Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
  • A01K67/027—New or modified breeds of vertebrates
  • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
• • A—HUMAN NECESSITIES
  • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
  • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
  • A23L15/00—Egg products; Preparation or treatment thereof
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/575—Hormones
  • C07K14/62—Insulins
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/02—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from eggs
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
  • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
  • C07K16/1036—Retroviridae, e.g. leukemia viruses
  • C07K16/1045—Lentiviridae, e.g. HIV, FIV, SIV
  • C07K16/1063—Lentiviridae, e.g. HIV, FIV, SIV env, e.g. gp41, gp110/120, gp160, V3, PND, CD4 binding site
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/26—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against hormones ; against hormone releasing or inhibiting factors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/30—Bird
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/01—Animal expressing industrially exogenous proteins
• • A—HUMAN NECESSITIES
  • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
  • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
  • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
  • C07K2317/23—Immunoglobulins specific features characterized by taxonomic origin from birds
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
  • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/90—Vectors containing a transposable element
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
  • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
  • C12N2830/003—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
  • C12N2830/90—Vector systems having a special element relevant for transcription from vertebrates avian
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2840/00—Vectors comprising a special translation-regulating system
  • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
  • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

• the present invention relates generally to production of multimeric proteins in a transgenic individual, wherein genes encoding the multimeric proteins are operably- linked to signal sequences, or portions of signal sequences.
• transgenic animals Methods for producing multimeric proteins in transgenic animals are desirable for a variety of reasons, including the transgenic animal's potential as biological factories to produce multimeric proteins for pharmaceutical, diagnostic and industrial uses. This potential is attractive to the industry due to the inadequate capacity in facilities used for recombinant production of multimeric proteins and the increasing demand by the pharmaceutical industry for use of these facilities. Numerous attempts to produce transgenic animals have met several problems, including low rates of gene incorporation and unstable gene incorporation. Accordingly, improved gene technologies are needed for the development of transgenic animals for the production of multimeric proteins .
• virus-based delivery vectors such as adeno and adeno-associated viruses, retroviruses, and other viruses, which have been attenuated to no longer replicate.
• virus-based delivery vectors such as adeno and adeno-associated viruses, retroviruses, and other viruses, which have been attenuated to no longer replicate.
• viral vectors There are multiple problems associated with the use of viral vectors. Firstly, they are not tissue-specific. In fact, a gene therapy trial using adenovirus was recently halted because the vector was present in the patient's sperm (Gene trial to proceed despite fears that therapy could change child's genetic makeup. The New York Times, December 23, 2001).
• viral vectors are likely to be transiently incorporated, which necessitates re-treating a patient at specified time intervals.
• viral-based vectors require a dividing cell for stable integration.
• Fifthly, viral-based vectors indiscriminately integrate into various cells, which can result in undesirable germline integration.
• the required high titers needed to achieve the desired effect have resulted in the death of one patient and they are believed to be responsible for induction of cancer in a separate study. (Science, News of the Week, October 4, 2002).
• Multimeric proteins include associated multimeric proteins (two or more associated polypeptides) and multivalent multimeric proteins (a single polypeptide encoded by more than one gene of interest).
• Expression and/or formation of the multimeric protein in the individual is achieved by administering a polynucleotide cassette containing the genes of interest to the individual.
• the polynucleotide cassette may additionally contain one or more pro sequences, prepro sequences, cecropin prepro sequences, and/or cleavage site sequences.
• This invention provides polynucleotide cassettes containing two or more genes of interest and two or more pro polynucleotide sequences, wherein each gene of interest is operably-linked to a pro nucleotide sequence.
• Each of the genes of interest encodes a polypeptide that forms a part of the multimeric protein.
• One discovery of the present invention is the use of pro portions of prepro signal sequences to facilitate appropriate processing, expression, and/or formation of multimeric proteins in an individual.
• prepro polynucleotides from which a pro polynucleotide can be derived or be a part of are a cecropin prepro, lysozyme prepro, ovomucin prepro, ovotransferrin prepro, a signal peptide for tumor necrosis factor receptor (SEQ ID NO: 6), a signal peptide encoded by a polynucleotide sequence provided in one of SEQ ID NOs:7-54 and a signal peptide provide in SEQ ID NO:55.
• the prepro or pro polynucleotide can be a cecropin prepro or pro polynucleotide selected from the group consisting of cecropin Al, cecropin A2, cecropin B, cecropin C, cecropin D, cecropin E and cecropin F.
• the pro polynucleotide is a cecropin B pro polynucleotide having a sequence shown in SEQ ID NO:l or SEQ ID NO:2.
• a preferred prepro polynucleotide is a cecropin B polynucleotide having a sequence shown in SEQ ID NO:3 or SEQ ID NO:4.
• cecropin prepro sequences facilitate appropriate processing, expression, and/or formation of proteins, including multimeric proteins, in an individual.
• the present invention includes polynucleotide cassettes containing one or more genes of interest operably-linked to a cecropin prepro sequence.
• the polynucleotide cassette contains two or more genes of interest operably-linked to a cecropin prepro sequence.
• Preferred cecropin prepro polynucleotides are provided in SEQ ID NO: 3 and SEQ ID NO:4.
• the present invention also includes polynucleotide cassettes containing two or more genes of interest operably linked to a cecropin prepro polynucleotide, wherein pro sequences are located between the genes of interest.
• polynucleotide cassettes are administered to an individual for expression of polypeptide sequences and the formation of a protein, and more preferably, a multimeric protein.
• the individual is an animal from which the protein can be harvested.
• Preferred animals are egg-laying or milk-producing animals.
• the egg-laying transgenic animal is an avian.
• the method of the present invention may be used in avians including Ratites, Psittaciformes, Falconiformes, Piciformes, Strigiformes, Passeriformes, Coraciformes, Ralliformes, Cuculiformes, Columbiformes, Galliformes, Anseriformes, and Herodiones.
• the egg-laying transgenic animal is a poultry bird. More preferably, the bird is a chicken, turkey, duck, goose or quail. Another preferred bird is a ratite, such as, an emu, an ostrich, a rhea, or a cassowary. Other preferred birds are partridge, pheasant, kiwi, parrot, parakeet, macaw, falcon, eagle, hawk, pigeon, cockatoo, song birds, jay bird, blackbird, finch, warbler, canary, toucan, mynah, or sparrow.
• the polynucleotide cassettes are located within transposon-based vectors that allow for incorporation of the cassettes into the DNA of the individual.
• the transposon-based vectors of the present invention include a transposase, operably-linked to a first promoter, and a coding sequence for a protein or peptide of interest operably-linked to a second promoter, wherein the coding sequence for the protein or peptide of interest and its operably-linked promoter are flanked by transposase insertion sequences recognized by the transposase.
• the transposon-based vector also includes the following characteristics: a) one or more modified Kozak sequences comprising ACCATG (SEQ ID NO: 5) at the 3' end of the first promoter to enhance expression of the transposase; b) modifications of the codons for the first several N-terminal amino acids of the transposase, wherein the nucleotide at the third base position of each codon is changed to an A or a T without changing the corresponding amino acid; c) addition of one or more stop codons to enhance the termination of transposase synthesis; and/or, d) addition of an effective polyA sequence operably-linked to the transposase to further enhance expression of the transposase gene.
• the effective polyA sequence is an avian optimized polyA sequence.
• the transposon-based vector comprises an avian optimized polyA sequence and does not comprise a modified Kozak sequence comprising ACCATG (SEQ ID NO: 5).
• a transposon-based vector is the pTnMCS vector (SEQ ID NO:56).
• the transposon-based vector comprises a) one or more modified Kozak sequences comprising ACCATG (SEQ ID NO: 5) at the 3' end of the first promoter to enhance expression of the transposase; b) modifications of the codons for the first several N-terminal amino acids of the transposase, wherein the third base of each codon was changed to an A or a T without changing the corresponding amino acid; c) addition of one or more stop codons to enhance the termination of transposase synthesis; and, d) addition of an effective polyA sequence operably-linked to the transposase to further enhance expression of the transposase gene.
• pTnMod vector SEQ ID NO: 57.
• Another object of the present invention is to provide a method to produce an egg or milk containing a multimeric protein.
• An advantage of the present invention is that multimeric proteins are produced by transgenic animals much more efficiently and economically than prior art methods, thereby providing a means for large scale production of multimeric proteins.
• Figure 1 depicts schematically a polynucleotide cassette containing two genes of interest operably-linked to two pro polynucleotides, wherein the first pro polynucleotide is a part of a prepro polynucleotide. "Prom” indicates promoter.
• Figure 2 depicts schematically a polynucleotide cassette containing polynucleotides encoding for a heavy chain and a light chain of an antibody.
• "Oval prom” indicates an ovalbumin promoter.
• the polynucleotide cassette contains pro and prepro sequences and is flanked by insertion sequences (IS) recognized by a transposase.
• Figure 3 depicts schematically a polynucleotide cassette containing a cecropin prepro sequence operably-linked to two genes of interest. Between the genes of interest resides a cleavage site indicates by "CS.”
• Figure 4 depicts schematically a polynucleotide cassette containing two genes of interest, a promoter (prom), a signal sequence (SS) and a cleavage site (CS).
• the polynucleotide cassette is flanked by insertion sequences (IS) recognized by a transposase.
• Figure 5 is a picture of a gel showing partially purified egg white derived from a transgenic avian run under reducing and non-reducing conditions.
• Multimeric proteins include associated multimeric proteins (two or more associated polypeptides) and multivalent multimeric proteins (a single polypeptide encoded by more than one gene of interest). Expression and/or formation of the multimeric protein in the individual is achieved by administering a polynucleotide cassette containing the genes of interest to the individual.
• the polynucleotide cassette may additionally contain one or more pro sequences, prepro sequences, cecropin prepro sequences, and/or cleavage site sequences.
• This invention provides polynucleotide cassettes containing two or more genes of interest and two or more pro polynucleotide sequences, wherein each gene of interest is operably-linked to a pro nucleotide sequence.
• Each of the genes of interest encodes a polypeptide that forms a part of the multimeric protein.
• These polynucleotide cassettes are administered to an individual for expression of the polypeptide sequences and expression and/or formation of the multimeric protein.
• the individual is an animal from which the multimeric protein can be harvested. Preferred animals are egg-laying or milk-producing animals.
• the polynucleotide cassettes are located within transposon-based vectors that allow for incorporation of the cassettes into the DNA of the individual.
• the pro polynucleotide sequences operably-linked to the genes of interest include pro portions of prepro polynucleotide sequences commonly associated with polynucleotides encoding proteins secreted from a cell in nature. It may be that the pre polynucleotide sequence functions to direct the resultant protein into the endoplasmic reticulum and the pro sequence is cleaved within the endoplasmic reticulum or Golgi complex of a cell containing the protein.
• each gene of interest is operably-linked with a pro polynucleotide sequence.
• Figure 1 shows schematically one polynucleotide cassette containing two genes of interest, wherein each gene of interest is operably-linked to a pro polynucleotide sequence.
• the first gene of interest is operably-linked to a pro polynucleotide sequence that is part of a prepro polynucleotide sequence
• the second gene of interest is operably-linked to a pro polynucleotide sequence that is not part of a prepro polynucleotide sequence, but may have been derived from a prepro polynucleotide sequence.
• pro sequence encompasses a pro sequence that is part of a prepro sequence and a pro sequence that is not part of a prepro sequence, but may have been derived from a prepro sequence.
• the most 5' pro polynucleotide sequence in the polynucleotide cassette is a part of a prepro polynucleotide sequence.
• prepro polynucleotides from which a pro polynucleotide can be derived or be a part of are a cecropin prepro, lysozyme prepro, ovomucin prepro, ovotransferrin prepro, a signal peptide for tumor necrosis factor receptor (SEQ ID NO: 6), a signal peptide encoded by a polynucleotide sequence provided in one of SEQ ID NOs:7-54 and a signal peptide provide in SEQ ID NO: 55.
• the prepro or pro polynucleotide can be a cecropin prepro or pro polynucleotide selected from the group consisting of cecropin Al, cecropin A2, cecropin B, cecropin C, cecropin D, cecropin E and cecropin F.
• the pro polynucleotide is a cecropin B pro polynucleotide having a sequence shown in SEQ ID NO:l or SEQ ID NO:2.
• a preferred prepro polynucleotide is a cecropin B polynucleotide having a sequence shown in SEQ ID NO:3 or SEQ ID NO:4.
• Figure 1 provides one embodiment of the invention wherein the polynucleotide cassette includes two genes of interest and two pro polynucleotide sequences arranged in the following order: a prepro polynucleotide, a first gene of interest, a pro polynucleotide, and a second gene of interest.
• the sequences are arranged in the aforementioned order beginning at a 5' end of the polynucleotide cassette.
• Figure 2 provides a more specific embodiment of the present invention wherein the first and second genes of interest are polynucleotides encoding antibody heavy and light chains.
• the invention includes polynucleotide cassettes containing at least two genes of interest.
• Each of the genes of interest is operably-linked to a pro polynucleotide.
• Each of these pro polynucleotides can be the same, or each can be different.
• all of the pro polynucleotides in the polynucleotide cassette are the same and are cecropin pro polynucleotides.
• the most 5' cecropin pro polynucleotide is preferably a part of a cecropin prepro polynucleotide sequence as shown in Figure 3.
• the polynucleotide cassettes of the present invention may be administered to an individual for production of a multimeric protein in that individual.
• the present invention includes a method of producing a multimeric protein in an individual comprising administering to the individual a polynucleotide cassette comprising at least two genes of interest, each encoding a part of the multimeric protein, wherein each gene of interest is operably-linked to a pro polynucleotide sequence.
• the present invention also includes a method of producing a multimeric protein in an individual comprising administering to the individual a polynucleotide cassette comprising a cecropin prepro sequence operably-linked to two or more genes of interest, each gene of interest encoding a part of the multimeric protein.
• This second method does not require the linking of pro polynucleotides to each gene of interest since the use of a cecropin prepro sequence itself in a polynucleotide cassette facilitates processing, expression, and/or formation of multimeric proteins.
• Polynucleotide cassettes containing the cecropin prepro polynucleotide can contain at least two genes of interest.
• the cecropin prepro polynucleotide is located 5' of the genes of interest in the polynucleotide cassette.
• One exemplary polynucleotide cassette is shown in Figure 3.
• the prepro sequence comprises a sequence shown in SEQ ID NO:3 or SEQ ID NO:4.
• the polynucleotide cassettes containing a cecropin prepro polynucleotide preferably contain a cleavage site between each of two genes of interest.
• Such cleavage site(s) may be nucleotides encoding any cleavage sites including, but not limited to, an enzymatic cleavage site, a pro polynucleotide, and a photolabile cleavage site, a chemical cleavage site, and a self-splicing cleavage site (i.e., intein). Cleavage sites are discussed in more detail below.
• the polynucleotide cassettes of the present invention are particularly suited for production of multimeric proteins in an individual.
• Individuals include both humans and animals.
• Preferred animals are egg-laying animals and milk-producing animals.
• the term "egg-laying animal” includes all amniotes such as birds, turtles, lizards and monotremes.
• Monotremes are egg-laying mammals and include the platypus and echidna.
• the term "bird” or "fowl,” as used herein, is defined as a member of the Aves class of animals which are characterized as warm-blooded, egg- laying vertebrates primarily adapted for flying.
• Avians include, without limitation, Ratites, Psittaciformes, Falconiformes, Piciformes, Strigiformes, Passeriformes, Coraciformes, Ralliformes, Cuculiformes, Columbiformes, Galliformes, Anseriformes, and Herodiones.
• Ratite as used herein, is defined as a group of flightless, mostly large, running birds comprising several orders and including the emus, ostriches, kiwis, and cassowaries.
• Psittaciformes includes parrots and refers to a monofamilial order of birds that exhibit zygodactylism and have a strong hooked bill.
• a "parrot” is defined as any member of the avian family Psittacidae (the single family of the Psittaciformes), distinguished by the short, stout, strongly hooked beak.
• Preferred avians are poultry birde including chickens, quail, turkeys, geese and ducks.
• chickens used for table egg production such as egg-type chickens, chickens reared for public meat consumption, or broilers, and chickens reared for both egg and meat production ("dual-purpose” chickens).
• the term “chicken” also denotes chickens produced by primary breeder companies, or chickens that are the parents, grandparents, great-grandparents, etc. of those chickens reared for public table egg, meat, or table egg and meat consumption.
• the polynucleotide cassettes of the present invention When the polynucleotide cassettes of the present invention are administered to an egg-laying or milk-producing animal, a transgenic animal containing a polynucleotide cassette is created and the animal produces a transgenic multimeric protein. It is preferred that the resultant multimeric protein is deposited in the egg or in the milk. Various different signal sequences and promoters may be used to achieve deposition of the multimeric protein in the egg or in the milk and these are described in more detail below.
• the polynucleotide cassettes can be administered to the individual with, or contained in, any vector, as naked DNA, or in any delivery construct or solution.
• a preferred vector for incorporation of the polynucleotide cassettes into an individual is a transposon-based vector described below. Definitions
• antibody is used interchangeably with the term "immunoglobulin” and is defined herein as a protein synthesized by an animal or a cell of the immune system in response to the presence of a foreign substance commonly referred to as an "antigen" or an “immunogen".
• the term antibody includes fragments of antibodies.
• Antibodies are characterized by specific affinity to a site on the antigen, wherein the site is referred to an "antigenic determinant" or an "epitope".
• Antigens can be naturally occurring or artificially engineered. Artificially engineered antigens include but are not limited to small molecules, such as small peptides, attached to haptens such as macromolecules, for example proteins, nucleic acids, or polysaccharides.
• egg as used herein is defined as a large female sex cell enclosed in a porous, calcarous or leathery shell, when a bird or reptile produces it, or it is an ovum when it is produced by all other animals.
• gene is defined herein to include a polynucleotide that includes a coding region for a protein, peptide or polypeptide, with or without intervening sequences such as introns.
• multimeric protein is defined herein to include one or more polypeptides that are associated, or joined, by any means including disulfde bonds.
• An example of this type of multimeric protein is an antibody that contains both heavy and light chains that are associated by disulfide bonds.
• These multimeric proteins are referred to herein as "associated multimeric proteins.”
• multimeric protein also includes a polypeptide that is encoded by more than one gene of interest.
• An example of this type of multimeric protein is a single polypeptide containing a heavy chain polypeptide (first polypeptide of interest) and a light chain polypeptide (second polypeptide of interest).
• the different polypeptides of interest may be separated by other polypeptide sequences such as spacer polypeptides and cleavage site polypeptides.
• multivalent multimeric proteins are referred to herein as "multivalent multimeric proteins.”
• milk-producing animal refers herein to mammals including, but not limited to, bovine, ovine, porcine, equine, and primate animals. Milk-producing animals include but are not limited to cows, llamas, camels, goats, reindeer, zebu, water buffalo, yak, horses, pigs, rabbits, non-human primates, and humans.
• transgenic animal refers to an animal having at least a portion of the transposon-based vector DNA is incorporated into its DNA.
• transgenic animal includes an animal wherein the transposon-based vector DNA is incorporated into the germline DNA
• a transgenic animal also includes an animal having DNA in one or more somatic cells that contain a portion of the transposon-based vector DNA for any period of time.
• a portion of the transposon-based vector comprises a gene of interest. More preferably, the gene of interest is incorporated into the animal's DNA for a period of at least five days, more preferably the laying life of the animal, and most preferably the life of the animal.
• the animal is an avian.
• vector is used interchangeably with the terms “construct”, “DNA construct” and “genetic construct” to denote synthetic nucleotide sequences used for manipulation of genetic material, including but not limited to cloning, subcloning, sequencing, or introduction of exogenous genetic material into cells, tissues or organisms, such as birds. It is understood by one skilled in the art that vectors may contain synthetic DNA sequences, naturally occurring DNA sequences, or both.
• the vectors of the present invention are transposon-based vectors as described herein.
• operably-linked is defined herein to mean that the two sequences are associated in a manner that allows the regulatory sequence to affect expression of the other nucleotide sequence. It is not required that the operably-linked sequences be directly adjacent to one another with no intervening sequence(s).
• regulatory sequence is defined herein as including promoters, enhancers and other expression control elements such as polyadenylation sequences, matrix attachment sites, insulator regions for expression of multiple genes on a single construct, ribosome entry/attachment sites, introns that are able to enhance expression, and silencers.
• Transposon-Based Vectors While not wanting to be bound by the following statement, it is believed that the nature of the DNA construct is an important factor in successfully producing transgenic animals.
• the "standard" types of plasmid and viral vectors that have previously been almost universally used for transgenic work in all species, especially avians, have low efficiencies and may constitute a major reason for the low rates of transformation previously observed.
• the DNA (or RNA) constructs previously used often do not integrate into the host DNA, or integrate only at low frequencies. Other factors may have also played a part, such as poor entry of the vector into target cells.
• the present invention provides transposon-based vectors that can be administered to an animal that overcome the prior art problems relating to low transgene integration frequencies.
• Two preferred transposon-based vectors of the present invention in which a transposase, gene of interest and other polynucleotide sequences may be introduced are termed pTnMCS (SEQ ID NO:56) and pTnMod (SEQ ID NO:57).
• the transposon-based vectors of the present invention produce integration frequencies an order of magnitude greater than has been achieved with previous vectors. More specifically, intratesticular injections performed with a prior art transposon-based vector (described in U.S. Patent No. 5,719,055) resulted in 41% sperm positive roosters whereas intratesticular injections performed with the novel transposon-based vectors of the present invention resulted in 77% sperm positive roosters.
• Actual frequencies of integration were estimated by either or both comparative strength of the PCR signal from the sperm and histological evaluation of the testes and sperm by quantitative PCR.
• the transposon-based vectors of the present invention include a transposase gene operably-linked to a first promoter, and a coding sequence for a desired protein or peptide operably-linked to a second promoter, wherein the coding sequence for the desired protein or peptide and its operably-linked promoter are flanked by transposase insertion sequences recognized by the transposase.
• the transposon-based vector also includes one or more of the following characteristics: a) one or more modified Kozak sequences comprising ACCATG (SEQ ID NO: 5) at the 3' end of the first promoter to enhance expression of the transposase; b) modifications of one or more of the codons for the first several N-terminal amino acids of the transposase, wherein the third base of each codon was changed to an A or a T without changing the corresponding amino acid; c) addition of one or more stop codons to enhance the termination of transposase synthesis; and/or, d) addition of an effective polyA sequence operably-linked to the transposase to further enhance expression of the transposase gene.
• ACCATG SEQ ID NO: 5
• the transposon-based vector comprises an avian optimized polyA sequence and does not comprise a modified Kozak sequence comprising ACCATG (SEQ ID NO:5).
• a transposon-based vector is the pTnMCS vector (SEQ ID NO: 56).
• the transposon-based vector comprises a) one or more modified Kozak sequences comprising ACCATG (SEQ ID NO: 5) at the 3' end of the first promoter to enhance expression of the transposase; b) modifications of the codons for the first several N-terminal amino acids of the transposase, wherein the third base of each codon was changed to an A or a T without changing the corresponding amino acid; c) addition of one or more stop codons to enhance the termination of transposase synthesis; and, d) addition of an effective polyA sequence operably-linked to the transposase to further enhance expression of the transposase gene.
• ACCATG SEQ ID NO: 5
• transposon-based vector is the pTnMod vector (SEQ ID NO:57).
• the transposon-based vector may additionally or alternatively include one or more of the following Kozak sequences at the 3' end of any promoter, including the promoter operably-linked to the transposase: ACCATGG (SEQ ID NO:58), AAGATGT (SEQ ID NO:59), ACGATGA (SEQ ID NO:60), AAGATGG (SEQ ID NO:61), GACATGA (SEQ ID NO:62), ACCATGA (SEQ ID NO:63), and ACCATGA (SEQ ID NO:64), ACCATGT (SEQ ID NO:65).
• the transposase found in the transposase-based vector is an altered target site (ATS) transposase and the insertion sequences are those recognized by the ATS transposase.
• ATS target site
• the transposase located in the transposase-based vectors is not limited to a modified ATS transposase and can be derived from any transposase.
• Transposases known in the prior art include those found in AC7, Tn5SEQl, Tn916, Tn951, Tnl721, Tn 2410, Tnl681, Tnl, Tn2, Tn3, Tn4, Tn5, Tn6, Tn9, TnlO, Tn30, TnlOl, Tn903, Tn501, Tnl 000 ( ⁇ ), Tnl 681, Tn2901, AC transposons, Mp transposons, Spm transposons, En transposons, Dotted transposons, Mu transposons, Ds transposons, dSpm transposons and I transposons.
• these transposases and their regulatory sequences are modified for improved functioning as follows: a) the addition one or more modified Kozak sequences comprising ACCATG (SEQ ID NO:5) at the 3' end of the promoter operably-linked to the transposase; b) a change of one or more of the codons for the first several amino acids of the transposase, wherein the third base of each codon was changed to an A or a T without changing the corresponding amino acid; c) the addition of one or more stop codons to enhance the termination of transposase synthesis; and/or, d) the addition of an effective polyA sequence operably-linked to the transposase to further enhance expression of the transposase gene.
• ACCATG SEQ ID NO:5
• the modifications of the first several N-terminal codons of the transposase gene facilitate transcription of the transposase gene, in part, by increasing strand dissociation during transcription. It is preferable that one or more of between approximately the first 1 to 20, more preferably 3 to 15, and most preferably between 4 to 12 N-terminal codons of the transposase are modified such that the third base of each codon is changed to an A or a T without changing the encoded amino acid. In one embodiment, the first ten N-terminal codons of the transposase gene are modified in this manner.
• the transposase contain mutations that make it less specific for preferred insertion sites and thus increases the rate of transgene insertion as discussed in U.S. Patent No. 5,719,055.
• the transposon-based vectors are optimized for expression in a particular host by changing the methylation patterns of the vector DNA. For example, prokaryotic methylation may be reduced by using a methylation deficient organism for production of the transposon-based vector.
• the transposon- based vectors may also be methylated to resemble eukaryotic DNA for expression in a eukaryotic host.
• Transposases and insertion sequences from other analogous eukaryotic transposon-based vectors that can also be modified and used are, for example, the Drosophila P element derived vectors disclosed in U.S. Patent No. 6,291,243; the Drosophila mariner element described in Sherman et al. (1998); or the sleeping beauty transposon. See also Hackett et al. (1999); D. Lampe et al., 1999. Proc. Natl. Acad. Sci. USA, 96:11428-11433; S. Fischer et al., 2001. Proc. Natl. Acad. Sci. USA, 98:6759-6764; L. Zagoraiou et al., 2001. Proc. Natl.
• bacterial transposon-based elements are preferred, as there is less likelihood that a eukaryotic transposase in the recipient species will recognize prokaryotic insertion sequences bracketing the transgene.
• transposases recognize different insertion sequences, and therefore, it is to be understood that a transposase-based vector will contain insertion sequences recognized by the particular transposase also found in the transposase-based vector.
• the insertion sequences have been shortened to about 70 base pairs in length as compared to those found in wild-type transposons that typically contain insertion sequences of well over 100 base pairs.
• the present invention also encompasses the use of a "rolling replication" type transposon-based vector.
• Use of a rolling replication type transposon allows multiple copies of the transposon/transgene to be made from a single transgene construct and the copies inserted. This type of transposon-based system thereby provides for insertion of multiple copies of a transgene into a single genome.
• a rolling replication type transposon-based vector may be preferred when the promoter operably-linked to gene of interest is endogenous to the host cell and present in a high copy number or highly expressed.
• the transposon-based vector contains two stop codons operably-linked to the transposase and or to the gene of interest.
• one stop codon of UAA or UGA is operably linked to the transposase and/or to the gene of interest. While not wanting to be bound by the following statement, it is thought that the stop codon UAG is less effective in translation termination and is therefore less desirable in the constructs described herein.
• an "effective polyA sequence” refers to either a synthetic or non-synthetic sequence that contains multiple and sequential nucleotides containing an adenine base (an A polynucleotide string) and that increases expression of the gene to which it is operably-linked.
• a polyA sequence may be operably-linked to any gene in the transposon-based vector including, but not limited to, a transposase gene and a gene of interest.
• a preferred polyA sequence is optimized for use in the host animal or human. In one embodiment, the polyA sequence is optimized for use in an avian species and more specifically, a chicken.
• An avian optimized polyA sequence generally contains a minimum of 40 base pairs, preferably between approximately 40 and several hundred base pairs, and more preferably approximately 75 base pairs that precede the A polynucleotide string and thereby separate the stop codon from the A polynucleotide string.
• the polyA sequence comprises a conalbumin polyA sequence as provided in SEQ ID NO: 66 and as taken from GenBank accession # Y00407, base pairs 10651-11058.
• the polyA sequence comprises a synthetic polynucleotide sequence shown in SEQ ID NO: 67.
• the polyA sequence comprises an avian optimized polyA sequence provided in SEQ ID NO:68.
• a chicken optimized polyA sequence may also have a reduced amount of CT repeats as compared to a synthetic polyA sequence. It is a surprising discovery of the present invention that such an avian optimized poly A sequence increases expression of a polynucleotide to which it is operably-linked in an avian as compared to a non-avian optimized polyA sequence. Accordingly, the present invention includes methods of or increasing incorporation of a gene of interest wherein the gene of interest resides in a transposon-based vector containing a transposase gene and wherein the transposase gene is operably linked to an avian optimized polyA sequence.
• the present invention also includes methods of increasing expression of a gene of interest in an avian that includes administering a gene of interest to the avian, wherein the gene of interest is operably-linked to an avian optimized polyA sequence.
• An avian optimized polyA nucleotide string is defined herein as a polynucleotide containing an A polynucleotide string and a minimum of 40 base pairs, preferably between approximately 40 and several hundred base pairs, and more preferably approximately 75 base pairs that precede the A polynucleotide string.
• the present invention further provides transposon-based vectors containing a gene of interest or transposase gene operably linked to an avian optimized polyA sequence.
• the first promoter operably-linked to the transposase gene and the second promoter operably-linked to the gene of interest can be a constitutive promoter or an inducible promoter.
• Constitutive promoters include, but are not limited to, immediate early cytomegalovirus (CMV) promoter, herpes simplex virus 1 (HSV1) immediate early promoter, SV40 promoter, lysozyme promoter, early and late CMV promoters, early and late HSV promoters, ⁇ -actin promoter, tubulin promoter, Rous-Sarcoma virus (RSV) promoter, and heat-shock protein (HSP) promoter.
• CMV immediate early cytomegalovirus
• HSV40 promoter herpes simplex virus 1
• lysozyme promoter early and late CMV promoters
• early and late HSV promoters early and late HSV promoters
• ⁇ -actin promoter tubulin promoter
• Inducible promoters include tissue-specific promoters, developmentally-regulated promoters and chemically inducible promoters.
• tissue-specific promoters include the glucose 6 phosphate (G6P) promoter, vitellogenin promoter, ovalbumin promoter, ovomucoid promoter, conalbumin promoter, ovotransferrin promoter, prolactin promoter, kidney uromodulin promoter, and placental lactogen promoter.
• the vitellogenin promoter includes a polynucleotide sequence of SEQ ID NO: 69.
• the G6P promoter sequence may be deduced from a rat G6P gene untranslated upstream region provided in GenBank accession number U57552.1.
• Examples of developmentally-regulated promoters include the homeobox promoters and several hormone induced promoters.
• Examples of chemically inducible promoters include reproductive hormone induced promoters and antibiotic inducible promoters such as the tetracycline inducible promoter and the zinc-inducible metallothionine promoter.
• Other inducible promoter systems include the Lac operator repressor system inducible by IPTG (isopropyl beta-D-thiogalactoside) (Cronin, A. et al. 2001. Genes and Development, v. 15), ecdysone-based inducible systems (Hoppe, U. C. et al. 2000. Mol. Ther.
• GLVP chimeric regulator
• CID-based inducible systems using chemical inducers of dimerization (CIDs) to regulate gene expression, such as a system wherein rapamycin induces dimerization of the cellular proteins FKBP12 and FRAP (Belshaw, P. J. et al. 1996. J. Chem. Biol. 3:731-738; Fan, L. et al. 1999. Hum. Gene Ther. 10:2273-2285; Shariat, S.F. et al. 2001. Cancer Res. 61:2562-2571; Spencer, D.M. 1996. Curr. Biol. 6:839- 847).
• Chemical substances that activate the chemically inducible promoters can be administered to the animal containing the transgene of interest via any method known to those of skill in the art.
• cell or tissue-specific and constitutive promoters include but are not limited to smooth-muscle SM22 promoter, including chimeric SM22alpha/telokin promoters (Hoggatt A.M. et al., 2002. Circ Res. 91(12):1151-9); ubiquitin C promoter (Biochim Biophys Acta, 2003. Jan. 3;1625(l):52-63); Hsf2 promoter; murine COMP (cartilage oligomeric matrix protein) promoter; early B cell- specific mb-1 promoter (Sigvardsson M., et al., 2002. Mol. Cell Biol.
• PSA prostate specific antigen
• promoter of the human FAT/CD36 gene (Kuriki C, et al., 2002. Biol. Pharm. Bull. 25(11): 1476-8); VL30 promoter (Staplin W.R. et al., 2002. Blood October 24, 2002); and IL-10 promoter (Brenner S., et al., 2002. J. Biol. Chem. December 18, 2002).
• avian promoters include, but are not limited to, promoters controlling expression of egg white proteins, such as ovalbumin, ovotransferrin (conalbumin), ovomucoid, lysozyme, ovomucin, g2 ovoglobulin, g3 ovoglobulin, ovoflavoprotein, ovostatin (ovomacroglobin), cystatin, avidin, thiamine-binding protein, glutamyl aminopeptidase minor glycoprotein 1, minor glycoprotein 2; and promoters controlling expression of egg-yolk proteins, such as vitellogenin, very low- density lipoproteins, low density lipoprotein, cobalamin-binding protein, riboflavin- binding protein, biotin-binding protein (Awade, 1996.
• egg white proteins such as ovalbumin, ovotransferrin (conalbumin), ovomucoid, lysozyme, ovomucin
• vitellogenin promoter is that it is active during the egg-laying stage of an animal's life-cycle, which allows for the production of the protein of interest to be temporally connected to the import of the protein of interest into the egg yolk when the protein of interest is equipped with an appropriate targeting sequence.
• the avian promoter is an oviduct-specific promoter.
• oviduct-specific promoter includes, but is not limited to, ovalbumin, ovotransferrin (conalbumin), ovomucoid, lysozyme, ovomucin, g2 ovoglobulin, g3 ovoglobulin, ovoflavoprotein, and ovostatin (ovomacroglobin) promoters.
• Liver-specific promoters of the present invention include, but are not limited to, the following promoters, vitellogenin promoter, G6P promoter, cholesterol-7- alpha-hydroxylase (CYP7A) promoter, phenylalanine hydroxylase (PAH) promoter, protein C gene promoter, insulin-like growth factor I (IGF-I) promoter, bilirubin UDP-glucuronosyltransferase promoter, aldolase B promoter, furin promoter, metallothioneine promoter, albumin promoter, and insulin promoter.
• CYP7A cholesterol-7- alpha-hydroxylase
• PAH phenylalanine hydroxylase
• protein C gene promoter protein C gene promoter
• IGF-I insulin-like growth factor I
• bilirubin UDP-glucuronosyltransferase promoter aldolase B promoter
• furin promoter metallothioneine promoter
• albumin promoter albumin promoter
• promoters that can be used to target expression of a protein of interest into the milk of a milk-producing animal including, but not limited to, ⁇ lactoglobin promoter, whey acidic protein promoter, lactalbumin promoter and casein promoter.
• Promoters associated with cells of the immune system may also be used.
• Acute phase promoters such as interleukin (IL)-l and IL-2 may be employed. Promoters for heavy and light chain Ig may also be employed.
• the promoters of the T cell receptor components CD4 and CD8, B cell promoters and the promoters of CR2 (complement receptor type 2) may also be employed.
• Immune system promoters are preferably used when the desired protein is an antibody protein.
• modified promoters/enhancers wherein elements of a single promoter are duplicated, modified, or otherwise changed.
• a steroid hormone-binding domain of the ovalbumin promoter is moved from about -6.5 kb to within approximately the first 1000 base pairs of the gene of interest.
• the promoters contained within the transposon-based vectors of the present invention may be entire promoter sequences or fragments of promoter sequences.
• the promoter operably linked to a gene of interest is an approximately 900 base pair fragment of a chicken ovalbumin promoter (SEQ ID NO:70).
• the constitutive and inducible promoters contained within the transposon-based vectors may also be modified by the addition of one or more modified Kozak sequences of ACCATG (SEQ ID NO : 5) .
• the present invention includes transposon-based vectors containing one or more enhancers. These enhancers may or may not be operably- linked to their native promoter and may be located at any distance from their operably-linked promoter.
• a promoter operably-linked to an enhancer is referred to herein as an "enhanced promoter.”
• the enhancers contained within the transposon- based vectors are preferably enhancers found in birds, and more preferably, an ovalbumin enhancer, but are not limited to these types of enhancers.
• an approximately 675 base pair enhancer element of an ovalbumin promoter is cloned upstream of an ovalbumin promoter with 300 base pairs of spacer DNA separating the enhancer and promoter.
• the enhancer used as a part of the present invention comprises base pairs 1-675 of a Chicken Ovalbumin enhancer from GenBank accession #S82527.1.
• the polynucleotide sequence of this enhancer is provided in SEQ ID NO:71.
• cap sites and fragments of cap sites are also included in some of the transposon-based vectors of the present invention.
• approximately 50 base pairs of a 5' untranslated region wherein the capsite resides are added on the 3' end of an enhanced promoter or promoter.
• An exemplary 5' untranslated region is provided in SEQ ID NO:72.
• a putative cap-site residing in this 5' untranslated region preferably comprises the polynucleotide sequence provided in SEQ ID NO: 73.
• the first promoter operably-linked to the transposase gene is a constitutive promoter and the second promoter operably- linked to the gene of interest is a tissue-specific promoter.
• the first constitutive promoter allows for constitutive activation of the transposase gene and incorporation of the gene of interest into virtually all cell types, including the germlme of the recipient animal.
• the gene of interest is incorporated into the germline generally, the gene of interest is only expressed in a tissue-specific manner.
• a transposon-based vector having a constitutive promoter operably-linked to the transposase gene can be administered by any route, and in one embodiment, the vector is administered to an ovary or to an artery leading to the ovary. In another embodiment, the vector is administered into the lumen of the oviduct or into an artery supplying the oviduct. It should be noted that cell- or tissue-specific expression as described herein does not require a complete absence of expression in cells or tissues other than the preferred cell or tissue. Instead, "cell-specific" or “tissue-specific” expression refers to a majority of the expression of a particular gene of interest in the preferred cell or tissue, respectively.
• the first promoter operably-linked to the transposase gene can be a tissue-specific promoter.
• transfection of a transposon-based vector containing a transposase gene operably-linked to an oviduct specific promoter such as the ovalbumin promoter provides for activation of the transposase gene and incorporation of the gene of interest in the cells of the oviduct but not into the germline and other cells generally.
• the second promoter operably-linked to the gene of interest can be a constitutive promoter or an inducible promoter. In a preferred embodiment, both the first promoter and the second promoter are an ovalbumin promoter.
• the transposon-based vector is administered directly to the tissue of interest or to an artery leading to the tissue of interest.
• the tissue of interest is the oviduct and administration is achieved by direct injection into the lumen of the oviduct or an artery leading to the oviduct.
• administration is achieved by direct injection into the lumen of the magnum or the infundibulum of the oviduct.
• cell specific promoters may be used to enhance transcription in selected tissues.
• promoters that are found in cells of the fallopian tube such as ovalbumin, conalbumin, ovomucoid and/or lysozyme, are used in the vectors to ensure transcription of the gene of interest in the epithelial cells and tubular gland cells of the fallopian tube, leading to synthesis of the desired protein encoded by the gene and deposition into the egg white.
• promoters specific for the epithelial cells of the alveoli of the mammary gland such as prolactin, insulin, beta lactoglobin, whey acidic protein, lactalbumin, casein, and/or placental lactogen, are used in the design of vectors used for transfection of these cells for the production of desired proteins for deposition into the milk.
• the G6P promoter may be employed to drive transcription of the gene of interest for protein production. Proteins made in the liver of birds may be delivered to the egg yolk.
• the promoter and other regulatory sequences operably-linked to the transposase gene may be those derived from the host.
• host specific regulatory sequences can be tissue specific as described above or can be of a constitutive nature.
• an avian actin promoter and its associated polyA sequence can be operably- linked to a transposase in a transposase-based vector for transfection into an avian.
• Examples of other host specific promoters that could be operably-linked to the transposase include the myosin and DNA or RNA polymerase promoters.
• Directing Sequences In some embodiments of the present invention, the gene of interest is operably-linked to a directing sequence or a sequence that provides proper conformation to the desired protein encoded by the gene of interest.
• the term "directing sequence" refers to both signal sequences and targeting sequences.
• An egg directing sequence includes, but is not limited to, an ovomucoid signal sequence, an ovalbumin signal sequence, a cecropin prepro sequence, and a vitellogenin targeting sequence.
• the term "signal sequence” refers to an amino acid sequence, or the polynucleotide sequence that encodes the amino acid sequence, a portion or the entirety of which directs the protein to which it is linked to the endoplasmic reticulum in a eukaryote, and more preferably the translocational pores in the endoplasmic reticulum, or the plasma membrane in a prokaryote, or mitochondria, such as for the purpose of gene therapy for mitochondrial diseases.
• Signal and targeting sequences can be used to direct a desired protein into, for example, the milk, when the transposon-based vectors are administered to a milk- producing animal.
• Signal sequences can also be used to direct a desired protein into, for example, a secretory pathway for incorporation into the egg yolk or the egg white, when the transposon-based vectors are administered to a bird or other egg-laying animal.
• the present invention also includes a gene of interest operably-linked to a second gene containing a signal sequence.
• An example of such an embodiment is wherein the gene of interest is operably-linked to the ovalbumin gene that contains an ovalbumin signal sequence.
• Other signal sequences that can be included in the transposon-based vectors include, but are not limited to the ovotransferrin and lysozyme signal sequences.
• the signal sequence is an ovalbumin signal sequence including a sequence shown in SEQ ID NO: 74.
• the signal sequence is a shortened ovalbumin signal sequence including a sequence shown in SEQ ID NO:75 or SEQ ID NO:76.
• targeting sequence refers to an amino acid sequence, or the polynucleotide sequence encoding the amino acid sequence, which amino acid sequence is recognized by a receptor located on the exterior of a cell. Binding of the receptor to the targeting sequence results in uptake of the protein or peptide operably-linked to the targeting sequence by the cell.
• a targeting sequence is a vitellogenin targeting sequence that is recognized by a vitellogenin receptor (or the low density lipoprotein receptor) on the exterior of an oocyte.
• the vitellogenin targeting sequence includes the polynucleotide sequence of SEQ ID NO:77.
• the vitellogenin targeting sequence includes all or part of the vitellogenin gene.
• VLDL and Apo E are also capable of binding the vitellogenin receptor. Since the ApoE protein is not endogenously expressed in birds, its presence may be used advantageously to identify birds carrying the transposon- based vectors of the present invention.
• the genes of interest in the polynucleotide cassette can be any gene, and preferably are genes that encode portions of multimeric proteins.
• a gene of interest may contain modifications of the codons for the first several N-terminal amino acids of the gene of interest, wherein the third base of each codon is changed to an A or a T without changing the corresponding amino acid.
• the genes of interest are antibody genes or portions of antibody genes.
• Figure 2 shows a schematic drawing of a polynucleotide cassette containing an antibody heavy chain and an antibody light chain as two genes of interest.
• Antibodies used in or encoded by the polynucleotide cassettes of the present invention include, but are not limited to, IgG, IgM, IgA, IgD, IgE, IgY, lambda chains, kappa chains, bi-specific antibodies, and fragments thereof; scFv fragments, Fc fragments, and Fab fragments as well as dimeric, trimeric and oligomeric forms of antibody fragments. Desired antibodies include, but are not limited to, naturally occurring antibodies, human antibodies, humanized antibodies, autoantibodies and hybrid antibodies. Genes encoding modified versions of naturally occurring antibodies or fragments thereof and genes encoding artificially designed antibodies or fragments thereof may be incorporated into the transposon-based vectors of the present invention.
• Desired antibodies also include antibodies with the ability to bind specific ligands, for example, antibodies against proteins associated with cancer-related molecules, such as anti-her 2, or anti- CA125. Accordingly, the present invention encompasses a polynucleotide cassette as described herein containing one or more genes encoding a heavy immunoglobulin (Ig) chain and a light Ig chain.
• Ig immunoglobulin
• Antibodies that may be produced using the present invention include, but are not limited to, antibodies for use in cancer immunotherapy against specific antigens, or for providing passive immunity to an animal or a human against an infectious disease or a toxic agent.
• the antibodies prepared using the methods of the present invention may also be designed to possess specific labels that may be detected through means known to one of ordinary skill in the art.
• antibodies may be labeled with a fluorescent label attached that may be detected following exposure to specific wavelengths.
• Such labeled antibodies may be primary antibodies directed to a specific antigen, for example, rhodamine-labeled rabbit anti-growth hormone, or may be labeled secondary antibodies, such as fluorescein-labeled goat-anti chicken IgG.
• Such labeled antibodies are known to one of ordinary skill in the art.
• the antibodies may also be designed to possess specific sequences useful for purification through means known to one of ordinary skill in the art. Labels useful for attachment to antibodies are also known to one of ordinary skill in the art. Some of these labels are described in the "Handbook of Fluorescent Probes and Research Products", ninth edition, Richard P. Haugland (ed) Molecular Probes, Inc. Eugene, OR), which is incorporated herein in its entirety.
• Antibodies produced with the present invention may be used as laboratory reagents for numerous applications including radioimmunoassay, western blots, dot blots, ELISA, immunoaffinity columns and other procedures requiring antibodies as known to one of ordinary skill in the art.
• Such antibodies include primary antibodies, secondary antibodies and tertiary antibodies, which may be labeled or unlabeled.
• Additional antibodies that may be made with the practice of the present invention include, but are not limited to, primary antibodies, secondary antibodies, designer antibodies, anti-protein antibodies, anti-peptide antibodies, anti-DNA antibodies, anti-RNA antibodies, anti-hormone antibodies, anti-hypophysiotropic peptides, antibodies against non-natural antigens, anti-anterior pituitary hormone antibodies, anti-posterior pituitary hormone antibodies, anti-venom antibodies, anti- tumor marker antibodies, antibodies directed against epitopes associated with infectious disease, including, anti-viral, anti-bacterial, anti-protozoal, anti-fungal, anti-parasitic, anti-receptor, anti-lipid, anti-phospholipid, anti-growth factor, anti- cytokine, anti-monokine, anti-idiotype, and anti-accessory (presentation) protein antibodies.
• Antibodies made with the present invention, as well as light chains or heavy chains, may also be used to inhibit enzyme activity.
• Antibodies that may be produced using the present invention include, but are not limited to, antibodies made against the following proteins: Bovine ⁇ -Globulin, Serum; Bovine IgG, Plasma; Chicken ⁇ -Globulin, Serum; Human ⁇ -Globulin, Serum; Human IgA, Plasma; Human IgAi, Myeloma; Human IgA 2 , Myeloma; Human IgA 2 , Plasma; Human IgD, Plasma; Human IgE, Myeloma; Human IgG, Plasma; Human IgG, Fab Fragment, Plasma; Human IgG, F(ab') 2 Fragment, Plasma; Human IgG, Fc Fragment, Plasma; Human IgGi, Myeloma; Human IgG 2 , Myeloma; Human IgG 3 , Myeloma;
• the transposon-based vector comprises the coding sequence of light and heavy chains of a murine monoclonal antibody that shows specificity for human seminoprotein (GenBank Accession numbers AY129006 and AY 129304 for the light and heavy chains, respectively).
• a further non-limiting list of antibodies that recognize other antibodies and that may be produced using the present invention is as follows: Anti-Chicken IgG, heavy (H) & light (L) Chain Specific (Sheep); Anti-Goat ⁇ -Globulin (Donkey); Anti- Goat IgG, Fc Fragment Specific (Rabbit); Anti-Guinea Pig ⁇ -Globulin (Goat); Anti- Human Ig, Light Chain, Type K Specific; Anti-Human Ig, Light Chain, Type ⁇ Specific; Anti-Human IgA, c-Chain Specific (Goat); Anti-Human IgA, Fab Fragment Specific; Anti-Human IgA, Fc Fragment Specific; Anti-Human IgA, Secretory; Anti- Human IgE, e-Chain Specific (Goat); Anti-Human IgE, Fc Fragment Specific; Anti- Human IgG, Fc Fragment Specific (Goat); Anti-Human IgG, ⁇ -Cha
• Antibodies that bind a particular ligand may also be produced.
• Exemplary ligands are as follows: adrenomedulin, amylin, calcitonin, amyloid, calcitonin gene- related peptide, cholecystokinin, gastrin, gastric inhibitory peptide, gastrin releasing peptide, interleukin, interferon, cortistatin, somatostatin, endothelin, sarafotoxin, glucagon, glucagon-like peptide, insulin, atrial natriuretic peptide, BNP, CNP, neurokinin, substance P, leptin, neuropeptide Y, melanin concentrating hormone, melanocyte stimulating hormone, o hanin, endorphin, dynorphin, enkephalin, enkephalin, leumorphin, peptide F, PACAP, PACAP-related peptide, parathyroid hormone, uro
• abciximab (ReoPro), abciximab anti-platelet aggregation monoclonal antibody, anti-CDlla (hull24), anti-CD 18 antibody, anti- CD20 antibody, anti-cytomegalovirus (CMV) antibody, anti-digoxin antibody, anti- hepatitis B antibody, anti-HER-2 antibody, anti-idiotype antibody to GD3 glycolipid, anti-IgE antibody, anti-IL-2R antibody, antimetastatic cancer antibody (mAb 17-1A), anti-rabies antibody, anti-respiratory syncytial virus (RSV) antibody, anti-Rh antibody, anti-TCR, anti-TNF antibody, anti-VEGF antibody and Fab fragment thereof, rattlesnake venom antibody, black widow spider venom antibody, coral snake venom antibody, antibody against very late antigen-4 (VLA-4), C225 humanized antibody to EGF receptor, chimeric (human & mouse
• Another non-limiting list of the antibodies that may be produced using the present invention is provided in product catalogs of companies such as Phoenix Pharmaceuticals, Inc. (www.phoenixpeptide.com; 530 Harbor Boulevard, Belmont, CA), Peninsula Labs San Carlos CA, SIGMA, St-Louis, MO www.sigma- aldrich.com, Cappel ICN, Irvine, California, www.icnbiomed.com, and Calbiochem, La Jolla, California, www.calbiochem.com, which are all incorporated herein by reference in their entirety.
• the polynucleotide sequences encoding these antibodies may be obtained from the scientific literature, from patents, and from databases such as GenBank. Alternatively, one of ordinary skill in the art may design the antibody polynucleotide sequence by choosing the codons that encode for each amino acid in the desired antibody.
• Protein and peptide hormones are a preferred class of genes of interest in the present invention.
• Such protein and peptide hormones are synthesized throughout the endocrine system and include, but are not limited to, hypothalamic hormones and hypophysiotropic hormones, anterior, intermediate and posterior pituitary hormones, pancreatic islet hormones, hormones made in the gastrointestinal system, renal hormones, thymic hormones, parathyroid hormones, adrenal cortical and medullary hormones.
• hormones that can be produced using the present invention include, but are not limited to, chorionic gonadotropin, corticotropin, erythropoietin, glucagons, IGF-1, oxytocin, platelet-derived growth factor, calcitonin, follicle-stimulating hormone, luteinizing hormone, thyroid- stimulating hormone, insulin, gonadotropin-releasing hormone and its analogs, vasopressin, octreotide, somatostatin, prolactin, adrenocorticotropic hormone, antidiuretic hormone, thyrotropin-releasing hormone (TRH), growth hormone- releasing hormone (GHRH), dopamine, melatonin, thyroxin (T 4 ), parathyroid hormone (PTH), glucocorticoids such as cortisol, mineralocorticoids such as aldosterone, androgens such as testosterone, adrenaline (epinephrine), noradrenaline (n
• the gene of interest is a proinsulin gene and the desired molecule is insulin.
• Proinsulin consists of three parts: a C- peptide and two strands of amino acids (the alpha and beta chains) that later become linked together to form the insulin molecule.
• proinsulin is expressed in the oviduct tubular gland cells and then deposited in the egg white.
• SEQ ID NO:80 One example of a proinsulin polynucleotide sequence is shown in SEQ ID NO:80, wherein the C-peptide cleavage site spans from Arg at position 31 to Arg at position 65.
• genes of interet that encode proteins and peptides synthesized by the immune system including those synthesized by the thymus, lymph nodes, spleen, and the gastrointestinal associated lymph tissues (GALT) system.
• the immune system proteins and peptides proteins that can be made in transgenic animals using the polynucleotide cassettes of the present invention include, but are not limited to, alpha-interferon, beta-interferon, gamma-interferon, alpha-interferon A, alpha-interferon 1, G-CSF, GM-CSF, interlukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, TNF- ⁇ , and TNF- ⁇ .
• cytokines included in the present invention include cardiotrophin, stromal cell derived factor, macrophage derived chemokine (MDC), melanoma growth stimulatory activity (MGSA), macrophage inflammatory proteins 1 alpha (MIP-1 alpha), 2, 3 alpha, 3 beta, 4 and 5.
• pl46 Genes encoding lytic peptides such as pl46 are also included in the genes of interest of the present invention.
• the pl46 peptide comprises an amino acid sequence of SEQ ID NO:78.
• the present invention also encompasses a polynucleotide cassette comprising a pi 46 nucleic acid having a sequence of SEQ ID NO:79.
• Enzymes are another class of proteins that may be encoded by the polynucleotide cassettes of the present invention.
• Such enzymes include but are not limited to adenosine deaminase, alpha-galactosidase, cellulase, collagenase, dnasel, hyaluronidase, lactase, L-asparaginase, pancreatin, papain, streptokinase B, subtilisin, superoxide dismutase, thrombin, trypsin, urokinase, fibrinolysin, glucocerebrosidase and plasminogen activator.
• additional amino acids and a protease cleavage site are added to the carboxy end of the enzyme of interest in order to prevent expression of a functional enzyme. Subsequent digestion of the enzyme with a protease results in activation of the enzyme.
• Extracellular matrix proteins are one class of desired proteins that may be encoded by the polynucleotide cassettes of the present invention. Examples include but are not limited to collagen, fibrin, elastin, laminin, and fibronectin and subtypes thereof. Intracellular proteins and structural proteins are other classes of desired proteins in the present invention.
• Growth factors are another desired class of proteins that may be encoded by the polynucleotide cassettes of the present invention and include, but are not limited to, transforming growth factor- ⁇ ("TGF- ⁇ "), transforming growth factor- ⁇ (TGF- ⁇ ), platelet-derived growth factors (PDGF), fibroblast growth factors (FGF), including FGF acidic isoforms 1 and 2, FGF basic form 2 and FGF 4, 8, 9 and 10, nerve growth factors (NGF) including NGF 2.5s, NGF 7.0s and beta NGF and neurotrophins, brain derived neurotrophic factor, cartilage derived factor, growth factors for stimulation of the production of red blood cells, growth factors for stimulation of the production of white blood cells, bone growth factors (BGF), basic fibroblast growth factor, vascular endothelial growth factor (VEGF), granulocyte colony stimulating factor (G-CSF), insulin like growth factor (IGF) I and II, hepatocyte growth factor, glial neurotrophic growth factor (GDNF), stem cell factor (SCF), kerat
• polynucleotide cassettes of the present invention include, but are not limited to, leptin, leukemia inhibitory factor (LIF), tumor necrosis factor alpha and beta, ENBREL, angiostatin, endostatin, thrombospondin, osteogenic protein- 1, bone morphogenetic proteins 2 and 7, osteonectin, somatomedin-like peptide, and osteocalcin.
• LIF leukemia inhibitory factor
• ENBREL angiostatin
• endostatin endostatin
• osteogenic protein- 1 bone morphogenetic proteins 2 and 7, osteonectin, somatomedin-like peptide, and osteocalcin.
• Yet another desired class of proteins encoded by the genes of interet are blood proteins or clotting cascade protein including albumin, Prekallikrein, High molecular weight kininogen (HMWK) (contact activation cofactor; Fitzgerald, Flaujeac Williams factor), Factor I (Fibrinogen), Factor II (prothrombin), Factor III (Tissue Factor), Factor IV (calcium), Factor V (proaccelerin, labile factor, accelerator (Ac-) globulin), Factor VI (Va) (accelerin), Factor VII (proconvertin), serum prothrombin conversion accelerator (SPCA), cothromboplastin), Factor VIII (antihemophiliac factor A, antihemophilic globulin (AHG)), Factor IX (Christmas Factor, antihemophilic factor B,plasma thromboplastin component (PTC)), Factor X (Stuart- Prower Factor), Factor XI (Plasma thromboplastin antecedent (
• a non-limiting list of the peptides and proteins that may be encoded by the polynucleotide cassettes of the present invention is provided in product catalogs of companies such as Phoenix Pharmaceuticals, Inc. (www.phoenixpeptide.com; 530 Harbor Boulevard, Belmont, CA), Peninsula Labs (San Carlos CA), SIGMA, (StXouis, MO www.sigma-aldrich.com), Cappel ICN (Irvine, California, www.icnbiomed.com), and Calbiochem (La Jolla, California, www.calbiochem.com).
• the polynucleotide sequences encoding these proteins and peptides of interest may be obtained from the scientific literature, from patents, and from databases such as GenBank.
• polynucleotide sequence may be incorporated into the genome by choosing the codons that encode for each amino acid in the desired protein or peptide.
• desired proteins or peptides that may be encoded by the polynucleotide cassettes of the present invention include but are not limited to the following: adrenomedulin, amylin, calcitonin, amyloid, calcitonin gene-related peptide, cholecystokinin, gastrin, gastric inhibitory peptide, gastrin releasing peptide, interleukin, interferon, cortistatin, somatostatin, endothelin, sarafotoxin, glucagon, glucagon-like peptide, insulin, atrial natriuretic peptide, BNP, CNP, neurokinin, substance P, leptin, neuropeptide Y, melanin concentrating hormone, melanocyte stimulating hormone,
• polynucleotide cassettes of the present invention include bacitracin, polymixin b, vancomycin, cyclosporine, anti- RSV antibody, alpha- 1 antitrypsin (AAT), anti-cytomegalovirus antibody, anti- hepatitis antibody, anti-inhibitor coagulant complex, anti-rabies antibody, anti-Rh(D) antibody, adenosine deaminase, anti-digoxin antibody, antivenin crotalidae (rattlesnake venom antibody), antivenin latrodectus (black widow spider venom antibody), antivenin micrurus (coral snake venom antibody), aprotinin, corticotropin (ACTH), diphtheria antitoxin, lymphocyte immune globulin (anti-thymocyte antibody), protamine, thyrotropin, capreomycin, ⁇ -galactosidase, gramici
• IR502 IR502
• IR501 BI 1050/1272 mAb against very late antigen-4 (VLA-4)
• C225 humanized mAb to EGF receptor anti-idiotype antibody to GD3 glycolipid, antibacterial peptide against H. pylori, MDX-447 bispecific humanized mAb to EGF receptor, anti-cytomegalovirus (CMV), Medi-491 B19 parvovirus vaccine, humanized recombinant mAb (IgGlk) against respiratory syncytial virus (RSV), urinary tract infection vaccine (against "pili” on Escherechia coli strains), proteins of lyme disease vaccine against B.
• VLA-4 very late antigen-4
• burgdorferi protein DbpA
• proteins of Medi-501 human papilloma virus-11 vaccine HPV
• Streptococcus pneumoniae vaccine Medi-507 mAb (humanized form of BTI-322) against CD2 receptor on T-cells
• MDX-33 mAb to Fc ⁇ Rl receptor MDX-RA immunotoxin (ricin A linked) mAb
• MDX-210 bi- specific mAb against HER-2 MDX-447 bi-specific mAb against EGF receptor
• MDX-22 MDX-220 bi-specific mAb against TAG-72 on tumors
• colony-stimulating factor (CSF) molgramostim
• humanized mAb to the IL-2 R c-chain basiciliximab
• mAb to IgE IGE 025A
• myelin basic protein-altered peptide MSP771A
• humanized mAb against the epidermal growth receptor-2 humanized mAb against the a subunit of the inter
• multimeric proteins that may be produced using the present invention are as follows: factors involved in the synthesis or replication of DNA, such as DNA polymerase alpha and DNA polymerase delta; proteins involved in the production of mRNA, such as TFIID and TFIIH; cell, nuclear and other membrane-associated proteins, such as hormone and other signal transduction receptors, active transport proteins and ion channels, multimeric proteins in the blood, including hemoglobin, fibrinogen and von Willabrand's Factor; proteins that form structures within the cell, such as actin, myosin, and tubulin and other cytoskeletal proteins; proteins that form structures in the extra cellular environment, such as collagen, elastin and fibronectin; proteins involved in intra- and extra-cellular transport, such as kinesin and dynein, the SNARE family of proteins (soluble NSF attachment protein receptor) and clathrin; proteins that help regulate chromatin structure, such as histones and protamines, Swi3p, Rsc8p and moira; multimeric transcription
• the multimeric proteins made using the present invention may be labeled using labels and techniques known to one of ordinary skill in the art. Some of these labels are described in the "Handbook of Fluorescent Probes and Research Products", ninth edition, Richard P. Haugland (ed) Molecular Probes, Inc. Eugene, OR), which is incorporated herein in its entirety. Some of these labels may be genetically engineered into the polynucleotide sequence for the expression of the selected multimeric protein. The peptides and proteins may also have label-incorporation "handles" incorporated to allow labeling of an otherwise difficult or impossible to label multimeric protein. It is to be understood that the various classes of desired peptides and proteins, as well as specific peptides and proteins described in this section may be modified as described below by inserting selected codons for desired amino acid substitutions into the gene incorporated into the transgenic animal.
• the present invention may also be used to produce desired molecules other than proteins and peptides including, but not limited to, Hpoproteins such as high density lipoprotein (HDL), HDL-Milano, and low density lipoprotein, lipids, carbohydrates, siRNA and ribozymes.
• Hpoproteins such as high density lipoprotein (HDL), HDL-Milano, and low density lipoprotein, lipids, carbohydrates, siRNA and ribozymes.
• a gene of interest encodes a nucleic acid molecule or a protein that directs production of the desired molecule.
• the present invention further encompasses the use of inhibitory molecules to inhibit endogenous (i.e., non-vector) protein production. These inhibitory molecules include antisense nucleic acids, siRNA and inhibitory proteins.
• the endogenous protein whose expression is inhibited is an egg white protein including, but not limited to ovalbumin, ovotransferrin, and ovomucin ovomucoid, ovoinhibitor, cystatin, ovostatin, lysozyme, ovoglobulin G2, ovoglobulin G3, avidin, and thiamin binding protein.
• RNAi interference RNA mechanism
• a polynucleotide cassette encodes an inhibitory RNA molecule that inhibits the expression of more than one egg white protein. Additionally, inducible knockouts or knockdowns of the endogenous protein may be created to achieve a reduction or inhibition of endogenous protein production. Endogenous egg white production can be inhibited in an avian at any time, but is preferably inhibited preceding, or immediately preceding, the harvest of eggs. Modified Desired Proteins and Peptides
• the present invention may be used for the production of multimeric proteins.
• Proteins “Proteins”, “peptides,” “polypeptides” and “oligopeptides” are chains of amino acids (typically L-amino acids) whose alpha carbons are linked through peptide bonds formed by a condensation reaction between the carboxyl group of the alpha carbon of one amino acid and the amino group of the alpha carbon of another amino acid.
• the terminal amino acid at one end of the chain i.e., the amino terminal
• the terminal amino acid at the other end of the chain i.e., the carboxy terminal
• amino terminus refers to the free alpha-amino group on the amino acid at the amino terminal of the protein, or to the alpha-amino group (imino group when participating in a peptide bond) of an amino acid at any other location within the protein.
• carboxy terminus refers to the free carboxyl group on the amino acid at the carboxy terminus of a protein, or to the carboxyl group of an amino acid at any other location within the protein.
• amino acids making up a protein are numbered in order, starting at the amino terminal and increasing in the direction toward the carboxy terminal of the protein. Thus, when one amino acid is said to "follow" another, that amino acid is positioned closer to the carboxy terminal of the protein than the preceding amino acid.
• amino acid is used herein to refer to an amino acid (D or L) or an amino acid mimetic that is incorporated into a protein by an amide bond.
• the amino acid may be a naturally occurring amino acid or, unless otherwise limited, may encompass known analogs of natural amino acids that function in a manner similar to the naturally occurring amino acids (i.e., amino acid mimetics).
• an amide bond mimetic includes peptide backbone modifications well known to those skilled in the art.
• a conservative substitution is a substitution in which the substituting amino acid (naturally occurring or modified) is structurally related to the amino acid being substituted, i.e., has about the same size and electronic properties as the amino acid being substituted. Thus, the substituting amino acid would have the same or a similar functional group in the side chain as the original amino acid.
• a “conservative substitution” also refers to utilizing a substituting amino acid which is identical to the amino acid being substituted except that a functional group in the side chain is protected with a suitable protecting group.
• Suitable protecting groups are described in Green and Wuts, "Protecting Groups in Organic Synthesis", John Wiley and Sons, Chapters 5 and 7, 1991, the teachings of which are incorporated herein by reference.
• Preferred protecting groups are those which facilitate transport of the peptide through membranes, for example, by reducing the hydrophilicity and increasing the lipophilicity of the peptide, and which can be cleaved, either by hydrolysis or enzymatically (Ditter et al., 1968. J. Pharm. Sci. 57:783; Ditter et al., 1968. J. Pharm. Sci. 57:828; Ditter et al., 1969. J. Pharm. Sci.
• Suitable hydroxyl protecting groups include ester, carbonate and carbamate protecting groups.
• Suitable amine protecting groups include acyl groups and alkoxy or aryloxy carbonyl groups, as described above for N-terminal protecting groups.
• Suitable carboxylic acid protecting groups include aliphatic, benzyl and aryl esters, as described below for C-terminal protecting groups.
• the carboxylic acid group in the side chain of one or more glutamic acid or aspartic acid residues in a peptide of the present invention is protected, preferably as a methyl, ethyl, benzyl or substituted benzyl ester, more preferably as a benzyl ester.
• each amino acid in a group has similar electronic and steric properties.
• a conservative substitution can be made by substituting an amino acid with another amino acid from the same group. It is to be understood that these groups are non- limiting, i.e. that there are additional modified amino acids which could be included in each group.
• Group I includes leucine, isoleucine, valine, methionine and modified amino acids having the following side chains: ethyl, n-propyl n-butyl.
• Group I includes leucine, isoleucine, valine and methionine.
• Group II includes glycine, alanine, valine and a modified amino acid having an ethyl side chain.
• Group II includes glycine and alanine.
• Group III includes phenylalanine, phenylglycine, tyrosine, tryptophan, cyclohexylmethyl glycine, and modified amino residues having substituted benzyl or phenyl side chains.
• Preferred substituents include one or more of the following: halogen, methyl, ethyl, nitro, — NH 2 , methoxy, ethoxy and —
• Group III includes phenylalanine, tyrosine and tryptophan.
• Group IV includes glutamic acid, aspartic acid, a substituted or unsubstituted aliphatic, aromatic or benzylic ester of glutamic or aspartic acid (e.g., methyl, ethyl, n-propyl iso-propyl, cyclohexyl, benzyl or substituted benzyl), glutamine, asparagine, — CO — NH — alkylated glutamine or asparagines (e.g., methyl, ethyl, n-propyl and iso-propyl) and modified amino acids having the side chain — (CH 2 ) 3 — COOH, an ester thereof (substituted or unsubstituted aliphatic, aromatic or benzylic ester), an amide thereof and a substituted or unsubstituted N-alkylated amide thereof.
• glutamic acid e.g., methyl, ethyl, n-prop
• Group IV includes glutamic acid, aspartic acid, methyl aspartate, ethyl aspartate, benzyl aspartate and methyl glutamate, ethyl glutamate and benzyl glutamate, glutamine and asparagine.
• Group V includes histidine, lysine, omithine, arginine, N-nitroarginine, ⁇ - cycloarginine, ⁇ -hydroxyarginine, N-amidinocitruline and 2-amino-4- guanidinobutanoic acid, homologs of lysine, homologs of arginine and homologs of omithine.
• Group V includes histidine, lysine, arginine and omithine.
• a homolog of an amino acid includes from 1 to about 3 additional or subtracted methylene units in the side chain.
• Group VI includes serine, threonine, cysteine and modified amino acids having Cl- C5 straight or branched alkyl side chains substituted with — OH or — SH, for example, — CH 2 CH 2 OH, — CH 2 CH 2 CH 2 OH or -CH 2 CH 2 OHCH 3 .
• Group VI includes serine, cysteine or threonine.
• suitable substitutions for amino acid residues include “severe” substitutions.
• a "severe substitution” is a substitution in which the substituting amino acid (naturally occurring or modified) has significantly different size and/or electronic properties compared with the amino acid being substituted.
• the side chain of the substituting amino acid can be significantly larger (or smaller) than the side chain of the amino acid being substituted and/or can have functional groups with significantly different electronic properties than the amino acid being substituted.
• severe substitutions of this type include the substitution of phenylalanine or cyclohexylmethyl glycine for alanine, isoleucine for glycine, a D amino acid for the corresponding L amino acid, or — NH — CH[( — CH 2 ) 5 — COOH] — CO — for aspartic acid.
• a functional group may be added to the side chain, deleted from the side chain or exchanged with another functional group.
• Examples of severe substitutions of this type include adding of valine, leucine or isoleucine, exchanging the carboxylic acid in the side chain of aspartic acid or glutamic acid with an amine, or deleting the amine group in the side chain of lysine or omithine.
• the side chain of the substituting amino acid can have significantly different steric and electronic properties that the functional group of the amino acid being substituted. Examples of such modifications include tryptophan for glycine, lysine for aspartic acid and — (CH 2 ) 4 COOH for the side chain of serine. These examples are not meant to be limiting.
• the individual amino acids may be substituted according in the following manner:
• AN ! is serine, glycine, alanine, cysteine or threonine;
• AA 2 is alanine, threonine, glycine, cysteine or serine;
• AA 3 is valine, arginine, leucine, isoleucine, methionine, omithine, lysine, ⁇ - nitroarginine, ⁇ -cycloarginine, ⁇ -hydroxyarginine, ⁇ -amidinocitruline or 2-amino-4- guanidinobutanoic acid;
• a ⁇ is proline, leucine, valine, isoleucine or methionine;
• AA 5 is tryptophan, alanine, phenylalanine, tyrosine or glycine;
• AA 6 is serine, glycine, alanine, cysteine or threonine;
• AA is proline, leucine, valine, isoleucine or methionine
• AA 8 is alanine, threonine, glycine, cysteine or serine;
• AA is alanine, threonine, glycine, cysteine or serine; AAio is leucine, isoleucine, methionine or valine;
• AA ⁇ is serine, glycine, alanine, cysteine or threonine
• AAj 2 is leucine, isoleucine, methionine or valine;
• AAj 3 is leucine, isoleucine, methionine or valine;
• AAj 4 is glutamine, glutamic acid, aspartic acid, asparagine, or a substituted or unsubstituted aliphatic or aryl ester of glutamic acid or aspartic acid;
• AA 15 is arginine, N-nitroarginine, ⁇ -cycloarginine, ⁇ -hydroxy-arginine, N- amidinocitruline or 2-amino-4-guanidino-butanoic acid
• AA 16 is proline, leucine, valine, isoleucine or methionine;
• AA ⁇ 7 is serine, glycine, alanine, cysteine or threonine; AAis is glutamic acid, aspartic acid, asparagine, glutamine or a substituted or unsubstituted aliphatic or aryl ester of glutamic acid or aspartic acid;
• AAj 9 is aspartic acid, asparagine, glutamic acid, glutamine, leucine, valine, isoleucine, methionine or a substituted or unsubstituted aliphatic or aryl ester of glutamic acid or aspartic acid;
• AA 20 is valine, arginine, leucine, isoleucine, methionine, omithine, lysine, N- nitroarginine, ⁇ -cycloarginine, ⁇ -hydroxyarginine, N-amidinocitruline or 2-amino-4- guanidinobutanoic acid;
• AA 1 is alanine, threonine, glycine, cysteine or serine;
• AA 22 is alanine, threonine, glycine, cysteine or serine; AA 23 is histidine, serine, threonine, cysteine, lysine or omithine;
• AA 24 is threonine, aspartic acid, serine, glutamic acid or a substituted or unsubstituted aliphatic or aryl ester of glutamic acid or aspartic acid;
• AA 25 is asparagine, aspartic acid,, glutamic acid, glutamine, leucine, valine, isoleucine, methionine or a substituted or unsubstituted aliphatic or aryl ester of glutamic acid or aspartic acid;
• AA 26 is cysteine, histidine, serine, threonine, lysine or omithine. It is to be understood that these amino acid substitutions may be made for longer or shorter peptides than the 26 mer in the preceding example above, and for proteins.
• codons for the first several N- terminal amino acids of the transposase are modified such that the third base of each codon is changed to an A or a T without changing the corresponding amino acid. It is preferable that between approximately 1 and 20, more preferably 3 and 15, and most preferably between 4 and 12 of the first N-terminal codons of the gene of interest are modified such that the third base of each codon is changed to an A or a T without changing the corresponding amino acid. In one embodiment, the first ten N-terminal codons of the gene of interest are modified in this manner.
• proteins, protein fragments or peptides may be separated by a spacer molecule such as, for example, a peptide, consisting of one or more amino acids.
• a spacer molecule such as, for example, a peptide, consisting of one or more amino acids.
• the spacer will have no specific biological activity other than to join the desired proteins, protein fragments or peptides together, or to preserve some minimum distance or other spatial relationship between them.
• the constituent amino acids of the spacer may be selected to influence some property of the molecule such as the folding, net charge, or hydrophobicity.
• the spacer may also be contained within a nucleotide sequence with a purification handle or be flanked by proteolytic cleavage sites.
• polypeptide spacers may have from about 1 to about 100 amino acids, preferably 3 to 20 amino acids, and more preferably 4-15 amino acids.
• the spacers in a polypeptide are independently chosen, but are preferably all the same.
• the spacers should allow for flexibility of movement in space and are therefore typically rich in small amino acids, for example, glycine, serine, proline or alanine.
• peptide spacers contain at least 60%, more preferably at least 80% glycine or alanine.
• peptide spacers generally have little or no biological and antigenic activity.
• Preferred spacers are (Gly-Pro-Gly-Gly) x (SEQ ID NO:81) and (Gly 4 -Ser) y , wherein x is an integer from about 3 to about 9 and y is an integer from about 1 to about 8.
• suitable spacers include (Gly-Pro-Gly-Gly) 3
• LH leutinizing hormone
• a heavy and light chain may be synthesized as a single polypeptide using a spacer sequence with protease sites native to the transgenic animal so as to make, upon processing, a heavy and light chain combination in close association, facilitating the addition of a similar heavy and light chain to produce the native immunoglobulin.
• the removal of the spacer sequence may or may not be required.
• Other multimeric proteins may be made in bioengineered organisms in a similar fashion. Nucleotide sequences encoding for the production of residues which may be useful in purification of the expressed recombinant protein may also be built into the vector.
• Such sequences are known in the art and include the glutathione binding domain from glutathione S-transferase, polylysine, hexa-histidine or other cationic amino acids, thioredoxin, hemagglutinin antigen and maltose binding protein. Additionally, nucleotide sequences may be inserted into the gene of interest to be incorporated so that the protein or peptide can also include from one to about six amino acids that create signals for proteolytic cleavage.
• nucleotide sequences encoding for amino acids recognized by enzymes may be incorporated into the gene to facilitate cleavage of the large protein or peptide sequence into desired peptides or proteins or both.
• nucleotides encoding a proteolytic cleavage site can be introduced into the gene of interest so that a signal sequence can be cleaved from a protein or peptide encoded by the gene of interest.
• Nucleotide sequences encoding other amino acid sequences which display pH sensitivity, chemical sensitivity or photolability may also be added to the vector to facilitate separation of the signal sequence from the peptide or protein of interest.
• Proteolytic cleavage sites include cleavage sites recognized by exopeptidases such as carboxypeptidase A, carboxypeptidase B, aminopeptidase I, and dipeptidylaminopeptidase; endopeptidases such as trypsin, V8-protease, enterokinase, factor Xa, collagenase, endoproteinase, subtilisin, and thombin; and proteases such as Protease 3C IgA protease • (Igase) Rhinovirus 3C(preScission)protease. Chemical cleavage sites are also included in the defintion of cleavage site as used herein.
• Chemical cleavage sites include, but are not limited to, site cleaved by cyanogen bromide, hydroxylamine, formic acid, and acetic acid. Self-splicing cleavage sites such as inteins are also included in the present invention.
• one or more cleavage sites are incorporated into a polynucleotide cassette containing multiple genes of interest.
• Figure 4 depicts one example of a polynucleotide cassette containing two genes of interest containing a cleavage site between them.
• the genes of interest may encode different proteins or peptides, the same protein or peptide, or modified versions of the same protein or peptide. While Figure 4 shows a polynucleotide cassette containing two genes of interest, the present invention encompasses a polynucleotide cassette containing any number of genes of interest.
• the cleavage site located between the genes of interest can encode any amino acid sequence that is cleaved by any means. As mentioned above, the cleavage site can encode an amino acid sequence cleaved by a protease, a chemical reaction, can be a photolabile site, can be a pro polynucleotide
• the present invention includes a polynucleotide cassette that encodes a repetitive polypeptide chain in which two or more peptides, polypeptides or proteins, designated as P in the structural formulae presented below, are each separated by a peptide spacer or cleavage site designated as B.
• a polypeptide multivalent ligand also called a multivalent protein, is a form of a multimeric protein encoded by the polynucleotide cassettes of the present invention, and is represented by structural formulae (I, II and III). Each peptide or protein is connected to another peptide or protein through a peptide bond, to a linker group, to a spacer, or to a cleavage site.
• polypeptide multivalent protein is a multiple repeat polypeptide chain in which two or more peptides P are each separated by a peptide linker group, a spacer or a cleavage site.
• a polypeptide multivalent ligand is represented by structural formulae II and 111. I B— (L— P)n
• B is a peptide spacer or cleavage site
• n is an integer from 2 to about 20
• each L is a covalent bond, a linking group or cleavage site which may be present or absent
• each P is a peptide having from about 4 to about 200 amino acid residues.
• m is an integer from 0 to about 20.
• n is an integer from 1 to 20, preferably 2 to 10, more preferably 3 to 7, further wherein a is 1.
• multivalent proteins include the following:
• each P is a peptide having from about 4 to about 200 amino acid residues
• y is 1
• x is an integer from 1 to 3
• n is an integer from 1 to 20, preferably 2 to 10, more preferably 3 to 7.
• Each B is a peptide spacer or cleavage site comprised of at least 2 amino acids or a cleavage site.
• Each peptide P and each B are independently chosen and may be the same or different.
• Suitable linkers (L) are groups that can connect peptides and proteins to each other.
• the linker is an oligopeptide of from about 1 to about 10 amino acids consisting of amino acids with inert side chains.
• Suitable ohgopeptides include polyglycine, polyserine, polyproline, polyalanine and ohgopeptides consisting of alanyl and/or serinyl and/or prolinyl and/or glycyl amino acid residues, m in structural formula II is an integer from 0 to about 20.
• the peptides, polypeptides and proteins in a multivalent protein can be connected to each other by covalent bonds, linker groups, spacers, cleavage groups or a combination thereof.
• the linking groups can be the same or different.
• a polypeptide spacer shown in structural formula (II) is a peptide having from about 5 to about 40 amino acid residues.
• the spacers in a polypeptide multivalent ligand are independently chosen, and may be the same or different.
• the spacers should allow for flexibility of movement in space for the flanking peptides.
• polypeptides and proteins P and are therefore typically rich in small amino acids, for example, glycine, serine, proline or alanine.
• peptide spacers contain at least 60%, more preferably at least 80% glycine or alanine.
• peptide spacers generally have little or no biological and antigenic activity.
• Preferred spacers are (Gly-Pro-Gly-Gly) x (SEQ ID NO:81) and (Gly 4 -Ser) y , wherein x is an integer from about 3 to about 9 and y is an integer from about 1 to about 8.
• suitable spacers include (Gly 4 -Ser) 3 (SEQ ID NO:82).
• Spacers can also include from one to about four amino acids that create a signal for proteolytic cleavage.
• a TAG sequence is linked to a gene of interest. The TAG sequence serves three purposes: 1) it allows free rotation of the peptide or protein to be isolated so there is no interference from the native protein or signal sequence, i.e.
• a TAG sequence includes a spacer sequence, a purification handle and a cleavage site.
• the spacer sequences in the TAG proteins contain one or more repeats shown in SEQ ID NO:85.
• a preferred spacer sequence comprises the sequence provided in SEQ ID NO:86.
• One example of a purification handle is the gp41 hairpin loop from BJV I.
• Exemplary gp41 polynucleotide and polypeptide sequences are provided in SEQ ID NO:87 and SEQ ID NO:88, respectively.
• the cleavage site can be any protein cleavage site known to one of ordinary skill in the art and includes an enterokinase cleavage site comprising the Asp Asp Asp Asp Lys sequence (SEQ ID NO: 89) and a furin cleavage site.
• the TAG sequence comprises a polynucleotide sequence of SEQ ID NO: 90.
• the present invention also includes methods of administering the polynucleotide cassettes to an animal, methods of producing a transgenic animal wherein a gene of interest is incorporated into the germline of the animal and methods of producing a transgenic animal wherein a gene of interest is incorporated into cells other than the germline cells of the animal.
• the polynucleotide cassettes may reside in any vector or delivery solution when administered or may be naked DNA.
• a transposon-based vector containing the polynucleotide cassette between two insertion sequences recognized by a transposase is administered to an animal.
• the polynucleotide cassettes of the present invention may be administered to an animal via any method known to those of skill in the art, including, but not limited to, intraembryonic, intratesticular, intraoviduct, intraovarian, into the duct system of the mammary gland, intraperitoneal, intraarterial, intravenous, topical, oral, nasal, and pronuclear injection methods of administration, or any combination thereof.
• the polynucleotide cassettes may also be administered within the lumen of an organ, into an organ, into a body cavity, into the cerebrospinal fluid, through the urinary system, through the genitourinary system, through the reproductive system, or through any route to reach the desired cells.
• the polynucleotide cassettes may be delivered through the vascular system to be distributed to the cells supplied by that vessel.
• the compositions may be placed in the artery supplying the ovary or supplying the fallopian tube to transfect cells in those tissues. In this manner, follicles could be transfected to create a germline transgenic animal.
• supplying the compositions through the artery leading to the oviduct would preferably transfect the tubular gland and epithelial cells.
• Such transfected cells could manufacture a desired protein or peptide for deposition in the egg white.
• Administration of the compositions through the portal vein would target uptake and transformation of hepatic cells.
• Administration through the urethra and into the bladder would target the transitional epithelium of the bladder.
• Administration through the vagina and cervix would target the lining of the uterus and the epithelial cells of the fallopian tube.
• Administration through the internal mammary artery or through the duct system of the mammary gland would transfect secretory cells of the lactating mammary gland to perform a desired function, such as to synthesize and secrete a desired protein or peptide into the milk.
• the polynucleotide cassettes may be administered in a single administration, multiple administrations, continuously, or intermittently.
• the polynucleotide cassettes may be administered by injection, via a catheter, an osmotic mini-pump or any other method.
• a polynucleotide cassette is administered to an animal in multiple administrations, each administration containing the polynucleotide cassette and a different transfecting reagent.
• the animal is an egg-laying animal, and more preferably, an avian.
• between approximately 1 and 150 ⁇ g, 1 and 100 ⁇ g, 1 and 50 ⁇ g, preferably between 1 and 20 ⁇ g, and more preferably between 5 and 10 ⁇ gof a transposon-based vector containing the polynucleotide cassette is administered to the oviduct of a bird.
• a transposon-based vector containing the polynucleotide cassette is administered to the oviduct of a bird.
• a chicken it is preferred that between approximately 1 and 100 ⁇ g, or 5 and 50 ⁇ g are administered.
• In a quail it is preferred that between approximately 5 and 10 ⁇ g are administered.
• Intraoviduct administration of the transposon-based vectors of the present invention result in a PCR positive signal in the oviduct tissue, whereas intravascular administration results in a PCR positive signal in the liver.
• the polynucleotide cassettes is administered to an artery that supplies the oviduct or the liver.
• These methods of administration may also be combined with any methods for facilitating transfection, including without limitation, electroporation, gene guns, injection of naked DNA, and use of dimethyl sulfoxide (DMSO).
• DMSO dimethyl sulfoxide
• the transposon-based vectors may be administered to the animal at any point during the lifetime of the animal, however, it is preferable that the vectors are administered prior to the animal reaching sexual maturity.
• the transposon-based vectors are preferably administered to a chicken oviduct between approximately 14 and 16 weeks of age and to a quail oviduct between approximately 5 and 10 weeks of age, more preferably 5 and 8 weeks of age, and most preferably between 5 and 6 weeks of age, when standard poultry rearing practices are used.
• the vectors may be administered at earlier ages when exogenous hormones are used to induce early sexual maturation in the bird.
• the transposon-based vector is administered to an animal's oviduct following an increase in proliferation of the oviduct epithelial cells and/or the tubular gland cells. Such an increase in proliferation normally follows an influx of reproductive hormones in the area of the oviduct.
• the transposon-based vector is administered to the avian' s oviduct following an increase in proliferation of the oviduct epithelial cells and before the avian begins to produce egg white constituents.
• the present invention also includes a method of intraembryonic administration of a transposon-based vector containing a polynucleotide cassette to an avian embryo comprising the following steps: 1) incubating an egg on its side at room temperature for two hours to allow the embryo contained therein to move to top dead center (TDC); 2) drilling a hole through the shell without penetrating the underlying shell membrane; 3) injecting the embryo with the transposon-based vector in solution; 4) sealing the hole in the egg; and 5) placing the egg in an incubator for hatching.
• Administration of the transposon-based vector can occur anytime between immediately after egg lay (when the embryo is at Stage X) and hatching.
• the transposon-based vector is administered between 1 and 7 days after egg lay, more preferably between 1 and 2 days after egg lay.
• the transposon-based vectors may be introduced into the embryo in amounts ranging from about 5.0 ⁇ g to 10 pg, preferably 1.0 ⁇ g to 100 pg.
• the transposon-based vector solution volume may be between approximately 1 ⁇ l to 75 ⁇ l in quail and between approximately 1 ⁇ l to 500 ⁇ l in chicken.
• the present invention also includes a method of intratesticular administration of a transposon-based vector containing a polynucleotide cassette including injecting a bird with a composition comprising the transposon-based vector, an appropriate carrier and an appropriate transfection reagent.
• the bird is injected before sexual maturity, preferably between approximately 4-14 weeks, more preferably between approximately 6-14 weeks and most preferably between 8-12 weeks old.
• a mature bird is injected with a transposon-based vector an appropriate carrier and an appropriate transfection reagent.
• the mature bird may be any type of bird, but in one example the mature bird is a quail.
• a bird is preferably injected prior to the development of the blood-testis barrier, which thereby facilitates entry of the transposon-based vector into the seminiferous tubules and transfection of the spermatogonia or other germline cells.
• the testes of chickens are likely to be most receptive to transfection.
• the blood testis barrier has not yet formed, and there is a relatively high number of spermatogonia relative to the numbers of other cell types, e.g., spermatids, etc. See J. Kumaran et al., 1949. Poultry Sci., 29:511-520. See also E. Oakberg, 1956. Am. J. Anatomy, 99:507-515; and P. Kluin et al., 1984. Anat. Embryol., 169:73-78.
• the transposon-based vectors may be introduced into a testis in an amount ranging from about 0.1 ⁇ g to 10 ⁇ g, preferably 1 ⁇ g to 10 ⁇ g, more preferably 3 ⁇ g to 10 ⁇ g. In a quail, about 5 ⁇ g is a preferred amount. In a chicken, about 5 ⁇ g to 10 ⁇ g per testis is preferred.
• These amounts of vector DNA may be injected in one dose or multiple doses and at one site or multiple sites in the testis. In a preferred embodiment, the vector DNA is administered at multiple sites in a single testis, both testes being injected in this manner. In one embodiment, injection is spread over three injection sites: one at each end of the testis, and one in the middle.
• the transposon-based vector solution volume may be between approximately 1 ⁇ l to 75 ⁇ l in quail and between approximately 1 ⁇ l to 500 ⁇ l in chicken. In a preferred embodiment, the transposon-based vector solution volume may be between approximately 20 ⁇ l to 60 ⁇ l in quail and between approximately 50 ⁇ l to 250 ⁇ l in chicken. Both the amount of vector DNA and the total volume injected into each testis may be determined based upon the age and size of the bird.
• the polynucleotide cassette is administered in conjunction with an acceptable carrier and/or transfection reagent.
• Acceptable carriers include, but are not limited to, water, saline, Hanks Balanced Salt Solution (HBSS), Tris-EDTA (TE) and lyotropic liquid crystals.
• Transfection reagents commonly known to one of ordinary skill in the art that may be employed include, but are not limited to, the following: cationic lipid transfection reagents, cationic lipid mixtures, polyamine reagents, liposomes and combinations thereof; SUPERFECT®, Cytofectene, BioPORTER®, GenePORTER®, NeuroPORTER®, and perfectin from Gene Therapy Systems; lipofectamine, cellfectin, DMRIE-C oligofectamine, and PLUS reagent from InVitrogen; Xtreme gene, fugene, DOSPER and DOTAP from Roche; Lipotaxi and Genejammer from Strategene; and Escort from SIGMA.
• the transfection reagent is SUPERFECT®.
• the ratio of DNA to transfection reagent may vary based upon the method of administration.
• a transposon-based vector containing a polynucleotide cassette is administered intratesticularly and the ratio of DNA to transfection reagent can be from 1:1.5 to 1:15, preferably 1:2 to 1:10, all expressed as wt vol.
• Transfection may also be accomplished using other means known to one of ordinary skill in the art, including without limitation electroporation, gene guns, injection of naked DNA, and use of dimethyl sulfoxide (DMSO).
• DMSO dimethyl sulfoxide
• transposon-based vector may be important. Plasmids harvested from bacteria are generally closed circular supercoiled molecules, and this is the preferred state of a vector for gene delivery because of the ease of preparation. In some instances, transposase expression and insertion may be more efficient in a relaxed, closed circular configuration or in a linear configuration. In still other instances, a purified transposase protein may be co-injected with a transposon-based vector containing the gene of interest for more immediate insertion. This could be accomplished by using a transfection reagent complexed with both the purified transposase protein and the transposon-based vector. Testing for and Breeding Animals Carrying the Transgene
• DNA is extracted from the animal to confirm integration of the genes of interest.
• Advantages provided by the present invention include the high rates of integration, or incorporation, and transcription of the gene of interest when administered to a bird via an intraoviduct or intraovary route (including intraarterial administrations to arteries leading to the oviduct or ovary) and contained within a transposon-based vector.
• PRINS primed in situ hybridization technique
• This technique combines the best features of in situ PCR and fluorescence in situ hybridization (FISH) to provide distinct chromosome location and copy number of the gene in question.
• FISH fluorescence in situ hybridization
• the 28s rRNA gene will be used as a positive control for spermatogonia to confirm that the technique is functioning properly.
• Using different fluorescent labels for the transgene and the 28s gene causes cells containing a transgene to fluoresce with two different colored tags.
• Breeding experiments may also be conducted to determine if germline transmission of the transgene has occurred.
• each male bird is exposed to 2-3 different adult female birds for 3-4 days each. This procedure is continued with different females for a total period of 6-12 weeks. Eggs are collected daily for up to 14 days after the last exposure to the transgenic male, and each egg is incubated in a standard incubator. The resulting embryos are examined for transgene presence at day 3 or 4 using PCR. Any male producing a transgenic embryo is bred to additional females. Eggs from these females are incubated, hatched, and the chicks tested for the exogenous DNA.
• Any embryos that die are necropsied and examined directly for the transgene or protein encoded by the transgene, either by fluorescence or PCR.
• the offspring that hatch and are found to be positive for the exogenous DNA are raised to maturity.
• These birds are bred to produce further generations of transgenic birds, to verify efficiency of the transgenic procedure and the stable incorporation of the transgene into the germ line.
• the resulting embryos are examined for transgene presence at day 3 or 4 using PCR.
• a transposon-based vector containing a polynucleotide cassette of the present invention may be administered to a bird for production of desired proteins or peptides in the egg white.
• These trasnposon-based vectors preferably contain one or more of an ovalbumin promoter, an ovomucoid promoter, an ovalbumin signal sequence and an ovomucoid signal sequence. Oviduct-specific ovalbumin promoters are described in B. O'Malley et al., 1987. EMBO J., vol.
• the present invention is particularly advantageous for production of recombinant peptides and proteins of low solubility in the egg yolk.
• proteins include, but are not limited to, membrane-associated or membrane-bound proteins, lipophilic compounds; attachment factors, receptors, and components of second messenger transduction machinery.
• Low solubility peptides and proteins are particularly challenging to produce using conventional recombinant protein production techniques (cell and tissue cultures) because they aggregate in water- based, hydrophilic environments. Such aggregation necessitates denaturation and refolding of the recombinantly-produced proteins, which may deleteriously affect their structure and function.
• the present invention provides an advantageous resolution of the problem of protein and peptide solubility during production of large amounts of recombinant proteins.
• deposition of a desired protein into the egg yolk is accomplished by attaching a sequence encoding a protein capable of binding to the yolk vitellogenin receptor to a gene of interest that encodes a desired protein.
• This polynucleotide cassette can be used for the receptor-mediated uptake of the desired protein by the oocytes.
• the sequence ensuring the binding to the vitellogenin receptor is a targeting sequence of a vitellogenin protein.
• the invention encompasses various vitellogenin proteins and their targeting sequences.
• a chicken vitellogenin protein targeting sequence is used, however, due to the high degree of conservation among vitellogenin protein sequences and known cross-species reactivity of vitellogenin targeting sequences with their egg-yolk receptors, other vitellogenin targeting sequences can be substituted.
• a construct for use in the transposon-based vectors of the present invention and for deposition of an insulin protein in an egg yolk is a transposon-based vector containing a vitellogenin promoter, a vitellogenin targeting sequence, a TAG sequence, a pro-insulin sequence and a synthetic polyA sequence.
• the present invention includes, but is not limited to, vitellogenin targeting sequences residing in the N-terminal domain of vitellogenin, particularly in lipovitellin I.
• vitellogenin targeting sequence contains the polynucleotide sequence of SEQ ID NO:77.
• the transposon-based vector contains a transposase gene operably-linked to a constitutive promoter and a gene of interest operably-linked to a liver-specific promoter and a vitellogenin targeting sequence.
• an animal breeding stock that is homozygous for the transgene is preferred.
• Such homozygous individuals are obtained and identified through, for example, standard animal breeding procedures or PCR protocols.
• peptides, polypeptides and proteins can be purified according to standard procedures known to one of ordinary skill in the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis, high performance liquid chromatography, immunoprecipitation and the like.
• Substantially pure compositions of about 50 to 99% homogeneity are preferred, and 80 to 95% or greater homogeneity are most preferred for use as therapeutic agents.
• the animal in which the desired protein is produced is an egg-laying animal.
• the animal is an avian and a desired peptide, polypeptide or protein is isolated from an egg white.
• Egg white containing the exogenous protein or peptide is separated from the yolk and other egg constituents on an industrial scale by any of a variety of methods known in the egg industry. See, e.g., W. Stadelman et al. (Eds.), Egg Science & Technology, Haworth Press, Binghamton, NY (1995).
• Isolation of the exogenous peptide or protein from the other egg white constituents is accomplished by any of a number of polypeptide isolation and purification methods well known to one of ordinary skill in the art. These techniques include, for example, chromatographic methods such as gel permeation, ion exchange, affinity separation, metal chelation, HPLC, and the like, either alone or in combination. Another means that may be used for isolation or purification, either in lieu of or in addition to chromatographic separation methods, includes electrophoresis. Successful isolation and purification is confirmed by standard analytic techniques, including HPLC, mass spectroscopy, and spectrophotometry. These separation methods are often facilitated if the first step in the separation is the removal of the endogenous ovalbumin fraction of egg white, as doing so will reduce the total protein content to be further purified by about 50%.
• the polynucleotide cassettes may include one or more additional epitopes or domains.
• epitopes or domains include DNA sequences encoding enzymatic, chemical or photolabile cleavage sites including, but not limited to, an enterokinase cleavage site; the glutathione binding domain from glutathione S-transferase; polylysine; hexa- histidine or other cationic amino acids, and sites cleaved by cyanogen bromide, hydroxylamine, formic acid, and acetic acid; thioredoxin; hemagglutinin antigen; maltose binding protein; a fragment of gp41 from HIV; and other purification epitopes or domains commonly known to one of skill in the art.
• proteolytic cleavage sites that may be included in the polynucleotide cassettes are cleavage sites recognized by exopeptidases such as carboxypeptidase A, carboxypeptidase B, aminopeptidase I, and dipeptidylaminopeptidase; endopeptidases such as trypsin, V8- protease, enterokinase, factor Xa, collagenase, endoproteinase, subtilisin, and thombin; and proteases such as Protease 3C IgA protease (Igase) Rhinovirus 3C(preScission)protease.
• exopeptidases such as carboxypeptidase A, carboxypeptidase B, aminopeptidase I, and dipeptidylaminopeptidase
• endopeptidases such as trypsin, V8- protease, enterokinase, factor Xa, collagenase, endoproteinas
• Self-splicing cleavage sites such as inteins may also be included in the polynucleotide cassettes of the present invention.
• purification of desired proteins from egg white utilizes the antigenicity of the ovalbumin carrier protein and particular attributes of a TAG linker sequence that spans ovalbumin and the desired protein.
• the TAG sequence is particularly useful in this process because it contains 1) a highly antigenic epitope, a fragment of gp41 from HIV, allowing for stringent affinity purification, and, 2) a recognition site for the protease enterokinase immediately juxtaposed to the desired protein.
• the TAG sequence comprises approximately 50 amino acids.
• a representative TAG sequence is provided below.
• the underlined sequences were taken from the hairpin loop domain of HIV gp-41 (SEQ ID NO: 87). Sequences in italics represent the cleavage site for enterokinase (SEQ ID NO :89).
• the spacer sequence upstream of the loop domain was made from repeats of (Pro Ala Asp Asp Ala) (SEQ ID NO: 85) to provide free rotation and promote surface availability of the hairpin loop from the ovalbumin carrier protein. Isolation and purification of a desired protein is performed as follows:
• transgenic ovalbumin-TAG-desired protein is left attached to the gp41 affinity resin (beads) from step 4 and the protease enterokinase is added. This liberates the transgene target protein from the gp41 affinity resin while the ovalbumin-TAG sequence is retained. Separation by centrifugation (in a batch process) or flow through (in a column purification), leaves the desired protein together with enterokinase in solution.
• Enterokinase is recovered and reused.
• enterokinase is immobilized on resin (beads) by the addition of poly-lysine moieties to a non-catalytic area of the protease.
• the transgenic ovalbumin-TAG-desired protein eluted from the affinity column of step 4 is then applied to the protease resin. Protease action cleaves the ovalbumin-TAG sequence from the desired protein and leaves both entities in solution.
• the immobilized enterokinase resin is recharged and reused, c. The choice of these alternatives is made depending upon the size and chemical composition of the transgene target protein.
• a final separation of either of these two (5a or 5b) protein mixtures is made using size exclusion, or enterokinase affinity chromatography. This step allows for desalting, buffer exchange and/or polishing, as needed. Cleavage of the transgene product (ovalbumin-TAG-desired protein) by enterokinase, then, results in two products: ovalbumin-TAG and the desired protein. More specific methods for isolation using the TAG label is provided in the Examples. Some desired proteins may require additions or modifications of the above-described approach as known to one of ordinary skill in the art. The method is scaleable from the laboratory bench to pilot and production facility largely because the techniques applied are well documented in each of these settings.
• a typical chicken egg produced by a transgenic animal of the present invention will contain at least 0.001 mg, from about 0.001 to 1.0 mg, or from about 0.001 to 100.0 mg of exogenous protein, peptide or polypeptide, in addition to the normal constituents of egg white (or possibly replacing a small fraction of the latter).
• exogenous protein, peptide or polypeptide in addition to the normal constituents of egg white (or possibly replacing a small fraction of the latter).
• the desired proteins, fragments thereof and peptides may possess a conformation substantially different than the native conformations of the proteins, fragments thereof and peptides. In this case, it is often necessary to denature and reduce protein and then to cause the protein to re-fold into the preferred conformation. Methods of reducing and denaturing proteins and inducing re-folding are well known to those of skill in the art. Production of Multimeric Proteins in Milk
• the present invention encompasses methods for the production of milk containing transgenic proteins or peptides. These methods include the administration of a transposon-based vector described above to a mammal.
• the transposon-based vector contains a transposase operably-linked to a constitutive promoter and a gene of interest operably-linked to mammary specific promoter.
• Genes of interest can include, but are not limited to antiviral and antibacterial proteins and immunoglobulins.
• a vector was designed for inserting a desired coding sequence into the genome of eukaryotic cells, given below as SEQ ID NO:57.
• the vector of SEQ ID NO:57 termed pTnMod, was constructed and its sequence verified.
• This vector employed a cytomegalovirus (CMV) promoter.
• CMV cytomegalovirus
• a modified Kozak sequence (ACCATG) (SEQ ID NO: 5) was added to the promoter.
• the nucleotide in the wobble position in nucleotide triplet codons encoding the first 10 amino acids of transposase was changed to an adenine (A) or thymine (T), which did not alter the amino acid encoded by this codon.
• Two stop codons were added and a synthetic polyA was used to provide a strong termination sequence.
• This vector uses a promoter designed to be active soon after entering the cell (without any induction) to increase the likelihood of stable integration. The additional stop codons and synthetic polyA insures proper termination without read through to potential genes downstream.
• the first step in constructing this vector was to modify the transposase to have the desired changes. Modifications to the transposase were accomplished with the primers High Efficiency forward primer (Hef) Altered transposase (ATS)-Hef 5' ATCTCGAGACCATGTGTGAACTTGATATTTTACATGATTCTCTTTACC 3 ' (SEQ ID NO:91) and Altered transposase- High efficiency reverse primer (Her) 5' GATTGATCATTATCATAATTTCCCCAAAGCGTAACC 3' (SEQ ID NO:92, a reverse complement primer).
• Hef High Efficiency forward primer
• ATS Altered transposase
• ATS Altered transposase
• ATS ATCTCGAGACCATGTGTGAACTTGATATTTTACATGATTCTCTTTACC 3 '
• Altered transposase- High efficiency reverse primer Her
• the sequence CTCGAG (SEQ ID NO:93) is the recognition site for the restriction enzyme Xho I, which permits directional cloning of the amplified gene.
• the sequence ACCATG (SEQ ID NO: 5) contains the Kozak sequence and start codon for the transposase and the underlined bases represent changes in the wobble position to an A or T of codons for the first 10 amino acids (without changing the amino acid coded by the codon).
• Primer ATS-Her (SEQ ID NO:92) contains an additional stop codon TAA in addition to native stop codon TGA and adds a Bel I restriction site, TGATCA (SEQ ID NO: 94), to allow directional cloning.
• pTnLac plasmid
• tn defines transposon
• lac defines the beta fragment of the lactose gene, which contains a multiple cloning site
• Amplified PCR product was electrophoresed on a 1% agarose gel, stained with ethidium bromide, and visualized on an ultraviolet transilluminator.
• a band corresponding to the expected size was excised from the gel and purified from the agarose using a Zymo Clean Gel Recovery Kit (Zymo Research, Orange, CA).
• Purified DNA was digested with restriction enzymes Xho I (5') and Bel I (3') (New England Biolabs, Beverly, MA) according to the manufacturer's protocol. Digested DNA was purified from restriction enzymes using a Zymo DNA Clean and Concentrator kit (Zymo Research). Plasmid gWhiz (Gene Therapy Systems, San Diego, CA) was digested with restriction enzymes Sal I and BamH I (New England Biolabs), which are compatible with Xho I and Bel I, but destroy the restriction sites.
• Digested gWhiz was separated on an agarose gel, the desired band excised and purified as described above. Cutting the vector in this manner facilitated directional cloning of the modified transposase (mATS) between the CMV promoter and synthetic polyA.
• mATS modified transposase
• a Stratagene T4 Ligase Kit (Stratagene, Inc. La Jolla, CA) was used and the ligation set up according to the manufacturer's protocol. Ligated product was transformed into E. coli Top 10 competent cells (Invitrogen Life Technologies, Carlsbad, CA) using chemical transformation according to Invitrogen' s protocol.
• Transformed bacteria were incubated in 1 ml of SOC (GIBCO BRL, CAT# 15544- 042) medium for 1 hour at 37° C before being spread to LB (Luria-Bertani media (broth or agar)) plates supplemented with 100 ⁇ g/ml ampicillin (LB/amp plates). These plates were incubated overnight at 37° C and resulting colonies picked to LB/amp broth for overnight growth at 37° C. Plasmid DNA was isolated using a modified alkaline lysis protocol (Sambrook et al., 1989), electrophoresed on a 1% agarose gel, and visualized on a U.V. transilluminator after ethidium bromide staining.
• Colonies producing a plasmid of the expected size were cultured in at least 250 ml of LB/amp broth and plasmid DNA harvested using a Qiagen Maxi-Prep Kit (column purification) according to the manufacturer's protocol (Qiagen, Inc., Chatsworth, CA). Column purified DNA was used as template for sequencing to verify the changes made in the transposase were the desired changes and no further changes or mutations occurred due to PCR amplification. For sequencing, Perkin-Elmer's Big Dye Sequencing Kit was used. All samples were sent to the Gene Probes and Expression Laboratory (LSU School of Veterinary Medicine) for sequencing on a Perkin-Elmer Model 377 Automated Sequencer.
• primers CMVf-NgoM TV (5' TTGCCGGCATCAGATTGGCTAT (SEQ ID NO:95); underlined bases denote NgoM TV recognition site) and Syn-polyA-BstE II (5' AGAGGTCACCGGGTCAATTCTTCAGCACCTGGTA (SEQ ID NO:96); underlined bases denote BstE II recognition site) were used to PCR amplify the entire CMV promoter, mATS, and synthetic polyA for cloning upstream of the transposon in pTnLac.
• PCR was conducted with FailSafeTM as described above, purified using the Zymo Clean and Concentrator kit, the ends digested with NgoM TV and BsfE II (New England Biolabs), purified with the Zymo kit again and cloned upstream of the transposon in pTnLac as described below.
• Plasmid pTnLac was digested with NgoM IV and BsfE II to remove the ptac promoter and transposase and the fragments separated on an agarose gel.
• the band corresponding to the vector and transposon was excised, purified from the agarose, and dephosphorylated with calf intestinal alkaline phosphatase (New England Biolabs) to prevent self-annealing.
• the enzyme was removed from the vector using a Zymo DNA Clean and Concentrator-5.
• the purified vector and CMVp/mATS/polyA were ligated together using a Stratagene T4 Ligase Kit and transformed into E. coli as described above.
• Base pairs 1-130 are a remainder of Fl(-) on from pBluescriptll sk(-) (Stratagene), corresponding to base pairs 1-130 of pBluescriptll sk(-).
• Base pairs 131 - 132 are a residue from ligation of restriction enzyme sites used in constructing the vector.
• Base pairs 133 -1777 are the CMV promoter/enhancer taken from vector pGWiz (Gene Therapy Systems), corresponding to bp 229-1873 of pGWiz.
• the CMV promoter was modified by the addition of an ACC sequence upstream of ATG.
• Base pairs 1778-1779 are a residue from ligation of restriction enzyme sites used in constructing the vector.
• Base pairs 1780 - 2987 are the coding sequence for the transposase, modified from TnlO (GenBank accession JO 1829) by optimizing codons for stability of the transposase rnK A and for the expression of protein. More specifically, in each of the codons for the first ten amino acids of the transposase, G or C was changed to A or T when such a substitution would not alter the amino acid that was encoded.
• Base pairs 2988-2993 are two engineered stop codons.
• Base pair 2994 is a residue from ligation of restriction enzyme sites used in constructing the vector.
• Base pairs 2995 - 3410 are a synthetic polyA sequence taken from the pGWiz vector (Gene Therapy Systems), corresponding to bp 1922-2337 of 10 pGWiz.
• Base pairs 3415 - 3718 are non-coding DNA that is residual from vector pNK2859.
• Base pairs 3719 - 3761 are non-coding ⁇ DNA that is residual from pNK2859.
• Base pairs 3762 - 3831 are the 70 bp of the left insertion sequence recognized by the transposon TnlO.
• Base pairs 3832-3837 are a residue from ligation of restriction enzyme sites used in constructing the vector.
• Base pairs 3838 - 4527 are the multiple cloning site from pBluescriptll sk(20), corresponding to bp 924-235 of pBluescriptll sk(-). This multiple cloning site may be used to insert any coding sequence of interest into the vector.
• Base pairs 4528-4532 are a residue from ligation of restriction enzyme sites used in constructing the vector.
• Base pairs 4533 - 4602 are the 70 bp of the right insertion sequence recognized by the transposon TnlO.
• Base pairs 4603 - 4644 are non-coding ⁇ DNA that is residual from pNK2859.
• Base pairs 4645 - 5488 are non-coding DNA that is residual from pNK2859.
• Base pairs 5489 - 7689 are from the pBluescriptll sk(-) base vector - (Stratagene, Inc.), corresponding to bp 761-2961 of pBluescriptll sk(-).
• Completing pTnMod is a pBlueScript backbone that contains a colE I origin of replication and an antibiotic resistance marker (ampicillin).
• transposon-based vector was designed for inserting a desired coding sequence into the genome of eukaryotic cells.
• This vector was termed pTnMCS and its constituents are provided below.
• the sequence of the pTnMCS vector is provided in SEQ ID NO:56.
• the pTnMCS vector contains an avian optimized polyA sequence operably-linked to the transposase gene.
• the avian optimized polyA sequence contains approximately 75 nucleotides that precede the A nucleotide string.
• Lanes 1 & 18 molecular weight markers
• Lanes 2 and 3 EW #1, non-reduced, reduced, respectively
• Lanes 4 and 5 EW #2, non-reduced, reduced, respectively
• Lanes 6 and 7 EW #3, non-reduced, reduced, respectively
• Lanes 8 and 9 EW #4, non-reduced, reduced, respectively
• Lanes 10 and 11 EW #5, non-reduced, reduced, respectively
• Lanes 12 and 13 EW #6, non-reduced, reduced, respectively
• Lanes 14 and 15 EW #7, non-reduced, reduced, respectively
• Lanes 16 and 17 EW #8 Control, non-reduced, reduced, respectively.
• transposon-based vectors of the present invention provides a description of various transposon-based vectors of the present invention and several constructs for insertion into the transposon-based vectors of the present invention. These examples are not meant to be limiting in any way.
• the constructs for insertion into a transposon-based vector are provided in a cloning vector pTnMCS or pTnMod, both described above.
• pTnMOD CMV-prepro-HCPro-Lvs-CPA ⁇
• SEQ ID NO: 97 Bp 1 ⁇ 1090 from vector pTnMod, bp 1 - 4090
• Bp 4096-5739 CMV promoter/enhancer taken from vector pGWIZ (Gene therapy systems), bp 230-1864
• Bp 1 - 3715 from vector pTnMCS Bp 1 - 3715 from vector pTnMCS, bp 1-3715
• Bp 3721 - 5364 CMV promoter/enhancer taken from vector pGWIZ (Gene therapy systems), bp 230-1864
• Bp 1 - 3715 from vector pTnMCS Bp 1 - 3715 from vector pTnMCS, bp 1-3715
• Bp 3721 - 5364 CMV promoter/enhancer taken from vector pGWIZ (Gene therapy systems), bp 230-1864
• Bp 6120-6290 Capsite/Prepro taken from GenBank accession # X07404, bp 563-733 Bp 6297-7661 Heavy Chain gene construct taken from antibody RM2 provided by
• Bp 4096-5739 CMV promoter/enhancer taken from vector pGWIZ (Gene therapy systems), bp 230-1864

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• General Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Biophysics (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Zoology (AREA)
• Medicinal Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Immunology (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• Wood Science & Technology (AREA)
• General Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Microbiology (AREA)
• Veterinary Medicine (AREA)
• Virology (AREA)
• Environmental Sciences (AREA)
• Physics & Mathematics (AREA)
• Endocrinology (AREA)
• Plant Pathology (AREA)
• Oncology (AREA)
• Nutrition Science (AREA)
• AIDS & HIV (AREA)
• Hematology (AREA)
• Animal Behavior & Ethology (AREA)
• Animal Husbandry (AREA)
• Diabetes (AREA)
• Toxicology (AREA)
• Gastroenterology & Hepatology (AREA)
• Biodiversity & Conservation Biology (AREA)
• Food Science & Technology (AREA)
• Polymers & Plastics (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (3)

Applications Claiming Priority (14)

Publications (2)

Family

ID=32831251

Family Applications (3)

Family Applications Before (2)

Country Status (7)

Cited By (1)

Families Citing this family (63)

Family Cites Families (166)

• 2003
  • 2003-06-26 US US10/609,019 patent/US7527966B2/en not_active Expired - Fee Related
  • 2003-12-24 EP EP03800225A patent/EP1592789B1/en not_active Expired - Lifetime
  • 2003-12-24 WO PCT/US2003/041335 patent/WO2004067707A2/en not_active Ceased
  • 2003-12-24 JP JP2004567446A patent/JP2006512921A/ja not_active Withdrawn
  • 2003-12-24 JP JP2004567449A patent/JP2006512922A/ja active Pending
  • 2003-12-24 DE DE60327717T patent/DE60327717D1/de not_active Expired - Fee Related
  • 2003-12-24 AU AU2003299959A patent/AU2003299959A1/en not_active Abandoned
  • 2003-12-24 WO PCT/US2003/041269 patent/WO2004067743A1/en not_active Ceased
  • 2003-12-24 AT AT03800225T patent/ATE431849T1/de not_active IP Right Cessation
  • 2003-12-24 WO PCT/US2003/041261 patent/WO2004067706A2/en not_active Ceased
  • 2003-12-24 EP EP03808563A patent/EP1597378A4/en not_active Withdrawn
  • 2003-12-24 AU AU2003303831A patent/AU2003303831A1/en not_active Abandoned
  • 2003-12-24 AU AU2003303830A patent/AU2003303830A1/en not_active Abandoned
• 2007
  • 2007-10-31 US US11/981,574 patent/US7608451B2/en not_active Expired - Fee Related

Also Published As

Similar Documents

Legal Events