WO2003102198A1 - Verfahren zur stabilen expression von nukleinsäuren in transgenen pflanzen unter der kontrolle eines petersilie-ubiquitin-promoters - Google Patents
Verfahren zur stabilen expression von nukleinsäuren in transgenen pflanzen unter der kontrolle eines petersilie-ubiquitin-promoters Download PDFInfo
- Publication number
- WO2003102198A1 WO2003102198A1 PCT/EP2003/005668 EP0305668W WO03102198A1 WO 2003102198 A1 WO2003102198 A1 WO 2003102198A1 EP 0305668 W EP0305668 W EP 0305668W WO 03102198 A1 WO03102198 A1 WO 03102198A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- promoter
- nucleic acid
- plant
- expression
- plants
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
Definitions
- the present invention relates to a method for the stable expression of nucleic acids in transgenic plants.
- the invention further relates to nucleic acid constructs
- transgenic plants Vectors, transgenic plants and the use of these transgenic plants for the production of food, animal feed, seeds, pharmaceuticals or fine chemicals.
- herbicide resistance can be achieved by introducing foreign genes, which optimizes the cultivation conditions and reduces crop losses (Ott KH et al., J Mol Biol. 1996; 263 (2): 359-368).
- the quality of the products can also be improved.
- the shelf life and shelf life of crop products can be increased, for example, by inactivating certain ripening genes. This was shown, for example, on the tomato by inactivating the polygalacturonase (Hamilton AJ et al., Curr Top Microbiol Immunol 1995; 197: 77-89). 45 Furthermore, by introducing additional genes from metabolic genes in plants, certain products and by-products of naturally occurring metabolic processes can advantageously be used for a broad spectrum of industries, including the feed, food, cosmetics and pharmaceutical industries.
- These molecules include, for example, vitamins, amino acids, carbohydrates or lipids and fatty acids, among which an exemplary class is the polyunsaturated fatty acids (PUFAs).
- PUFAs polyunsaturated fatty acids
- polyunsaturated fatty acids are added to children's foods in order to produce a higher nutritional value for these foods.
- PUFAs have a positive influence on the cholesterol level in the blood of humans and are therefore suitable for protection against heart diseases.
- Fatty acids and triglycerides have a multitude of applications in the food industry, animal nutrition, cosmetics and pharmaceuticals.
- a basic requirement for the transgenic expression of certain genes in plants is the provision of plant-specific promoters.
- Various plant promoters are known. There can be constitutive promoters that allow local and temporally limited expression in different parts of a plant and specific promoters that only express in certain parts or cells of a plant (e.g. root, seeds, pollen, leaves, etc.) or allow to be differentiated only at certain times of development. Constitutive promoters are used advantageously for the expression of so-called selection markers. Selection markers (e.g. antibiotic or herbicide resistance genes) allow the transformation event to be filtered out from the large number of untransformed, but otherwise identical plant individuals.
- Selection markers e.g. antibiotic or herbicide resistance genes
- genes to be expressed In all cases it is necessary to control the expression of the genes to be expressed depending on the task of the genes. All expressed genes in all organisms have a promoter region 5 'of the coding sequence. This region is responsible for the start of the transcription itself as well as for the regulation of the transcription. This regulation usually takes place by binding transcription factors to regulatory sequences within the promoter region. Promoters are usually freely portable within a species, i.e. a promoter from one gene can be used to control the transcription of another gene.
- This control of the new gene is then usually identical to the control of the original gene from which the promoter comes.
- the expression of any gene can thus be controlled in a known manner using a known promoter whose regulation is known. This no longer applies in general as soon as the promoter is used in other species.
- promoters from the Streptomyces bacterium are not or only poorly recognized in the E. coli bacterium. The same applies to promoters of animal or vegetable origin which cannot easily be used mutually or in microorganisms.
- TR double promoter from Agrobacterium tumefaciens the promoters of the vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (WO 91/13991) and the Ppcl promoter from Mesembryanthemum crystallinum (Cushman et al. (1993) Plant Mol Biol 21 : 561-566).
- the constitutive promoters currently used predominantly in plants are almost exclusively of viral or bacterial origin, for example from Agrobacterium. These are specifically the nopaline synthase (nos) promoter [Shaw et al. (1984) Nucleic Acids Res. 12 (20): 7831-7846], the mannopine synthase (as) promoter [Comai et al.
- the ScBV promoter mediated expression level was comparable to that of the ubiquitin promoter from maize (see below). Furthermore, the ScBV promoter-mediated expression rate was tested in transgenic banana and tobacco plants and showed essentially constitutive expression in both plant species.
- the most common promoters for the expression of selection markers in plants are the nos promoter, but also the mas and ocs promoter, all of which have been isolated from Agrobacterium strains.
- the expression pattern of the two promoters Ubi-1 and Ubi-2 from maize is in Plant. Mol. Biol., (1992), 18 (4): 675-689. While the Ubi-1 promoter has good expression activity in maize and other monocotyledon plants, it shows in the dicotyledon tobacco plants only 10% of the activity which was achieved in comparable experiments with the 35S viral promoter.
- the maize Ubi-1 promoter is therefore suitable for the overexpression of genes in monocot plant systems. It is also sufficiently strong to mediate herbicide resistance by expression of selection markers [Christensen and Quail (1996) Transgenic Res 5 (3) .213-218]. However, the Ubi-1 promoter proved unsuitable for dicotyledon expression systems.
- WO01 / 18220 describes an ubiquitin regulator system which lacks the sweatshock elements, which means that it is no longer heat-inducible. This regulator system was developed based on the maize Ubi promoter system by removing the heat-inducible elements.
- Ubiquitins are omnipresent proteins that have been found in all eukaryotes analyzed so far.
- Kawalleck et al. [Plant Molecular Biology, 21, 1993: 673-684] described two parsley (Petroselinum crispum) ubiquitins ubi4-l and ubi4-2. The promoter was isolated from ubi4-2. Among those described by Kawalleck et al. No heat inducibility of ubi4-l and ubi4-2 could be shown under the conditions examined.
- the leaf-specific barley thionine promoter was inactive in the majority of the transformed lines, while the Arabidopsis UBQ1 promoter gave medium expression rates.
- McElroy and co-workers reported a construct based on the rice actin 1 (Actl) promoter for the transformation of monocotyledonous plants [McElroy et al. (1991) Mol Gen Genet 231: 150-1609]. Overall, it was concluded from the investigations described above that the expression vectors based on the Actl promoter are suitable for controlling a sufficiently strong and constitutive expression of foreign DNA in transformed cells of monocotyledonous plants.
- the promoter is also one
- WO 99/31258 describes chimeric, constitutive plant
- Promoters which are composed of different elements of different promoters with complementary expression patterns, so that the combination of individual tissue specificities leads additively to a constitutive expression pattern. This is a very complex process for the production of apparently constitutive promoters.
- promoters with specificities for the anthers ovaries, flowers, leaves, stems, roots and seeds have been described.
- the stringency of the specificity as well as the expression activity of these promoters is very different. Promoters that ensure leaf-specific expression are to be mentioned, such as the promoter of the cytosolic FBPase from potato (WO 97/05900), the SSU promoter (small subunit) of the Rubisco (ribulose-1, 5-bisphosphate carboxylase), the ST-LSI promoter from potatoes [Stockhaus et al.
- FNR promoter the predominantly leaf-specific ferredoxin NADPH oxidoreductase promoter which has a light-inducible element [Oelmüller et al. (1993) Mol. Gen. Genet. 237: 261-72] or the leaf-specific promoter of the triose phosphate translocator (TPT).
- promoters are, for example, promoters with specificity for tubers, storage roots or roots, such as, for example, the patatin promoter class I (B33), the promoter of the cathepsin D inhibitor from potato, the promoter of the starch synthase
- GBSS1 sporamine promoter
- fruit-specific promoters such as, for example, the fruit-specific promoter made of tomato (EP-A 409625), fruit-ripening-specific promoters, such as, for example, the fruit ripening-specific promoter made of tomato (WO 94/21794), flower-specific promoters, such as the phytoene synthase promoter (WO 92/16635) or the promoter of the P-rr gene (WO 98/22593).
- Promoters are described with tissue specificity for the mesophyll and pallisade cells in leaves (Broglie et al. (1984) Science 234: 838-845), the dividing shoot and the root meristem [Atanassova et al. (1992) Plant J 2: 291-300], pollen [Guerrero et al. (1990) Mol Gen Genet 224: 161-168], seed endosperm [Stalberg et al. (1993) Plant Mol Biol 23: 671-6839, lavenderepide ⁇ rtis [Suzuki et al. (1993) Plant Mol Biol 21: 109-119], as well as for the root meristem, root vessel tissue and root nodules [Bogusz et al. (1990) Plant Cell 2: 633-641].
- Promoters are also known which control expression in seeds and plant embryos.
- Seed-specific promoters are, for example, the promoter of phaseoline [US 5,504,200, Bustos MM et al. (1989) Plant Cell 1 (9): 839-53], 2S albuming [Joseffson LG et al. (1987) J Biol Chem 262: 12196-12201], leguminum [Shirsat A et al. (1989) Mol Gen Genet 215 (2): 326-331], of the USP [unknown seed protein; Baumlein H et al. (1991) Molecular & General Genetics 225 (3): 459-67] of the Napin gene [Stalberg K, et al.
- tissue-dependent expression pattern Because of the tissue-dependent expression pattern, the aforementioned tissue-specific promoters are poorly suited for the expression of selection markers. Here, a selection in as many tissue parts as possible is necessary to ensure an efficient selection.
- the so-called “constitutive" promoters described in the prior art have one or more of the following disadvantages:
- the known, so-called “constitutive” promoters often show a different level of expression depending on the tissue or cell type.
- the expression property is often strongly dependent on the insertion site of the host genome. This shows that the effects to be achieved by heterologous expression cannot be achieved to the same extent in the plant to the same extent. Underdosing or overdosing may occur. This can adversely affect plant growth or plant value.
- Promoters of viral origin can be influenced by virus infections of the transgenic plant and can then no longer express the desired property [Al-Kaff et al. (2000) Nature Biotechnology 18: 995-99]. Public acceptance of the use of promoters and elements from plant systems is higher than that of viral systems.
- the number of promoters suitable for the expression of selection markers in plants is small and they are usually of viral or bacterial origin.
- An ideal constitutive promoter should have as many of the following properties as possible:
- the object on which the present invention is based was therefore to provide a method for the stable expression of nucleic acids in transgenic plants under the control of a plant promoter which fulfills as many of the abovementioned properties as possible, above all a ubiquitous and development-independent (constitutive) expression of a expressing nucleic acid sequence - advantageously coding for a selection marker - mediated. Furthermore, the task was to provide a nucleic acid construct for the expression process that would allow the broadest possible expression of the expressed nucleic acid in various plant tissues enables one type of plant and is widely applicable in various plants.
- nucleic acid construct into a plant, which is formed from the nucleic acid to be expressed, which is under the control of the 5 'region of the promoter mentioned under a) or b), and the promoter
- the nucleic acid to be expressed in the method according to the invention can advantageously be functionally linked to further regulatory sequences 25.
- Expression in the sense of the method encompasses the transcription of the nucleic acid sequence to be expressed transgenically, but can - in the case of an open reading frame in "sense" orientation - also include the translation of the transcribed RNA of the transgenic nucleic acid sequence to be expressed into a corresponding polypeptide.
- GUS fusions ß-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
- the expression level is also preferred as a comparison value.
- nucleic acid sequence preferably those nucleic acid sequences which code for easily quantifiable proteins.
- Reporter proteins Schoenborn E, Groskreutz D. Mol Biotechnol. 1999; 13 (l): 29-44) such as "green fluorescence protein” (GFP) (Chui
- the method according to the invention advantageously leads to stable, strong expression of the nucleic acids in a very large number of individuals. That means the nucleic acid or the ones expressed in the method according to the invention
- nucleic acids (the singular should include the plural for the application and vice versa) is / are expressed very evenly within the transgenic plants regardless of their place of insertion and regardless of the tissue.
- gene silencing in which the nucleic acids or genes to be expressed by inter
- FIG. 1 shows the structure of a vector which is advantageously used. A comparison with the prior art, in which the GUS gene was connected behind the d35S promoter, can be seen in FIG. 3. The advantageous properties of the method are clearly shown.
- FIG. 3 shows the GUS staining of leaves of transgenic C24 Arabidopsis plants containing the GUS gene under the control of the d35S promoter.
- the d35S promoter also showed a different level of expression within a leaf of a plant, ie it shows a mosaic-like expression depending on the different situation within a leaf of a plant.
- the expression behavior under the control of the PcUbi4-2 promoter within a leaf of a plant is very homogeneous, which means that there is no mosaic-like expression. The method thus enables the strong, uniform expression of genes in stably transformed plants.
- Uniformly strong expression in the sense of the invention means that within a plant tissue at least 60%, advantageously at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, of the cells of a tissue have an expression of the nucleic acid.
- FIG. 4 shows the expression in the bud of a transgenic C24 Arabidopsis plant which contains the GUS gene under the control of the Pc-Ubi4-2 promoter from P. crispum.
- the dark gray areas show the expression of the ⁇ -glucoronidase.
- FIG. 5 shows the GUS coloration of the flower of a transgenic C24 Arabidopsis plant which contains the GUS gene under the control of the Pc-Ubi4-2 promoter from P. crispum.
- the dark gray areas are due to the enzymatic activity of the expressed ⁇ -glucoronidase.
- a strong expression can also be observed in the root in transgenic C24 Arabidopsis plants which contain the GUS gene under the control of the Pc-Ubi4-2 promoter from P. crispum, as can be seen in FIG. 6.
- the dark gray areas reflect the activity of the ⁇ -glucoronidase.
- FIG. 7 shows the GUS staining of seeds transgenic C24 Arabidopsis Plants that contain the GUS gene under the control of the Pc-Ubi4-2 promoter from P. crispum (middle and right) or under the control of the d35S promoter (left).
- the dark gray supernatant reflects the ⁇ -glucoronidase activity. It can clearly be seen that the Pc-Ubi4-2 promoter has a stronger activity in the seed than the d35S promoter.
- the method and the nucleic acid constructs according to the invention are therefore advantageously suitable for expressing a practically unlimited number of genes in plants such as monocotyledon or dicotyledonous plants, advantageously in dicotyledonous plants. Selection genes can advantageously be expressed in the method under the control of the advantageous promoter.
- the expression is advantageously constitutive, but induction via, for example, exposure to heat is conceivable.
- the HSE is within the intron range. This heat shock inducible element does not agree with the consensus sequences given by Mycogen 5 '-CTNGAANNTTCNAG-3' or CTGGAATNTTCTAGA-3 '(US 5,510,474) or with that of Drosophila (US 6,054,574, column 18, lines 59-64) agreed and was not recognized as HSE in a promoter analysis for plant-based cis-active elements with the website PLACE.
- the intron is located in the intron and not as described by Mycogen 5 'relative and thus upstream to the intron.
- FIG. 8 also shows the following further elements, which are the same as those described by Higo et al. [(1999) Plant cis-acting regulatory DNA elements (PLACE) database: 1999, Nucl. Acid. Res., Vol. 27, No.l, 297-300]:
- TATATATA A TATA box in the range 291 to 297 and thus at the expected distance from the start of transcription at position 237.
- the elements mentioned under a) to c) are marked in FIG. 8 by 15 boxes, the AACAAAC and CAAACAC boxes of the opposite strand being highlighted.
- the start of transcription is marked with an arrow.
- the promoter contains an intron immediately before the start of translation (positions 396 to 982, see FIG. 8). The intron is immediately followed (not specified) by the start codon ATG.
- the program also identified the following putative elements of the promoter:
- the specified TATA box (see FIG. 8) is essential for the function of the promoter. It should advantageously be in a range from -20 to -50, preferably from -25 to -35, at the start of the transcription.
- a sequence comparison between PcUbi4-2 and the Ubi promoter from maize shows that the genes of maize and P. crispum are identical at the nucleotide level to 66.1%, while the promoters are 26% identical, that is to say for AT-rich promoters no significant identity (gap opening penalty 15, gap extension penalty 6.66) [Altschul et al., 1990, J. Mol. Biol., 215: 403-410, Altschul et al. , 1997, Nucl. Acid Res., 25: 3389-3402]. The promoters are not found in each other in blast.
- the ubiquitin promoter advantageously used in the method according to the invention proved to be sufficiently strong to stably express nucleic acid sequences, in particular selection marker genes, in dicotyledons and monocotyledons in the genome of the plant. This is all the more surprising since the Arabidopsis thaliana ubiquitin promoter [Holtorf et al. (1995) Plant Mol Biol 29: 637-646] proved unsuitable.
- This advantageously used ubiquitin promoter can be further optimized for its task using methods which are known to the person skilled in the art. Those skilled in the art can use the in the examples isolate given assay using the ß-glucuronidase slightly improved mutants of the promoter.
- Mutations include substitutions, additions, deletions, inversions or insertions of one or more nucleotide residues.
- the present invention also includes those nucleotide sequences which are obtained by modification of the ubiquitin promoter according to SEQ ID NO: 1. The aim of such a modification may be to further narrow down the essential promoter sequence contained therein or e.g. also the insertion of further restriction enzyme interfaces, the removal of superfluous DNA or the addition of further sequences, for example further regulatory sequences.
- Transitions and transversions in question, techniques known per se, such as in vitro mutagenesis, "primer repair", restriction or ligation can be used. Through manipulations, such as Restriction, “chewing-back” or filling of overhangs for "blunt ends”, complementary ends of the fragments can be made available for the ligation. Analogous results can also be obtained using the polymerase chain reaction (PCR) using specific oligonucleotide primers.
- PCR polymerase chain reaction
- Functional equivalents or functional fragments derived from SEQ ID NO: 1, for example by substitution, insertion or deletion of nucleotides, have a homology of at least 30%, preferably 50%, preferably at least 70%, particularly preferably at least 90%, very particularly preferably at least 95%, and are characterized by essentially the same properties as the parsley ubiquitin promoter according to SEG ID NO: 1.
- non-essential sequences of the parsley promoter can be deleted without significantly impairing the promoter property.
- deletion variants represent functionally equivalent parts of the promoter described by SEQ ID NO: 1.
- the method according to the invention is advantageously used for the stable expression of nucleic acids in transgenic plants which are selected from the group consisting of a gene for a gene Selection marker, a reporter gene, an RNAi construct, an enzyme, a protein which mediates resistance to insects, viruses, bacteria, fungi or nematodes, a nucleic acid sequence or a protein which is resistant to drought, cold, heat or salt in plants mediates, an inhibitor, a lectin, an RNAase, a ribozyme, an antibody, a vaccine, a pharmaceutical, an "antifreezing" protein, a cytochrome P-450 protein, a transcription activator or repressor or a protein that involved in the biosynthesis of fine chemicals.
- the protein which is involved in the biosynthesis of fine chemicals is preferably a protein from the fatty acid metabolism, the amino acid metabolism, the vitamin metabolism, the carotenoid metabolism or the carbohydrate metabolism.
- genes or nucleic acids are to be expressed in the process according to the invention, these can also be expressed from parsley under the control of the ubiquitin promoter, or advantageously under the control of further promoters. These can be constitutive, inducible and / or tissue-specific.
- the nucleic acid construct used in the method is advantageously inserted between two T-DNA sections. This facilitates stable integration into the plant genome.
- the transgenic plant used in the process is a monocot or dicot plant, advantageously a dicot plant.
- Monocotyledons selected from the group consisting of corn, rice, triticale, wheat, rye, barley, oats, ryegrass or millet are examples of monocotyledonous plants.
- dicotyledonous plants for example, dicotyledons are selected from the group consisting of grass, evening primrose, canola, peanut, mullein, thistle, hazelnut, almond, macadamia, avocado, laurel, wild rose, pumpkin, pistachio, sesame, flax, sunflower, safflower, soybean , Borretseh, poppy seeds, mustard,
- nucleic acids used in the method according to the invention can be expressed constitutively or inducibly. Constitutive expression is preferred.
- the products resulting from the expression of the nucleic acids in the transgenic plants can be isolated from them after cultivation of the plants.
- the products from callus cultures, from fermentation cultures or from cultivated and harvested plants or parts of plants such as leaves, stems, roots, flowers or seeds can be isolated using methods known to those skilled in the art.
- fatty acid esters with polyunsaturated cis, C 2 n and / or C 2 fatty acid molecules may be mentioned as examples.
- These can be in the form of an oil or lipid, for example in the form of compounds such as sphingolipids, phosphoglycerides, lipids, glycolipids such as glycoshingolipid, phospholipids such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidyl, diacylglycerol acid glyceride, glycylglycerol acid glycerol, glycylglycerol acid, glycylglycerol acid, glycylglycerol acid Acetyl CoenzymA esters containing the polyunsatur
- the various aforementioned compounds (fatty acid esters and free fatty acids) in the plant are in an approximate distribution of 80 to 90% by weight triglycerides, 2 to 5% by weight diglycerides, 5 to 10% by weight monoglycerides, 1 up to 5% by weight of free fatty acids, 2 to 8% by weight of phospholipids, the sum of the various compounds adding up to 100% by weight.
- Linoleic acid (C18: 2), linolenic acid (C18: 3), arachidonic acid (ERA) or eicosapentaenoic acid (EPA) can advantageously be prepared and isolated in the process according to the invention.
- Plants belonging to the oil-producing plants that is to say used for the production of oils, such as oil-fruit plants which contain large amounts of lipid compounds, such as peanut, rapeseed, canola, sunflower, are advantageously used in the process according to the invention.
- Safflower poppy seeds, mustard, hemp, castor oil, olive, sesame, calendula, punica, Evening primrose, mullein, thistle, wild roses, hazelnut, almond, macadamia, avocado, laurel, pumpkin, flax, soy, pistachios, borage, trees (oil palm, coconut or walnut) or crops such as corn, wheat, rye, oats, triticale, Rice, barley, cotton, cassava, pepper, tagetes, solanaceae plants, such as potatoes, tobacco, aubergine and tomato, Vicia species, peas, alfalfa or bush plants (coffee, cocoa, tea), Salix species as well as perennial grasses and forage crops , Preferred plants are oil fruit plants, such as peanut, rapeseed, canola, sunflower, safflower (safflower), poppy, mustard, hemp, castor oil, calendula, punica, evening primrose
- Plants rich in C18: 2 and / or C18: 3 fatty acids such as sunflower, safflower, tobacco, mullein, sesame, cotton, pumpkin, poppy, evening primrose, walnut, flax, hemp, thistle or safflower are particularly preferred. Plants such as safflower, sunflower, poppy, evening primrose, walnut, flax or hemp are particularly preferred.
- nucleic acids when producing PUFAS, nucleic acids are expressed which code, for example, for polypeptides with ⁇ -5, ⁇ -6 desaturase or ⁇ -6 elongase activity.
- mixtures of the various aforementioned compounds or individual compounds such as EPA or ERA can be prepared in free or bound form.
- transgenic plants are also understood to mean plant cells, tissues, organs or whole plants which are suitable for the expression of nucleic acids.
- Cultivation means, for example, the cultivation of the transgenic plant cells, tissues or organs on a nutrient medium or the whole plant on or in a substrate, for example in hydroponics or on a field soil.
- nucleic acids can be used in the method according to the invention. These nucleic acids are advantageously derived from plants such as algae, diatoms, mosses or higher plants, but they can also come from microorganisms such as fungi, yeasts or animals such as nematodes, insects or humans.
- a transgenic plant is understood to mean that the nucleic acids used in the method are not stably integrated in their natural location in the genome of a plant; the nucleic acids can be expressed homologously or heterologously. Tansgen also means that the nucleic acids according to the invention are in their natural place in the genome of an organism, but that the sequence above the natural sequence was changed and / or that the regulatory sequences of the natural sequences were changed. Transgenic is preferably understood to mean the expression of the nucleic acids according to the invention at a non-natural location in the genome, that is to say a homologous or preferably heterologous expression of the nucleic acids is present.
- Transgenic plants which contain the nucleic acids expressed in the process according to the invention can be marketed directly without isolating the synthesized compounds.
- Plants in the process according to the invention are understood to mean all parts of plants, plant organs such as leaves, stems, roots, tubers or seeds or the entire plant.
- the semen comprises all parts of the semen such as the seminal shell, epidermis and sperm cells, endospe m or embyro tissue.
- the compounds produced in the process according to the invention can also be isolated from the plants in the form of the free products, for example their oils, fats, lipids and / or free fatty acids.
- Compounds made by this method can be harvested by harvesting the organisms either from the culture in which they grow or from the field.
- oils for example, this can be done in a manner known to those skilled in the art by pressing or extracting the plant parts, preferably the plant seeds.
- the oils, fats, lipids and / or free fatty acids can be obtained by cold pressing or cold pressing without the addition of heat by pressing.
- the seeds pretreated in this way can then be pressed or extracted with solvents such as warm hexane. The solvent is then removed again. In this way, more than 96% of the compounds produced in the process can be isolated.
- the products thus obtained are then processed further, that is to say refined. First, the plant mucilages and cloudy substances.
- degumming can be carried out enzymatically or, for example, chemically / physically by adding acid such as phosphoric acid.
- the free fatty acids are then removed by treatment with a base, for example sodium hydroxide solution.
- the product obtained is washed thoroughly with water to remove the lye remaining in the product and dried.
- the products are subjected to bleaching with, for example, bleaching earth or activated carbon.
- the product is still deodorized with steam, for example.
- the term "oil” or "fat” is understood to mean a fatty acid mixture which contains unsaturated, saturated, preferably esterified fatty acid (s).
- the oil or fat has a high proportion of unsaturated, non-conjugated esterified fatty acid (s), in particular linoleic acid, ⁇ -linolenic acid, dihomo- ⁇ -linolenic acid, arachidonic acid, ⁇ -linolenic acid, stearidonic acid, eicosatetraenoic acid or eicosapentaenoic acid.
- s unsaturated, non-conjugated esterified fatty acid
- the proportion of unsaturated esterified fatty acids is about 30%, more preferred is 50%, more preferred is 60%, 70%, 80% or more.
- the proportion of fatty acid after the fatty acids have been converted into the methyl esters can be determined by gas chromatography by transesterification.
- the oil or fat can contain various other saturated or unsaturated fatty acids. In particular, the proportion of the various fatty acids in the oil or fat can fluctuate depending on the starting plant.
- the polyunsaturated fatty acids containing can be liberated, for example via an alkali treatment, for example aqueous KOH or NaOH or acid hydrolysis, advantageously in the presence of an alcohol such as methanol or ethanol, or via an enzymatic cleavage and isolated via, for example Phase separation and subsequent acidification using, for example, H 2 S0 4 .
- the fatty acids can also be released directly without the workup described above.
- Another embodiment of the invention is the use of the transgenic plant or the products obtained from the plants in animal feed, foodstuffs, seeds, fine chemicals, cosmetics or pharmaceuticals.
- a further subject of the invention is a nucleic acid construct for the stable transgenic expression of nucleic acids in the aforementioned method according to the invention
- nucleic acid construct advantageously contains at least one further element selected from the following group:
- nucleic acid sequence to be expressed is functionally linked to further genetic control sequences, or
- nucleic acid construct contains additional functional elements
- a polylinker is present between the promoter and the nucleic acid sequence to be expressed, or
- the nucleic acid construct contains at least one further nucleic acid under the control of the promoter according to SEQ ID NO: 1 or a functional equivalent or equivalent fragment or another promoter.
- the T-DNA has a so-called right and left T-DNA border, which mediate the transfer of the area between them.
- Important for this transfer are two almost identical sequences of approximately 25 bp in length (right and left T-DNA border), which flank the T-DNA on the Ti plasmid and which are recognized by a nuclease encoded by a Ti plasmid. This nuclease is able to cut out a single strand of T-DNA from the plasmid, which is then stably inserted into the plant genome at any point. So can. any nucleic acid sequences can be inserted into the plant genome.
- the nucleic acid sequence to be expressed transgenically in the nucleic acid construct is selected from the group of nucleic acids consisting of a selection marker, a reporter gene, an RNAi construct, an enzyme, a protein which confers resistance to insects, viruses, bacteria, fungi or nematodes Nucleic acid sequence or a protein which confers resistance to drought, cold, heat or salt in plants, an inhibitor, a lectin, an RNAase, a ribozyme, an antibody, a vaccine, a pharmaceutical, an "antifreezing" protein, a cytochrome P-450 protein, a transcriptional activator or repressor or a protein involved in the biosynthesis of fine chemicals.
- the nucleic acids or nucleic acid constructs used in the process are stably integrated into the genome of the host cell after introduction into a plant cell or plant.
- the integration can be random or by recombination such that the native gene is replaced by the inserted copy, thereby modulating the production of the desired compound by the cell, or by using a gene in trans so that the gene is functionally linked to a functional expression unit which contains at least one sequence ensuring expression of a gene and at least one sequence ensuring polyadenylation of a functionally transcribed gene.
- the nucleic acids are advantageously introduced into the plants in a nucleic acid construct in the form of so-called multi-expression cassettes or constructs for the multiparallel expression of genes.
- the aim of the present invention is to integrate the nucleic acids or the codogenic gene segments in the genome of the plants.
- a certain codogenic gene segment can be integrated as a continuous coding sequence (ORF) or contain one or more introns. If the latter is the case, such sequences are usually spliced in the course of expression by the plant, the splicing pattern being able to correspond to that of the donor organism, but not necessarily so.
- the nucleic acids can be introduced into the extranuclear genome, e.g. the plastid genome, a plant. According to the invention, however, integration into the nuclear genome is preferred.
- nucleic acid or the codogenic gene segment can be determined; * The nucleic acid or the codogenic gene segment can be inherited as a characteristic of the plant, with nuclear integration according to Mendelian rules.
- the number of integrated copies of a nucleic acid or of a specific codogenic gene segment per cell is less than 20 and in most cases less than 10. Plants with cells which have about 1 to 5 copies and in particular 1 copy of a nucleic acid are preferred according to the invention or a specific codogenic gene segment.
- the number of copies per cell can be determined in a manner known per se by means of “Southern blot” analysis (extraction of the genomic DNA, restriction-enzymatic digestion, electrophoretic separation, membrane transfer, hybridization with labeled DNA-specific probe) or quantitative PCR.
- the advantageously heterologous nucleic acids or codogenic gene segments in the genome of the transgenic plants are flanked on one or preferably on both sides by T-DNA sequences, in particular Agrobacterium Ti plasmid sequences. This is also an expression of the stable integration according to the invention of the codogenic gene segments into the genome of the plants.
- nucleic acid construct according to the invention can then be inserted into a vector for introduction into the transgenic plant. But it can also be introduced directly into the plant.
- nucleic acids or nucleic acid constructs can be used for the genetic engineering modification of a broad spectrum of plants, so that this becomes a better or more efficient producer of one or more of the aforementioned products. This can improve production or production efficiency caused by the direct effect of the manipulation or an indirect effect of this manipulation.
- nucleic acid sequences used in the method are advantageously introduced into the plant in the form of a nucleic acid construct which enables stable expression of the nucleic acids in plants.
- nucleic acids for example, the functionalities for the desaturases used in the production of PUFAS and / or the nucleic acid sequences coding for the elongases are advantageously functionally linked with one or more regulatory signals to increase gene expression.
- upiquitin promoter can advantageously be used in these constructs instead of one or all of the stated and existing promoters or in combination with the mentioned or other promoters. These regulatory sequences are intended to enable targeted expression of the genes and protein expression.
- these regulatory sequences are sequences to which inducers or repressors bind and thus regulate the expression of the nucleic acid.
- the natural regulation of these sequences may still be present in front of the actual structural genes and may have been genetically modified so that the natural regulation has been switched off and the expression of the genes has been increased.
- the gene construct can also advantageously contain one or more so-called "enhancer sequences" functionally linked to the promoter, which enable increased expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 'end of the DNA sequences.
- the nucleic acids to be expressed can be in one or more copies in the expression cassette
- the promoter / terminator constructs mentioned above advantageously consist of at least two functional units such as a promoter and a terminator.
- further desired gene sequences such as targeting sequences, coding regions of further genes or parts thereof, etc. can be added between promoter and terminator. be inserted.
- promoters and terminators are used (USP promoter: Baeumlein et al., Mol Gen Genet, 1991, 225 (3): 459-67); OCS terminator: Gielen et al. EMBO J. 3 (1984) 835ff.) Isolated using the polymerase chain reaction and tailored with flanking sequences of your choice based on synthetic oligonucleotides.
- oligonucleotides can be used, for example:
- a promoter and a terminator are amplified via PCR. Then the terminator is cloned into a recipient plasmid and in a second step the promoter is inserted in front of the terminator.
- An expression cassette is thus obtained on a carrier plasmid.
- PUC19 can advantageously be used for this purpose, but the use of any other common vector is also possible.
- the DC3 promoter is described in Thomas, Plant Cell 1996,
- 35 263: 359-368 consists only of the region -117 to +26 which is why it is one of the smallest known seed-specific promoters.
- the expression cassettes can contain the same promoter several times or can be constructed using three different promoters.
- ubiquitin 0 promoter used in the process according to the invention (see SEQ ID NO: 1) and / or b) the 2.7 kB fragment of the LeB4 promoter and / or c) the phaseolin promoter and / or d) the constitutive v -ATPase cl promoter.
- the additional regulatory sequences or factors which are advantageously present in the nucleic acid construct can, as described above, preferably have a positive influence on the gene expression of the introduced genes and thereby increase them.
- the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or enhancers. Besides it is also possible to increase translation, for example, by improving the stability of the mRNA.
- the regulatory sequences or factors can preferably have a positive influence on the gene expression of the introduced genes and thereby increase it.
- the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers".
- an increase in translation is also possible, for example, by improving the stability of the mRNA.
- Genetic regulatory sequences also include the 5 'untranslated region, introns or the non-coding 3' region of genes. It has been shown that these can play a significant role in regulating gene expression. It has been shown that 5 'untranslated sequences can advantageously increase the transient stable expression of heterologous genes.
- promoters as in the CaMV / 35S plant promoters [Franck et al. , Cell 21 (1980) 285-294], PRP1 [Ward et al. , Plans. Mol. Biol. 22 (1993)], SSU, OCS, lib4, usp, STLS1, B33, nos or in the ubiquitin or phaseolin promoter.
- inducible promoters are also advantageous, such as those in EP-A-0 388 186 (benzylsulfonamide inducible), Plant J.
- Seed-specific promoters such as the USP promoter according to the embodiment, but also other promoters such as the LeB4, DC3, phaseolin or napin promoter are also advantageous. Further particularly advantageous promoters are seed-specific promoters which can be used for monocotyledonous or dicotyledonous plants and in US 5,608,152 (napin promoter from rapeseed), WO 98/45461 (oleosin promoter from Arobidopsis), US 5,504,200 (phaseolin promoter from Phaseolus vulgaris) ), WO 91/13980 (Brassica Bce4 promoter), by Baeumlein et al.
- promoters Plant J., 2, 2, 1992: 233-239 (LeB4 promoter from a legume) these promoters are suitable for dicotyledons.
- the following promoters are suitable, for example, for monocotyledons lpt-2 or lpt-1 promoter made from barley (WO 95/15389 and WO 95/23230), Hordein pro totor made from barley and other suitable promoters described in WO 99/16890.
- seed-specific promoters can be isolated both from dicotyledonous and from monocotyledonous plants.
- Amy 6-6 and Aleurain [US 5,677,474], Bce4 (rapeseed) [US 5,530,149], glycinin (soy) [EP 571 741], phosphoenol pyruvate carboxylase (soy) [JP 06/62870], ADR12-2 (soy) [ WO 98/08962], isocitrate lyase (rape) [US 5,689,040] or ⁇ -amylase (barley) [EP 781 849].
- Plant gene expression can also be facilitated via a chemically inducible promoter (see an overview in Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48: 89-108).
- Chemically inducible promoters are particularly suitable if it is desired that the gene expression be carried out in a time-specific manner. Examples of such promoters are a salicylic acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.
- each of the nucleic acids used in the method should be expressed under the control of its own, preferably a different promoter, since repeating sequence motifs relating to instability of the T-DNA or to recombination events or genes Can lead to silencing.
- the expression cassette is included advantageously constructed in such a way that a promoter is followed by a suitable interface for inserting the nucleic acid to be expressed, in a polylinker advantageously then optionally a terminator is located behind the polylinker. This sequence is repeated several times, preferably three, four or five times, so that up to five genes are brought together in one construct and can thus be introduced into the transgenic plant for expression.
- the sequence is advantageously repeated up to three times (see sequence listing SEQ ID NO: 2 to 6).
- the nucleic acid sequences are inserted for expression via the suitable interface, for example in the polylinker behind the promoter.
- Each nucleic acid sequence advantageously has its own promoter and possibly its own terminator. However, it is also possible to insert several nucleic acid sequences behind a promoter and possibly in front of a terminator.
- the insertion point or the sequence of the inserted nucleic acids in the expression cassette is not of critical importance, ie a nucleic acid sequence can be inserted in the first or last position in the cassette without the expression being significantly influenced thereby.
- Different promoters such as, for example, the parsley ubiquitin promoter, the USP, the LegB4 or the DC3 promoter and different terminators can advantageously be used in the expression cassette.
- Homologous recombination for stable integration is a relatively rare event in higher eukaryotes, especially in plants. Random integrations into the host genome predominate.
- One way of removing the randomly integrated sequences and thus enriching cell clones with a correct homologous recombination is to use a sequence-specific recombination system as described in US Pat. No. 6,110,736. This consists of three elements: two pairs of specific recombination sequences and a sequence-specific recombinase. This recombinase catalyzes recombination only between the two pairs of specific recombination sequences.
- One pair of these specific DNA sequences is located outside the DNA sequence to be integrated, ie outside the two homologous DNA sequences. In the case of a correct homologous recombination, these sequences are not transferred into the genome. In the case of accidental integration, they usually insert together with the rest of the construct. Using a special recombinase and a construct containing a second pair of the specific sequences, the randomly inserted sequences can be cut out or inverted by inversion. activated while the sequences correctly inserted via homologous recombination remain in the genome.
- a variety of sequence-specific recombination systems can be used, examples being the Cre / lox system of Bacteriophagen Pl, the FLP / FRT system of yeast, the gin recombinase of Mu Phage, the pin recombinase from E. coli and the R / RS system of called pSRI plasmids.
- the bacteriophage Pl Cre / lox and the yeast FLP / FRT system are preferred.
- the recombinase (Cre or FLP) interacts specifically with its respective recombination sequences (34bp lox sequence or 47bp FRT sequence) in order to delete or invert the intermediate sequences.
- the FLP / FRT and cre / lox recombinase system has already been used in plant systems (Odell et al., Mol. Gen. Genet., 223: 369-378, 1990.)
- the transcription of the introduced genes should advantageously be terminated by suitable terminators at the 3 'end of the introduced biosynthetic genes (behind the stop codon). You can use e.g. the OCSl Terminator. As for the promoters, different terminator sequences should be used for each gene.
- the nucleic acid construct can advantageously contain one or more so-called “enhancer sequences” functionally linked to the promoter, which enable increased transgenic expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 'end of the nucleic acid sequences to be expressed transgenically.
- the nucleic acid sequences to be expressed transgenically can be contained in one or more copies in the gene construct.
- Control sequences are also to be understood as those which enable homologous recombination or insertion into the genome of a host organism or which allow removal from the genome.
- homologous recombination for example, the natural promoter of a specific gene can be exchanged for the nucleic acid sequence to be expressed and / or the promoter.
- Methods such as cre / lox technology allow tissue-specific, possibly inducible removal of the expression cassette from the genome of the host organism (Sauer B. Methods. 1998; 14 (4): 381-92).
- certain flanking sequences are added to the target gene (lox sequences), which later enable removal using the cre recombinase.
- the nucleic acid construct can also comprise further genes which are to be introduced into the organisms. It is possible and beneficial in the host organism to introduce and express regulatory genes, such as genes for inducers, repressors or enzymes, which intervene in the regulation of one or more genes of a biosynthetic pathway by their enzyme activity. These genes can be of heterologous or homologous origin. Furthermore can be advantageous in
- Nucleic acid construct or gene construct may contain further biosynthesis genes of the fatty acid or lipid metabolism, or these genes may be on another or more further nucleic acid constructs.
- the above-mentioned desaturases in combination with elongases and other desaturases can be cloned into the nucleic acid constructs according to the invention and used to transform plants with the aid of Agrobacterium.
- Other transformation methods are the protoplast polyethylene glycol (PEG) method, the protoplast electroporation, the protoplast microinjection or the balistic methods.
- a selectable marker into the nucleic acid construct which, for example, provides resistance to a biocide (for example a herbicide), a metabolism inhibitor such as 2-deoxyglucose, to the successfully recombined cells. 6-phosphate (WO 98/45456) or an antibiotic.
- the selection marker allows the selection of the transformed cells from untransformed ones (McCormick et al., Plant Cell Reports 5 (1986), 81-84).
- selection markers are, for example, selectable markers such as biocides such as phosphinotricin, glyphosate, sulfonylurea and imidazolinone or bromoxynil; Metabolism inhibitor such as 2-deoxyglucose-6-phosphate or antibiotics such as kanamycin, G 418, bleomycin, hygromycin.
- biocides such as phosphinotricin, glyphosate, sulfonylurea and imidazolinone or bromoxynil
- Metabolism inhibitor such as 2-deoxyglucose-6-phosphate or antibiotics such as kanamycin, G 418, bleomycin, hygromycin.
- pathogen resistance genes such as insect, fungal, bacterial and / or virus resistance genes can also be advantageously used in the method according to the invention.
- pathogen resistance genes such as insect, fungal, bacterial and / or virus resistance genes can also be advantageously used in the method according to the invention.
- So-called metabolism inhibitors such as 2-deoxyglucose-6-phosphate (WO 98/45456) are also suitable as selection markers.
- reporter genes which code for easily quantifiable proteins and which, by means of their own color or enzyme activity, ensure an evaluation of the transformation efficiency, the expression site or the time.
- Genes coding for reporter proteins see also Schenborn E, Groskreutz D. Mol Biotechnol. 1999; 13 (l): 29-44) such as the "green fluorescence protein” (GFP) [Chui WL et al. , Curr Biol 1996, 6: 325-330; Leffel SM et al., Biotechniques. 23 (5): 12-8, 1997; Sheen et al. (1995) Plant Journal 8 (5): 777-784; Haseloff et al.
- GFP green fluorescence protein
- genes for enzymes such as the oxidoredetases, the transferases, the hydrolases, the lyases, the isomerases or ligases.
- the preferred enzymes are the hydrolases.
- Genes for pharmaceuticals such as for insulin or for the various mediators such as EPO or interferons can also be included.
- the regulatory sequences or factors can preferably have a positive influence on the gene expression of the introduced genes and thereby increase it.
- the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers".
- an increase in translation is also possible, for example, by improving the stability of the mRNA.
- the expression cassettes can be inserted directly can be used in the plant or introduced into a vector.
- vectors preferably expression vectors
- vector refers to a nucleic acid molecule that can transport another nucleic acid to which it is attached.
- plasmid which stands for a circular double-stranded DNA loop into which additional DNA segments can be ligated.
- viral vector Another type of vector is a viral vector, whereby additional DNA segments can be ligated into the viral genome.
- Certain vectors can replicate autonomously in a host cell into which they have been introduced (e.g. bacterial vectors with a bacterial origin of replication).
- vectors are advantageously integrated into the genome of a host cell when introduced into the host cell and are thereby replicated together with the host genome.
- certain vectors can control the expression of genes to which they are operably linked. These vectors are referred to here as "expression vectors".
- expression vectors suitable for recombinant DNA techniques are in the form of plasmids.
- plasmid and vector can be used interchangeably because the plasmid is the most commonly used vector form.
- the invention is intended to encompass these other expression vector forms, such as viral vectors, which perform similar functions.
- vector is also intended to include other vectors which are known to the person skilled in the art, such as phages, viruses such as SV40, CMV, TMV, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA.
- the recombinant nucleic acid construct which is advantageously used in the method and which is suitable for the stable expression of the nucleic acids used in a host cell comprises one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is functionally linked to the nucleic acid sequence to be expressed.
- “operably linked” means that the nucleotide sequence of interest is bound to the regulatory sequence (s) in such a way that expression of the nucleotide sequence is possible and they are linked to one another, so that both sequences have the predicted sequence ascribed to the sequence Perform function (for example in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).
- regulatory sequence is intended to encompass promoters, enhancers and other expression control elements (for example polyadenylation signals). These regulatory sequences are described, for example, in Goeddel: Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990), or see: Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnolgy, CRC Press, Boca Raton , Florida, ed. : Glick and Thompson, Chapter 7, 89-108, including the literature therein. Regulatory sequences include those that control the constitutive expression of a nucleotide sequence in many host cell types and those that control the direct expression of the nucleotide sequence only in certain host cells under certain conditions. The person skilled in the art knows that the design of the expression vector can depend on factors such as the selection of the host cell to be transformed, the extent of expression of the desired protein, etc.
- the recombinant nucleic acid constructs and vectors used can be used for stable expression in algae (Falciatore et al., 1999, Marine Biotechnology .1, 3: 239-251) and preferably in cells of multicellular plants (see Schmidt, R. and Willmitzer, L. (1988 ) "High efficiency Agrobacterium tu efaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants" Plant Cell Rep.: 583-586; Plant Molecular Biology and Biotechnology, C Press, Boca Raton, Florida, Chapter 6/7, Pp. 71-119 (1993); FF White, B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol.
- nucleic acid sequences used in single-cell plant cells such as algae
- plant cells from higher plants eg spermatophytes, such as crops
- plant expression vectors include those described in detail in: Becker, D., Kemper, E., Schell, J., and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border ", Plant Mol. Biol. 20: 1195-1197; and Bevan, MW (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12: 8711-8721; Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, ed. : Kung and R. Wu, Academic Press, 1993, pp. 15-38.
- a plant expression cassette preferably contains regulatory sequences which can control gene expression in plant cells and are operably linked so that each sequence can fulfill its function, such as termination of transcription, for example polyadenylation signals.
- Preferred polyadenylation signals are those derived from Agrobacterium tumefaciens-t-DNA, such as gene 3 of the Ti plasmid pTiACH5 known as octopine synthase (Gielen et al., EMBO J. 3 (1984) 835ff.) Or functional equivalents thereof, but all other terminators that are functionally active in plants are also suitable.
- a plant expression cassette preferably contains other functionally linked sequences, such as translation enhancers, for example the overdrive sequence, which is the 5 'untranslated leader sequence from tobacco mosaic virus which contains the protein / RNA ratio increased (Gallie et al., 1987, Nucl. Acids Research 15: 8693-8711).
- translation enhancers for example the overdrive sequence, which is the 5 'untranslated leader sequence from tobacco mosaic virus which contains the protein / RNA ratio increased (Gallie et al., 1987, Nucl. Acids Research 15: 8693-8711).
- the plant gene expression must be operably linked to a suitable promoter which carries out the gene expression in a timely, cell- or tissue-specific manner.
- suitable promoters are constitutive promoters (Benfey et al., EMBO J. 8 (1989) 2195-2202), such as those derived from plant viruses, such as 35S CAMV (Franck et al., Cell 21 (1980) 285-294), 19S CaMV (see also US 5352605 and WO 84/02913) or plant promoters, such as that of the small subunit of the Rubisco described in US 4,962,028. These can advantageously be combined with the parsley ubiquitin promoter in the process according to the invention.
- Chemically inducible promoters are particularly suitable if it is desired that the gene expression be carried out in a time-specific manner.
- Examples of such promoters are a salicylic acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.
- Promoters that react to biotic or abiotic stress conditions are also suitable promoters, for example the pathogen-induced PRPl gene promoter (Ward et al., Plant. Mol. Biol. 22 (1993) 361-366), the heat-inducible hsp80 promoter Tomato (US 5,187,267), the cold-inducible alpha amylase promoter from potato (WO 96/12814) or the wound-inducible pinII promoter (EP-A-0 375 091).
- Suitable promoters are the Napingen promoter from rapeseed (US 5,608,152), the USP promoter from Vicia faba (Baeumlein et al., Mol Gen Genet, 1991, 225 (3): 459-67), the oleosin
- Arabidopsis promoter (WO 98/45461), the Phaseolin promoter from Phaseolus vulgaris (US 5,504,200), the Bce4 promoter from Brassica (WO 91/13980) or the legumin B4 promoter (LeB4; Baeumlein et al., 1992 , Plant Journal, 2 (2): 233-9) and promoters which bring about the seed-specific expression in monocotyledonous plants, such as maize, barley, wheat, rye, rice, etc.
- Suitable noteworthy promoters are the lpt2 or lptl gene promoter from barley (WO 95/15389 and WO 95/23230) or those described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene , the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the Rye secalin gene).
- the multiparallel expression of the nucleic acid sequences used in the method may be desired alone or in combination with other genes.
- Such expression cassettes can be introduced via a simultaneous transformation of several individual expression constructs or, preferably, by combining several expression cassettes on one construct.
- Several vectors, each with several expression cassettes can also be transformed and transferred to the host cell.
- Promoters which bring about plastid-specific expression are also particularly suitable, since plastids are the compartment in which the precursors and some end products of lipid biosynthesis are synthesized.
- Suitable 5 promoters such as the viral RNA polymerase promoter, are described in WO 95/16783 and WO 97/06250, and the clpP promoter from Arabidopsis, described in WO 99/46394.
- the nucleic acid constructs or vectors can be introduced into plants 10 using conventional transformation techniques.
- the nucleic acid constructs or vectors can be introduced into plants 10 using conventional transformation techniques.
- transformation is intended to include a variety of methods known in the art for introducing foreign nucleic acid (e.g., DNA) into a host cell, including chemically mediated transfer, electroporation, or particle bombardment. Suitable methods for transforming or transfecting host cells, including plant cells, can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual., 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 20 1989) and other laboratory manuals, such as Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, eds: Gartland and Davey, Humana Press, Totowa, New Jersey.
- Host cells which in principle are used to take up the nucleic acid
- 25 nucleic acid construct according to the invention or the vector according to the invention are suitable, all plants or parts thereof, preferred plants are dicotyledonous or monocotyledonous plants such as rape, evening primrose, hemp, diesel, peanut, canola, flax, soy, safflower, sunflower, borage, or plants like corn, wheat,
- 35 selected transgenic plants according to the invention are selected from the group consisting of corn, rice, triticale, wheat, rye, barley, oats, ryegrass, millet, rapeseed, evening primrose, canola, peanut, mullein, thistle, hazelnut, almond, macadamia, avocado, Laurel, wild roses, pumpkin, pistachios, sesame, flax, sunflower,
- the promoter advantageously used in the method with the nucleotide sequence SEQ ID NO: 1, a functional equivalent or an equivalent fragment can be isolated using standard molecular biological techniques and the sequence information provided here.
- a homologous sequence or homologous, conserved sequence regions at the DNA or amino acid level can also be identified with the aid of comparison algorithms.
- These can be used as hybridization probes as well as standard hybridization techniques (as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) Isolation of further promoter sequences useful in the method can be used.
- nucleic acid molecule comprising a complete sequence of SEQ ID NO: 1 or a part thereof can be isolated by polymerase chain reaction, using oligonucleotide primers based on this sequence or parts thereof (for example comprising a nucleic acid molecule the entire sequence or a part thereof can be isolated by polymerase chain reaction using oligonucleotide primers which have been prepared on the basis of this same sequence).
- Methods for isolating genomic DNA from plants are known to the person skilled in the art.
- Promoters advantageous for the method according to the invention can be isolated on the basis of their homology to the nucleic acids disclosed here using the sequences or a part thereof as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
- isolated nucleic acid molecules can be used that are at least 18 nucleotides long and hybridize under stringent conditions with the nucleic acid molecules that comprise a nucleotide sequence of SEQ ID NO: 1. At least 25, 50, 100, 250 or more nucleotides can also advantageously be used.
- hybridizes under stringent conditions is intended to describe hybridization and washing conditions under which nucleotide sequences which are at least 60% homologous to one another usually remain hybridized to one another.
- the conditions are preferably such that sequences which are at least about 65%, more preferably at least about 70% and even more preferably at least about 75% or more homologous to one another usually remain hybridized to one another.
- stringent conditions are known to the person skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.
- a preferred, non-limiting example of stringent hybridization conditions are hybridizations in 6 x sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by one or more washing steps in 0.2 x SSC, 0.1% SDS at 50 to 65 ° C.
- hybridization conditions differ depending on the type of nucleic acid and, if organic solvents are present, for example, with regard to the temperature and the concentration of the buffer.
- the temperature differs for example under "standard hybridization conditions” depending on the type of nucleic acid between 42 and 58 ° C in aqueous buffer with a concentration of 0.1 to 5 x SSC (pH 7.2). If there is organic solvent in the above buffer, for example 50% formamide, the temperature is about 42 ° C under standard conditions.
- the hybridization conditions for DNA DNA hybrids are preferably, for example, 0.1 ⁇ SSC and 20 to 45 ° C., preferably between
- RNA hybrids are preferably, for example, 0.1 ⁇ SSC and 30 ° C. to 55 ° C., preferably between 45 ° C. and 55 ° C.
- the person skilled in the art knows how the required hybridization conditions are based on textbooks such as that mentioned above or from the following textbooks Sambrook et al. , Molecular Cloning, Cold Spring Harbor Laboratory, 1989; Harnes and Higgins (ed.) 1985,
- the sequences are written for the purpose of optimal comparison with one another (for example, gaps can be inserted into the sequence of one promoter in order to optimally align with the other protomotor and to generate the elements that are essential for the function such as the start of transcription or the TATA box).
- the nucleotides at the corresponding nucleotide positions are then compared. If a position in a sequence is occupied by the same nucleotide as the corresponding position in the other sequence, then the molecules at this position are homologous (ie nucleic acid "homology” as used here corresponds to nucleic acid "identity").
- Another object of the invention are transgenic plants which contain the nucleic acid construct according to the invention or the vector according to the invention.
- Example 1 Isolation of genomic DNA from Petroselinum crispum var. Hamburger section
- Hamburger cut was harvested and snap frozen in liquid nitrogen. 100 mg of material were homogenized in a mortar and isolated from the homogenate genomic DNA (gDNA) using Macherey and Nagel NucleoSpin Plant-Kit according to the manufacturer's instructions. The gDNA was taken up in 100 ul TE buffer. The concentration was then determined photometrically. The yield was 1.05 ⁇ g / ⁇ l.
- gDNA homogenate genomic DNA
- Example 2 Isolation of the promoter from genomic DNA by means of PCR
- oligonucleotides were derived.
- the oligos were derived from the sequence of base pairs 1 to 22 and 982 to 959.
- recognition sequences of restriction enzymes were added to the oligonucleotides.
- the sequence of the oligos was:
- PcUbi4-2fw gctctagaattcgaatccaaaaattacg
- PcUbi4-2rev gggctgcacatacataacatatcaaga
- the oligos were adjusted to a concentration of 20 ⁇ M and used in a PCR.
- the PCR approach contained:
- the 25 PCR mixture was cleaned according to the manufacturer's instructions using the Qiagen PCR cleaning kit.
- the DNA was then taken up in 30 ⁇ l of TE buffer and completely digested with Xbal (MBI-Fermentas).
- the restriction mixture contained: 30 ul DNA, 4 ul water, 4 ul buffer and 2 ul enzyme (MBI Fermentas). Was incubated overnight at 30 37 ° C.
- the fragment was cloned into a binary vector with an expression cassette and uidA as a reporter gene, which had previously been opened with the restriction enzymes Xbal, Smal (MBI Fermentas)
- the construct lbxPcUbi4-2GUS was transformed into the agrobacterial strain pGV3101 containing the plasmid pMP90 by means of electroporation and the colonies were plated on TB medium (QBiogen, Germany) containing the selection markers kanamycin, gentamycin and rifampicin and incubated at 28 ° C. for 2 days.
- the preculture grew for 48 hours at 28oC and 120 rpm in a shaking incubator. 400 ml LB medium with the corresponding antibiotics were used for the main culture. The preculture was transferred to the main culture, which grew for 18 hours at 28 ° C. and 120 rpm.
- the pellet was resuspended in infiltration medium (M&S medium with 10% sucrose).
- the seedlings were transferred to pots containing the same substrate (Teku pots, 10 cm 0, LC series, manufacturer Pöppelmann GmbH & Co, Germany). 9 plants were pricked into a pot. The pots were then put back into the short day phytotron for further growth. After 10 days they came into a greenhouse cabin 16 h 340 ⁇ E 22 ° C and 8 h dark 20 ° C. Here they continued to grow for 10 days.
- the harvested seeds were placed in the greenhouse and subjected to spray selection, or, after sterilization on agar plates, were grown with the respective selection agent. After about 10 to 14 days, the transformed resistant plants clearly differed from the dead wild-type seedlings and could be pricked into 6 cm pots.
- Example 9 Quantitative determination of the amount of GUS mRNA in 10 leaves of transgenic Arabidopsis plants
- the reagents for cDNA synthesis and Q-PCR reaction came from Applied Biosystems and were used according to the manufacturer's instructions. The analysis was carried out using quantitative PCR, TaqMan probes and the ABIPrism7700 (PE Aplied Biosystems) [Gibson et al. , (1996) A novel method for real time
- Oligol 5 'ccatctcataaataacgtcatgcattac 3' probe: 5 'tgtaaatcatcgcaagaccggcaacag 3' 01igo2: 5 'aacatttggcaataaagtttcttaaga 3' 30
- the probe was labeled with FAM (fluorescein), the quencher was TAMRA (rhodamine)
- a 35 probe system was used to compare the amount of total RNA used, which detects the mRNA of the ubiquitin-conjugating enzyme 18 (Ubil8):
- Oligol 5 'agttcacccgaaaagcaacg 3'
- Probe 5 'cccactgataatgatcgatatgtgaagaactgc 3'
- 01igo2 5 'cgtcatggaaccaccacct 3'
- the probe was marked with VIC (trade name), the quencher was TAMRA.
- the Ct value for Ubil8 mRNA determined for each plant was subtracted from the Ct value for GUS mRNA determined from the same reaction mixture.
- the delta Ct value calculated from this is a relative value and a measure of the amount of GUS mRNA which was contained in a certain amount of mRNA (Tab. 3).
- the Q-PCR is followed over 40 cycles. Samples with a Ct value of 40 are negative because they did not develop any fluorescence above the background even in the 40 cycle.
- Table 3 Ct values for Tl plants containing the constructs D35S35SGUS or PcUbi4-2GUS.
- Tl lines were selected from each construct to determine the expression of GUS in the progeny. To this end, 10 offspring were raised from each line and leaves were harvested 3 weeks after sowing, and the amount of GUS transcript was determined using qPCR as described.
- the fluctuation range within the T2 of a line is smaller in the progeny of the lbxPcUbiGUS plants (Tab. 4).
- Table 4 Determination of GUS expression in progeny of transgenic Arabidopsis plants. The median of the delta Ct values is given from the measurement of 10 T2 plants in each line and the range of the measured values.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Fruits And Vegetables (AREA)
Abstract
Description
Claims
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP03732500A EP1513938A1 (de) | 2002-06-04 | 2003-05-30 | Verfahren zur stabilen expression von nukleinsäuren in transgenen pflanzen unter der kontrolle eines petersilie-ubiquitin-promoters |
| US10/515,020 US8030539B2 (en) | 2002-06-04 | 2003-05-30 | Method for the stable expression of nucleic acids in transgenic plants, controlled by a parsley-ubiquitin promoter |
| CA2486392A CA2486392C (en) | 2002-06-04 | 2003-05-30 | Method for the stable expression of nucleic acids in transgenic plants, controlled by a parsley-ubiquitin promoter |
| AU2003238437A AU2003238437A1 (en) | 2002-06-04 | 2003-05-30 | Method for the stable expression of nucleic acids in transgenic plants, controlled by a parsley-ubiquitin promoter |
| NO20044949A NO20044949L (no) | 2002-06-04 | 2004-11-12 | Fremgangsmate for stabil ekspresjon av nukleinsyrer i transgene planter, kontrollert av en persille-ubikvitin promoter |
| IL165206A IL165206A (en) | 2002-06-04 | 2004-11-15 | Uses of a promoter isolated from parsley, nucleic acid structures for stable transgenic nucleic acid expression, and vectors containing the structures and transgenic plants undergoing transformation with them |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10224889A DE10224889A1 (de) | 2002-06-04 | 2002-06-04 | Verfahren zur stabilen Expression von Nukleinsäuren in transgenen Pflanzen |
| DE10224889.3 | 2002-06-04 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2003102198A1 true WO2003102198A1 (de) | 2003-12-11 |
Family
ID=29557540
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2003/005668 Ceased WO2003102198A1 (de) | 2002-06-04 | 2003-05-30 | Verfahren zur stabilen expression von nukleinsäuren in transgenen pflanzen unter der kontrolle eines petersilie-ubiquitin-promoters |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US8030539B2 (de) |
| EP (1) | EP1513938A1 (de) |
| AU (1) | AU2003238437A1 (de) |
| CA (1) | CA2486392C (de) |
| DE (1) | DE10224889A1 (de) |
| IL (1) | IL165206A (de) |
| NO (1) | NO20044949L (de) |
| WO (1) | WO2003102198A1 (de) |
Cited By (43)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006032426A3 (en) * | 2004-09-23 | 2006-07-20 | Basf Plant Science Gmbh | Recombination cassettes and methods for sequence excision in plants |
| WO2007107516A3 (en) * | 2006-03-17 | 2008-01-10 | Basf Plant Science Gmbh | D-amino acid selection for soybean |
| EP1953232A1 (de) | 2007-02-05 | 2008-08-06 | Empresa Brasileira de Pesquisa Agropecuaria - EMBRAPA | Zusammensetzung und Verfahren zur Modifizierung einer Genexpression mithilfe des Promotors für ein das Ubiquitin-konjugierendes Protein kodierendes Sojabohnengen |
| EP1953231A1 (de) | 2007-02-05 | 2008-08-06 | Empresa Brasileira de Pesquisa Agropecuaria - EMBRAPA | Zusammensetzungen und Verfahren zur Modifizierung der Genexpression mithilfe des Promotors für ein das Ubiquitin-konjugierende Protein kodierendes Baumwollengen |
| WO2008095910A1 (en) | 2007-02-08 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference of opr3-like gene for control of nematodes |
| WO2008095970A1 (en) | 2007-02-09 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference of cdpk-like for control of nematodes |
| WO2008112970A2 (en) | 2007-03-14 | 2008-09-18 | Pioneer Hi-Bred International, Inc. | Dominant gene suppression transgenes and methods of using same |
| EP2141239A1 (de) | 2003-12-16 | 2010-01-06 | Pioneer Hi-Bred International, Inc. | Gensuppression durch dominante Transgene und Methoden zur Verwendung |
| WO2010020552A1 (en) | 2008-08-20 | 2010-02-25 | Basf Plant Science Gmbh | Transgenic plants comprising as transgene a phosphatidate cytidylyltransferase |
| WO2010086277A2 (en) | 2009-01-28 | 2010-08-05 | Basf Plant Science Company Gmbh | Engineering nf-yb transcription factors for enhanced drought resistance and increased yield in transgenic plants |
| WO2010086220A1 (en) | 2009-01-28 | 2010-08-05 | Basf Plant Science Company Gmbh | Transgenic plants having altered nitrogen metabolism |
| WO2009149304A3 (en) * | 2008-06-04 | 2010-08-19 | Edenspace Systems Corporation | Plant gene regulatory elements |
| WO2010108836A1 (en) | 2009-03-23 | 2010-09-30 | Basf Plant Science Company Gmbh | Transgenic plants with altered redox mechanisms and increased yield |
| DE112008003224T5 (de) | 2007-11-27 | 2010-12-23 | Basf Plant Science Gmbh | Transgene Pflanzen mit erhöhter Stresstoleranz und erhöhtem Ertrag |
| WO2011023537A1 (en) | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2011064750A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| WO2011069953A1 (en) | 2009-12-09 | 2011-06-16 | Basf Plant Science Company Gmbh | Methods for increasing the resistance of plants to fungi by silencing the fungal smt1-gene |
| DE112009002061T5 (de) | 2008-08-27 | 2011-07-14 | BASF Plant Science GmbH, 67063 | Nematodenresistente transgene Pflanzen |
| DE112009002213T5 (de) | 2008-09-23 | 2011-07-28 | BASF Plant Science GmbH, 67063 | Transgene Pflanzen mit erhöhtem Ertrag |
| WO2012074868A2 (en) | 2010-12-03 | 2012-06-07 | Ms Technologies, Llc | Optimized expression of glyphosate resistance encoding nucleic acid molecules in plant cells |
| DE112009002342T5 (de) | 2008-10-23 | 2012-06-14 | Basf Plant Science Gmbh | Verfahren zum Herstellen einer transgenen Zelle mit erhöhtem Gehalt an gamma-Aminobuttersäure (GABA) |
| DE112010003389T5 (de) | 2009-08-25 | 2012-06-14 | Basf Plant Science Company Gmbh | Nematodenresistente transgene Pflanzen |
| WO2012084756A1 (en) | 2010-12-20 | 2012-06-28 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
| DE112009003576T5 (de) | 2008-12-11 | 2012-09-06 | Basf Plant Science Gmbh | Pflanzenwurzel-spezifische Nematodenresistenz |
| DE112010004584T5 (de) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Chimäre Endonukleasen und Anwendungen davon |
| WO2013116782A1 (en) | 2012-02-01 | 2013-08-08 | Dow Agrosciences Llc | Novel class of glyphosate resistance genes |
| WO2013138358A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013138309A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2014117988A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp7 |
| WO2014117990A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp6 |
| WO2014118018A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing ein2 |
| WO2014135682A1 (en) | 2013-03-08 | 2014-09-12 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing mybtf |
| WO2014143996A2 (en) | 2013-03-15 | 2014-09-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods of use of acc oxidase polynucleotides and polypeptides |
| WO2014160122A1 (en) | 2013-03-14 | 2014-10-02 | Pioneer Hi-Bred International, Inc. | Maize stress related transcription factor 18 and uses thereof |
| US9150871B2 (en) | 2009-08-31 | 2015-10-06 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific and/or seed-preferential gene expression in plants |
| US9428757B2 (en) | 2009-08-31 | 2016-08-30 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| WO2020229241A1 (en) | 2019-05-10 | 2020-11-19 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021007284A2 (en) | 2019-07-11 | 2021-01-14 | The Regents Of The University Of California | Methods for improved regeneration of transgenic plants using growth-regulating factor (grf), grf-interacting factor (gif), or chimeric grf-gif genes and proteins |
| WO2021048316A1 (en) | 2019-09-12 | 2021-03-18 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021069387A1 (en) | 2019-10-07 | 2021-04-15 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021110582A1 (en) | 2019-12-03 | 2021-06-10 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2024083579A1 (en) | 2022-10-20 | 2024-04-25 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1926820A2 (de) * | 2005-09-13 | 2008-06-04 | BASF Plant Science GmbH | Neues auswahlsystem für weizen |
| US7622573B2 (en) * | 2006-01-17 | 2009-11-24 | Biolex, Inc. | Expression control elements from the lemnaceae family |
| DE102008042050A1 (de) | 2008-09-12 | 2010-03-18 | Robert Bosch Gmbh | Leistungs-Steckkontakt sowie Leiterplattenanordnung |
| WO2017128039A1 (zh) * | 2016-01-26 | 2017-08-03 | 浙江大学 | 基因组合及其用途 |
| CN109504680B (zh) * | 2019-01-25 | 2022-11-18 | 湖南农业大学 | 盐胁迫诱导型启动子及其引物、表达载体和应用 |
| CN121380167A (zh) * | 2025-11-27 | 2026-01-23 | 安徽省农业科学院蔬菜研究所 | 基于usp1基因编辑的番茄抗灰霉病育种方法及应用 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5659026A (en) * | 1995-03-24 | 1997-08-19 | Pioneer Hi-Bred International | ALS3 promoter |
| US6177611B1 (en) * | 1998-02-26 | 2001-01-23 | Pioneer Hi-Bred International, Inc. | Maize promoters |
| US6365728B1 (en) * | 1997-04-04 | 2002-04-02 | Purdue Research Foundation | Regulatory element for expressing genes in plants |
| WO2003008596A2 (de) * | 2001-07-13 | 2003-01-30 | Sungene Gmbh & Co. Kgaa | Expressionskassetten zur transgenen expression von selektionsmarkern |
| US6528701B1 (en) * | 1999-03-02 | 2003-03-04 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Rice ubiquitin-derived promoters |
Family Cites Families (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5352605A (en) * | 1983-01-17 | 1994-10-04 | Monsanto Company | Chimeric genes for transforming plant cells using viral promoters |
| US5504200A (en) * | 1983-04-15 | 1996-04-02 | Mycogen Plant Science, Inc. | Plant gene expression |
| ES2060765T3 (es) * | 1988-05-17 | 1994-12-01 | Lubrizol Genetics Inc | Sistema promotor de ubiquitina en plantas. |
| IL95132A0 (en) | 1989-07-19 | 1991-06-10 | Calgene Inc | Fruit-specific transcriptional factors |
| GB9005772D0 (en) | 1990-03-14 | 1990-05-09 | Cambridge Advanced Tech | Plant promoter |
| GB9105420D0 (en) | 1991-03-14 | 1991-05-01 | Ici Plc | Expression of genes in transgenic plants |
| US5612472A (en) * | 1992-01-09 | 1997-03-18 | Sandoz Ltd. | Plant promoter |
| CA2158473A1 (en) | 1993-03-22 | 1994-09-29 | Umi Kalsom Abu-Bakar | Dna, dna constructs, cells and plants derived therefrom |
| CA2225553A1 (en) | 1995-08-03 | 1997-02-20 | Rijksuniversiteit Te Leiden | Cell derived antigen presenting vesicles |
| US5767379A (en) * | 1995-11-06 | 1998-06-16 | John Howard | Commercial production of avidin in plants |
| US5955361A (en) | 1996-11-20 | 1999-09-21 | Pioneer Hi-Bred International, Inc. | P gene promoter constructs for floral-tissue preferred gene expression |
| WO1998034819A1 (en) * | 1997-02-07 | 1998-08-13 | Lace Effect, Llc. | Anti-theft vehicle system |
| EP0975777A1 (de) * | 1997-03-07 | 2000-02-02 | Prodigene, Inc. | Verfahren zur kommerziellen produktion und extraktion von proteinen aus pflanzlichen samen |
| DE19852195C2 (de) | 1998-11-04 | 2000-11-02 | Inst Pflanzengenetik & Kultur | Neue Expressionskassette zur Expression von beliebigen Genen in Pflanzensamen |
| EP1141355B1 (de) | 1998-12-21 | 2007-12-05 | E.I. Du Pont De Nemours And Company | S-adenosyl-l-methionin synthetase promotor und dessen verwendung zur transgen-expression in pflanzen |
| ES2265978T3 (es) | 1999-09-09 | 2007-03-01 | Monsanto Uk Ltd. | Sistema regulador de ubiquitina modificado. |
-
2002
- 2002-06-04 DE DE10224889A patent/DE10224889A1/de not_active Withdrawn
-
2003
- 2003-05-30 EP EP03732500A patent/EP1513938A1/de not_active Ceased
- 2003-05-30 AU AU2003238437A patent/AU2003238437A1/en not_active Abandoned
- 2003-05-30 US US10/515,020 patent/US8030539B2/en not_active Expired - Lifetime
- 2003-05-30 WO PCT/EP2003/005668 patent/WO2003102198A1/de not_active Ceased
- 2003-05-30 CA CA2486392A patent/CA2486392C/en not_active Expired - Lifetime
-
2004
- 2004-11-12 NO NO20044949A patent/NO20044949L/no not_active Application Discontinuation
- 2004-11-15 IL IL165206A patent/IL165206A/en active IP Right Grant
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5659026A (en) * | 1995-03-24 | 1997-08-19 | Pioneer Hi-Bred International | ALS3 promoter |
| US6365728B1 (en) * | 1997-04-04 | 2002-04-02 | Purdue Research Foundation | Regulatory element for expressing genes in plants |
| US6177611B1 (en) * | 1998-02-26 | 2001-01-23 | Pioneer Hi-Bred International, Inc. | Maize promoters |
| US6528701B1 (en) * | 1999-03-02 | 2003-03-04 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Rice ubiquitin-derived promoters |
| WO2003008596A2 (de) * | 2001-07-13 | 2003-01-30 | Sungene Gmbh & Co. Kgaa | Expressionskassetten zur transgenen expression von selektionsmarkern |
Non-Patent Citations (10)
| Title |
|---|
| BINET M-N ET AL: "ANALYSIS OF A SUNFLOWER POLYUBIQUITIN PROMOTER BY TRANSIENT EXPRESSION", PLANT SCIENCE (LIMERICK), vol. 79, no. 1, 1991, pages 87 - 94, XP009016692, ISSN: 0168-9452 * |
| CHRISTENSEN A H ET AL: "MAIZE POLYUBIQUITIN GENES: STRUCTURE, THERMAL PERTURBATION OF EXPRESSION AND TRANSCRIPT SPLICING, AND PROMOTER ACTIVITY FOLLOWING TRANSFER TO PROTOPLASTS BY ELECTROPORATION", PLANT MOLECULAR BIOLOGY, NIJHOFF PUBLISHERS, DORDRECHT, NL, vol. 18, no. 4, 1992, pages 675 - 689, XP009002808, ISSN: 0167-4412 * |
| CUSHMAN JOHN C ET AL: "Expression of a phosphoenolpyruvate carboxylase promoter from Mesembryanthemum crystallinum is not salt-inducible in mature transgenic tobacco.", PLANT MOLECULAR BIOLOGY, vol. 21, no. 3, 1993, pages 561 - 566, XP009016691, ISSN: 0167-4412 * |
| HILL-AMBROZ KRISTI L ET AL: "Comparison of constitutive promoters for Sorghum (Sorghum bicolor (L.) Moench) transformation.", CEREAL RESEARCH COMMUNICATIONS, vol. 29, no. 1-2, 2001, pages 17 - 24, XP001153699, ISSN: 0133-3720 * |
| HILL-AMBROZ KRISTI L ET AL: "Constitutive promoter expression of transgenes in wheat (Triticum aestivum).", CEREAL RESEARCH COMMUNICATIONS, vol. 29, no. 1-2, 2001, pages 9 - 16, XP001153700, ISSN: 0133-3720 * |
| HOLTORF S ET AL: "COMPARISON OF DIFFERENT CONSTITUTIVE AND INDUCIBLE PROMOTERS FOR THE OVEREXPRESSION OF TRANSGENES IN ARABIDOPSIS THALIANA", PLANT MOLECULAR BIOLOGY, NIJHOFF PUBLISHERS, DORDRECHT, NL, vol. 29, 1 November 1995 (1995-11-01), pages 637 - 646, XP002036874, ISSN: 0167-4412 * |
| KAWALLEK P ET AL: "Polyubiquitin gene expression and structural properties of the ubi4-2 gene in Petroselinum crispum", PLANT MOLECULAR BIOLOGY, NIJHOFF PUBLISHERS, DORDRECHT, NL, vol. 21, no. 4, February 1993 (1993-02-01), pages 673 - 684, XP002130818, ISSN: 0167-4412 * |
| See also references of EP1513938A1 * |
| WANG JIANLIN ET AL: "Structure, expression and promoter activity of two polyubiquitin genes from rice (Oryza sativa L.).", PLANT SCIENCE (SHANNON), vol. 156, no. 2, 28 July 2000 (2000-07-28), pages 201 - 211, XP002259295, ISSN: 0168-9452 * |
| ZHANG ET AL: "Analysis of rice act1 5' region activity in transgenic rice", PLANT CELL, AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD, US, vol. 3, no. 3, November 1991 (1991-11-01), pages 1155 - 1165, XP002118813, ISSN: 1040-4651 * |
Cited By (78)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2141239A1 (de) | 2003-12-16 | 2010-01-06 | Pioneer Hi-Bred International, Inc. | Gensuppression durch dominante Transgene und Methoden zur Verwendung |
| AU2005287547B2 (en) * | 2004-09-23 | 2010-09-02 | Basf Plant Science Gmbh | Recombination cassettes and methods for sequence excision in plants |
| WO2006032426A3 (en) * | 2004-09-23 | 2006-07-20 | Basf Plant Science Gmbh | Recombination cassettes and methods for sequence excision in plants |
| WO2007107516A3 (en) * | 2006-03-17 | 2008-01-10 | Basf Plant Science Gmbh | D-amino acid selection for soybean |
| US8071383B2 (en) | 2006-03-17 | 2011-12-06 | Basf Plant Science Gmbh | D-amino acid selection for soybean |
| EP1953232A1 (de) | 2007-02-05 | 2008-08-06 | Empresa Brasileira de Pesquisa Agropecuaria - EMBRAPA | Zusammensetzung und Verfahren zur Modifizierung einer Genexpression mithilfe des Promotors für ein das Ubiquitin-konjugierendes Protein kodierendes Sojabohnengen |
| EP1953231A1 (de) | 2007-02-05 | 2008-08-06 | Empresa Brasileira de Pesquisa Agropecuaria - EMBRAPA | Zusammensetzungen und Verfahren zur Modifizierung der Genexpression mithilfe des Promotors für ein das Ubiquitin-konjugierende Protein kodierendes Baumwollengen |
| US9012720B2 (en) | 2007-02-05 | 2015-04-21 | Empresa Brasileira De Pesquisa Agropecuaria | Compositions and methods for modifying gene expression using the promoter of ubiquitin conjugating protein coding gene of soybean plants |
| US8227588B2 (en) | 2007-02-05 | 2012-07-24 | Empresa Brasileira De Pesquisa Agropecuaria | Compositions and methods for modifying gene expression using the promoter of ubiquitin conjugating protein coding gene of cotton plants |
| WO2008095910A1 (en) | 2007-02-08 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference of opr3-like gene for control of nematodes |
| WO2008095970A1 (en) | 2007-02-09 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference of cdpk-like for control of nematodes |
| WO2008112970A2 (en) | 2007-03-14 | 2008-09-18 | Pioneer Hi-Bred International, Inc. | Dominant gene suppression transgenes and methods of using same |
| DE112008003224T5 (de) | 2007-11-27 | 2010-12-23 | Basf Plant Science Gmbh | Transgene Pflanzen mit erhöhter Stresstoleranz und erhöhtem Ertrag |
| WO2009149304A3 (en) * | 2008-06-04 | 2010-08-19 | Edenspace Systems Corporation | Plant gene regulatory elements |
| WO2010020552A1 (en) | 2008-08-20 | 2010-02-25 | Basf Plant Science Gmbh | Transgenic plants comprising as transgene a phosphatidate cytidylyltransferase |
| DE112009001976T5 (de) | 2008-08-20 | 2011-07-14 | BASF Plant Science GmbH, 67063 | Transgene Pflanzen mit erhöhtem Ertrag |
| EP2695944A2 (de) | 2008-08-20 | 2014-02-12 | BASF Plant Science GmbH | Transgene Pflanze mit erhöhtem Ertrag |
| DE112009002061T5 (de) | 2008-08-27 | 2011-07-14 | BASF Plant Science GmbH, 67063 | Nematodenresistente transgene Pflanzen |
| DE112009002213T5 (de) | 2008-09-23 | 2011-07-28 | BASF Plant Science GmbH, 67063 | Transgene Pflanzen mit erhöhtem Ertrag |
| DE112009002342T5 (de) | 2008-10-23 | 2012-06-14 | Basf Plant Science Gmbh | Verfahren zum Herstellen einer transgenen Zelle mit erhöhtem Gehalt an gamma-Aminobuttersäure (GABA) |
| EP2527450A1 (de) | 2008-12-11 | 2012-11-28 | BASF Plant Science GmbH | Pflanzenwurzelspezifische Nematodenresistenz |
| DE112009003576T5 (de) | 2008-12-11 | 2012-09-06 | Basf Plant Science Gmbh | Pflanzenwurzel-spezifische Nematodenresistenz |
| WO2010086277A2 (en) | 2009-01-28 | 2010-08-05 | Basf Plant Science Company Gmbh | Engineering nf-yb transcription factors for enhanced drought resistance and increased yield in transgenic plants |
| WO2010086220A1 (en) | 2009-01-28 | 2010-08-05 | Basf Plant Science Company Gmbh | Transgenic plants having altered nitrogen metabolism |
| DE112010000693T5 (de) | 2009-01-28 | 2012-11-22 | Basf Plant Science Company Gmbh | Transgene Pflanzen mit verändertem Stickstoffmetabolismus |
| DE112010000749T5 (de) | 2009-01-28 | 2012-08-30 | Basf Plant Science Company Gmbh | Gentechnische Bearbeitung von NF-YB-Transkriptionsfaktoren für gesteigerte Trockenheitsresistenz und erhöhten Ertrag in transgenen Pflanzen |
| WO2010108836A1 (en) | 2009-03-23 | 2010-09-30 | Basf Plant Science Company Gmbh | Transgenic plants with altered redox mechanisms and increased yield |
| DE112010001241T5 (de) | 2009-03-23 | 2012-05-16 | Basf Plant Science Company Gmbh | Transgene Pflanzen mit geändertem Redox-Mechanismus und erhöhtem Ertrag |
| DE112010003389T5 (de) | 2009-08-25 | 2012-06-14 | Basf Plant Science Company Gmbh | Nematodenresistente transgene Pflanzen |
| AU2016202274B2 (en) * | 2009-08-31 | 2017-09-28 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| EP3581657A2 (de) | 2009-08-31 | 2019-12-18 | Basf Plant Science Company GmbH | Regulatorische nukleinsäuremoleküle für erhöhte konstitutive genexpression bei pflanzen |
| DE112010003500T5 (de) | 2009-08-31 | 2012-06-14 | Basf Plant Science Company Gmbh | Regulatorische Nukleinsäuremoleküle für die Verstärkung der konstitutiven Genexpression in Pflanzen |
| US12351807B2 (en) | 2009-08-31 | 2025-07-08 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| US11708578B2 (en) | 2009-08-31 | 2023-07-25 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| CN102482684A (zh) * | 2009-08-31 | 2012-05-30 | 巴斯夫植物科学有限公司 | 用于增强植物中组成型基因表达的调节性核酸分子 |
| CN109468339B (zh) * | 2009-08-31 | 2022-11-04 | 巴斯夫植物科学有限公司 | 用于增强植物中组成型基因表达的调节性核酸分子 |
| US10689657B2 (en) | 2009-08-31 | 2020-06-23 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| EP3581657A3 (de) * | 2009-08-31 | 2020-03-18 | Basf Plant Science Company GmbH | Regulatorische nukleinsäuremoleküle für erhöhte konstitutive genexpression bei pflanzen |
| CN109468339A (zh) * | 2009-08-31 | 2019-03-15 | 巴斯夫植物科学有限公司 | 用于增强植物中组成型基因表达的调节性核酸分子 |
| US10041082B2 (en) | 2009-08-31 | 2018-08-07 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific and/or seed-preferential gene expression in plants |
| US10041081B2 (en) | 2009-08-31 | 2018-08-07 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific and/or seed-preferential gene expression in plants |
| US10041083B2 (en) | 2009-08-31 | 2018-08-07 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific and/or seed-preferential gene expression in plants |
| US9970019B2 (en) | 2009-08-31 | 2018-05-15 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific and/or seed-preferential gene expression in plants |
| US9828607B2 (en) | 2009-08-31 | 2017-11-28 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| WO2011023537A1 (en) | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| EP3153585A3 (de) * | 2009-08-31 | 2017-07-05 | BASF Plant Science Company GmbH | Regulatorische nukleinsäuremoleküle für erhöhte konstitutive genexpression bei pflanzen |
| EP3153585A2 (de) | 2009-08-31 | 2017-04-12 | BASF Plant Science Company GmbH | Regulatorische nukleinsäuremoleküle für erhöhte konstitutive genexpression bei pflanzen |
| US9428757B2 (en) | 2009-08-31 | 2016-08-30 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| AU2010288758B2 (en) * | 2009-08-31 | 2016-02-04 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| CN102482684B (zh) * | 2009-08-31 | 2015-11-25 | 巴斯夫植物科学有限公司 | 用于增强植物中组成型基因表达的调节性核酸分子 |
| US9150871B2 (en) | 2009-08-31 | 2015-10-06 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific and/or seed-preferential gene expression in plants |
| DE112010004583T5 (de) | 2009-11-27 | 2012-10-18 | Basf Plant Science Company Gmbh | Chimäre Endonukleasen und Anwendungen davon |
| DE112010004582T5 (de) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Optimierte Endonukleasen und Anwendungen davon |
| DE112010004584T5 (de) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Chimäre Endonukleasen und Anwendungen davon |
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2011064750A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| WO2011069953A1 (en) | 2009-12-09 | 2011-06-16 | Basf Plant Science Company Gmbh | Methods for increasing the resistance of plants to fungi by silencing the fungal smt1-gene |
| WO2012074868A2 (en) | 2010-12-03 | 2012-06-07 | Ms Technologies, Llc | Optimized expression of glyphosate resistance encoding nucleic acid molecules in plant cells |
| DE112011104462T5 (de) | 2010-12-20 | 2013-09-12 | Basf Plant Science Company Gmbh | Nematodenresistente transgene Pflanzen |
| WO2012084756A1 (en) | 2010-12-20 | 2012-06-28 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
| WO2013116700A1 (en) | 2012-02-01 | 2013-08-08 | Dow Agrosciences Llc | Glyphosate resistant plants and associated methods |
| WO2013116782A1 (en) | 2012-02-01 | 2013-08-08 | Dow Agrosciences Llc | Novel class of glyphosate resistance genes |
| EP3470522A2 (de) | 2012-02-01 | 2019-04-17 | Dow AgroSciences LLC | Neuartige klasse von glyphosatresistenzgenen |
| EP3219200A1 (de) | 2012-02-01 | 2017-09-20 | Dow Agrosciences Llc | Glyphosatresistente pflanzen und zugehörige verfahren |
| WO2013138309A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013138358A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2014117988A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp7 |
| WO2014117990A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp6 |
| WO2014118018A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing ein2 |
| WO2014135682A1 (en) | 2013-03-08 | 2014-09-12 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing mybtf |
| WO2014160122A1 (en) | 2013-03-14 | 2014-10-02 | Pioneer Hi-Bred International, Inc. | Maize stress related transcription factor 18 and uses thereof |
| WO2014143996A2 (en) | 2013-03-15 | 2014-09-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods of use of acc oxidase polynucleotides and polypeptides |
| WO2020229241A1 (en) | 2019-05-10 | 2020-11-19 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021007284A2 (en) | 2019-07-11 | 2021-01-14 | The Regents Of The University Of California | Methods for improved regeneration of transgenic plants using growth-regulating factor (grf), grf-interacting factor (gif), or chimeric grf-gif genes and proteins |
| WO2021048316A1 (en) | 2019-09-12 | 2021-03-18 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021069387A1 (en) | 2019-10-07 | 2021-04-15 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021110582A1 (en) | 2019-12-03 | 2021-06-10 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2024083579A1 (en) | 2022-10-20 | 2024-04-25 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1513938A1 (de) | 2005-03-16 |
| US8030539B2 (en) | 2011-10-04 |
| IL165206A0 (en) | 2005-12-18 |
| CA2486392C (en) | 2015-03-24 |
| NO20044949L (no) | 2005-01-26 |
| IL165206A (en) | 2015-11-30 |
| AU2003238437A1 (en) | 2003-12-19 |
| DE10224889A1 (de) | 2003-12-18 |
| CA2486392A1 (en) | 2003-12-11 |
| US20070006347A1 (en) | 2007-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1513938A1 (de) | Verfahren zur stabilen expression von nukleinsäuren in transgenen pflanzen unter der kontrolle eines petersilie-ubiquitin-promoters | |
| AU2015286221B2 (en) | Processes for producing industrial products from plant lipids | |
| AU2017320470B2 (en) | Plants with modified traits | |
| AU2023202628A1 (en) | Plants with modified traits | |
| AU2009222578B2 (en) | Novel plant promoters for use in early seed development | |
| EP1356056A2 (de) | Verfahren zur expression von biosynthesegenen in pflanzlichen samen unter verwendung von neuen multiplen expressionskonstrukten | |
| WO2003095655A2 (de) | Verfahren zum erhöhen des ölgehaltes in pflanzen | |
| DE112010003162T5 (de) | Gesamtsamen-spezifischer Promotor | |
| KR20140130506A (ko) | 사탕수수 바실루스형 바이러스 (scbv) 인핸서 및 식물 기능성 유전체학에서의 이의 용도 | |
| AU2024202648A1 (en) | Plant regulatory elements and uses therefor | |
| CN112969792A (zh) | 用于在植物中产生高水平pufa的改进方法 | |
| CN102070706B (zh) | 与种子脂肪酸合成相关的蛋白AtL1L及其编码基因与应用 | |
| EP1346046B1 (de) | Elongase promotoren | |
| Liu et al. | Isolation and functional characterization of seed-specific FAD2-1 promoter from cotton (Gossypium hirsutum L) | |
| DE10212893A9 (de) | Verfahren zum Erhöhen des Ölgehaltes in Pflanzen | |
| CN113412332A (zh) | 用于在植物中产生高水平pufa的改进方法 | |
| Caiyin et al. | Isolation and sequencing analysis on the seed-specific promoter from soybean | |
| Xie et al. | Molecular cloning and characterization of an achene-seed-specific promoter from motherwort (Leonurus japonicus Houtt) | |
| CN102250895A (zh) | 植物胚特异性表达启动子及其应用 | |
| WO2020049157A1 (en) | Improved method for the production of high levels of pufa in plants | |
| WO2002034924A2 (de) | Expressionskassetten zur transgenen expression von nukleinsäuren in der pflanzlichen embryonalen epidermis und der blüte | |
| HK1166349A (en) | Bidirectional promoter from z. mais | |
| MX2007003050A (en) | Promoter molecules for use in plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2003732500 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2486392 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007006347 Country of ref document: US Ref document number: 10515020 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003732500 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: JP |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |
|
| WWP | Wipo information: published in national office |
Ref document number: 10515020 Country of ref document: US |

