligonucleotide-treated ob/ob mice, animals treated with glucagon receptor antisense compounds showed a dramatic reduction in plasma glucose. At day 12, plasma glucose levels in ob/ob mice treated with control oligonucleotide (ISIS 141923) and saline were approximately 472 and 425 mg/dl, respectively.
- ISIS 141923 control oligonucleotide
- Plasma glucose levels in mice treated with antisense oligonucleotides ISIS 148359 and ISIS 180475 were 240 and 180 mg/dl, respectively.
- plasma glucose levels in ob/ob mice treated with control oligonucleotide (ISIS 141923) and saline were approximately 435 and 390 mg/dl, respectively.
- Plasma glucose levels in mice treated with antisense oligonucleotides ISIS 148359 and ISIS 180475 were 165 and 130 mg/dl, respectively. The latter is in the normal range .
- liver glucagon receptor mRNA was measured (normalized to total RNA in the same samples using Ribogreen) and was found to be reduced by 85-95%. Data are mean values of four mice per treatment group (P ⁇ 0.05 using Student's t-test) .
- Glucagon receptor antisense oligonucleotides lower plasma glucose in db/db diabetic mice - 4 week study
- mice C57Bl/KsOlaHsd-Lep dJb ⁇ db/db) and lean (db +/? ) male mice were purchased from Harlan (Indianapolis, Indiana, USA) . Animals were acclimated for one week prior to study initiation. Mice were housed five per cage in polycarbonate cages with filter tops. Animals were maintained on a 12:12 hr light-dark cycle (lights on at 6:00 AM) at 21°C. All animals received de-ionized water ad libi tum . db/db mice received Purina Diet 5008 ad libi tum.
- Antisense compounds were prepared in normal saline, and the solution was sterilized through a 0.2 ⁇ m filter. Animals were dosed with antisense compound solutions or vehicle (saline) twice per week (separated by 3.5 days) via subcutaneous injection. Before the initiation of each study and once weekly during the study, blood was collected by tail clip without anesthesia into EDTA plasma tubes containing trasylol (Serologicals Proteins, Kankakee, Illinois, USA) and dipeptidyl peptidase (DPP) -IV inhibitor (Linco Diagnostic Services, St. Charles, Missouri, USA). Food intake and body weights were measured weekly.
- trasylol Serologicals Proteins, Kankakee, Illinois, USA
- DPP dipeptidyl peptidase
- Plasma levels of glucose and triglycerides were determined on the Hitachi 912 clinical chemistry analyzer (Roche, Indianapolis, Indiana, USA.
- antisense inhibitors of glucagon receptor [ISIS 148359 (SEQ ID NO: 408) or ISIS 180475 (SEQ ID NO: 452)]
- ISIS 148359 SEQ ID NO: 408
- ISIS 180475 SEQ ID NO: 452
- ISIS 141923 a generic control oligonucleotide
- a mismatch oligonucleotide ISIS 298682; SEQ ID NO: 819) whose sequence is identical to ISIS 180475 except for 7 internal bases, or saline for 4 weeks.
- Glucose lowering efficacy and target reduction in db/db mice undergoing glucagon receptor antisense treatment were similar to those observed in similarly treated ob/ob mice; furthermore, plasma triglycerides were lowered from 412+ 33 to 121 ⁇ 12 mg/dl following glucagon receptor antisense treatment (Table 5) . These results in db/db mice are similar to those reported in preliminary studies testing glucagon receptor antisense compound ISIS 148359 for 3 weeks [Osborne et al . , 2003, Diabetes 52, A129 (abstract)].
- ZDF/GmiCrl -fa/fa (ZDF) male rats were purchased from Charles River Laboratories (Wilmington, Massachusetts, USA) . Animals were acclimated for one week prior to study initiation. Rats were housed one per cage in polycarbonate cages with filter tops. Animals were maintained on a 12:12 hr light-dark cycle (lights on at 6:00 AM) at 21°C. All animals received de-ionized water ad libi tum . ZDF rats received Purina Diet 5008 ad libi tum .
- Antisense compounds were prepared in normal saline, and the solution was sterilized through a 0.2 ⁇ m filter. Seven-week old animals were dosed with antisense compound solutions or vehicle (saline) twice per week (separated by 3.5 days) via subcutaneous injection, for a total of 9 doses (last treatment on day 28) , followed by a washout period of equal duration. Oligonucleotide concentration was 25 mg/kg of either glucagon receptor antisense oligonucleotide ISIS 180475 (SEQ ID NO: 452) or negative control oligonucleotide ISIS 141923 (SEQ ID NO: 818) .
- target reduction by glucagon receptor antisense compound ISIS 180475 was significantly different when compared to control oligonucleotide- treated animals (P ⁇ 0.05 adjusted using the Tukey method) .
- Liver glucagon receptor mRNA decreased dramatically to 50% of controls within 24 hours after the first dose of ISIS 180475 and to 30% of controls 48 hr following the seventh dose .
- rats were treated as described above. Data are the mean values of five rats per treatment group.
- glucose lowering by the glucagon receptor antisense compound ISIS 180475 showed significant difference when compared to control oligonucleotide-treated animals. (P ⁇ 0.05 adjusted using the Tukey method) .
- the drop in plasma glucose paralleled the drop' in glucagon receptor mRNA levels; there was a significant drop in plasma glucose within 48 hours after the initial glucagon receptor antisense dose.
- the control oligonucleotide (ISIS 141923) treated rats had plasma glucose levels averaging approximately 417 mg/dl and antisense (ISIS 180475) treated rats had plasma glucose levels averaging approximately 143 mg/dl .
- hyperglycemia and glucagon receptor expression in liver began to rebound within 10 days, but even one month after the final dose, efficacy was still observed as plasma glucose and target mRNA levels in washout animals remained below pre-treatment levels.
- Glucose lowering achieved by the twice per week dosing schedule and the gradula rebound of glucagon receptor mRNA during the washout period are both consistent with the extended half lives of 2'- methoxyethoxy modified phosphorothioate oligonucleotides (typically ranging from 9 to 19 days according to published reports) .
- Non-fasted plasma insulin levels were also determined for rats treated as described above. Data are the mean values of five rats per treatment group. No significant changes were observed during the treatment period; however, individual comparisons between glucagon receptor antisense and control oligonucleotide treated animals on day 38 and 56 (washout period) were significant (P ⁇ 0.05). Plasma insulin levels declined during the treatment phase in both control oligonucleotide and antisense-treated animals. During the washout phase of the control oligonucleotide treated group, insulin levels continued to decline as hyperglycemia progressed. This result is expected since beta-cell failure typically occurs in ZDF rats between 8 and 12 weeks of age. Interestingly, the mild elevation of glucose in glucagon receptor antisense-treated animals during the washout period resulted in a robust rise in plasma insulin to levels nearly as high as at start of study. This is consistent with evidence of preserved beta-cell function.
- Glucagon receptor antisense oligonucleotides do not cause hyperglycemia or hypoglycemia, in spite of hyperglucagonemia
- glucagon receptor antisense-treated animals showed a moderate decrease in fed plasma glucose at all time points tested.
- Glucagon receptor mRNA is reduced in islets of antisense- treated db/db mice
- the common bile duct was cannulated with a 27-gauge needle and the pancreas was distended with 3 ml of Hank's buffer (Sigma, Taufkirchen, Germany) containing 2% bovine serum albumin (Applichem, Darmstadt, Germany) and 1 mg/ml collagenase (Serva, Heidelberg, Germany) . Subsequently, the pancreas was removed and digested in Hank's buffer at 37°C. Islets were purified on a Histopaque-1077TM (Sigma) gradient for 15 min at 750 x g.
- Islets were cultured overnight in RPMI-1640 medium containing 10% FBS, 100 U/ml penicillin, and 100 : g/ml streptomycin (Invitrogen, Düsseldorf, Germany) . 200 islets from 3 individuals were pooled to give one sample for RNA extraction. Real-time quantitative RT-PCR was used to profile gene expression. Islet glucagon receptor mRNA levels were decreased by approximately 75% in antisense- treated animals compared to saline-treated controls. It should be noted that, in addition to pharmacologic effect of the antisense compound, a compensatory response to hyperglucagonemia or the increased alpha-cell populations in treated animals could contribute to the results observed.
- Glucagon receptor antisense oligonucleotides decrease the number of functional glucagon receptors
- glucagon receptor mRNA correlates .with a reduction in functional glucagon receptor number
- a homologous competition assay was performed using hepatocyte membranes prepared from mice treated with control or glucagon receptor antisense compounds. 125 I-glucagon binding was effectively competed by increasing concentrations of unlabeled glucagon in control membrane samples.
- Antisense inhibitors of human and monkey glucagon receptor- dose response Based on the screen in Example 15 above, a subset of human glucagon receptor antisense oligonucleotides were chosen for further study. Dose-response studies were conducted for ISIS 315186, 310457, 315324, 315278, 315181, 315297, 315163 and 310456 in both human HepG2 cell cultures and in cynomolgus monkey primary hepatocytes . These six compounds are homologous to both human and cynomolgus monkey glucagon receptor nucleic acid targets.
- the universal control ISIS 29848 (NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN; SEQ ID NO : 820, where N is an equimolar mixture of A, C, G and T, a chimeric 2' MOE gapmer with a phosphorothioate backbone and with MOEs at positions 1-5 & 16-20) was used as negative control.
- HepG2 The human hepatoblastoma cell line HepG2 was obtained from the American Type Culture Collection (Manassas, VA) . HepG2 cells are routinely cultured in
- hepatocytes Primary cynomolgus monkey hepatocytes were obtained from CellzDirect (Los Angeles) and plated onto collagen- coated 24-well plates (Costar) at a density of 75,000 cells/well. The culturing medium for these hepatocytes was William's E media (Invitrogen) supplemented with 10% FBS (Invitrogen) . Cells were allowed to attach overnight and were then treated with oligonucleotide-Lipofectin mixture for 4 hours. The oligonucleotide-Lipofectin mixture was washed off and then cells were incubated in normal medium.
- Samples were shipped on dry ice via overnight courier as described below for subsequent analysis .
- oligonucleotides were given at 2.0, 5.0 and 20 mg/kg/dose (Day 1, 3 and 5); in week 2 through 10, oligonucleotides were given at 1.0, 2.5 and 10 mg/kg/dose (twice weekly starting at Day 8)
- the larger dose (6, 15 or 60 mg/kg/week, i.e. 3 injections of 2, 5 or 20 mg/kg) was given in week 1 in order to rapidly achieve the desired steady state oligonucleotide concentration.
- compounds were administered 3 times, every other day; for weeks 2-10, compounds were administered twice per week, with at least 2 days between dosings .
- Oligonucleotides were given by subcutaneous (SC) injection, using volumes of 0.1-0.3ml/kg) .
- SC subcutaneous
- the appropriate volume of the relevant ASO solution or of the control/vehicle article was administered subcutaneously using a syringe and needle (27G) .
- the total volume of the relevant dosing solution or the control article was calculated on the basis of the animal's most recent body weight.
- Multiple injection sites on the upper back (intra-scapular region) of each monkey were employed. During acclimation the skin of the upper back was be shaved and a clock-like grid (points at 12, 3, 6, and 9 o'clock) was tattooed on each animal. Injection points were a minimum of 5 cm apart. The injection sites were rotated so that each site was used for fourth dose, starting with 12 o'clock and rotating clockwise. The needle was inserted away from the dot and angled so that the dose was deposited underneath the dot .
- RNA amounts were normalized to 18S RNA levels in the tissue. Results are shown in Table 7, as percent reduction in glucagon receptor mRNA in antisense-treated monkeys compared to saline-treated monkeys.
- Glucagon receptor mRNA reduction in monkey liver after treatment with antisense inhibitors of glucagon receptor Glucagon receptor mRNA reduction in monkey liver after treatment with antisense inhibitors of glucagon receptor
- RNA analysis of the same tissue samples by RT-PCR was repeated independently using the same primer-probe set as above. Results are shown in Table 8 as percent reduction in glucagon receptor mRNA in antisense-treated monkeys compared to saline-treated monkeys.
- Glucagon receptor mRNA reduction in monkey liver after treatment with antisense inhibitors of glucagon receptor Glucagon receptor mRNA reduction in monkey liver after treatment with antisense inhibitors of glucagon receptor
- RT-PCR results obtained by RT-PCR were confirmed by Northern blot analysis according to standard methods (Example 14) .
- the cDNA probe that was used for northern blots was a 900-base fragment of monkey GCGR generated by RT-PCR from cynomolgus monkey liver. Results are shown in Table 9.
- Blood glucose levels were measured in monkeys after treatment with antisense inhibitors of glucagon receptor. Glucose readings were performed using a drop of blood from the blood samples collected as above and read on a One Touch Profile ® (Lifescan Inc., a Johnson and Johnson Company) . Because normoglycemic (nondiabetic) monkeys were used in this study, no significant changes in blood glucose levels were expected or observed. At no point did animals become hypoglycemic after antisense treatment.
- Glucagon levels were measured in plasma of fasted monkeys before (baseline) and after treatment for 5 weeks or 10 weeks with antisense inhibitors of glucagon receptor. Monkeys were anesthetized prior to blood collection to avoid artifacts due to stress. Glucagon levels were determined by radioimmunoassay, ELISA and/or Luminex immunoassay by contract laboratory (Linco, St. Charles MO) . Results are shown in Table 10.
- GLP-1 Glucagon-like peptide 1
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Diabetes (AREA)
- Biomedical Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Animal Behavior & Ethology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Obesity (AREA)
- Hematology (AREA)
- Toxicology (AREA)
- Wood Science & Technology (AREA)
- Endocrinology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Emergency Medicine (AREA)
- Child & Adolescent Psychology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP04750827A EP1620453A4 (en) | 2003-04-28 | 2004-04-28 | MODULATION OF EXPRESSION OF THE GLUCAGON RECEPTOR |
| JP2006513404A JP2007525945A (ja) | 2003-04-28 | 2004-04-28 | グルコガンレセプター発現の調節 |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US46625603P | 2003-04-28 | 2003-04-28 | |
| US60/466,256 | 2003-04-28 | ||
| US10/832,777 US7399853B2 (en) | 2003-04-28 | 2004-04-27 | Modulation of glucagon receptor expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004096016A2 true WO2004096016A2 (en) | 2004-11-11 |
| WO2004096016A3 WO2004096016A3 (en) | 2005-08-11 |
Family
ID=33544192
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2004/013120 Ceased WO2004096016A2 (en) | 2003-04-28 | 2004-04-28 | Modulation of glucagon receptor expression |
Country Status (4)
| Country | Link |
|---|---|
| US (7) | US7399853B2 (https=) |
| EP (3) | EP2327709B1 (https=) |
| JP (3) | JP2007525945A (https=) |
| WO (1) | WO2004096016A2 (https=) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7399853B2 (en) | 2003-04-28 | 2008-07-15 | Isis Pharmaceuticals | Modulation of glucagon receptor expression |
| US7750142B2 (en) | 2003-04-28 | 2010-07-06 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
| US7968686B2 (en) | 2008-03-27 | 2011-06-28 | Eli Lilly And Company | Glucagon receptor antagonists |
| US8865674B2 (en) | 2011-09-20 | 2014-10-21 | Isis Pharmaceuticals, Inc. | Antisense modulation of GCGR expression |
| WO2014179620A1 (en) | 2013-05-01 | 2014-11-06 | Isis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
| RU2603076C2 (ru) * | 2011-04-27 | 2016-11-20 | Айсис Фармасьютикалс, Инк. | Модулирование экспрессии аполипопротеина сiii (аросiii) |
| US9994855B2 (en) | 2014-05-01 | 2018-06-12 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating growth hormone receptor expression |
| US10570169B2 (en) | 2014-05-22 | 2020-02-25 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
| US11400161B2 (en) | 2016-10-06 | 2022-08-02 | Ionis Pharmaceuticals, Inc. | Method of conjugating oligomeric compounds |
Families Citing this family (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7407943B2 (en) * | 2001-08-01 | 2008-08-05 | Isis Pharmaceuticals, Inc. | Antisense modulation of apolipoprotein B expression |
| US7511131B2 (en) | 2002-11-13 | 2009-03-31 | Genzyme Corporation | Antisense modulation of apolipoprotein B expression |
| US20060009410A1 (en) * | 2002-11-13 | 2006-01-12 | Crooke Rosanne M | Effects of apolipoprotein B inhibition on gene expression profiles in animals |
| US7691998B2 (en) * | 2002-11-14 | 2010-04-06 | Dharmacon, Inc. | siRNA targeting nucleoporin 62kDa (Nup62) |
| US9879266B2 (en) | 2002-11-14 | 2018-01-30 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
| US9719092B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting CNTD2 |
| US9719094B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting SEC61G |
| AU2003295600A1 (en) * | 2002-11-14 | 2004-06-15 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| US9771586B2 (en) | 2002-11-14 | 2017-09-26 | Thermo Fisher Scientific Inc. | RNAi targeting ZNF205 |
| US20100113307A1 (en) * | 2002-11-14 | 2010-05-06 | Dharmacon, Inc. | siRNA targeting vascular endothelial growth factor (VEGF) |
| US9228186B2 (en) | 2002-11-14 | 2016-01-05 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
| US7781575B2 (en) | 2002-11-14 | 2010-08-24 | Dharmacon, Inc. | siRNA targeting tumor protein 53 (p53) |
| US7612196B2 (en) | 2002-11-14 | 2009-11-03 | Dharmacon, Inc. | siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B) |
| WO2006006948A2 (en) | 2002-11-14 | 2006-01-19 | Dharmacon, Inc. | METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY |
| US9839649B2 (en) | 2002-11-14 | 2017-12-12 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
| US10011836B2 (en) | 2002-11-14 | 2018-07-03 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
| US20050287558A1 (en) * | 2004-05-05 | 2005-12-29 | Crooke Rosanne M | SNPs of apolipoprotein B and modulation of their expression |
| US7585968B2 (en) * | 2005-03-28 | 2009-09-08 | Isis Pharmaceuticals, Inc. | Compositions and their uses directed to thymus and activation-regulated chemokine (TARC) |
| CA2623762A1 (en) * | 2005-09-19 | 2007-03-29 | Johnson & Johnson Pharmaceutical Research & Development, L.L.C. | Modulation of glucagon receptor expression |
| JP2009536222A (ja) | 2006-05-05 | 2009-10-08 | アイシス ファーマシューティカルズ, インコーポレーテッド | Pcsk9の発現を調節するための化合物および方法 |
| US20080241140A1 (en) * | 2007-02-12 | 2008-10-02 | Medical College Of Georgia | Gene amplification of coactivator coaa and uses thereof |
| CA2682082A1 (en) * | 2007-03-24 | 2008-10-02 | Genzyme Corporation | Administering antisense oligonucleotides complementary to human apolipoprotein b |
| EP2408796B1 (en) | 2009-03-16 | 2020-04-22 | Ionis Pharmaceuticals, Inc. | Targeting Apolipoprotein B for the reduction of Apolipoprotein C-III |
| WO2017192820A1 (en) | 2016-05-06 | 2017-11-09 | Ionis Pharmaceuticals, Inc. | Glp-1 receptor ligand moiety conjugated oligonucleotides and uses thereof |
| CA3043768A1 (en) | 2016-11-29 | 2018-06-07 | PureTech Health LLC | Exosomes for delivery of therapeutic agents |
| WO2021229036A1 (en) * | 2020-05-13 | 2021-11-18 | F. Hoffmann-La Roche Ag | Oligonucleotide agonists targeting progranulin |
Family Cites Families (237)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
| US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
| JPS5927900A (ja) | 1982-08-09 | 1984-02-14 | Wakunaga Seiyaku Kk | 固定化オリゴヌクレオチド |
| FR2540122B1 (fr) | 1983-01-27 | 1985-11-29 | Centre Nat Rech Scient | Nouveaux composes comportant une sequence d'oligonucleotide liee a un agent d'intercalation, leur procede de synthese et leur application |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
| FR2567892B1 (fr) | 1984-07-19 | 1989-02-17 | Centre Nat Rech Scient | Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons |
| US5430136A (en) | 1984-10-16 | 1995-07-04 | Chiron Corporation | Oligonucleotides having selectably cleavable and/or abasic sites |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| FR2575751B1 (fr) | 1985-01-08 | 1987-04-03 | Pasteur Institut | Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques |
| US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| JPS638396A (ja) | 1986-06-30 | 1988-01-14 | Wakunaga Pharmaceut Co Ltd | ポリ標識化オリゴヌクレオチド誘導体 |
| EP0260032B1 (en) | 1986-09-08 | 1994-01-26 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
| US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| EP0366685B1 (en) | 1987-06-24 | 1994-10-19 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
| US4924624A (en) | 1987-10-22 | 1990-05-15 | Temple University-Of The Commonwealth System Of Higher Education | 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| DE3738460A1 (de) | 1987-11-12 | 1989-05-24 | Max Planck Gesellschaft | Modifizierte oligonukleotide |
| US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
| ATE151467T1 (de) | 1987-11-30 | 1997-04-15 | Univ Iowa Res Found | Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| JPH03503894A (ja) | 1988-03-25 | 1991-08-29 | ユニバーシィティ オブ バージニア アランミ パテンツ ファウンデイション | オリゴヌクレオチド n‐アルキルホスホラミデート |
| US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5194599A (en) | 1988-09-23 | 1993-03-16 | Gilead Sciences, Inc. | Hydrogen phosphonodithioate compositions |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5457183A (en) | 1989-03-06 | 1995-10-10 | Board Of Regents, The University Of Texas System | Hydroxylated texaphyrins |
| US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
| US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
| US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
| US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| US5721218A (en) | 1989-10-23 | 1998-02-24 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
| US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
| US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
| DE69034150T2 (de) | 1989-10-24 | 2005-08-25 | Isis Pharmaceuticals, Inc., Carlsbad | 2'-Modifizierte Oligonukleotide |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
| US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
| US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
| US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
| US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| US5587470A (en) | 1990-01-11 | 1996-12-24 | Isis Pharmaceuticals, Inc. | 3-deazapurines |
| US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
| US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
| AU7579991A (en) | 1990-02-20 | 1991-09-18 | Gilead Sciences, Inc. | Pseudonucleosides and pseudonucleotides and their polymers |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
| US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
| US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| GB9009980D0 (en) | 1990-05-03 | 1990-06-27 | Amersham Int Plc | Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| ES2116977T3 (es) | 1990-05-11 | 1998-08-01 | Microprobe Corp | Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente. |
| US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
| US5378825A (en) | 1990-07-27 | 1995-01-03 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5386023A (en) | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
| US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5223618A (en) | 1990-08-13 | 1993-06-29 | Isis Pharmaceuticals, Inc. | 4'-desmethyl nucleoside analog compounds |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| JPH0874B2 (ja) | 1990-07-27 | 1996-01-10 | アイシス・ファーマシューティカルス・インコーポレーテッド | 遺伝子発現を検出および変調するヌクレアーゼ耐性、ピリミジン修飾オリゴヌクレオチド |
| MY107332A (en) | 1990-08-03 | 1995-11-30 | Sterling Drug Inc | Compounds and methods for inhibiting gene expression. |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
| US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
| JPH06505704A (ja) | 1990-09-20 | 1994-06-30 | ギリアド サイエンシズ,インコーポレイテッド | 改変ヌクレオシド間結合 |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| KR930702373A (ko) | 1990-11-08 | 1993-09-08 | 안토니 제이. 페이네 | 합성 올리고누클레오티드에 대한 다중 리포터(Reporter)그룹의 첨합 |
| US6582908B2 (en) | 1990-12-06 | 2003-06-24 | Affymetrix, Inc. | Oligonucleotides |
| US5672697A (en) | 1991-02-08 | 1997-09-30 | Gilead Sciences, Inc. | Nucleoside 5'-methylene phosphonates |
| WO1992017611A1 (en) * | 1991-03-28 | 1992-10-15 | The University Of Tennessee Research Corporation | Dna silver staining |
| JP3220180B2 (ja) | 1991-05-23 | 2001-10-22 | 三菱化学株式会社 | 薬剤含有タンパク質結合リポソーム |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| EP0590090A4 (en) * | 1991-06-18 | 1995-04-12 | Univ Temple | SELECTIVE INHIBITATION OF LEUKEMIC CELL PROLIFERATION BY -I (BCR-ABL) ANTISENS OLIGONUCLEOTIDES. |
| DK0593618T3 (da) * | 1991-06-27 | 1998-11-23 | Genelabs Tech Inc | Screeningsassay til påvisning af DNA-bindende molekyler |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
| US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
| NZ244306A (en) | 1991-09-30 | 1995-07-26 | Boehringer Ingelheim Int | Composition for introducing nucleic acid complexes into eucaryotic cells, complex containing nucleic acid and endosomolytic agent, peptide with endosomolytic domain and nucleic acid binding domain and preparation |
| EP0538194B1 (de) | 1991-10-17 | 1997-06-04 | Novartis AG | Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte |
| US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
| US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
| AU3222793A (en) | 1991-11-26 | 1993-06-28 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| TW393513B (en) | 1991-11-26 | 2000-06-11 | Isis Pharmaceuticals Inc | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| FR2687679B1 (fr) | 1992-02-05 | 1994-10-28 | Centre Nat Rech Scient | Oligothionucleotides. |
| US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
| US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
| EP0577558A2 (de) | 1992-07-01 | 1994-01-05 | Ciba-Geigy Ag | Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
| ATE162198T1 (de) | 1992-07-27 | 1998-01-15 | Hybridon Inc | Oligonukleotid alkylphosphonothiate |
| US5804383A (en) * | 1992-08-21 | 1998-09-08 | The Regents Of The University Of California | Method and assay for detection of the expression of allele-specific mutations by allele-specific in situ reverse transcriptase polymerase chain reaction |
| US5776725A (en) * | 1992-08-28 | 1998-07-07 | Zymogenetics, Inc. | Recombinant production of glucagon receptors |
| HU219674B (hu) | 1992-08-28 | 2001-06-28 | Novo Nordisk A/S | Glukagon-receptort kódoló DNS-molekulák, glukagon-receptor peptidek, glukagon-receptort blokkoló monoklonális ellenanyagok, és eljárások előállításukra |
| US5872242A (en) * | 1992-10-05 | 1999-02-16 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide inhibition of ras |
| US5985558A (en) * | 1997-04-14 | 1999-11-16 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the inibition of c-Jun and c-Fos |
| US6410324B1 (en) * | 2001-04-27 | 2002-06-25 | Isis Pharmaceuticals, Inc. | Antisense modulation of tumor necrosis factor receptor 2 expression |
| US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| JP3351476B2 (ja) | 1993-01-22 | 2002-11-25 | 三菱化学株式会社 | リン脂質誘導体及びそれを含有するリポソーム |
| ATE138384T1 (de) | 1993-01-25 | 1996-06-15 | Hybridon Inc | Olionukleotidalkylphosphonate und - phosphonothioate |
| US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
| US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
| GB9304618D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Chemical compounds |
| GB9304620D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Compounds |
| CA2159631A1 (en) | 1993-03-30 | 1994-10-13 | Sanofi | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| HU9501974D0 (en) | 1993-03-31 | 1995-09-28 | Sterling Winthrop Inc | Oligonucleotides with amide linkages replacing phosphodiester linkages |
| DE4311944A1 (de) | 1993-04-10 | 1994-10-13 | Degussa | Umhüllte Natriumpercarbonatpartikel, Verfahren zu deren Herstellung und sie enthaltende Wasch-, Reinigungs- und Bleichmittelzusammensetzungen |
| US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
| US6455689B1 (en) | 1993-04-30 | 2002-09-24 | Biognostik Gesellschaft für Biomolekulare Diagnostik mbH | Antisense-oligonucleotides for transforming growth factor-β (TGF-β) |
| US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
| US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
| US5801154A (en) * | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
| US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
| US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
| DE733059T1 (de) | 1993-12-09 | 1997-08-28 | Univ Jefferson | Verbindungen und verfahren zur ortsspezifischen mutation in eukaryotischen zellen |
| US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
| US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
| US5563036A (en) * | 1994-04-29 | 1996-10-08 | Tularik, Inc. | Transcription factor-DNA binding assay |
| US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
| US5612455A (en) * | 1994-07-05 | 1997-03-18 | Tularik, Inc. | Nuclear factors and binding assay |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5734039A (en) * | 1994-09-15 | 1998-03-31 | Thomas Jefferson University | Antisense oligonucleotides targeting cooperating oncogenes |
| US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
| US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
| US5792747A (en) | 1995-01-24 | 1998-08-11 | The Administrators Of The Tulane Educational Fund | Highly potent agonists of growth hormone releasing hormone |
| US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
| CA2253877A1 (en) * | 1997-03-07 | 1998-11-09 | Mochida Pharmaceutical Co., Ltd. | Antisense compounds to cd14 |
| JP3756313B2 (ja) | 1997-03-07 | 2006-03-15 | 武 今西 | 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体 |
| US6133246A (en) * | 1997-08-13 | 2000-10-17 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the modulation of JNK proteins |
| JP4236812B2 (ja) | 1997-09-12 | 2009-03-11 | エクシコン エ/エス | オリゴヌクレオチド類似体 |
| CA2304312A1 (en) * | 1997-09-17 | 1999-03-25 | East Carolina University | Multiple target hybridizing nucleic acids, their preparation, compositions, formulation, kits and applications |
| WO1999015643A2 (en) * | 1997-09-25 | 1999-04-01 | University Of Florida | ANTISENSE OLIGONUCLEOTIDE COMPOSITIONS TARGETED TO ANGIOTENSI N CONVERTING ENZYME mRNA AND METHODS OF USE |
| US20030203862A1 (en) * | 1998-03-26 | 2003-10-30 | Miraglia Loren J. | Antisense modulation of MDM2 expression |
| US6238921B1 (en) * | 1998-03-26 | 2001-05-29 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of human mdm2 expression |
| US20030228597A1 (en) | 1998-04-13 | 2003-12-11 | Cowsert Lex M. | Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation |
| JP2002521037A (ja) | 1998-07-23 | 2002-07-16 | ジェン−プローブ・インコーポレーテッド | スプライシングされた核酸を検出および測定する方法 |
| US20030096771A1 (en) * | 2001-07-26 | 2003-05-22 | Butler Madeline M. | Antisense modulation of hormone-sensitive lipase expression |
| US6228642B1 (en) * | 1998-10-05 | 2001-05-08 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of tumor necrosis factor-(α) (TNF-α) expression |
| US6692959B2 (en) * | 1998-11-25 | 2004-02-17 | Isis Pharmaceuticals, Inc. | Antisense modulation of IL-1 receptor-associated kinase-4 expression |
| US20030087854A1 (en) * | 2001-09-10 | 2003-05-08 | Isis Pharmaceuticals Inc. | Antisense modulation of fibroblast growth factor receptor 3 expression |
| JP4785252B2 (ja) | 1999-02-26 | 2011-10-05 | ザ・ユニバーシティ・オブ・ブリティッシュ・コロンビア | Trpm−2アンチセンス療法 |
| US5998148A (en) * | 1999-04-08 | 1999-12-07 | Isis Pharmaceuticals Inc. | Antisense modulation of microtubule-associated protein 4 expression |
| US6492152B1 (en) * | 1999-06-15 | 2002-12-10 | The Board Of Regents Of The University Of Oklahoma | Core 1 β3-galactosyl transferases and methods of use thereof |
| US6284538B1 (en) * | 1999-07-21 | 2001-09-04 | Isis Pharmaceuticals, Inc. | Antisense inhibition of PTEN expression |
| JP2003516151A (ja) * | 1999-11-29 | 2003-05-13 | エイブイアイ バイオファーマ, インコーポレイテッド | 細菌16Sおよび23SrRNAに標的化された、荷電していないアンチセンスオリゴヌクレオチド、ならびにその使用 |
| US20020055479A1 (en) * | 2000-01-18 | 2002-05-09 | Cowsert Lex M. | Antisense modulation of PTP1B expression |
| US6287860B1 (en) | 2000-01-20 | 2001-09-11 | Isis Pharmaceuticals, Inc. | Antisense inhibition of MEKK2 expression |
| US6770486B1 (en) * | 2000-02-08 | 2004-08-03 | Isis Pharmaceuticals, Inc. | Optimization of ligand affinity for RNA targets using mass spectrometry |
| WO2001092524A2 (en) | 2000-05-26 | 2001-12-06 | Aeomica, Inc. | Myosin-like gene expressed in human heart and muscle |
| EP1313753A4 (en) | 2000-08-18 | 2004-09-15 | Proskelia | REGULATORY GENE AND SYSTEM FOR USE IN THE DIAGNOSIS AND TREATMENT OF OSTEOPOROSIS |
| WO2002027033A1 (en) * | 2000-09-29 | 2002-04-04 | Isis Pharmaceuticals, Inc. | Antisense modulation of mekk4 expression |
| US6426220B1 (en) | 2000-10-30 | 2002-07-30 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
| AU2002239538A1 (en) | 2000-12-06 | 2002-06-18 | Deltagen, Inc. | Transgenic mice containing glucagon receptor gene disruptions |
| US7425545B2 (en) * | 2001-07-25 | 2008-09-16 | Isis Pharmaceuticals, Inc. | Modulation of C-reactive protein expression |
| US7407943B2 (en) * | 2001-08-01 | 2008-08-05 | Isis Pharmaceuticals, Inc. | Antisense modulation of apolipoprotein B expression |
| WO2003103377A2 (en) * | 2002-06-06 | 2003-12-18 | Monsanto Technology Llc | Methods and compositions for production of maize lines with increased transformability |
| US6903105B2 (en) * | 2003-02-19 | 2005-06-07 | Parion Sciences, Inc. | Sodium channel blockers |
| US7399853B2 (en) * | 2003-04-28 | 2008-07-15 | Isis Pharmaceuticals | Modulation of glucagon receptor expression |
| US7750142B2 (en) | 2003-04-28 | 2010-07-06 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
| US7825235B2 (en) * | 2003-08-18 | 2010-11-02 | Isis Pharmaceuticals, Inc. | Modulation of diacylglycerol acyltransferase 2 expression |
| US20050142581A1 (en) | 2003-09-04 | 2005-06-30 | Griffey Richard H. | Microrna as ligands and target molecules |
| US20050053981A1 (en) * | 2003-09-09 | 2005-03-10 | Swayze Eric E. | Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini |
| US20050074801A1 (en) * | 2003-09-09 | 2005-04-07 | Monia Brett P. | Chimeric oligomeric compounds comprising alternating regions of northern and southern conformational geometry |
| WO2005061710A1 (en) * | 2003-12-23 | 2005-07-07 | Santaris Pharma A/S | Oligomeric compounds for the modulation of bcl-2 |
| US7919472B2 (en) * | 2004-09-17 | 2011-04-05 | Isis Pharmaceuticals, Inc. | Enhanced antisense oligonucleotides |
| DE202005008426U1 (de) | 2005-05-31 | 2005-09-15 | Ricon Sieb Und Foerdertechnik | Fördervorrichtung mit Fördertuch |
| CA2623762A1 (en) * | 2005-09-19 | 2007-03-29 | Johnson & Johnson Pharmaceutical Research & Development, L.L.C. | Modulation of glucagon receptor expression |
| US8935416B2 (en) | 2006-04-21 | 2015-01-13 | Fortinet, Inc. | Method, apparatus, signals and medium for enforcing compliance with a policy on a client computer |
| WO2013080784A1 (ja) | 2011-11-30 | 2013-06-06 | シャープ株式会社 | メモリ回路とその駆動方法、及び、これを用いた不揮発性記憶装置、並びに、液晶表示装置 |
| US9400902B2 (en) | 2012-05-22 | 2016-07-26 | Trimble Navigation Limited | Multi-modal entity tracking and display |
| US10867398B2 (en) | 2017-11-21 | 2020-12-15 | Reliance Core Consulting LLC | Methods, systems, apparatuses and devices for facilitating motion analysis in an environment |
-
2004
- 2004-04-27 US US10/832,777 patent/US7399853B2/en not_active Expired - Fee Related
- 2004-04-28 EP EP10181097.6A patent/EP2327709B1/en not_active Expired - Lifetime
- 2004-04-28 EP EP04750827A patent/EP1620453A4/en not_active Withdrawn
- 2004-04-28 WO PCT/US2004/013120 patent/WO2004096016A2/en not_active Ceased
- 2004-04-28 EP EP10175905A patent/EP2272857A1/en not_active Withdrawn
- 2004-04-28 JP JP2006513404A patent/JP2007525945A/ja active Pending
-
2007
- 2007-04-05 US US11/697,273 patent/US20070238689A1/en not_active Abandoned
- 2007-04-05 US US11/697,270 patent/US20070238688A1/en not_active Abandoned
- 2007-04-05 US US11/697,262 patent/US20070238687A1/en not_active Abandoned
- 2007-04-05 US US11/697,280 patent/US7919476B2/en not_active Expired - Lifetime
-
2010
- 2010-03-16 US US12/725,359 patent/US20100234447A1/en not_active Abandoned
-
2011
- 2011-09-14 JP JP2011200724A patent/JP2012050439A/ja active Pending
- 2011-09-14 JP JP2011200723A patent/JP2012050438A/ja active Pending
-
2012
- 2012-08-03 US US13/566,642 patent/US8642753B2/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| See references of EP1620453A4 * |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7750142B2 (en) | 2003-04-28 | 2010-07-06 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
| US7919476B2 (en) | 2003-04-28 | 2011-04-05 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
| US8642753B2 (en) | 2003-04-28 | 2014-02-04 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
| US7399853B2 (en) | 2003-04-28 | 2008-07-15 | Isis Pharmaceuticals | Modulation of glucagon receptor expression |
| US7968686B2 (en) | 2008-03-27 | 2011-06-28 | Eli Lilly And Company | Glucagon receptor antagonists |
| RU2603076C2 (ru) * | 2011-04-27 | 2016-11-20 | Айсис Фармасьютикалс, Инк. | Модулирование экспрессии аполипопротеина сiii (аросiii) |
| RU2603076C9 (ru) * | 2011-04-27 | 2017-02-03 | Айсис Фармасьютикалс, Инк. | Модулирование экспрессии аполипопротеина сiii (аросiii) |
| US8865674B2 (en) | 2011-09-20 | 2014-10-21 | Isis Pharmaceuticals, Inc. | Antisense modulation of GCGR expression |
| EP3401401A1 (en) | 2011-09-20 | 2018-11-14 | Ionis Pharmaceuticals, Inc. | Antisense modulation of gcgr expression |
| US9404114B2 (en) | 2011-09-20 | 2016-08-02 | Ionis Pharmaceuticals, Inc. | Antisense modulation of GCGR expression |
| RU2598709C2 (ru) * | 2011-09-20 | 2016-09-27 | Айсис Фармасьютикалс, Инк. | Антисмысловая регуляция экспрессии gcgr |
| US11299736B1 (en) | 2013-05-01 | 2022-04-12 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
| US9714421B2 (en) | 2013-05-01 | 2017-07-25 | Ionis Pharmaceuticals, Inc. | Compositions and methods |
| US10883104B2 (en) | 2013-05-01 | 2021-01-05 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating apolipoprotein (a) expression |
| WO2014179620A1 (en) | 2013-05-01 | 2014-11-06 | Isis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
| US11851655B2 (en) | 2013-05-01 | 2023-12-26 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating apolipoprotein (a) expression |
| US12291709B2 (en) | 2013-05-01 | 2025-05-06 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating apolipoprotein (a) expression |
| US9994855B2 (en) | 2014-05-01 | 2018-06-12 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating growth hormone receptor expression |
| US10793862B2 (en) | 2014-05-01 | 2020-10-06 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating growth hormone receptor expression |
| US11312964B2 (en) | 2014-05-01 | 2022-04-26 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating growth hormone receptor expression |
| US10570169B2 (en) | 2014-05-22 | 2020-02-25 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
| US11400161B2 (en) | 2016-10-06 | 2022-08-02 | Ionis Pharmaceuticals, Inc. | Method of conjugating oligomeric compounds |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2007525945A (ja) | 2007-09-13 |
| US7399853B2 (en) | 2008-07-15 |
| US20070238689A1 (en) | 2007-10-11 |
| US20070238690A1 (en) | 2007-10-11 |
| US20040266714A1 (en) | 2004-12-30 |
| EP1620453A2 (en) | 2006-02-01 |
| EP2272857A1 (en) | 2011-01-12 |
| US20100234447A1 (en) | 2010-09-16 |
| US7919476B2 (en) | 2011-04-05 |
| EP2327709A3 (en) | 2011-10-05 |
| EP2327709A2 (en) | 2011-06-01 |
| JP2012050439A (ja) | 2012-03-15 |
| US20070238687A1 (en) | 2007-10-11 |
| US8642753B2 (en) | 2014-02-04 |
| EP2327709B1 (en) | 2017-05-17 |
| US20070238688A1 (en) | 2007-10-11 |
| WO2004096016A3 (en) | 2005-08-11 |
| US20120295958A1 (en) | 2012-11-22 |
| JP2012050438A (ja) | 2012-03-15 |
| EP1620453A4 (en) | 2006-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8642753B2 (en) | Modulation of glucagon receptor expression | |
| AU2004217508B2 (en) | Modulation of growth hormone receptor expression and insulin-like growth factor expression | |
| US7598227B2 (en) | Modulation of apolipoprotein C-III expression | |
| US9988635B2 (en) | Modulation of growth hormone receptor expression and insulin-like growth factor expression | |
| US7750142B2 (en) | Modulation of glucagon receptor expression | |
| WO2004055162A2 (en) | Modulation of endothelial lipase expression | |
| CA2515484C (en) | Modulation of insulin like growth factor i receptor expression | |
| US20070265219A1 (en) | Modulation of thyroid hormone receptor interactor 3 expression | |
| WO2004045527A2 (en) | Modulation of nima-related kinase 6 expression | |
| US20090111767A1 (en) | Modulation of insulin like growth factor i receptor expression | |
| WO2004053083A2 (en) | Modulation of fetoprotein transcription factor expression | |
| WO2004046326A2 (en) | Modulation of interleukin 22 receptor expression | |
| WO2004048601A2 (en) | Modulation of b7h expression | |
| WO2004048325A2 (en) | Modulation of jagged 1 expression | |
| WO2004047736A2 (en) | Modulation of bcl2-associated athanogene expression | |
| WO2004052306A2 (en) | Modulation of ppar-alpha expression | |
| US20050153925A1 (en) | Compositions and their uses directed to transferases | |
| EP1570087A1 (en) | Modulation of cd1d expression | |
| HK1156634A (en) | Modulation of glucagon receptor expression | |
| WO2004046325A2 (en) | Modulation of serine/threonine kinase 16 expression | |
| WO2004053168A1 (en) | Modulation of adipophilin expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006513404 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004750827 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004750827 Country of ref document: EP |