WO2003099859A2 - Neue verwendung von adenoviren und dafür codierenden nukleinsäuren - Google Patents

Neue verwendung von adenoviren und dafür codierenden nukleinsäuren Download PDF

Info

Publication number
WO2003099859A2
WO2003099859A2 PCT/EP2003/005583 EP0305583W WO03099859A2 WO 2003099859 A2 WO2003099859 A2 WO 2003099859A2 EP 0305583 W EP0305583 W EP 0305583W WO 03099859 A2 WO03099859 A2 WO 03099859A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
adenovirus
viral
replication
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2003/005583
Other languages
German (de)
English (en)
French (fr)
Other versions
WO2003099859A3 (de
Inventor
Per Sonne Holm
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE2002123534 external-priority patent/DE10223534A1/de
Application filed by Individual filed Critical Individual
Priority to CA002487811A priority Critical patent/CA2487811A1/en
Priority to EP03755145.4A priority patent/EP1506021B1/de
Priority to CN03812310XA priority patent/CN1655827B/zh
Priority to US10/515,238 priority patent/US20060099178A1/en
Priority to AU2003242585A priority patent/AU2003242585A1/en
Priority to JP2004508113A priority patent/JP5213298B2/ja
Priority to KR1020047019231A priority patent/KR101083450B1/ko
Priority to US10/531,366 priority patent/US8951772B2/en
Priority to KR1020057006313A priority patent/KR101123510B1/ko
Priority to CA2515650A priority patent/CA2515650C/en
Priority to PCT/EP2003/011427 priority patent/WO2004035616A2/de
Priority to AU2003271730A priority patent/AU2003271730A1/en
Priority to EP03753560.6A priority patent/EP1554375B1/de
Priority to MXPA05004074A priority patent/MXPA05004074A/es
Priority to SG200703426-7A priority patent/SG165168A1/en
Priority to JP2005501293A priority patent/JP4988199B2/ja
Priority to RU2005114516/13A priority patent/RU2393221C2/ru
Priority to PL376573A priority patent/PL219321B1/pl
Priority to CN2003801015004A priority patent/CN1705740B/zh
Priority to DK03753560.6T priority patent/DK1554375T3/en
Publication of WO2003099859A2 publication Critical patent/WO2003099859A2/de
Publication of WO2003099859A3 publication Critical patent/WO2003099859A3/de
Priority to ZA2004/09361A priority patent/ZA200409361B/en
Anticipated expiration legal-status Critical
Priority to ZA2005/02680A priority patent/ZA200502680B/en
Priority to US12/769,435 priority patent/US10155930B2/en
Priority to AU2010219364A priority patent/AU2010219364B2/en
Priority to US15/452,470 priority patent/US10538744B2/en
Priority to US16/176,461 priority patent/US10731136B2/en
Priority to US16/704,669 priority patent/US11268073B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/861Adenoviral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/761Adenovirus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/763Herpes virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10322New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10332Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/20Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • the invention relates to the use of adenoviruses and nucleic acids coding therefor and recombinant viral oncoprotein.
  • Onyx-015 is an adenovirus with the ElB-55kDA gene completely deleted.
  • the complete deletion of the ElB55kDa protein of the adenovirus is based on the observation that the replication and thus the lysis of cells with a defective ⁇ 53 is possible in the adenoviral vector (Kirn, D. et al., Proc. Am. Soc. Clin. Oncol 17, 391a, 1998), whereby normal cells are not damaged.
  • the ElB-55kDa gene product is involved in the inhibition of p53, the transport of viral mRNA and the shutdown of protein synthesis in the host cell.
  • P53 is inhibited by forming a complex of p53 and the adenovirally encoded ElB-55kDa protein and / or complex consisting of ElB-55kDA and E4orf6.
  • P53, encoded by TP53 is based on a complex regulatory mechanism (Zambetti, GP et al., FASEB J. 7, 855-865, 1993), which among other things also leads to the efficient replication of viruses such as adenoviruses in the cell is suppressed.
  • the TP 53 gene has been deleted or mutated in approximately 50% of all human tumors, with the result that there is no — desired — apoptosis as a result of chemotherapy or radiation therapy and the success of these tumor treatments is usually not achieved.
  • tumor lytic viruses Another concept of tumor lytic viruses is based on the observation that if the E1A protein is deleted in a certain way or has one or more mutations which do not bind Rb / E2F and / or ⁇ l07 / E2F and / or pl30 / E2F influence, such adenoviruses do not induce the entry of the infected cells into the S phase and are capable of replication in tumor cells which have no functional Rb protein.
  • the EIA protein may be deleted at the N-terminus or comprise one or more mutations in the region of amino acid positions 1 to 76 of the EIA protein in order to prevent the binding of EIA to p300, in order to thereby achieve a more selective replication in tumor cells ,
  • adenoviruses are Ad ⁇ 24, dl922-947, ElAd / 01/07 and CB016 (Howe, JA et al., Molecular Therapy 2, 485-495, 2000; Fueyo , J. et al., Oncogene 19, 2-12, 2000; Heise, C.
  • tumor-lytic adenoviral systems relies on the use of selective promoters to specifically express the viral oncogene EIA, which allows selective replication in tumor cells (Rodriguez, R. et al., Cancer Res. 57, 2559-2563, 1997) ,
  • adenoviral tumor-lytic viruses depend on the selection of a cellular background suitable for the mechanism of action on which the respective concept is based.
  • the various currently known adenoviral systems for tumor lysis can only be present certain molecular biological requirements are applied. This limits the application of such systems to certain patient groups.
  • MDR multidrug resistance
  • MRP multidrug resistance-related protein
  • the present invention has for its object to provide a technical teaching and in particular a means that allows an organism, specifically a human organism or a patient collective to be treated specifically with tumor-lytic agents. Furthermore, it is an object of the present invention to provide an agent which is suitable for inducing tumor lysis in patients with tumor diseases who are resistant to cytostatics, in particular those which show multiple resistance.
  • the object is achieved in a first aspect by the use of a virus, preferably an adenovirus, for the manufacture of a medicament, the virus being replication-deficient in cells which do not have YB-1 in the nucleus and the virus for an oncogene or oncogene product, in particular an oncogene protein, which encodes at least one viral gene in YB-1 nucleus-positive cells, preferably an adenoviral gene, transactivated, the gene being selected from the group comprising ElB55kDa, E4orf6, E4orf3 and E3ADP.
  • a virus preferably an adenovirus
  • the object is achieved by using a virus, preferably an adenovirus, for replication in cells which have YB-1 in the nucleus, the virus being replication-deficient in cells which do not have YB-1 in the nucleus, and Virus encodes an oncogene or oncogene product, in particular an oncogene protein, which transactivates at least one viral gene, preferably an adenoviral gene, the gene being selected from the group comprising ElB55kDa, E4orf6, E4orf3 and E3ADP.
  • a virus preferably an adenovirus
  • the virus in particular the adenovirus, replicates in cells which have YB-1 in the nucleus.
  • the viral oncogene protein is EIA and / or the oncogene is the gene coding for EIA and / or the oncogene protein EIA.
  • the viral oncogene protein EIA is capable of binding a functional Rb tumor suppressor gene product.
  • the viral oncogene protein EIA is not capable of binding a functional Rb tumor suppressor gene product.
  • the viral oncoprotein EIA does not induce the nuclear localization of YB-1.
  • a still further embodiment of the two uses according to the invention provides that the medicament is intended for patients whose cells are Rb-positive or Rb-negative.
  • the cells are those cells which are involved in the development of the condition which is to be influenced by the medicament.
  • the cells are Rb-negative and positive in the cell nucleus YB-1, in particular independently of the cell cycle in the cell nucleus YB-1 positive.
  • the medicament is for the treatment of tumors.
  • the cells in particular the cells forming the tumor or parts thereof, have resistance, in particular multiple resistance to pharmacologically active substances, preferably antitumor agents and more preferably cytostatics.
  • the cells show an expression, preferably an overexpression, of the membrane-bound transport protein P-glycoprotein and / or of MRP.
  • the cells are p53-positive or p53-negative.
  • the oncogene protein has one or more mutations or deletions compared to the wild-type oncogene protein EIA, the deletion preferably being one which is selected from the group consisting of the deletions of the region CR3 and deletions of the Includes N-terminus and deletions of the C-terminus. It is envisaged that the El A oncogene protein can bind to Rb.
  • the oncogene protein has one or more mutations or deletions compared to the wild-type oncogene protein, the deletion preferably having one in the CRl region and / or the CR2 region. It is envisaged that the oncogene protein EIA will not be able to bind to Rb.
  • the viral oncogene protein in particular EIA, is under the control of a tissue and / or tumor-specific promoter.
  • the virus in particular the adenovirus, codes for YB-1.
  • a still further embodiment of the two uses according to the invention provides that YB-1 is under the control of a tissue and / or tumor-specific promoter.
  • the virus in particular the adenovirus, codes for at least one protein which is selected from the group comprising E4orf6, E4orf3, E1B55K and adenoviral E3ADP protein.
  • the cells have YB-1 in the nucleus, in particular the cells YB-1 forming the tumor or a part thereof have in the nucleus.
  • Another embodiment of the two uses according to the invention provides that the tumor contains YB-1 in the core after induction of the transport of YB-1 in the core.
  • the transport of YB-1 into the core is triggered by at least one measure which is selected from the group comprising radiation, administration of cytostatics and hyperthermia.
  • the measure is applied to a cell, an organ or an organism.
  • the virus in particular the adenovirus, is selected from the group consisting of Ad ⁇ 24, dl922-947, ElAd / 01/07, dll 119/1131, CB 016, dl520, and viruses lacking an expressed EIA viral oncogene capable of binding a functional Rb tumor suppressor gene product.
  • the object is achieved by using a virus, in particular the adenovirus, for the manufacture of a medicament, the virus, in particular the adenovirus, being designed such that the replication by or by means of YB-1 via the activation of the E2- Late promoter is controlled, preferably controlled predominantly via the activation of the E2 late promoter.
  • the YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • a transgenic YB-1 is preferably understood to be one which is expressed in a cell by a vector, in particular one or the adenovirus.
  • the E2 late promoter is preferably the adenoviral E2 late promoter as present in the wild type adenovirus or an E2 late promoter as used in connection with the expression of transgenes described herein becomes.
  • the object is achieved by using a virus, in particular the adenovirus, for replication in cells which have YB-1 in the nucleus, the virus, in particular the adenovirus, being designed in such a way that the replication by YB-1 is controlled via the activation of the E2 late promoter, preferably predominantly controlled via the activation of the E2 late promoter.
  • the YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • a transgenic YB-1 is preferably understood to be one which is expressed in a cell by a vector, in particular one or the adenovirus.
  • the E2 late promoter is preferably the adenoviral E2 late promoter as present in the wild-type adenovirus or an E2 late promoter as used in connection with the expression of transgenes herein.
  • the adenovirus is designed as disclosed herein, in particular as designed to be used according to the invention.
  • the object is achieved by a viral oncogene protein, in particular an isolated viral oncogene protein, which has the following properties:
  • YB-1 nucleus-positive cells which is selected from the group comprising E1B-55K, E3ADP and E4orf6 and E4orf3;
  • the viral oncoprotein is EIA.
  • the viral oncogene protein has one or more mutations or deletions compared to the wild-type oncogene protein, the deletion preferably being one which is selected from the group consisting of the deletion of the region CR3 and deletion of the N-terminus and deletion of the C-terminus.
  • the induction of YB-1 by the viral oncogene protein does not take place if E4orf6 and / or E1B 55 kD is / are not present in the cell having the nucleus.
  • the viral oncogene product will be able to bind to Rb.
  • the viral oncogene protein has one or more mutations or deletions, the deletion preferably being one in the CRl region and / or the CR2 region of the EIA oncogene protein. It is envisaged that the viral oncogene protein will not be able to bind to Rb.
  • the invention relates to the use of a viral replication system, in particular an adenoviral replication system, comprising a nucleic acid which codes for a virus, in particular an adenovirus as used according to the invention, and comprising a nucleic acid of a helper virus, the nucleic acid of Helper virus comprises a nucleic acid sequence encoding YB-1.
  • the viral nucleic acid in particular the adenoviral nucleic acid, and / or the nucleic acid of the helper virus is present as a replicable vector.
  • the invention relates to the use of a nucleic acid coding for a virus, in particular an adenovirus, as used according to the invention, for the manufacture of a medicament, in particular for the manufacture of a medicament for the treatment of tumors.
  • the cells in particular the cells forming the tumor or parts thereof, have resistance, in particular multiple resistance to pharmacologically active substances, preferably antitumor agents, and preferably cytostatics.
  • the invention relates to the use of a nucleic acid which codes for a virus, in particular an adenovirus as used according to the invention, for replication in cells which have YB-1 in the nucleus, the virus being replication-deficient in cells, which do not have YB-1 in the nucleus, and the virus codes for an oncogene or oncogene product which transactivates at least one viral gene, preferably an adenoviral gene, in YB-1 nucleus-positive cells, the gene being selected from the group ElB55kDa , E4orf6, E4orf3 and E3ADP.
  • the object is achieved by the use of a nucleic acid which is necessary for a virus, in particular an adenovirus, as is used according to the invention. encoded for the production of a medicament, the virus being designed such that the replication by YB-1 is controlled via the activation of the E2 late promoter, preferably predominantly via the activation of the E2 late promoter.
  • the YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • a transgenic YB-1 is preferably understood to be one which is expressed in a cell by a vector, in particular one or the adenovirus.
  • the E2 late promoter is preferably the adenoviral E2 late promoter as present in the wild type adenovirus or an E2 late promoter as used in connection with the expression of transgenes described herein becomes.
  • the object is achieved by using a nucleic acid which codes for a virus, in particular an adenovirus, as is used according to the invention, for replication in cells, the virus being designed in such a way that the replication by YB-1 is controlled via the activation of the E2 late promoter, preferably predominantly controlled via the activation of the E2 late promoter.
  • the YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • a transgenic YB-1 is preferably understood to be one which is expressed in a cell by a vector, in particular one or the adenovirus.
  • the E2 late promoter is preferably the adenoviral E2 late promoter as present in the wild type adenovirus or an E2 late promoter as used in connection with the expression of transgenes described herein becomes.
  • the object is achieved by using a vector comprising one of the nucleic acids described above, for use according to the first or second aspect of the present invention.
  • the invention relates to the use of an agent interacting with YB-1 for the characterization of cells, cells of a tumor tissue or patient, in order to determine whether it is infected with a virus, in particular an adenovirus, as is used according to the invention, should be contacted and / or treated.
  • the agent is selected from the group comprising antibodies, anticalins, aptamers, aptazymes and Spiegelmers.
  • the object is achieved by using the viral oncogene protein according to the invention or a nucleic acid coding therefor for producing a virus, in particular an adenovirus, as is used in the context of the uses according to the first and second aspect of the present invention.
  • the virus comprises a nucleic acid coding for a transgene.
  • the virus comprises the translation and / or the transcription product of a transgene.
  • the nucleic acid of the adenoviral replication system and / or the nucleic acid of the helper virus comprises a transgene or a nucleic acid coding for a transgene.
  • the nucleic acid comprises a transgene or a nucleic acid coding for a transgene.
  • the transgene is selected from the group comprising prodrug genes, cytokines, apoptosis-inducing genes, tumor suppressor genes, genes for metalloproteinase inhibitors and genes for angiogenic inhibitors.
  • the transgene is selected from the group that includes nucleic acids for siRNA, for aptamers, for antisense molecules and for ribozymes, the siRNA, the aptamers, the antisense molecules and / or the ribozymes against a target molecule is targeted.
  • the target molecule is selected from the group consisting of resistance-relevant factors, anti-apoptosis factors, oncogenes, Angiogenesis factors, DNA synthesis enzymes, DNA repair enzymes, growth factors and their receptors, transcription factors, metalloproteinases, in particular matrix metalloproteinases, and plasminogen activator of the urokinase type.
  • the resistance-relevant factors are preferably selected from the group comprising P-glycoprotein, MRP and GST, and also include the nucleic acids coding therefor.
  • the anti-apopotosis factors are selected from the group comprising BCL2 and also include the nucleic acids coding therefor.
  • the oncogenes are selected from the group comprising Ras, in particular mutated Ras, Rb and Myc, and also include the nucleic acids coding therefor.
  • the angiogenesis factors are selected from the group comprising VEGF and HMG proteins and also include the nucleic acids coding therefor.
  • the DNA synthesis enzymes are selected from the group comprising telomerase and also include the nucleic acids coding therefor.
  • the DNA repair enzymes are selected from the group comprising Ku-80 and also include the nucleic acids coding therefor.
  • the growth factors are selected from the group comprising PDGF, EGF and M-CSF and also include the nucleic acids coding therefor.
  • the receptors are in particular those of the growth factors, the growth factors preferably being from the Group are selected, which includes PDGF, EGF and M-CSF, and also include the nucleic acids coding therefor.
  • the transcription factors are selected from the group comprising YB-1 and also include the nucleic acids coding therefor.
  • the metalloproteinases are in particular matrix metalloproteinases.
  • the matrix metalloproteinases are selected from the group comprising MMP-1 and MMP-2 and also include the nucleic acids coding therefor.
  • the urokinase-type plasminogen activators are selected from the group comprising uPa-R and also include the nucleic acids coding therefor.
  • the medicament further contains at least one pharmaceutically active compound.
  • the pharmaceutically active compound is selected from the group comprising cytokines, metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics and cell cycle inhibitors.
  • the present invention is based on the surprising finding that the DNA replication of ElA-modified adenoviruses in YB-1 nucleus-positive tumor cells is due to the activation of the E2-late promoter.
  • ElA-modified adenoviruses are understood to mean those adenoviruses which (a) show no replication or a replication which is reduced, preferably greatly reduced, compared to the respective wild type, in YB-1 nucleus-negative cells, (b) transactivating to at least one viral gene act, the gene is particularly selected from the group comprising ElB-55kDa, E4orf6, E4orf3 and E3ADP and / or (c) cellular YB-1 is not translocated into the nucleus by the adenovirus.
  • the adenoviruses used according to the invention have the further property that the binding of the El A protein encoded by the adenovirus interferes with the binding of E2F to RB or is able to resolve the corresponding complex of E2F and Rb.
  • Adenoviruses which have one or more of the above-mentioned features a) to c), preferably all features a) to c), are replication-deficient in cells which do not have YB-1 in the nucleus.
  • a greatly reduced replication is understood in particular to mean a replication which is reduced by a factor of 2, preferably by a factor of 5, more preferably by a factor of 10 and most preferably by a factor of 100, compared to the wild type.
  • the comparison of the replication when using the same or similar cell lines, the same or similar virus titers for the infection (English: multiplicity of infection, MOI, or English plaque forming unit, pfu) and / or the same or similar general test conditions.
  • Replication is understood in particular to mean particle formation. In further embodiments, however, the extent of the synthesis of viral nucleic acid can be understood as a measure of the replication.
  • a replication comparable to the wild type can already be achieved with an infection rate of 1 to 10 pfu / cell compared to 10 to 100 pfu / cell according to the prior art.
  • Cellular YB-1 is to be understood herein to mean any YB-1 which is encoded and preferably also expressed by a cell, this YB-1 in the cell in particular before the relevant cell is infected with an adenovirus, preferably an adenovirus, and / or a helper virus as described herein.
  • cellular YB-1 is also one which is introduced into or produced by the cell only through exogenous measures, such as, for example, by infection with a virus, in particular with an adenovirus.
  • the present inventor assumes that the E2 early promoter, ie the early E2 promoter, is not switched on via the human cellular E2F transcription factor as part of the replication of the viruses used according to the invention.
  • Activation of replication is independent of the Rb status of the cells, ie the tumor cells which are infected using the viruses disclosed herein and are subsequently preferably lysed can have both functional and inactive Rb proteins.
  • adenoviral replication using the adenoviruses or conditions disclosed herein does not require a functional p53 protein, but is not adversely affected by its presence.
  • adenoviral systems according to the prior art are based on EIA in order to control the in vivo replication of adenoviruses by means of the early E2 promoter (E2-early promoter) and “free E2F”. Nevertheless, these viruses known in the prior art can be used according to the invention are used, ie for replication in cells that contain YB-1 in the nucleus regardless of the cell cycle.
  • viruses and in particular adenoviruses described in said European patent EP 0 931 830 can be used according to the invention.
  • the viruses described in said patent are those which have replication deficiency and which lack an expressed viral oncoprotein capable of binding a functional Rb tumor suppressor gene product.
  • the adenovirus can in particular be one which lacks the expressed viral EIA oncoprotein which is capable of binding a functional tumor suppressor gene product, in particular Rb.
  • the viral EIA oncoprotein can have an inactivating mutation, for example in the CR1 domain at amino acids 30 to 85 in Ad 5, nucleotide positions 697-790, and / or the CR2 domain at amino acids 120 to 139 in Ad 5 , nucleotide positions 920 to 967, which are involved in the binding of pl05 Rb protein, pl30 and pl07 protein. It can also be provided that the adenovirus is type 2 dl 312 or adenovirus type 5 NT dl 1010.
  • adenoviruses according to the invention When using adenoviruses according to the invention for the production of a medicament, in particular for producing a medicament for the treatment of tumor diseases, and when using adenoviruses according to the invention for replication in cells which have YB-1 in the nucleus, the replication ultimately takes place in such cells which have YB-1 in the nucleus, preferably independently of the cell cycle, and are therefore YB-1 nucleus-positive. It is particularly noteworthy here that the adenoviruses as such do not replicate or greatly reduce in cells which do not contain YB-1 in the nucleus but essentially only in the cytoplasm. In this respect, it is necessary that YB-1 is present in the core for a successful replication of these viruses.
  • this can be achieved by applying conditions to the cells such that expression or the presence of YB-1 in the nucleus occurs.
  • Appropriate measures can e.g. B. the coding or expression of YB-1 by the adenoviruses used according to the invention be, which in addition to the adenoviral genes also carry a genetic information that codes for YB-1 and in particular its expression.
  • Other measures that lead to the transport, induction or expression of YB-1 in the nucleus of the cell are the application of stress conditions, such as the application of cytostatics, radiation, hyperthermia and the like to the cell or the cell containing one such cell Organism.
  • adenoviruses used in the context of the present invention are furthermore distinguished by the fact that they do not replicate in those cells which do not have YB-1 in the nucleus and are therefore YB-1 nucleus-negative.
  • adenoviruses to be used according to the invention code for a viral oncoprotein, which is also referred to herein as oncogene protein, the oncogene protein preferably being EIA, the oncogene protein being capable of at least one activate viral gene, which can have an effect on the replication of the virus and / or cell lysis of the cell infected by the virus. It is preferred that the influence on replication is such that the virus replicates better in the presence of the oncogene protein than in the absence of the oncogene protein of the respective virus.
  • This process is also referred to herein as transactivating and in particular referred to as ElA transactivating when the transactivation is mediated by EIA.
  • transactivate or “transactivation” preferably describes the process in which the viral oncoprotein in question influences the expression and / or transcription of a gene or genes other than the gene coding for the viral oncoprotein itself, ie , H. preferably controls its expression and / or translation, and in particular activates it.
  • viral genes are preferably ElB55kDa, E4orf6, E4orf3 and E3ADP and any combination of the above-mentioned genes or gene products.
  • adenoviruses to be used according to the invention Another, albeit preferably optional, feature of the adenoviruses to be used according to the invention is their binding behavior to or with the tumor suppressor Rb. It is fundamentally within the scope of the present invention that the adenoviruses used according to the invention bind or cannot bind to Rb. The use of the two Alternative designs of the adenoviruses are possible regardless of the Rb status of the treating cell.
  • deletions on the EIA oncoprotein are possible, for example: deletion in the CRl region (amino acid positions 30-85 in Ad5) and deletion in the CR2 region (amino acid positions 120-139 in Ad5).
  • the CR3 region is preserved and can exert its transactivating function on the other early viral genes.
  • viruses which are known in principle in the prior art, are generally considered to be replication-deficient. However, it is to the merit of the present invention to have recognized that they are nevertheless suitable for replication in a suitable background, in particular a cellular background.
  • a suitable cellular background is conditioned or provided by the presence of YB-1 in the nucleus, preferably a cell cycle-independent presence of YB-1 in the nucleus.
  • the term “cells” or “cellular systems” as used herein includes fragments or fractions of cell disruption as well as cells that are present in vitro, in vivo or in situ.
  • cellular systems or cells also includes those cells which are isolated in a cell culture, tissue culture, organ culture or in a tissue or organ in vivo or in situ, in groups or as part of tissues, organs or organisms or also as such in a preferably living organism.
  • the organism is preferably a vertebrate organism and more preferably a mammal.
  • the organism is particularly preferably a human organism.
  • new viruses are generated which affect the replication behavior of Adenoviruses described herein and known in the art show in those cells that are YB-1 nucleus positive.
  • further viruses can be designed which have the features defined here which are necessary for the use according to the invention.
  • the modified EIA oncoprotein of the various adenoviruses to be used according to the invention is capable of having a transactivating effect on the early viral genes, such as, for example, E1B55K, E4orf3, E4orf6, E3ADP, in YB-1 nuclear positive cells. Otherwise there is preferably no change in the viral genome and the corresponding adenovirus can otherwise correspond to a wild-type adenovirus or a modification thereof.
  • viruses disclosed herein which code for or comprise a transactivating oncogene protein in the sense of the present invention include, for example, the adenoviruses Ad ⁇ 24, dl922-947, ElAd / 01/07, CB106 and / or those described in European patent EP 0931 830 Adenoviruses, each of which is capable of transactivating the early genes, for example E1B, E2, E3 and or E4 to act, and is comparable to wild type adenovirus, in particular of the wild type Ad5.
  • a specific area of the EIA protein is responsible for the transactivation. There are 3 highly conserved areas in the EIA protein within different adenovirus serotypes.
  • the transactivating function is mainly due to the presence of the CR3 region in the EIA protein.
  • the AS sequence of CR3 is unchanged in the adenoviruses mentioned above.
  • the early genes E1B, E2, E3 and E4 are transactivated regardless of whether YB-1 is present in the nucleus or in the cytoplasm.
  • dl520 expresses a so-called E1A12S protein which does not have the AS sequence of the CR3 region.
  • E1A12S protein which does not have the AS sequence of the CR3 region.
  • dl520 can only perform a very weak transactivating function, especially on the E2 region, and therefore does not replicate in YB-1 nucleus-negative cells.
  • YB-1 nucleus-positive cells YB-1 takes over the transactivation of the E2 region and thus enables an efficient replication dl520. This is the basis for the use of systems such as dl520 or based on dl520 for the purposes disclosed herein.
  • delta 24 also referred to herein as Ad ⁇ 24
  • dl520 the early genes E1B, E3 and E4 are stronger in YB-1 nucleus-positive cells than in YB- 1 nuclear negative cells can be transactivated.
  • delta 24 there are no or only slight differences.
  • the transactivation of dl520 or more precisely the E1A12S protein is, however, considerably weaker in comparison to the wild-type adenovirus. However, this transactivation is sufficient to carry out an efficient replication in YB-1 nuclear positive cells, as is also shown in Example 10.
  • adenoviruses to be newly constructed which are also referred to here as modifications and which can be used according to the invention
  • there is typically an El deletion, an El / E3 deletion and / or an E4 deletion ie the corresponding adenoviruses unable to produce functionally active El and / or E3 and / or E4 expression products or corresponding products, or in other words, these adenoviruses are only able to produce functionally inactive El, E3 and / or To produce an E4 expression product, a functionally inactive El, E3 and / or E4 expression product being one which is either not at all as an expression product, be it at the level of transcription and / or translation, or in a form, in which it does not have at least one of the functions assigned to it in the wild-type adenovirus.
  • Virology, 70, 2296- 2306, 1996. is / are brought into expression in such a vector individually or in any combination.
  • the individual genes mentioned, like the transgenes disclosed herein, can be cloned independently of one another either in the E1 and / or E3 'and / or E4 region and brought to expression using a suitable promoter or under the control of a suitable promoter.
  • the regions E1, E3 and E4 are equally suitable as cloning sites within the adenoviral nucleic acid.
  • Suitable promoters include those as disclosed herein in connection with the control or expression of EIA, in particular the modified EIA.
  • one embodiment provides that the adenoviruses used according to the invention are deficient in terms of E1B, in particular 19 kDa-deficient in terms of E1B.
  • the term deficient is generally understood to mean a state in which E1B does not have the entirety of the properties inherent in the wild type and at least one of these properties is missing.
  • the adenoviruses as used in accordance with the invention disclosed herein are generally known in the art, at least in some embodiments.
  • the adenoviruses used according to the invention are preferably recombinant adenoviruses, in particular also when a change compared to the wild type has been made in the sense of the technical teaching given herein. It is within the knowledge of those skilled in the art to delete or mutate adenoviral nucleic acid sequences that are not essential to the invention. Such deletions can e.g. B relate to the nucleic acid coding for part of the E3 and E4 as also described herein.
  • these adenoviral nucleic acids can still be packaged in the viral capsid and thus form infectious particles. The same applies to the Use of the nucleic acids according to the invention.
  • the adenoviral systems can be deficient with regard to one or more expression products.
  • nucleic acid coding for the expression product is completely or mutated or deleted to the extent that essentially no expression product is formed anymore, or on the regulatory or expression-controlling elements such as promoters or transcription factors are absent or are active differently than in the wild type, be it at the nucleic acid level (lack of a promoter; ice-acting element) or at the level of the translation or transcription system (trans-acting elements).
  • the latter aspect in particular can depend on the respective cellular background.
  • new adenoviruses can also be used to the extent that has already been disclosed for the other adenoviruses described herein.
  • the new adenoviruses according to the invention result from the technical teaching disclosed herein.
  • Particularly preferred representatives are, for example, the viruses Xvir03 and Xvir03 / 01 shown here in FIGS. 16 and 17, the construction principle of which is further illustrated in Examples 11 and 12.
  • a CMV promoter was cloned in the E1 region, which codes the nucleic acids separated by an IRES sequence for E1B 55k and E4ORF6.
  • a replication efficiency which practically corresponds to that of wild-type viruses, the selectivity of replication in cells, in particular tumor cells, being retained to the extent that replication, in particular in YB- 1-nucleus-positive cells and especially in those cells in which YB-1 is deregulated.
  • Cells in which YB-1 is deregulated are preferably those which have an increased expression of YB-1, preferably compartment-independent, compared to normal or non-tumor cells.
  • virus Xvir03 A further development of the virus Xvir03 is the virus Xvir03 / 01, in which, under the control of a specific promoter, in particular a tumor or tissue-specific promoter, therapeutic genes or transgenes are cloned in a preferred embodiment. It is also within the scope of such a virus that region E4 is functionally inactive, is preferably deleted.
  • the transgenes described here can also be cloned into the E4 region, this being possible as an alternative or in addition to the cloning of the transgenes into the E3 region.
  • Such therapeutic genes can be prodrug genes, genes for cytokines, apoptosis-inducing genes, tumor suppressor genes, genes for metalloproteinase inhibitors and / or angiogenesis inhibitors.
  • siRNA, aptamers, antisense and ribozymes can be expressed which are directed against cancer-relevant target molecules.
  • the individual or the multiple target molecules are preferably selected from the group, the resistance-relevant factors, anti-apoptosis factors, oncogenes, angiogenesis factors, DNA synthesis enzymes, DNA repair enzymes, growth factors and their receptors, transcription factors, metalloproteinases , in particular matrix metalloproteinases, and plasminogen activator of the urokinase type. Preferred embodiments thereof have already been disclosed herein.
  • Possible prodrug genes are, for example, cytosine deaminase, thymidine kinase, carboxypeptidase, uracil phosphoribosyl transferase; Purine nucleoside phosphorylase (PNP); Kirn et al, Trends in Molecular Medicine, Volume 8, No.4 (Suppl), 2002; Wybranietz W.A. et al, Gene Therapy, 8, 1654-1664, 2001; Niculescu-Duvaz et al., Curr. Opin. Mol.
  • PNP Purine nucleoside phosphorylase
  • Possible cytokines are for example GM-CSF, TNF-alpha, 11-12, 11-2, 11-6, CSF, interferon-gamma; Gene Therapy, Advances in Pharmacology, Volume 40, Editor: J. Thomas August, Academic Press; Zhang and Degroot, Endocrinology, 144, 1393-1398, 2003; Descamps et al., J. Mol. Med., 74, 183-189, 1996; Majumdar et al., Cancer Gene Therapy, 7, 1086-1099, 2000.
  • Possible apoptosis-inducing genes are, for example, decorin: Tralhao et al., FASEB J, 17, 464-466, 2003; Retinoblastoma 94: Zhang et al., Cancer Res., 63, 760-765, 2003; Bax and Bad: Zhang et al, Hum. Gene Ther., 20, 2051-2064, 2002; Apoptin: Noteborn and Pietersen, Adv. Exp. Med.
  • Possible tumor suppressor genes are, for example, EIA, p53, pl6, p21, p27, MDA-7.
  • EIA EIA
  • p53 pl6, p21, p27, MDA-7.
  • Opalka et al. Cell Tissues Organs, 172, 126-132, 2002, Ji et al, Cancer Res., 59, 3333-3339, 1999, Su et al., Oncogene, 22, 1164-1180, 2003.
  • angiogenesis inhibitors as can be used in preferred embodiments are, for example, endostatin, angiostatin: Hajitou et al., FASEB J., 16, 1802-1804, 2002, and antibodies against VEGF (Ferrara, N., Semin Oncol 2002 Dec; 29 (6 suppl 16): 10-4.
  • Possible metalloproteinase inhibitors are, for example, Timp-3, Ahonen et al., Mol Therapy, 5, 705-715, 2002; PAI-i; Söff et al., J. Clin. Invest, 96, 2593-2600, 1995; Timp-1, Brandt K. Curr. Gene Therapy, 2, 255-271, 2002.
  • siRNA short interfering RNA
  • siRNA consists of two, preferably two separate RNA strands which hybridize with one another due to base complementarity, ie are essentially base-paired, and preferably has a length of up to 50 nucleotides, preferably between 18 and 30 nucleotides, preferably less as 25 nucleotides and most preferably 21, 22 or 23 nucleotides, these numerical values relating to a single strand of the siRNA, in particular to the length of the region of a single strand which hybridizes or is base-paired with one, more precisely the second single strand.
  • siRNA specifically induces or mediates the breakdown of mRNA. The specificity required for this is conveyed by the sequence of the siRNA and thus its binding site.
  • siRNA is believed to be a biological strategy for cells during development inhibit certain alleles and protect against viruses.
  • the RNA interference mediated by siRNA is used as a method for specifically suppressing or even completely eliminating the expression of a protein by introducing a gene-specific double-stranded RNA.
  • a 19 to 23 nucleotide siRNA is particularly suitable for higher organisms because it does not lead to the activation of the non-specific defense response, the so-called interleukin response.
  • vectors are also used in the prior art which have endogenous siRNA expression allow.
  • oligonucleotides with a length of 64 nucleotides, which include the 19 nucleotide long target sequence are incorporated into the vector both in sense and in antisense orientation, separated by, for example, a 9 nucleotide long spacer sequence.
  • the resulting transcript folds into a hairpin structure with a stem structure of, for example, 19 base pairs.
  • the loop is rapidly cleaved in the cell, so that a functional siRNA is formed (Brummelkamp et al., Science, 296, 550-553, 2002)
  • the activity of pRb or E2F is regulated by phosphorylation.
  • the hypophosphorylated form of pRb mainly occurs in the Gl and M phases.
  • the hyperphosphorylated form of pRb occurs in the S and G2 phases.
  • the phosphorylation of pRb releases E2F from the complex of E2F and hypophosphorylated pRb.
  • the release of E2F from the complex of E2F and hypophosphorylated pRb leads to the transcription of E2F-dependent genes.
  • the EIA protein only binds to the hypophosphorylated form of the pRb, with the binding of EIA to pRb mainly via the CR2 region of the EIA protein.
  • the nucleic acid coding for YB-1 which in one embodiment of the adenoviruses to be used according to the invention can be part of the adenoviruses, can comprise a nucleic acid sequence mediating a core transport of YB-1.
  • nucleic acids, adenoviruses and adenoviral systems according to the invention as well as the adenoviruses known in the prior art such as, for example, Onyx-015, Ad ⁇ 24, dl922-947, ElAd / 01/07, CB016, dl 520 and the adenoviruses described in patent EP 0931 830 can be used.
  • Suitable nucleic acid sequences mediating nuclear transport are known to those skilled in the art and are described, for example, in (Whittaker, GR et al, Virology, 246, 1-23, 1998; Friedberg, EC, TL3S 17, 347, 1992; Jans, DA et al ., Bioessays 2000 Jun; 22 (6): 532-44; Yoneda, Y., J. Biocehm. (Tokyo) 1997 May; 121 (5): 811-7; Boulikas, T., Grit. Rev. Eukaryot. Gene Expr. 1993; 3 (3): 193-227; Lyons RH, Mol. Cell Biol., 7, 2451-2456, 1987).
  • YB-1 is formed as a fusion protein with a signal peptide and, as a result of the signal peptide YB-1, is introduced into the cell nucleus and the adenoviruses are thus replicated according to the invention.
  • YB-1 is provided with a transport sequence which leads to YB-1, preferably starting from a synthesis in the cytoplasm, in the Cell nucleus is smuggled or translocated and promotes viral replication there.
  • An example of a particularly effective nucleic acid sequence mediating the nuclear transport is the TAT sequence of HIV, which is described, for example, in addition to other suitable nucleic acid sequences of this kind in Efthymiadis, A., Briggs, LJ, Jans, DA., JBC 273, 1623-1628 , 1998.
  • the adenoviruses used according to the invention comprise the nucleic acid sequences which code for the peptides coding for the core transport.
  • YB-1 is in full length, in particular in a form that corresponds to the wild type of YB-1. It is further within the scope of the present invention that YB-1 as a derivative, for example, in a shortened or franked form Form is used or is present.
  • a YB-1 derivative such as is used or is present in the context of the present invention, is one which is able to bind to the E2 late promoter and thereby activates gene expression from the adenoviral E2 region.
  • Such derivatives include in particular the YB-1 derivatives disclosed herein. Further derivatives can be generated by deleting one or more amino acids at the N-terminus, at the C-terminus or within the amino acid sequence.
  • adenovirus and adenoviral systems are to be understood as having essentially the same meaning.
  • Adenovirus is to be understood in particular to mean the complete virus particle comprising the capsid and the nucleic acid.
  • the term adenoviral system is based in particular on the fact that the nucleic acid is changed compared to the wild type. Such changes preferably include those in the structure of the genome of the adenovirus as they result from the deletion and / or addition and / or mutation of promoters, regulatory sequences and / or coding sequences such as reading frames.
  • the term adenoviral systems is also preferably used in the context that it is a vector that can be used, for example, in gene therapy.
  • the adenoviruses used according to the invention or the nucleic acids coding for them are each corresponding adenoviral nucleic acid which leads to a replication event by itself or in connection with further nucleic acid sequences. It is possible, as explained here, that the sequences and / or gene products required for replication are provided by means of helper viruses. Insofar as reference is made to coding nucleic acid sequences and these are nucleic acid sequences which are known, it is in Within the scope of the invention that not only the identical sequence is used, but also sequences derived therefrom.
  • Derived sequences are to be understood here to mean in particular those sequences which still lead to a gene product, be it a nucleic acid or a polypeptide, which has a function which corresponds to one or the function of the non-derived sequence. This can be determined by simple routine tests familiar to the person skilled in the art.
  • An example of such derived nucleic acid sequences are those nucleic acid sequences which code for the same gene product, in particular for the same amino acid sequence, but which have a different base sequence due to the degeneracy of the genetic code.
  • the adenoviral nucleic acid is deficient for the expression of the oncogene protein, in particular the EIA protein, i.e.
  • Nucleic acid of a helper virus comprises, wherein the nucleic acid of the helper virus comprises a nucleic acid sequence which codes for the oncogene protein, in particular the EIA protein, which has the following properties or gives the adenovirus the following properties, namely that it preferably does not replicate in the YB core -negative cells but is replicating in cell-positive YB-1 nucleus-positive cells, transactivating to at least one viral gene, in particular ElB55kDa, E4orf6, E4orf3 and / or E3ADP, acts in YB-1 nucleus-positive cells, and / or cellular YB-1 is not translocated into the nucleus. It is within the scope of the present invention that the transgenes
  • adenoviral replication system it is provided in one embodiment that the adenoviral nucleic acid and / or the nucleic acid of the helper virus is present as a replicable vector.
  • nucleic acid (s) coding for the adenoviruses as used according to the invention are more preferred in a vector Is / are present in an expression vector and this expression vector is used according to the invention.
  • the present invention also relates to a vector group comprising at least two vectors, the vector group as a whole comprising an adenoviral replication system, as described herein, and the vector group is used according to the invention. It can be provided that each component of the adenoviral replication system is arranged on its own vector, preferably an expression vector.
  • the present invention also relates to the use of a cell which codes one or more of the nucleic acids such as those coding for the use according to the invention of the adenoviruses described herein which are to be used according to the invention, and / or a corresponding adenoviral replication system and / or a corresponding vector and / or a vector group according to the invention, for the same purposes as described herein for the adenoviruses
  • adenoviruses and, in particular, their nucleic acids or the nucleic acids coding therefor can also be introduced in parts into a cell, in particular a tumor cell, in which case, due to the presence of the various individual components, these interact as if the individual components came from a single one Nucleic acid or a single or more adenoviruses.
  • nucleic acids used for coding adenoviruses, adenoviral systems or parts thereof can be present as vectors. They are preferably viral vectors.
  • the virus particle is preferably the vector.
  • said nucleic acids are present in a plasmid vector.
  • the vector has elements which ensure or control the multiplication of the inserted nucleic acid, ie replication and possibly expression of the inserted nucleic acid.
  • Suitable vectors in particular also expression vectors, and corresponding elements are known to those skilled in the art and are described, for example, in Grunhaus, A., Horwitz, MS, 1994, Adenoviruses as cloning vectors. In Rice, C, ed., Seminars in Virology, London: Saunders Scientific Publications.
  • a vector group accordingly comprises at least two vectors. Otherwise, the statements made herein generally regarding vectors apply to the vectors or the vector group.
  • adenoviruses used according to the invention are characterized by the various nucleic acids or gene products disclosed herein and can otherwise comprise all those elements known to those skilled in the art, as is also the case with wild-type adenoviruses (Shenk, T .: Adenoviridae: The virus and their replication. Fields Virology, 3rd edition, ed. Fields, BN, Knipe, DM, Howley, PM et al., Lippincott-Raven Publishers, Philadelphia, 1996, chapter 67).
  • the replication of adenoviruses is a very complex process and usually uses the human transcription factor E2F.
  • E2F human transcription factor
  • the "early genes” El, E2, E3 and E4 are first expressed.
  • the group of the "late genes” is responsible for the synthesis of the viral structural proteins.
  • the El region consisting of two transcription units EIA and E1B, which code for different EIA and EIB proteins, plays a decisive role in the activation of both the early and late genes, since it transcribes the E2, E3, E4- Induce genes (Nevins, JR, Cell 26, 213-220, 1981).
  • the EIA proteins can induce DNA synthesis in resting cells and thus initiate their entry into the S phase (see Boulanger and Blair, 1991).
  • the cellular transcription factor E2F is released.
  • the E2F factors can then bind to the corresponding promoter regions of both cellular and viral genes (in particular to the adenoviral E2 early promoter) and initiate transcription and thus replication (Nevins, JR, Science 258, 424-429, 1992).
  • the gene products of the E2 region are required in particular for initiating or carrying out the replication, since they code for three essential proteins.
  • E2F-dependent also referred to herein as the E2-early promoter or earlier E2 promoter
  • E2-late the Molecular Repertoire of Adenoviruses III: Current Topics in Microbiology and ImmunologyNol 199, 177-194, Springer Verlag 1995.
  • E4 region together with the EIA and ElB-55kDa protein play an important role for the activity of E2F and the stability of p53.
  • E4orf6 / 7 protein encoded by the E4 region transactivates the E2 promoter even more (Swaminathan and Thimmapaya, JBC 258, 736-746, 1996).
  • p53 is inactivated by the complex consisting of ElB-55kDa and E4orf6 (Steegenga, WT et al, Oncogene 16, 349-357, 1998) in order to be able to go through a successful lyrical infection cycle.
  • the ElB-55kDa protein has another important function in that, in interaction with the E4orf6 protein, it requires the export of the viral RNA from the cell nucleus, whereas the cell's own RNAs are retained in the nucleus (Bridge and Ketner, Virology 174, 345- 353, 1990). Another important observation is that the protein complex consisting of E1B-55kDa / E4orf6 is located in the so-called "viral inclusion bodies". It is assumed that these structures represent sites of replication and transcription (Ornelles and Shenk, J. Virology 65 , 424-429, 1991).
  • the E3 region Another region that is particularly important for replication and in particular for the release of adenoviruses is the E3 region.
  • the E3 region more precisely contains the genetic information for a large number of relatively small proteins which are not essential for the adenoviral infection cycle in vitro, ie in cell culture. However, they play an important role in the survival of the virus during an acute and / or latent infection in vivo, since they have, inter alia, immunoregulatory and apoptotic function (s) (Marshall S. Horwitz, Virololgie, 279, 1-8, 2001; Russell, loc. Cit.). It could be shown that a protein with a size of approx. 11.6 kDa induces cell death.
  • the protein was designated due to its function as ADP - for the English term adenovirus death protein (Tollefson, J. Virology, 70, 2296-2306, 1996).
  • the protein is primarily formed in the late phase of the infection cycle. Furthermore, overexpression of the protein leads to better lysis of the infected cells (Doronin et al., J. Virology, 74, 6147-6155, 2000).
  • ElA-deleted viruses ie in particular viruses which do not express a 12S EIA protein and also no 13S EIA protein, can replicate very efficiently at higher MOEs (Nevins JR, Cell 26, 213-220 , 1981), which however cannot be realized in clinical application.
  • EIA-like activity This phenomenon is referred to in the literature as "ElA-like activity". Furthermore, it was known that of the 5 proteins encoded by EIA, two proteins, namely the 12S and the 13S protein, control or express the expression of the other adenoviral genes. (Nevins, JR, Cell 26, 213-220, 1981; Boulanger, P. and Blair, E .; Biochem. J. 275, 281-299, 1991).
  • CR3 region of the 13S protein has the transactivating function (Wong HK and Ziff EB., J Virol., 68, 4910-20, 1994)
  • Adenoviruses the specific deletions in the CR1 and / or CR2 region and / or CR3 region of the 13S proteins, are largely replication-defective, but still have a transactivating effect on individual viral genes or promoters, in particular on the E2 region (Wong HK, Ziff EB., J Virol. 68, 4910-20, 1994; Mymryk, JS and Bayley, ST, Virus Research 33, 89-97, 1994).
  • YB-1 After infection of a cell, typically a tumor cell, with a wild-type adenovirus, YB-1 is mediated by EIA, E1B-55K and E4orf6 in the nucleus and co-localized with E1B-55K in the nucleus in the viral inclusion bodies, which is an effective Replication of the virus in the cell nucleus allowed both in vitro and in vivo. It had previously been found that E4orf6 also binds to E1B-55 K (Weigel, S. and Dobbelstein, MJ Virology, 74, 764-772, 2000; Keith N.
  • an efficient according to the invention is Replication of the virus, and thus the use of the viruses described herein for replication in cells which are YB-1 nucleus positive, or for the manufacture of a medicament for the treatment of diseases in which YB-1 nucleus positive cells are involved , possible.
  • YB-1 belongs to a group of highly conserved factors that bind to the inverted CAAT sequence, the so-called Y box. They can have a regulatory effect both at the level of transcription and translation (Wolffe, AP Trends in Cell Biology 8, 318-323, 1998). More and more Y-box-dependent regulatory pathways are found in the activation but also in the inhibition of growth and apoptosis-associated genes (Swamynathan, SK et al., FASEB J.
  • YB-1 interacts directly with p53 (Okamoto, T. et al., Oncogene 19, 6194-6202, 2000), plays an important role in Fas gene expression (Lasham, A. et al, Gene 252, 1-13 , 2000), MDR and MRP gene expression (Stein, U. et al., JBC 276, 28562-69, 2001; Bargou, RC et al., Nature Medicine 3, 447-450, 1997) and in the activation of topoisomerases and metalloproteinases (Mertens. PR et al., JBC 272, 22905-22912, 1997; Shibao, K. et al, Int. J.
  • YB-1 is also involved in the regulation of mRNA stability (Chen, CY. Et al., Genes & Development 14, 1236-1248, 2000) and in repair processes (Ohga, T. et al., Cancer Res. 56, 4224-4228, 1996;).
  • the nuclear localization of YB-1 in tumor cells leads to an ElA-independent viral replication, in which neither a 12S EIA protein nor a 13S EIA protein is expressed or used, in particular (Holm, PS et al. JBC 277, 10427-10434, 2002) and in the case of overexpression of the protein YB-1 to a multidrug resistance.
  • the adenoviral proteins such. B. E4orf6 and E1B-55K have a positive effect on viral replication (Goodrum, FD and Ornelles, D.A, J. Virology 73, 7474-7488, 1999), a functional EIA protein for switching on the other viral gene products (e.g.
  • E4orf6, E3ADP and E1B-55K is responsible (Nevins JR, Cell 26, 213-220, 1981). However, this does not occur with the ElA minus adenoviruses known in the prior art, in which the 13S EIA protein is not present.
  • the nuclear localization of YB-1 in multidrug-resistant cells which have YB-1 in the nucleus allows the replication or particle formation of such ElA-minus viruses.
  • the efficiency of viral replication or particle formation is many times lower than that of wild type Ad5.
  • a combination of YB-1 which is either already contained in the cell nucleus of the tumor cell, or induced by external factors (e.g.
  • adenoviral system which switches on the adenoviral genes but is not capable of viral replication, surprisingly represents a system which mediates very effective viral replication or particle formation by YB-1 and thus allows oncolysis.
  • Suitable cytostatics are, for example, those which belong to the following groups: anthracyclines, such as, for example, daunomycin and adriamycin; Alkylating agents such as cyclophosphamide; Alkaloids such as etoposide; Vin alkaloids such as vincristine and vinblastine; Antimetabolites such as 5-fluorouracil and methrothrexate; Platinum derivatives such as cis-platinum; Topoisomerase inhibitors such as camphothecin; and taxanes, such as taxol.
  • anthracyclines such as, for example, daunomycin and adriamycin
  • Alkylating agents such as cyclophosphamide
  • Alkaloids such as etoposide
  • Vin alkaloids such as vincristine and vinblastine
  • Antimetabolites such as 5-fluorouracil and methrothrexate
  • Platinum derivatives such as cis-platinum
  • the adenoviruses disclosed herein are limited in their ability to transactivate the viral genes E1B-55K, E4orf6, E4orf3 and E3ADP with the relevant transactivating abilities of wild-type adenoviruses, in particular wild-type Ad5.
  • the present inventor has now surprisingly found that this limited transactivating ability can be abolished by expressing the corresponding genes and in particular E1B-55K and E4orf6 in connection with the nuclear localization of YB-1.
  • the viral replication or particle formation increases under these circumstances to a level which is comparable to the replication behavior or particle formation behavior of wild-type adenoviruses.
  • the medicament in the context of or during the manufacture of which the adenoviruses described herein are used according to the invention, it is provided that this is generally administered systemically, although it is also within the scope of the present invention if it is administered or dispensed locally.
  • the application is carried out with the intention that, in particular, those cells are infected with the adenovirus and, in particular, replication of the adenoviruses in which there is an involvement, preferably causally, in the development of a condition, typically a disease, for the diagnosis thereof and / or prevention and / or treatment, the medicament according to the invention is used.
  • Such a medicament is preferably provided for the treatment of tumor diseases.
  • tumor diseases in which either YB-1 is already in the cell nucleus due to the mechanism underlying the tumor disease, in particular of the underlying pathological mechanism, or else the presence of YB-1 in the cell nucleus is caused by external measures, the measures being suitable for transferring YB-1 into the cell nucleus, inducing it or expressing it there.
  • the term tumor or tumor disease is intended to mean both malignant and benign tumors and corresponding diseases.
  • the medicament contains at least one further pharmaceutically active compound. The type and scope of these further pharmaceutically active compounds will depend on the type of indication for which the medicament is used.
  • cytostatics such as cis-platinum and taxol, daunoblastin, daunorubicin, adriamycin and / or mitoxantrone or other of the cytostatics or groups of cytostatics described herein are typically used.
  • the medicament according to the invention can be present in various formulations, preferably in a liquid form.
  • the medicament will contain auxiliaries such as stabilizers, buffers, preservatives and the like, which are known to the person skilled in the field of galenics.
  • the present inventor has surprisingly found that the use according to the invention of the viruses described herein can be used with a particularly high success rate in tumors in which YB-1 occurs in the cell nucleus independently of the cell cycle.
  • YB-1 is normally present in the cytoplasm, in particular also in the perinuclear plasma.
  • S phase of the cell cycle YB-1 is found in the cell nucleus of both normal and tumor cells.
  • This is not sufficient to accomplish viral oncolysis using such modified adenoviruses.
  • the comparatively low effectiveness of such attenuated adenoviruses described in the prior art is ultimately based on their incorrect use.
  • adenoviral systems in particular also with greater effectiveness, can be used where the molecular biological prerequisites for viral oncolysis are present using the attenuated or modified adenoviruses described herein.
  • the adenoviruses to be used according to the invention such as Ad ⁇ 24, dl922-947, ElAd / 01/07, CB016, dl520 and the recombinant adenoviruses described in European patent EP 0 931 830, these requirements are met in tumor cancers whose cells have a nuclear localization of YB-1 that is independent of the cell cycle.
  • This form of core localization can be caused by the type of tumor itself, or can be brought about by the agents or measures according to the invention described herein.
  • the present invention thus defines a new group of tumors or tumor diseases and thus also of patients who can still be treated effectively with the viruses according to the invention, but particularly also with the attenuated or modified adenoviruses already described in the prior art.
  • adenoviruses such as Ad ⁇ 24, dl922-947, ElAd / 01/07, CB106 and / or those described in European patent EP 0931 830 can also replicate in cells which are YB-1 nucleus positive and / or in cells in which YB-1 is deregulated in the sense of the present invention.
  • these adenoviruses can be used according to the invention for the treatment of diseases or patient groups which have cells with these properties, in particular if these cells are involved in the development of the respective disease to be treated.
  • a further group of patients who can be treated according to the invention using the viruses described herein as to be used according to the invention or using the viruses described here for the first time, in particular adenoviruses are thus those who are YB-1 core-positive and / or YB -1 are core positive as a result of the treatments described below and or those patients who have experienced one of the following measures, preferably in the sense of treatment, or who experience it simultaneously with the administration of the corresponding viruses.
  • YB-1 nucleus-positive patients are those patients who, in particular in a number of the cells forming a tumor, have YB-1 in the nucleus independently of the cell cycle.
  • measures include the administration of cytostatics as described overall herein and / or used in the context of tumor therapy.
  • This group of measures also includes radiation, in particular radiation as used in the context of tumor therapy. Irradiation means in particular the irradiation with high-energy radiation, preferably with radioactive radiation, more preferably as used in the context of tumor therapy.
  • Another measure is hyperthermia or the application of hyperthermia, preferably hyperthermia, as used in the context of tumor therapy. In a very particularly preferred embodiment it is provided that hyperthermia is used locally.
  • hormone treatment in particular the hormone treatment that is used in tumor treatment.
  • Anti-estrogens and / or anti-androgens are used in the context of such a hormone treatment. Anti-estrogens, such as tamoxifen, are used in particular in the treatment of breast cancer and anti-androgens, such as flutamide or cyproterone acetate, are used in the treatment of prostate cancer.
  • some of the cells that make up the tumor have YB-1 either inherently or after induction or active insertion into the nucleus, or else deregulated with respect to YB-1 in the sense of the present disclosure.
  • YB-1 preferably, about 5% or any percentage above, ie 6%, 7%, 8% etc. of the cells making up the tumor are such YB-1 nucleus-positive cells or cells in which YB-1 is deregulated.
  • the core localization of YB-1 can be induced by external or locally applied stress. This induction can be caused, for example, by radiation, in particular UV radiation, application of cytostatics, as also disclosed herein, among others, and hyperthermia.
  • the medicament according to the invention would thus also be administered to those patients and patient groups or would be intended for those in whom a transport of YB-1, in particular into the corresponding tumor cells, would be caused by suitable pretreatments or simultaneous treatment.
  • the adenoviruses used according to the invention are able to replicate in cells or cellular systems which have YB-1 in the nucleus.
  • the status of the cells is independent with regard to the presence or absence of Rb, ie the retinoblastoma tumor suppressor product.
  • the oncogene or oncogene protein in particular EIA, can either be under the control of its own natural adenoviral promoters and / or can be controlled via a tumor or tissue-specific promoter.
  • Suitable non-adenoviral promoters can be selected from the group consisting of the cytomegalovirus promoter, RSV (Rous sarcoma Virus) promoter, adenovirus-based promoter Va I and the non-viral YB-1 promoter (Makino Y. et al. , Nucleic Acids Res. 1996, 15, 1873-1878).
  • telomerase promoter the alpha-fetoprotein (AFP) promoter
  • CEA caecinoembryonic antigen promoter
  • L-plastin promoter Choung, L, Schwartz, PE., Crystal, RC, Pizzorno, G, Leavitt, J., Deisseroth, AB. Cancer Gene Therapy, 6, 99-106, 1999
  • argenin-vasopressin promoter Coulson, JM, Staley, J., Woll, PJ. British J. Cancer, 80, 1935-1944, 1999
  • E2f promoter Tsukada et al.
  • telomerase promoter is known to be of central importance in human cells.
  • hTERT telomerase reverse transcriptase gene
  • Telomerase expression is active in 85% of human tumor cells. In contrast, it is inactive in most normal cells. Germ cells and embryonic tissue are excluded (Braunstein, I. et al., Cancer Research, 61, 5529-5536, 2001; Majumdar, AS et al., Gene Therapy 8, 568-578, 2001).
  • transgene in particular one selected from the group comprising E4orf6, ElB55kD, ADP and YB-1, is also provided in one embodiment in an adenoviral vector under one of these promoters. It is also within the scope of the present invention that the reading frame of the transactivating oncogene protein, in particular the EIA protein, is in frame with one or more of the gene products of the adenoviral system. The reading frame of the transactivating EIA protein can however, be independent of it.
  • Resistance preferably denotes resistance to the cytostatics described herein.
  • This multiple resistance is preferably associated with the expression, preferably overexpression, of the membrane-bound transport protein P-glycoprotein, which can be used as a marker for the determination of corresponding cells and thus also of tumors or corresponding patient groups exhibiting them.
  • resistance encompasses both the resistance referred to as classic resistance, mediated by the P-glycoprotein, and the resistance also referred to as atypical resistance, the resistance mediated by MRP or other, non-P-glycoprotein mediated resistance includes.
  • Another marker that correlates with the expression of YB-1 is topoisomerase II alpha.
  • the expression of topoisomerase II alpha can be used in place of or in addition to the determination of YB-1 in the core in a screening method to determine whether a patient can be treated with the adenoviruses according to the invention with the prospect of success become.
  • a marker that can basically be used similarly to the P-glycoprotein is MRP.
  • PCNA proliferating cell nuclear antigen (Hasan S. et al., Nature, 15, 387-391, 2001.), as described, for example, by Shibao K. et al. (Shibao K et al., Int. Cancer, 83, 732-737, 1999).
  • MDR International: multiple drug resistance
  • Another possible marker which can be used according to the invention is p73 (Kamiya, M., Nakazatp, Y., J Neurooncology 59, 143-149 (2002); Stiewe et al., J. Biol. Chem., 278, 14230-14236, 2003).
  • the viruses described here can in principle be used to treat tumors.
  • These tumors are preferably selected from the group comprising breast cancer, ovarian cancer, prostate cancer, osteosarcoma, glioblastoma, melanoma, small cell lung cancer and colorectal cancer.
  • Further tumors are those which are resistant, as described herein, preferably genes which are multi-resistant, in particular also those tumors of the group described above.
  • the invention also relates to a method for screening patients who are infected with a modified adenovirus, i.e. an adenovirus as used according to the invention, such as Ad ⁇ 24, dl922-947, ElAd / 01/07, CB016 or the viruses described in European patent EP 0931 830, the method comprising the following steps:
  • the presence of the markers described above can also be determined.
  • the tumor tissue or a part thereof has YB-1 localized in the cell nucleus, in particular independently of the cell cycle, the adenoviruses disclosed herein can be used according to the invention.
  • the tumor tissue is examined using an agent selected from the group consisting of antibodies against YB-1, aptamers against YB-1, Spiegelmers against YB-1 and anticalins against YB- 1 includes.
  • an agent selected from the group consisting of antibodies against YB-1, aptamers against YB-1, Spiegelmers against YB-1 and anticalins against YB- 1 includes.
  • the production of antibodies, particularly monoclonal antibodies, is known to those skilled in the art.
  • Another means for the specific detection of YB-1 or the markers are peptides which bind with high affinity to their target structures, in the present case YB-1 or the said markers. Methods are known in the prior art, such as phage display, for generating such peptides.
  • a peptide library is typically assumed here, the individual peptides having a length of approximately 8 to 20 amino acids and the size of the library being approximately 10 2 to 10 18 , preferably 10 8 to 10 15 different peptides.
  • a special form of polypeptides that bind to target molecules are the so-called anticalins, as are described, for example, in German patent application DE 197 42 706.
  • aptamers Another means of specifically binding to YB-1 or the corresponding markers disclosed herein and thus for detecting a cell cycle-independent localization of YB-1 in the cell nucleus are the so-called aptamers, ie D-nucleic acid, which are based on RNA or DNA either as a single strand or as a double strand and bind specifically to a target molecule.
  • the production of aptamers is described, for example, in European patent EP 0 533 838.
  • a special form of aptamers are the so-called aptazymes, which are described, for example, by Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, No. 29, pages 4369-4373.
  • aptamers insofar as, in addition to the aptamer part, they also have a ribozyme part and, after binding or release of the target molecule binding to the aptamer part, the ribozyme part catalytically becomes active and cleaves a nucleic acid substrate, which is accompanied by the generation of a signal.
  • aptamers are so-called Spiegelmers, ie target molecule-binding nucleic acids that are made from L-nucleic acids. The method for producing these Spiegelmers is described, for example, in WO 98/08856.
  • the sample of the tumor tissue can be obtained by puncture or by surgery.
  • the determination as to whether the nucleus is located independently of the cell cycle in the YB-1 is frequently carried out using microscopic techniques and / or by means of immunohistoanalysis, typically using antibodies or one of the other means mentioned above.
  • Other methods for detecting that YB-1 is located in the nucleus and in particular there independently of the cell cycle are known to those skilled in the art. For example, when screening tissue sections stained against YB-1, the location of YB-1 can be easily recognized. As a result of the frequency of the occurrence of YB-1 in the nucleus, it is clear that it is a cell cycle-independent localization in the nucleus.
  • Another possibility for the cell cycle-independent detection of YB-1 in the nucleus is to carry out a staining against YB-1 and to determine whether YB-1 is located in the nucleus and to determine the cell stage of the cells.
  • this or the detection of YB-1 can also be carried out using the abovementioned means directed against YB-1.
  • Proof of funds is provided through procedures that are known to those skilled in the art.
  • the fact that the said agents are specifically directed against YB-1 and so far do not bind to other structures within the sample to be investigated, in particular the cells means that the agents can also be localized and, as a result of the specific binding to YB-1, by suitable labeling of the agents the localization of YB-1 can be demonstrated accordingly. Methods for labeling the agents are known to those skilled in the art.
  • AdEl / E3-minus adenovirus which are El / E3-deleted adenoviruses, wild-type adenovirus and adenovirus dl520
  • 2 shows the binding domains of the EIA protein with regard to the binding of p300, pl07 and pl05;
  • FIG. 6 shows the result of an EMSA analysis, with which it is proven that YB-1 is present in the multiple-resistant cells or cell lines 257RDB, 181 RDB, MCF-7Ad- in the cell nucleus, whereas YB-1 is not present in U2OS and HeLa cells is present in the core;
  • Fig. 7 shows the structural structure of the EIA protein from wild-type adenovirus, from
  • Fig. 8 is a bar graph showing the replication efficiency of adenoviruses
  • Fig. 12 is a graph of tumor volume over time of different tumors
  • FIG. 13 pictures of euthanized mice based on a tumor
  • RDB257 cells developed after treatment with PBS or with 5 x 10 8 pfu dl520;
  • 15 is a bar graph showing the replication efficiency or the particle formation of dl520 and wild-type adenovirus in YB-1 nucleus-positive tumor cells (257RDB and 181RDB) and YB-1 nucleus-negative tumor cells (HeLa, U2OS);
  • 16 shows the structural structure of the wild-type adenovirus and the adenoviral
  • Fig. 1 shows the structural structure of the adenoviral vectors AdEl / E3-minus, i.e. of the E1 / E3 deleting adenovirus, wild-type adenovirus and adenovirus dl520.
  • the Adenoviras AdEl / E3 minus has no functional areas for El A and none for El B and no areas coding for E3 and serves as a toxicity control in the context of the experiments carried out
  • the wild-type El A gene codes for a total of 5 proteins which result from alternative splicing of the RNA from EIA. Among other things, two different proteins are produced, namely a 289 amino acid protein and a 243 amino acid protein. D1520 does not code for the 289 amino acid protein because it has a deletion in the CR3 region of the EIA gene, which leads to an absence of the 13S gene product.
  • the adenoviras dl520 which can be used according to the invention is referred to by experts as the 12S-E1A virus.
  • the adenovirus dl347 known in the prior art (Wong and Ziff, J. Virol., 68, 4910-4920, 1994) is also a 12S-E1 A virus which can be used according to the invention.
  • CR1, CR2 and CR3 are 3 areas that are conserved in the different adenoviral subtypes. These are called CR1, CR2 and CR3. While CR1 and CR2 occur in both E1A proteins (EIA 12S and EIA 13S), i. H. for both the 289 amino acid and the 243 amino acid long protein, the CR3 region can only be found in the larger of the two aforementioned proteins.
  • the CR3 area is required for the activation of the viral genes, in particular of E1B, E2, E3 and E4.
  • Viruses that have only the smaller, 243 amino acid protein only weakly transactivate the viral genes and do not perform adenoviral replication in cells that do not have YB-1 in the nucleus. Since YB-1 is only present or detectable in the nucleus of tumor cells, this vector is suitable for inducing tumor-specific replication.
  • this adenovirus Due to the deletion of CR3 in dl520, this adenovirus is not able to translocate cellular YB-1 into the cell nucleus, also referred to herein as translocating, and thus is also not able to replicate in YB-1 nucleus-negative cells and thus represents one of the viruses to be used according to the invention, this virus having the transactivating rank required according to the invention.
  • Example 2 Mechanism of action of adenoviruses depending on the Rb status of cells
  • P300 is a cellular binding protein.
  • the retinoblastoma protein (pRb), a tumor suppressor protein, is bound via CRl and CR2.
  • pRb and pl07 / p300 in conjunction with the cellular transcription factor E2F exert a transcriptional regulation.
  • the wild-type EIA protein interrupts the binding of E2F to Rb.
  • the E2F released in this way binds to the E2 early promoter and thereby induces adenoviral replication.
  • the adenoviral vector dl922-947 has a deletion in the CR2 region (amino acid positions 122-129) and the vector GBO 16 deletions in the regions CRl (amino acid positions 27-80) and CR2 (amino acid positions 122-129).
  • the vector ElA ⁇ f / 01/07 has a deletion in the CR2 region (amino acid positions 111-123).
  • the adenoviral vector Ad ⁇ 24 has a deletion in the CR2 region (amino acid positions 120-127).
  • the adenoviral vector described in patent EP 0 931 830 has deletions in the CR1 and CR2 region.
  • E2F / RB and the release of E2F mediated by EIA is fundamentally different from the mechanism on which the present invention is based.
  • the release of E2F from the Rb protein is not as in the prior art assumed to be an important, if not to say the crucial, process of adenoviral replication, but rather the nuclear localization of the human transcription factor YB-1. This transcription factor occurs in normal cells over most of the cell cycle only in the cytoplasm.
  • tumor diseases such as, but not limited to, breast cancer, ovarian carcinoma, prostate carcinoma, osteosarcoma, glioblastoma, melanoma, small cell lung carcinoma and colorectal carcinoma Core before.
  • the U2OS cells which do not have YB-1 in the nucleus, after infection with two different adenoviruses, namely the El / E3-deleted adenovirus designated as E1 / E3 minus and adenovirus dl520, which are used according to the invention can, no lysis, as shown by crystal violet staining of the cells.
  • the medium is first removed.
  • the cells are then overlaid with crystal violet (50% ETOH, 3% formaldehyde, 5% acetic acid, 1% crystal violet) and incubated for 5-10 min at room temperature.
  • the plates are then washed with 6 wells with water and dried at room temperature.
  • the result of this experiment is shown in Fig. 4.
  • the Adenoviras designated El / E3-minus Ad5, deleted El / E3-deleted adenovirus shows no lysis at low MOIs (pfu / cell) when 257RDB cells are infected, which have YB-1 in the nucleus.
  • dl520 which, as demonstrated in Example 3, does not replicate in YB-1 nucleus-negative cells and at the same time codes with EIA for an oncogene protein which is transactive in the sense of the present invention, shows a practically complete lysis in an MOI (multiplicity) of infection) of 40 pfu per cell and a still predominant lysis with an MOI of 10 pfu per cell.
  • dl 520 and comparable viruses as described here, for example with dll 119/1131 or AdXvir 03, require a MOI which is reduced by approximately one order of magnitude (approximately ten times) compared to an El-deleted or an El / E3-deleted adenoviur , which justifies their suitability for clinical use.
  • the EIA protein of dl520 is distinguished in that the region CR3 is deleted therefrom, which leads to the transactivation and replication required for the use of the adenovirus according to the invention in YB-1 nucleus-positive cells.
  • the adenoviras dll 119/1131 thus represents a further adenoviras that can be used according to the invention. It is within the scope of the present invention that viruses can also be used which are designed like dll 119/1131 in terms of the CR3 range, but in a difference for this purpose have the area CR1 and / or CR2.
  • the experiment is based on the idea that nuclear YB-1 as a transcription factor should bind to the Y box (CAAT sequence) within the mdrl promoter (multiple drug resistance promoter).
  • EMSA analysis episomal mobility shift assay
  • Core protein is isolated and then 1-10 ⁇ g protein with a short DNA fragment (oligo) are incubated together at 37 ° C.
  • the following oligonucleotide was used to determine nuclear YB-1: mdrl promoter in contrast to U20S (position -86 to -67): TGAGGCTGATTGGCTGGGCA (the Y-box is underlined).
  • This DNA fragment is previously radioactively labeled with 32 P using a kinase at the 5 'end.
  • the separation is then carried out in a native polyacrylamide gel. If the protein YB-1 binds to a sequence on the oligonucleotide, this can be seen since unbound oligonucleotide migrates faster in the gel than the bound oligonucleotide (Holm, PS et al., JBC 277, 10427-10434, 2002; Bargou, RC et al., Nature Medicine 3, 447-450, 1997). As shown in FIG. 6, it could be shown in an EMSA analysis that YB-1 is present in the core in the multiple-resistant cells 257RDB, 181RDB and MCF-7Ad cells, in contrast to the cell lines U2OS and HeLa cells.
  • the results prove that even weak transactivation of the viral genes in YB-1 nucleus-positive cells compared to the wild-type adenovirus by the modified or deleted EIA gene products in the presence of YB-1 in the cell nucleus successfully with replication and lysis is accompanied by such cells, including, for example, multi-resistant cells, and thus the adenoviruses described herein can be used in the lysis of such tumors.
  • Example 7 Increasing the replication efficiency of El minus adenoviruses
  • Ad-55k is an E1 E3 deleted virus, whereby ElB-55k has been cloned into the El and is under CMV control. This substitution is required because AdYB-1, i.e. H.
  • an adenovirus which expresses YB-1 does not express these early genes and the present inventor has recognized that substitution of these early genes in a replication system in which YB-1 is present in the core is able to improve the replication efficiency or to increase the particle formation efficiency to an extent comparable to that of wild-type adenoviruses of the type Ad5.
  • the plasmid pE4orf6 carries the DNA sequence coding for the early viral gene E4orf6 under CMV control. 24 hours after the transfection with the plasmid pE4orf6, the cells were infected with the YB-1 expressing El / E3-deleted adenovirus AdYB-1 (50 pfu / cell) and the E1 / E3-deleted E1B-55K adenovirus Ad-55K (50 pfu / Cell) infected.
  • Ad-55K is an E1 / E3-deleted virus which carries the viral gene E1B-55K as a transgene under CMV control.
  • FIG. 8 shows the result of the plaque assay, shown in absolute numbers.
  • the clearest difference to infection with AdYB-1 alone shows the combination of transfection with the plasmid pE4orf6 and co-infection with the two viruses AdYB-1 and Ad-55K.
  • FIG. 9 shows the result of FIG.
  • the oncolytic assays were carried out as follows. 200,000 cells (HeLa or U2OS) were plated out in 6-well plates per well. The next day, 40 ng / ml (final concentration) of daunorubicin was added. After an incubation period of 3 hours, the cells were infected with 10 and 30 pfu dl520 / cell. The cells were then incubated in cytostatics-free medium. After 3-5 days, the cells were stained with crystal violet.
  • daunorubicin induces replication of dl520 by the nuclear localization of YB-1.
  • dl520 achieves a greater tumor-lytic effect than daunorubicin alone.
  • the HeLa (YB-1 nucleus negative) and 257RDB (YB-1 nucleus positive) cells used in this in vivo study are expanded under sterile cell culture conditions. Shortly before the cells are injected into the mice (strain CDlNuNu) in order to set a tumor subcutaneously, they are harvested by trypsinization, taken up in DMEM medium (10% FCS), counted and rinsed once with PBS. The cells are then centrifuged, the PBS is suctioned off and portioned in fresh PBS corresponding to the desired cell number. The subcutaneously injected cell count was 5xl0 6 cells from both cell lines in this study.
  • the injection is subcutaneous into one flank of the animals, with the HELA cells in the right side and the 257RDB- Cells were injected into the left flank for better differentiation.
  • the growth of the tumors was checked twice a week and the length and width of the tumors were measured using a sliding void.
  • the tumor volume was calculated from this using the following mathematical formula:
  • the virus or PBS is administered as a mtratumoral negative control.
  • the volumes to be injected were the same and each was 50 ⁇ l. This is repeated on 3 consecutive days.
  • the total dose of virus applied was 5 ⁇ 10 8 pfu.
  • the tumor growth is then documented twice a week and the volume is calculated.
  • the mice are euthanized and the tumors removed for further analysis.
  • FIG. 12 shows a diagram which shows the volume of the tumor as a function of time and the various treatment regimens.
  • a significant growth of the tumor of approximately 438 mm 3 to 1466 mm 3 occurs when PBS is injected.
  • the tumor growth was significantly reduced under the influence of the vector dl520 used according to the invention.
  • the tumor size increased by only 21% to a total of 543 mm 3 .
  • the tumor from HeLa cells was used in the present example, which behaved similarly in terms of growth when PBS was administered, like the tumor attributable to RDB257 when PBS was administered.
  • HeLa cell-based tumors treated with dl520 showed an even more substantial increase in tumor growth from 311 mm to 1954 mm 3 .
  • Fig. 13 shows photographs of euthanized nude mice to whom a tumor was set using RDB257. It can be clearly seen that after the application of the adenovirus dl520 according to the invention, a significant regression of the Tumor occurred. In the present case, the tumor volume was even reduced (day 1 after application of virus dl520: 515 mm 3 ; day 30 after application of virus dl520: 350 mm 3 .
  • the DNA is isolated from a piece of tumor which has been removed from the center of the tumor set in Example 9.
  • the Dneasy Tissue Kit from Qiagen is used for the insulation. DNA isolation was carried out according to the manufacturer's instructions. The DNA is released from the cells by alkaline lysis. Isolated DNA is then purified on a column. The concentration of the isolated DNA is then measured photometrically at 260 nm. The analysis was carried out using 2 ⁇ g of the DNA samples, which were digested with the restriction enzyme Kpn I 10 units. The samples are then separated electrophoretically in a 0.8% agarose gel. The DNA was then blotted onto a nylon membrane (according to the Schleicher & Schuell system).
  • the DNA blotted on the membrane is hybridized against a specific 1501 bp DNA probe.
  • the 1501 bp DNA probe specifically binds to the 3369 bp Kpn I fragment within the E2A-coding Ad5 sequence.
  • the probe was previously prepared by PCR (primer: 5'- GTC GGA GAT CAG ATC CGC GT, 5'- GAT CCT CGT CGT CTT CGC TT) and radioactively labeled with 32 P.
  • the membrane is then washed and exposed on a film.
  • FIG. 14 The result of the Southern blot of the tumor DNA is shown in FIG. 14.
  • the analysis shows that only dl520 replicates in vitro in the resistant cells RDB257, as shown in lanes 3, 4 and 5.
  • Lane 1 shows Ad-5d
  • FIG. 15 Another result with dl520 is shown in FIG. 15.
  • Various YB-1 nuclear positive (257RDB and 181RDB) tumor cells and YB-1 nuclear negative tumor cells are infected with dl520 and wild-type adenovirus.
  • Each 100,000-200,000 cells are plated in so-called plates with 6 wells in L 15 medium (resistant cells) or DMEM (non-resistant cells) each with 10% FCS. After 24 hours, infection with dl520 and WT adenovirus (10 pfu / cell) takes place. 3 days after the infection (post infectionem), the viral particles are released from the cell suspension (3 ml) by three alternating freezes and thaws / freeze). A plaque assay was then carried out on 293 cells to determine the infectious particles formed (plaque forming units per ml (pfu / ml)). The result is shown in FIG. 15.
  • the result of the plaque assay shows that dl520 replicates in the YB-1 nucleus-positive cells (257RDB and 181RDB) comparable to the wild-type adenovirus.
  • a replication efficiency comparable to that of wild-type adenoviruses is achieved.
  • Example 11 Structural structure of the adenoviral vector Xvir03
  • Fig. 16 shows the structural structure of the adenoviral vector Xvir03.
  • the Adenoviras Xvir03 is a so-called El / E3-deleted Adenoviras. This means that no EIA, E1B and E3 proteins that are functional for adenoviral replication are produced.
  • the deletion of the El Region extends from 342 - 3528; the deletion of the E3 region from amino acid position 27865-30995.
  • the term "El deleted virus” means such a virus in which El is no longer functionally active. This can be done by inactivation with the nucleic acid or amino acid sequence otherwise largely intact, but can also mean a different size deletion of the protein coding for the E1 region.
  • the E4 region for example E4orf6, is not or only very weakly expressed (approx. 1-5% compared to the wild-type adenovirus).
  • the viral genes ElB55k and E4orf6 are mediated by the heterologous CMV promoter (Clontech: Plasmid pShuttle) expressed.
  • CMV promoter the heterologous CMV promoter
  • those promoters described here can also be used, as disclosed in connection with the expression of EIA.
  • IRES sequence internal ribosomal entry site
  • This element Novagen company: pCITE
  • pCITE allows the expression of 2 proteins from one mRNA.
  • the plasmid ElB55k-pShuttle was obtained by cloning the open reading frame of ElB55k from pCGNElB from M. Dobelstein (University of Marburg) with Xbal and Bfrl into the pShuttle vector from Clontech. Then ElB55k was linearized in pShuttle with Apal, the ends smoothed and cut with Nhel.
  • IRES-E4orf6 in pcDNA3.1 (+) was linearized with Notl, the ends were smoothed and then the fragment IRES-E40RF6 was cut out with Nhel.
  • the fragment IRES-E4orfF6 was linked to the opened vector ElB55k-pShuttle (blunt, Nhel).
  • the cassette was then removed from the ElB55k-IRES-E4orf6-pShuttle together with the CMV promoter and the bovine growth hormone (BGH) -PolyA into the ⁇ E1, ⁇ E3 Adeno-X plasmid (Clontech) with I-Ceu I and Pl- Scel Moniert and designated as AdcmvElB / IRES / E4orf6.
  • the adenovirus was then produced according to the manufacturer's instructions (Clontech).
  • the Pacl linearized adenoplasmid with the expression element CMV-ElB55k-IRES-E4orf6-BGH polyA was transfected with in HEK293 cells and after 11 days post transfectionem the detaching cells were removed together with the medium in order to obtain the resulting cells by repeated freeze-thaw cycles To release adenoviruses.
  • the vector described above is basically suitable like the other viruses to be used according to the invention described herein.
  • the vector described above is suitable for use in YB-1 nucleus-positive cells and cells in which YB-1 deregulated, that is to say overexpressed in comparison to normal cells or non-tumor cells, to replicate and to this extent bring about lysis.
  • the use of this vector also extends in particular to those diseases and patient groups or patient groups which are disclosed for the other adenoviruses and adenoviruses according to the invention to be used according to the invention described herein.
  • Example 12 Structural structure of the adenoviral vector Xvir03 / 01
  • XVTR03 / 01 is a further development of XVIR03.
  • therapeutic genes such as the genes and transgenes described here can be cloned in the E3 region.
  • a deletion was also introduced in the E4 region in order to avoid homologous recombination with the E4orf6 from the expression cassette of Xvir03. This also means that larger transgenes can be cloned in this contract.
  • the deleted E3 region contains Sacl, Ndel and Nhel interfaces which can be used for inserting a cassette and into which, for example, the therapeutic transgenes can be cloned.
  • the Clontech pAdenoX plasmid has an SfuI interface behind the 3 'ITR region, which is absent in the wild-type adenovirus.
  • the expression cassette was then, as described for Xvir03, from the ElB55k-IRES-E4orf6-pShuttle together with the CMV promoter and the bovine growth hormone (BGH) -PolyA into the pAdenoX E3 ⁇ 27865-30995, E4 ⁇ 33241-33875 with I-Ceu I and Pl -Scel cloned and designated as AdcmvElB / IRES / E4orf6- ⁇ E4.
  • BGH bovine growth hormone
  • the vector described above is fundamentally suitable like the other viruses to be used according to the invention described herein.
  • the vector described above is suitable for YB-1 nucleus-positive cells as well as cells in which YB-1 deregulates, i.e. compared to normal cells or non-tumor cells overexpressed to replicate and to this extent bring about lysis.
  • the use of this vector also extends in particular to those diseases and patient groups or patient groups which are disclosed for the other adenoviruses and adenoviruses according to the invention to be used according to the invention described herein.
  • Example 13 Oncolytic effect of Xvir 03 in 257 RDB and 181 RDB cells
  • the multiple-resistant cells which have YB-1 in the nucleus show lysis only with Xvir03, as shown by crystal violet staining of the cells.
  • the medium is first removed.
  • the cells are then overlaid with crystal violet (50% ETOH, 3% formaldehyde, 5% acetic acid, 1% crystal violet) and incubated for 5-10 min at room temperature.
  • the plates are then washed thoroughly with water using six wells and dried at room temperature.
  • ElA-deleted viruses eg Ad312
  • Ad312 ElA-deleted viruses
  • adenovirus Ad312 used here is an ElA-deleted virus.
  • the early adenoviral genes such as, for example, ElB55k and E4orf6 are not or only very slightly expressed (Nevins J. R, Cell 26, 213-220, 1981).
  • these genes or the proteins play an important role in viral replication.
  • these genes or proteins are expressed in the adenoviras Xvir03 (Fig. 16), and it can be seen from Figs. 18A and 18B that the expression of the genes ElB55k and E4orf6 lead to efficient viral replication and cell lysis with a simultaneously low infection titer ( expressed as pfu / cell)
  • a simultaneously low infection titer expressed as pfu / cell

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/EP2003/005583 2002-05-27 2003-05-27 Neue verwendung von adenoviren und dafür codierenden nukleinsäuren Ceased WO2003099859A2 (de)

Priority Applications (27)

Application Number Priority Date Filing Date Title
CA002487811A CA2487811A1 (en) 2002-05-27 2003-05-27 Use of adenoviruses replicating in a yb-1 dependent manner for the treatment of tumors
EP03755145.4A EP1506021B1 (de) 2002-05-27 2003-05-27 Verwendung von adenoviren und dafur kodierenden nukleinsäuren
CN03812310XA CN1655827B (zh) 2002-05-27 2003-05-27 腺病毒和编码其的核酸的新应用
US10/515,238 US20060099178A1 (en) 2002-05-27 2003-05-27 Novel use of adenoviruses and nucleic acids coding therefor
AU2003242585A AU2003242585A1 (en) 2002-05-27 2003-05-27 Novel use of adenoviruses and nucleic acids coding therefor
JP2004508113A JP5213298B2 (ja) 2002-05-27 2003-05-27 アデノウイルスおよびそれをコードしている核酸の新たな使用
KR1020047019231A KR101083450B1 (ko) 2002-05-27 2003-05-27 아데노바이러스 및 그를 코딩하는 핵산의 신규 용도
DK03753560.6T DK1554375T3 (en) 2002-10-15 2003-10-15 Adenovirus expressing genes in reverse order and use thereof
SG200703426-7A SG165168A1 (en) 2002-10-15 2003-10-15 New adenoviruses, nucleic acids coding therefor and their use
CN2003801015004A CN1705740B (zh) 2002-10-15 2003-10-15 具有反向基因表达的腺病毒及其应用
CA2515650A CA2515650C (en) 2002-10-15 2003-10-15 New adenoviruses, nucleic acids coding therefor and their use
PCT/EP2003/011427 WO2004035616A2 (de) 2002-10-15 2003-10-15 Adenovirus mit umgekehrter reihenfolge der expression von genen und verwendung davon
AU2003271730A AU2003271730A1 (en) 2002-10-15 2003-10-15 Novel adenoviruses, nucleic acids coding therefor, and use thereof
EP03753560.6A EP1554375B1 (de) 2002-10-15 2003-10-15 Adenovirus mit umgekehrter reihenfolge der expression von genen und verwendung davon
MXPA05004074A MXPA05004074A (es) 2002-10-15 2003-10-15 Nuevos adenovirus, acidos nucleicos que los codifican y su uso.
US10/531,366 US8951772B2 (en) 2002-10-15 2003-10-15 Adenoviruses, nucleic acids coding therefor, and use thereof
JP2005501293A JP4988199B2 (ja) 2002-10-15 2003-10-15 新規アデノウイルス、それをコードする核酸及びその使用
RU2005114516/13A RU2393221C2 (ru) 2002-10-15 2003-10-15 Аденовирус с обращенной генной экспрессией и его применение
PL376573A PL219321B1 (pl) 2002-10-15 2003-10-15 Adenowirus, kodujący go kwas nukleinowy, zawierający je układ replikacyjny, wektor, komórka i organizm, ich zastosowanie oraz środek farmaceutyczny
KR1020057006313A KR101123510B1 (ko) 2002-10-15 2003-10-15 신규한 아데노바이러스, 이를 암호화하는 핵산 및 이들의 조성물
ZA2004/09361A ZA200409361B (en) 2002-05-27 2004-11-22 Novel use of adenoviruses and nucleic acids coding therefore
ZA2005/02680A ZA200502680B (en) 2002-10-15 2005-04-01 Adenovirus expressing genes in reverse order and use thereof
US12/769,435 US10155930B2 (en) 2002-05-27 2010-04-28 Use of adenovirus and nucleic acids coding therefor
AU2010219364A AU2010219364B2 (en) 2002-05-27 2010-09-09 Novel use of adenoviruses and nucleic acids coding therefor
US15/452,470 US10538744B2 (en) 2002-05-27 2017-03-07 Use of adenovirus and nucleic acids coding therefor
US16/176,461 US10731136B2 (en) 2002-05-27 2018-10-31 Use of adenovirus and nucleic acids coding therefor
US16/704,669 US11268073B2 (en) 2002-05-27 2019-12-05 Use of adenovirus and nucleic acids coding therefor

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
DE10223534.1 2002-05-27
DE2002123534 DE10223534A1 (de) 2002-05-27 2002-05-27 Verwendung von Adenoviren und dafür codierenden Nukleinsäuren
DE10225400.1 2002-06-07
DE10225400 2002-06-07
DE10248039 2002-10-15
DE10248039.7 2002-10-15
DE10322530.7 2003-05-19
DE10322530 2003-05-19

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US10/515,238 A-371-Of-International US20060099178A1 (en) 2002-05-27 2003-05-27 Novel use of adenoviruses and nucleic acids coding therefor
US10515238 A-371-Of-International 2003-05-27
US12/769,435 Continuation US10155930B2 (en) 2002-05-27 2010-04-28 Use of adenovirus and nucleic acids coding therefor

Publications (2)

Publication Number Publication Date
WO2003099859A2 true WO2003099859A2 (de) 2003-12-04
WO2003099859A3 WO2003099859A3 (de) 2004-04-15

Family

ID=29587746

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/005583 Ceased WO2003099859A2 (de) 2002-05-27 2003-05-27 Neue verwendung von adenoviren und dafür codierenden nukleinsäuren

Country Status (9)

Country Link
US (5) US20060099178A1 (https=)
EP (1) EP1506021B1 (https=)
JP (3) JP5213298B2 (https=)
KR (1) KR101083450B1 (https=)
CN (2) CN101843641B (https=)
AU (2) AU2003242585A1 (https=)
CA (1) CA2487811A1 (https=)
WO (1) WO2003099859A2 (https=)
ZA (1) ZA200409361B (https=)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005051430A1 (de) * 2003-11-14 2005-06-09 Per Sonne Holm Neue verwendung von adenoviren und dafür codierenden nukleinsäuren
WO2006070023A3 (en) * 2004-12-31 2006-09-21 Per Sonne Holm Method for reversing multiple resistance in animal cells
WO2006070024A3 (de) * 2004-12-31 2006-12-28 Per Sonne Holm E1 -minus adenoviren und deren verwendung
WO2012022496A2 (en) 2010-08-19 2012-02-23 Per Sonne Holm Method for killing tumor stem cells
US8361976B2 (en) 2004-07-09 2013-01-29 University Of Massachusetts Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
US10155930B2 (en) 2002-05-27 2018-12-18 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
WO2019170283A1 (en) 2018-03-05 2019-09-12 Klinikum Rechts Der Isar Der Technischen... Treatment of tumors by a combination of an oncolytic adenovirus and a cdk4/6 inhibitor
WO2021044061A1 (en) 2019-09-05 2021-03-11 Klinikum Rechts Der Isar Der Technischen Universität München Treatment of tumors by a combination of an oncolytic adenovirus, a cdk4/6 inhibitor and a further therapeutically active agent
CN112601812A (zh) * 2018-06-25 2021-04-02 圣拉斐尔医院有限责任公司 基因疗法

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1689446B1 (de) * 2003-11-14 2015-01-07 Per Sonne Holm Neue adenoviren, dafür codierende nukleinsäuren und deren verwendung
SG11201507393TA (en) 2013-03-14 2015-10-29 Salk Inst For Biological Studi Oncolytic adenovirus compositions
KR102608590B1 (ko) 2014-09-24 2023-12-01 솔크 인스티튜트 포 바이올로지칼 스터디즈 종양 살상 바이러스 및 이의 사용방법
WO2017147265A1 (en) 2016-02-23 2017-08-31 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
WO2017147269A1 (en) 2016-02-23 2017-08-31 Salk Institute For Biological Studies Exogenous gene expression in therapeutic adenovirus for minimal impact on viral kinetics
EP3532082A4 (en) 2016-12-12 2020-08-26 Salk Institute for Biological Studies SYNTHETIC ADENOVIRUS TUMOR TARGETING AND THEIR USES
CN112292449A (zh) 2018-04-09 2021-01-29 萨克生物研究学院 具有增强的复制特性的溶瘤腺病毒组合物
CN120060368A (zh) * 2020-03-23 2025-05-30 株式会社库利金 包含双特异性核酸分子的溶瘤病毒的结构
CN114540349B (zh) * 2020-11-27 2024-11-22 中国科学院分子细胞科学卓越创新中心 结合yb-1蛋白的核酸分子
CA3233100A1 (en) 2021-09-23 2023-03-30 Sagittarius Bio, Inc. Adenoviruses and methods for using adenoviruses

Family Cites Families (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US931830A (en) * 1907-09-17 1909-08-24 Harry Zimmerman Material-cutter.
US4947842A (en) 1988-09-22 1990-08-14 Medical Engineering And Development Institute, Inc. Method and apparatus for treating tissue with first and second modalities
ES2259800T3 (es) 1990-06-11 2006-10-16 Gilead Sciences, Inc. Procedimientos de uso de ligandos de acido nucleico.
US5801029A (en) 1993-02-16 1998-09-01 Onyx Pharmaceuticals, Inc. Cytopathic viruses for therapy and prophylaxis of neoplasia
ATE178490T1 (de) * 1993-02-16 1999-04-15 Onyx Pharmaceuticals Cytopathische viren zur therapie und prophylaxe der neoplasie
US5698443A (en) 1995-06-27 1997-12-16 Calydon, Inc. Tissue specific viral vectors
ATE336587T1 (de) 1994-06-10 2006-09-15 Genvec Inc Adenoviren-vektor systeme und zelllinien
US5998205A (en) 1994-11-28 1999-12-07 Genetic Therapy, Inc. Vectors for tissue-specific replication
US6326356B1 (en) * 1996-10-18 2001-12-04 Board Of Regents, The University Of Texas System Suppression of neu overexpression using a mini-E1A gene
US5707618A (en) 1995-03-24 1998-01-13 Genzyme Corporation Adenovirus vectors for gene therapy
JP3827163B2 (ja) 1995-03-24 2006-09-27 ジェンザイム・コーポレーション 遺伝子治療用のアデノウイルスベクター
US6676935B2 (en) 1995-06-27 2004-01-13 Cell Genesys, Inc. Tissue specific adenoviral vectors
AU7674896A (en) 1995-10-31 1997-05-22 Board Of Regents, The University Of Texas System Adenovirus-antisense k-ras expression vectors and their application in cancer therapy
US6022863A (en) 1996-05-21 2000-02-08 Yale University Regulation of gene expression
US6730662B1 (en) * 1996-07-05 2004-05-04 Mcgill University Adenovirus E4 proteins for inducing cell death
DE69725882T2 (de) 1996-07-05 2004-07-29 Branton, Philip E., St. Lambert Adenovirus e4 proteine für induktion von zelltod
DE59708838D1 (de) 1996-08-30 2003-01-09 Jens Peter Fuerste Spiegelselektion und spiegelevolution von nucleinsäuren
US5994132A (en) 1996-10-23 1999-11-30 University Of Michigan Adenovirus vectors
US6110744A (en) 1996-11-13 2000-08-29 Board Of Regents, The University Of Texas System Diminishing viral gene expression by promoter replacement
US6080578A (en) 1996-12-31 2000-06-27 Onyx Pharmaceuticals, Inc. Cytopathic adenoviral E1B mutated viruses for therapy and prophylaxis of neoplasia
US6100086A (en) 1997-04-14 2000-08-08 Genzyme Corporation Transgene expression systems
DE69838584T2 (de) 1997-08-04 2008-06-26 Cell Genesys, Inc., Foster City Enhancer des menschlichen glandulären kallikreingens, vektoren die ihn enthalten und methoden für seine verwendung
DE19742706B4 (de) 1997-09-26 2013-07-25 Pieris Proteolab Ag Lipocalinmuteine
CN101618049A (zh) 1997-10-09 2010-01-06 威尔斯塔特生物公司 使用病毒来治疗赘生物
CN1110553C (zh) * 1998-07-15 2003-06-04 杭州赛狮生物技术开发有限公司 基因工程腺病毒及其用途
AU1092500A (en) 1998-10-15 2000-05-01 Canji, Inc. Recombinant e1a deleted adenoviral vectors
US6649158B1 (en) 1998-10-15 2003-11-18 Canji, Inc. Methods and compositions to induce antitumor response
DE19860602A1 (de) 1998-12-29 2000-07-06 Max Delbrueck Centrum Gentransfervektor für die Diagnostik und die Therapie von malignen Tumoren
US6428968B1 (en) 1999-03-15 2002-08-06 The Trustees Of The University Of Pennsylvania Combined therapy with a chemotherapeutic agent and an oncolytic virus for killing tumor cells in a subject
GB9906815D0 (en) 1999-03-24 1999-05-19 Isrec Anti-neoplastic viral agents
DE19929569A1 (de) 1999-06-21 2000-12-28 Holm Per Sonne Mittel zur Behandlung maligner Erkrankungen unter Verwendung des Proteins YB-1
AU6425800A (en) 1999-06-30 2001-01-22 Max-Delbruck-Centrum Fur Molekulare Medizin Agents for the diagnosis, prognosis and treatment of malignant diseases
US6955808B2 (en) 1999-09-24 2005-10-18 Uab Research Foundation Capsid-modified recombinant adenovirus and methods of use
AU1087701A (en) 1999-10-15 2001-04-30 Canji, Inc. Targeted vectors
US6140126A (en) 1999-10-26 2000-10-31 Isis Pharmaceuticals Inc. Antisense modulation of Y-box binding protein 1 expression
CN1382218A (zh) * 1999-11-15 2002-11-27 昂尼克斯药物公司 溶瘤腺病毒
DE10015413A1 (de) 2000-03-23 2001-09-27 Max Delbrueck Centrum Mittel zur Diagnose und Therapie viraler Erkrankungen
WO2001092549A2 (en) 2000-05-31 2001-12-06 Genvec, Inc. Method and composition for targeting an adenoviral vector
AU784975B2 (en) 2000-10-11 2006-08-10 Sumitomo Chemical Company, Limited DNA-binding protein YB-1-containing collagen accumulation inhibitors
AU2002235141A1 (en) 2000-11-27 2002-06-03 Geron Corporation Glycosyltransferase vectors for treating cancer
US20030095989A1 (en) 2000-12-18 2003-05-22 Irving John M. Chimeric cytolytic viruses for cancer treatment
DE10150945A1 (de) 2001-10-16 2003-04-17 Holm Per Sonne Adenovirale Systeme und deren Anwendungen
EP1346058B1 (de) 2000-12-28 2007-05-02 Per Sonne Holm Adenovirale systeme und deren anwendungen
US20030138405A1 (en) 2001-04-17 2003-07-24 Juan Fueyo Conditionally replicative adenovirus to target the Rb and Rb-related pathways
WO2003025190A1 (en) 2001-09-14 2003-03-27 The New Industry Research Organization Tumor-specific promoter and use thereof
DE10150984A1 (de) 2001-10-16 2003-04-17 Holm Per Sonne Verwendung des adenoviralen E2-late-Promotors
EP1497440B1 (en) 2002-04-25 2008-08-20 Crucell Holland B.V. Stable adenoviral vectors and methods for propagation thereof
JP5213298B2 (ja) * 2002-05-27 2013-06-19 ホルム,ペル・ゾンネ アデノウイルスおよびそれをコードしている核酸の新たな使用
MXPA05004074A (es) 2002-10-15 2005-09-20 Sonne Holm Per Nuevos adenovirus, acidos nucleicos que los codifican y su uso.
US20050042217A1 (en) 2003-03-19 2005-02-24 Yan Qi Specific inhibition of allorejection
EP1689446B1 (de) 2003-11-14 2015-01-07 Per Sonne Holm Neue adenoviren, dafür codierende nukleinsäuren und deren verwendung
CA2546178A1 (en) 2003-11-14 2005-06-09 Per Sonne Holm New use of adenovirus and nucleic acids coding therefor
US7851218B2 (en) 2004-12-13 2010-12-14 Schering Corporation Cell lines for production of replication-defective adenovirus
US20090232800A1 (en) 2004-12-31 2009-09-17 Per Sonne Holm E1-minus adenoviruses and use thereof
SG158133A1 (en) 2004-12-31 2010-01-29 Sonne Holm Method for reversing multiple resistance in animal cells
WO2007103825A2 (en) 2006-03-02 2007-09-13 The Board Of Regents Of The University Of Texas System Combination therapy with oncolytic adenovirus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GANLY I ET AL., GENE THERAPY, vol. 8, 2001, pages 369 - 375
HOLM P S ET AL., JBC, vol. 277, 2002, pages 10427 - 10434
HOWE J A ET AL., MOLECULAR THERAPY, vol. 2, no. 5, November 2000 (2000-11-01), pages 485 - 494
WONG H K ET AL., JOURNAL OF VIROLOGY, vol. 68, no. 8, August 1994 (1994-08-01), pages 4910 - 4920

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10155930B2 (en) 2002-05-27 2018-12-18 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US11268073B2 (en) 2002-05-27 2022-03-08 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US10731136B2 (en) 2002-05-27 2020-08-04 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US10538744B2 (en) 2002-05-27 2020-01-21 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US20160074447A1 (en) * 2003-11-14 2016-03-17 Per Sonne Holm Novel use of adenoviruses and nucleic acids that code for said viruses
WO2005051430A1 (de) * 2003-11-14 2005-06-09 Per Sonne Holm Neue verwendung von adenoviren und dafür codierenden nukleinsäuren
US10300096B2 (en) * 2003-11-14 2019-05-28 Per Sonne Holm Use of adenoviruses and nucleic acids that code for said viruses
US9150861B2 (en) 2004-07-09 2015-10-06 University Of Massachusetts Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
US11220686B2 (en) 2004-07-09 2022-01-11 University Of Massachusetts Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
US8940709B2 (en) 2004-07-09 2015-01-27 University Of Massachusetts Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
US10260066B2 (en) 2004-07-09 2019-04-16 University Of Massachusetts Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
US8361976B2 (en) 2004-07-09 2013-01-29 University Of Massachusetts Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
AU2006203736B2 (en) * 2004-12-31 2012-03-29 Per Sonne Holm Method for reversing multiple resistance in animal cells
KR101527213B1 (ko) * 2004-12-31 2015-06-09 페르 손네 홀름 동물 세포에서 다중 내성을 역전시키기 위한 방법
JP2008526188A (ja) * 2004-12-31 2008-07-24 ホルム,ペル・ゾンネ 動物細胞における多剤耐性を逆転させる方法
WO2006070024A3 (de) * 2004-12-31 2006-12-28 Per Sonne Holm E1 -minus adenoviren und deren verwendung
US11369650B2 (en) 2004-12-31 2022-06-28 Per Sonne Holm Methods for reversing multiple resistance in animal cells
WO2006070023A3 (en) * 2004-12-31 2006-09-21 Per Sonne Holm Method for reversing multiple resistance in animal cells
WO2012022496A2 (en) 2010-08-19 2012-02-23 Per Sonne Holm Method for killing tumor stem cells
WO2019170283A1 (en) 2018-03-05 2019-09-12 Klinikum Rechts Der Isar Der Technischen... Treatment of tumors by a combination of an oncolytic adenovirus and a cdk4/6 inhibitor
CN112601812A (zh) * 2018-06-25 2021-04-02 圣拉斐尔医院有限责任公司 基因疗法
US12558435B2 (en) 2018-06-25 2026-02-24 Ospedale San Raffaele S.R.L. Transient inhibition of p53 in gene therapy
WO2021044061A1 (en) 2019-09-05 2021-03-11 Klinikum Rechts Der Isar Der Technischen Universität München Treatment of tumors by a combination of an oncolytic adenovirus, a cdk4/6 inhibitor and a further therapeutically active agent

Also Published As

Publication number Publication date
CA2487811A1 (en) 2003-12-04
CN101843641A (zh) 2010-09-29
US10731136B2 (en) 2020-08-04
CN1655827B (zh) 2010-06-23
US10155930B2 (en) 2018-12-18
US20190055522A1 (en) 2019-02-21
JP2012179058A (ja) 2012-09-20
AU2010219364A1 (en) 2010-09-30
US10538744B2 (en) 2020-01-21
AU2003242585A2 (en) 2003-12-12
JP5213298B2 (ja) 2013-06-19
JP2014224141A (ja) 2014-12-04
US20110033424A1 (en) 2011-02-10
US20060099178A1 (en) 2006-05-11
JP5719800B2 (ja) 2015-05-20
CN1655827A (zh) 2005-08-17
US11268073B2 (en) 2022-03-08
US20180002674A1 (en) 2018-01-04
EP1506021B1 (de) 2019-05-01
CN101843641B (zh) 2014-09-17
KR101083450B1 (ko) 2011-11-16
ZA200409361B (en) 2005-08-31
EP1506021A2 (de) 2005-02-16
WO2003099859A3 (de) 2004-04-15
JP2006512284A (ja) 2006-04-13
AU2003242585A1 (en) 2003-12-12
KR20050008744A (ko) 2005-01-21
US20200095560A1 (en) 2020-03-26
AU2010219364B2 (en) 2011-06-09

Similar Documents

Publication Publication Date Title
US11268073B2 (en) Use of adenovirus and nucleic acids coding therefor
EP1689445B1 (de) Neue verwendung von adenoviren und dafür codierende nukleinsäuren
EP1689446B1 (de) Neue adenoviren, dafür codierende nukleinsäuren und deren verwendung
AU2010257327C1 (en) Adenovirus expressing genes in reverse order and use thereof
EP1830864A2 (de) E1 -minus adenoviren und deren verwendung
RU2393221C2 (ru) Аденовирус с обращенной генной экспрессией и его применение
CN1705740B (zh) 具有反向基因表达的腺病毒及其应用
AU2015201828B2 (en) Novel use of adenoviruses and nucleic acids coding therefor
DE10223534A1 (de) Verwendung von Adenoviren und dafür codierenden Nukleinsäuren

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004/09361

Country of ref document: ZA

Ref document number: 200409361

Country of ref document: ZA

Ref document number: 2003242585

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 3701/DELNP/2004

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 1020047019231

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2487811

Country of ref document: CA

Ref document number: 2004508113

Country of ref document: JP

Ref document number: 2003812310X

Country of ref document: CN

Ref document number: 2003755145

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2004138095

Country of ref document: RU

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 1020047019231

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2003755145

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2006099178

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10515238

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10515238

Country of ref document: US