WO2002077263A2 - Nucleic acid molecules encoding serine protease cvsp14, the encoded polypeptides and methods based thereon - Google Patents
Nucleic acid molecules encoding serine protease cvsp14, the encoded polypeptides and methods based thereon Download PDFInfo
- Publication number
- WO2002077263A2 WO2002077263A2 PCT/US2002/009039 US0209039W WO02077263A2 WO 2002077263 A2 WO2002077263 A2 WO 2002077263A2 US 0209039 W US0209039 W US 0209039W WO 02077263 A2 WO02077263 A2 WO 02077263A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polγpeptide
- sequence
- nucleotides
- cvsp1
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6402—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
- C12N9/6405—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals not being snakes
- C12N9/6408—Serine endopeptidases (3.4.21)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
- G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
- G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
- G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
- G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
- G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
- G01N2333/96433—Serine endopeptidases (3.4.21)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S436/00—Chemistry: analytical and immunological testing
- Y10S436/807—Apparatus included in process claim, e.g. physical support structures
- Y10S436/809—Multifield plates or multicontainer arrays
Definitions
- Nucleic acid molecules that encode proteases and portions thereof, particularly protease domains are provided. Also provided are prognostic, diagnostic and therapeutic methods using the proteases and domains thereof and the encoding nucleic acid molecules. BACKGROUND OF THE INVENTION AND OBJECTS THEREOF
- Cancer is a leading cause of death in the United States, developing in one in three Americans; one of every four Americans dies of cancer. Cancer is characterized by an increase in the number of abnormal neoplastic cells, which proliferate to form a tumor mass, the invasion of adjacent tissues by these neoplastic tumor cells, and the generation of malignant cells that metastasize via the blood or lymphatic system to regional lymph nodes and to distant sites. Among the hallmarks of cancer is a breakdown in the communication among tumor cells and their environment. Normal cells do not divide in the absence of stimulatory signals, and cease dividing in the presence of inhibitory signals. Growth-stimulatory and growth-inhibitory signals are routinely exchanged between cells within a tissue. In a cancerous, or neoplastic, state, a cell acquires the ability to "override" these signals and to proliferate under conditions in which normal cells do not grow.
- tumor cells acquire a number of distinct aberrant traits reflecting genetic alterations.
- the genomes of certain well-studied tumors carry several different independently altered genes, including activated oncogenes and inactivated tumor suppressor genes. Each of these genetic changes appears to be responsible for imparting some of the traits that, in the aggregate, represent the full neoplastic phenotype.
- a variety of biochemical factors have been associated with different phases of metastasis.
- Cell surface receptors for collagen, glycoproteins such as laminin, and proteoglycans facilitate tumor cell attachment, an important step in invasion and metastases. Attachment triggers the release of degradative enzymes which facilitate the penetration of tumor cells through tissue barriers. Once the tumor cells have entered the target tissue, specific growth factors are required for further proliferation.
- Tumor invasion and progression involves a complex series of events, in which tumor cells detach from the primary tumor, break down the normal tissue surrounding it, and migrate into a blood or lymphatic vessel to be carried to a distant site. The breaking down of normal tissue barriers is accomplished by the elaboration of specific enzymes that degrade the proteins of the extracellular matrix that make up basement membranes and stromal components of tissues.
- MMP matrix metalloproteinases
- MMPs proteinase enzymes
- MMPs proteinase enzymes
- MMPs are reported to enhance degradation of the basement membrane, which thereby permits tumorous cells to invade tissues.
- two major metalloproteinases having molecular weights of about 70 kDa and 92 kDa appear to enhance ability of tumor cells to metastasize.
- Serine proteases have been implicated in neoplastic disease progression. Most serine proteases, which are either secreted enzymes or are sequestered in cytoplasmic storage organelles, have roles in blood coagulation, wound healing, digestion, immune responses and tumor invasion and metastasis. A class of cell surface proteins designated type II transmembrane serine proteases, which are membrane-anchored proteins with additional extracellular domains, has been identified. As cell surface proteins, they are positioned to play a role in intracellular signal transduction and in mediating cell surface proteolytic events. Other serine proteases can be membrane bound and function in a similar manner. Others are secreted. Many serine proteases exert their activity upon binding to cell surface receptors, and, hence act at cell surfaces.
- Cell surface proteolysis is a mechanism for the generation of biologically active proteins that mediate a variety of cellular functions.
- Serine proteases including secreted and transmembrane serine proteases, have been implicated in processes involved in neoplastic development and progression. While the precise role of these proteases has not been elaborated, serine proteases and inhibitors thereof are involved in the control of many intra- and extracellular physiological processes, including degradative actions in cancer cell invasion, metastatic spread, and neovascularization of tumors, that are involved in tumor progression. It is believed that proteases are involved in the degradation of extracellular matrix (ECM) and contribute to tissue remodeling, and are necessary for cancer invasion and metastasis. The activity and/or expression of some proteases have been shown to correlate with tumor progression and development.
- ECM extracellular matrix
- MTSP1 membrane-type serine protease
- matriptase also called matriptase; see SEQ ID Nos. 1 and 2 from U.S. Patent No. 5,972,61 6; and GenBank Accession No. AF1 1 8224; ( 1 999) J. Biol. Chem. 274: 1 8231 -1 8236; U.S. Patent No. 5,792,61 6; see, also Takeuchi ( 1 999) Proc. Natl. Acad. Sci. U. S.A. 36: 1 1054-1 1 61 ) that is expressed in epithelial cancer and normal tissue (Takeucuhi et al. ( 1 999) Proc. Natl. Acad. Sci.
- Matriptase was originally identified in human breast cancer cells as a major gelatinase (see, U.S. Patent No. 5,482,848), a type of matrix metalloprotease (MMP). It has been proposed that it plays a role in the metastasis of breast cancer. Matriptase also is expressed in a variety of epithelial tissues with high levels of activity and/or expression in the human gastrointestinal tract and the prostate.
- MTSPs designated MTSP3, MTSP4, MTSP6 have been decribed in published International PCT application No. WO 01 /571 94, based in International PCT application No. PCT/US01 /03471 .
- Prostate-specific antigen a kallikrein-like serine protease, degrades extracellular matrix glycoproteins fibronectin and laminin, and, has been postulated to facilitate invasion by prostate cancer cells (Webber et al. ( 1 995) Clin. Cancer Res. 7 : 1 089-94) .
- Blocking PSA proteolytic activity with PSA-specific monoclonal antibodies results in a dose-dependent decrease in vitro in the invasion of the reconstituted basement membrane Matrigel by LNCaP human prostate carcinoma cells which secrete high levels of PSA.
- Hepsin a cell surface serine protease identified in hepatoma cells, is overexpressed in ovarian cancer (Tanimoto et al.
- hepsin transcript appears to be abundant in carcinoma tissue and is almost never expressed in normal adult tissue, including normal ovary. It has been suggested that hepsin is frequently overexpressed in ovarian tumors and therefore can be a candidate protease in the invasive process and growth capacity of ovarian tumor cells.
- NES1 normal epithelial cell-specific 1
- transmembrane and other serine proteases and other proteases appear to be involved in the etiology and pathogenesis of tumors. There is a need to further elucidate their role in these processes and to identify additional transmembrane proteases. Therefore, it is an object herein to provide serine protease proteins and nucleic acids encoding such proteases that are involved in the regulation of or participate in tumorigenesis and/or carcinogenesis. It is also an object herein to provide prognostic, diagnostic, therapeutic screening methods using such proteases and the nucleic acids encoding such proteases.
- CVSP14 is a secreted serine protease.
- CVSP1 4 is highly expressed in androgen-independent prostate tumors and is expressed in other tumors. Hence, as a protease it can be involved in tumor progression. By virtue of its functional activity it can be a therapeutic or diagnostic target.
- the expression and/or activation (or reduction in level of expression or activation) of the expressed protein or zymogen form thereof can be used to monitor cancer and cancer therapy. For example, the expression of the this protein can be used to monitor prostate cancer and prostate cancer therapy.
- the serine protease family includes members that are activated and/or expressed in tumor cells at different levels from non-tumor cells; and those from cells in which substrates therefor differ in tumor cells from non-tumor cells or otherwise alter the specificity or activity of the serine protease (SP).
- the serine protease provided herein, designated herein as CVSP14 is a secreted protease.
- the protease domain and full-length protein, including the zymogen and activated forms, and uses thereof are also provided. Proteins encoded by splice variants are also provided. Nucleic acid molecules encoding the proteins and protease domains are also provided.
- the protease domain of a CVSP1 4 is set forth in SEQ ID No.
- CVSP14 is expressed as a secreted protein and may bind to cell surface receptors and function as a cell-surface bound protease, such as by binding thereto or by dimerization or multimerization with a membrane-bound or receptor-bound protein.
- nucleic acid molecules that encode SP proteins and the encoded proteins.
- nucleic acid molecules encoding CVSP1 4 from animals, including splice variants thereof are provided.
- the encoded proteins are also provided.
- functional domains thereof are from or based on animal SPs, including, but are not limited to, rodent, such as mouse and rat; fowl, such as chicken; ruminants, such as goats, cows, deer, sheep; ovine, such as pigs; and humans.
- protease domain for use in the methods and assay provided herein does not have to result from activation, which produces a two chain activated product, but rather is a single chain polypeptide where the N-terminus includes the sequence I ILGG. Such polypeptides, although not the result of activation and not two-chain forms, exhibit proteolytic (catalytic) activity. These protease domain polypeptides are used in assays to screen for agents that modulate the activity of the CVSP14.
- Such assays are also provided herein.
- the effects of test compounds on the ability of the full length or along at least about 70%, 80% or 90% of the full length of the single chain, two chain activated form, or a protease domain, which is a single chain or a two chain activated form, of CVSP1 4 to proteolytically cleave a known substrate, typically a fluorescently, chromogenically or otherwise detectably labeled substrate, are assessed.
- Agents generally compounds, particularly small molecules, that modulate the activity of the protein (full length or protease domain either single or two chain forms thereof) are candidate compounds for modulating the activity of the CVSP14.
- protease domains and full length proteins also can be used to produce two-chain and single-chain protease-specific antibodies.
- the protease domains provided herein include, but are not limited to, the single chain region having an N-terminus at the cleavage site for activation of the zymogen, through the C-terminus, or C-terminal truncated portions thereof that exhibit proteolytic activity as a single-chain polypeptide in in vitro proteolysis assays, of any family member, including CVSP14, such as from a mammal, including human, that, for example, is expressed or activity in tumor cells at different levels from non-tumor cells.
- muteins of the single chain protease domain of CVSP1 4 particularly muteins in which the Cys residue (residue no. 26 in SEQ ID No. 6) in the protease domain that is free (i.e. , does not form disulfide linkages with any other Cys residue in the protease domain) is substituted with another amino acid substitution, generally with a substitution that does not eliminate the activity of interest, and muteins in which a glycosylation site(s) is eliminated.
- Muteins in which other substitutions in which catalytic activity is retained are also contemplated (see, e.g. , Table 1 , for exemplary amino acid substitutions).
- CVSP14 a member of the family of serine proteases designated CVSP14, and functional domains, especially protease (or catalytic) domains thereof, muteins and other derivatives and analogs thereof. Also provided herein are nucleic acids encoding the CVSP1 .
- nucleic acid and amino acid sequences of CVSP14 are set forth in SEQ ID Nos. 5 and 6. Nucleic acid molecules that encode a single-chain protease domain or catalytically active portion thereof and also those that encode the full-length CVSP14 (SEQ ID Nos. 1 2 and 1 3) are provided. Single amino acid changes are contemplated; for example peptides in which there is an Arg in place of a Gly are provided. Nucleic acid molecules that encode a single- chain protease domain or catalytically active portion thereof and also those that encode the full-length CVSP1 4 are provided.
- nucleic acid molecules that hybridize to such CVSP14 encoding nucleic acid along their full length or along at least about 70%, 80% or 90% of the full length and encode the full length or a truncated portion thereof, such as without the signal sequence or a protease domain or catalytically active portion thereof are provided. Hybridization is typically performed under conditions of at least low, generally at least moderate, and often high stringency. Additionally provided herein are antibodies that specifically bind to the
- CVSP14 and inhibit the activity thereof. Included are antibodies that specifically bind to the protein or protease domain, including to the single and/or two chain forms thereof. Among the antibodies are two-chain-specific antibodies, and single-chain specific antibodies and neutralizing antibodies. Antibodies that specifically bind to the CVSP1 4, particularly the single chain protease domain, the zymogen and activated form are also provided herein. Antibodies that specifically bind to the two-chain and/or single-chain form of CVSP14 are provided. The antibodies include those that specifically bind to the two-chain or single-chain form of the protease domain and/or the full-length protein.
- CVSP1 4 cardiovascular disease 2019
- nucleic acids encoding CVSP1 4
- transgenic non-human animals bearing inactivated genes encoding the CVSP and bearing the genes encoding the CVSP1 4 under non-native or native promotor control are provided. Such animals are useful in animal models of tumor initiation, growth and/or progression models.
- CVSP1 4 serine proteases
- lung carcinoma, leukemia and cervical carcinoma as well as in certain normal cells and tissues
- CVSP1 4 can also be a marker for breast, prostate and colon cancer.
- SPs are of interest because they appear to be expressed and/or activated at different levels in tumor cells from normal cells, or have functional activity that is different in tumor cells from normal cells, such as by an alteration in a substrate therefor, or a cofactor.
- CVSP1 4 is of interest because it is expressed or is active in tumor cells.
- the level of activated CVSP14 can be diagnostic of prostate, uterine, lung or colon cancer or leukemia or other cancer.
- the protease domain of CVSP1 4 that includes the catalytic portion of the protein.
- CVSP14 polypeptides including, but not limited to splice variants thereof, and nucleic acids encoding CVSPs, and domains, derivatives and analogs thereof are provided herein.
- Single chain protease domains that contain the N-terminii that are generated by activation of the zymogen form of CVSP14 are also provided.
- the cleavage site for the protease domain is at amino acid 52 (FU IGGSHsee SEQ ID Nos. 1 2 and 1 3).
- plasmids containing any of the nucleic acid molecules provided herein are also provided. Such cells include, but are not limited to, bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells.
- methods of expression of the encoded polypeptide are provided.
- the nucleic acid encoding the signal sequence is removed. The protein is expressed in the inclusion bodies.
- the CVSP14 protease domain was then isolated from the inclusion bodies and treated under conditions whereby proper refolding occurred.
- methods for producing active CVSP14 protease domain are also provided.
- CVSP14 Also provided is a method of producing CVSP14 by growing the above- described cells under conditions whereby the CVSP1 4 is expressed by the cells, and recovering the expressed CVSP14 polypeptide. Methods for isolating nucleic acid encoding other CVSP1 4s are also provided.
- cells generally eukaryotic cells, such as mammalian cells and yeast cells, in which the CVSP1 4 polypeptide is expressed by the cells.
- Such cells to which the secreted protein can bind are used in drug screening assays to identify compounds that modulate the activity of the CVSP14 polypeptide.
- assays include in vitro binding assays, and transcription based assays in which signal transduction mediated directly or indirectly, such as via activation of pro-growth factors, by the CVSP1 4 or cleavage products thereof is assessed.
- prognostic, diagnostic and therapeutic screening methods using the CVSP1 4 and the nucleic acids encoding CVSP14.
- the prognostic, diagnostic and therapeutic screening methods are used for preventing, treating, or for finding agents useful in preventing or treating, tumors or cancers such as lung carcinoma, colon adenocarcinoma and ovarian carcinoma.
- the compounds are identified by contacting them with the CVSP1 4 or protease domain thereof and a substrate for the CVSP14. A change in the amount of substrate cleaved in the presence of the compounds compared to that in the absence of the compound indicates that the compound modulates the activity of the CVSP14.
- Such compounds are selected for further analyses or for use to modulate the activity of the CVSP1 4, such as inhibitors or agonists.
- the compounds also can be identified by contacting the substrates with a cell that binds to a CVSP1 4 or catalytically active portion thereof.
- modulators of the activity of CVSP14 especially the modulators obtained according to the screening methods provided herein.
- modulators can have use in treating cancerous conditions and other neoplastic conditions.
- compositions containing the protease domain and/or full- length or other domain of a CVSP1 4 polypeptide are provided herein in a pharmaceutically acceptable carrier or excipient are provided herein.
- articles of manufacture that contain CVSP14 polypeptide and protease domains of CVSP1 4 in single chain forms or activated forms.
- the articles contain a) packaging material; b) the polypeptide (or encoding nucleic acid), particularly the single chain protease domain thereof; and c) a label indicating that the article is for using in assays for identifying modulators of the activities of a CVSP1 4 polypeptide is provided herein.
- the conjugate can contain a plurality of agents linked thereto.
- the conjugate can be a chemical conjugate; and it can be a fusion protein.
- the targeting agent is a protein or peptide fragment.
- the protein or peptide fragment can include a protein binding sequence, a nucleic acid binding sequence, a lipid binding sequence, a polysaccharide binding sequence, or a metal binding sequence.
- the combination can include: a) an inhibitor of the activity of a CVSP1 4; and b) an anti-cancer treatment or agent.
- the CVSP inhibitor and the anti-cancer agent can be formulated in a single pharmaceutical composition or each is formulated in a separate pharmaceutical composition.
- the CVSP14 inhibitor can be an antibody or a fragment or binding portion thereof made against the CVSP1 4, such as an antibody that specifically binds to the protease domain, an inhibitor of CVSP1 4 production, or an inhibitor of CVSP14 membrane-localization or an inhibitor of CVSP14 activation.
- CVSP1 4 inhibitors include, but are not limited to, an antisense nucleic acid or double-stranded RNA (dsRNA), such as RNAi, encoding the CVSP1 4 or portions thereof, particularly a portion of the protease domain, a nucleic acid encoding at least a portion of a gene encoding the CVSP1 4 with a heterologous nucleotide sequence inserted therein such that the heterologous sequence inactivates the biological activity encoded CVSP1 4 or the gene encoding it.
- the portion of the gene encoding the CVSP14 typically flanks the heterologous sequence to promote homologous recombination with a genomic gene encoding the CVSP14.
- a tumor or cancer in a mammal by administering to a mammal an effective amount of an inhibitor of a CVSP1 4, whereby the tumor or cancer is treated or prevented.
- the CVSP14 inhibitor used in the treatment or for prophylaxis is administered with a pharmaceutically acceptable carrier or excipient.
- the mammal treated can be a human.
- the treatment or prevention method can additionally include administering an anti-cancer treatment or agent simultaneously with or subsequently or before administration of the CVSP1 4 inhibitor.
- a recombinant non-human animal where the gene of a CVSP14 is under control of a promoter that is not the native promoter of the gene or that is not the native promoter of the gene in the non-human animal or where the nucleic acid encoding the CVSP1 4 is heterologous to the non-human animal and the promoter is the native or a non- native promoter or the CVSP14 is on an extrachromosomal element, such as a plasmid or artificial chromosome.
- Transgenic non-human animals bearing the genes encoding the CVSP1 4 and bearing inactivated genes encoding CVSP1 4, particularly under a non-native promotor control or on an exogenous element, such as a plasmid or artificial chromosome, are additionally provided herein.
- the prodrug is administered and, upon administration, active CVSP14 cleaves the prodrug and releases active drug in the vicinity of the tumor cells.
- the active anti-cancer drug accumulates in the vicinity of the tumor. This is particularly useful in instances in which CVSP1 4 is expressed or active in greater quantity, higher level or predominantly in tumor cells compared to other cells.
- the forms can be full length or truncated forms, including but not limited to, the protease domain resulting from cleavage at the Rl activation site or from expression of the protease domain or catalytically active portions thereof.
- the conditions include, but are not limited to, a condition, such as a tumor, of the breast, cervix, prostate, lung, ovary or colon.
- Methods for monitoring tumor progression and/or therapeutic effectiveness are also provided.
- the levels of activation or expression of CVSP14 or the protease domain thereof are assessed, and the change in the level, reflects tumor progression and/or the effectiveness of therapy.
- the amount of CVSP14 in a body tissue or fluid sample increases; effective therapy reduces the level.
- serine protease refers to a diverse family of proteases wherein a serine residue is involved in the hydrolysis of proteins or peptides.
- the serine residue can be part of the catalytic triad mechanism, which includes a serine, a histidine and an aspartic acid in the catalysis, or be part of the hydroxyl/e-amine or hydroxyl/ ⁇ -amine catalytic dyad mechanism, which involves a serine and a lysine in the catalysis.
- the catalytic triad mechanism which includes a serine, a histidine and an aspartic acid in the catalysis
- hydroxyl/e-amine or hydroxyl/ ⁇ -amine catalytic dyad mechanism which involves a serine and a lysine in the catalysis.
- SPs of mammalian, including human, origin Those of skill in this art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g. , Watson et al. ( 1 987) Molecular Biology of the Gene, 4th Edition, The Bejac
- transmembrane serine protease refers to a family of transmembrane serine proteases that share common structural features as described herein (see, also Hooper et al. (2001 ) J. Biol. Chem. 76:857-860).
- MTSP transmembrane serine protease encompasses all proteins encoded by the MTSP gene family, including but are not limited to: MTSP3, MTSP4, MTSP6, MTSP7 or an equivalent molecule obtained from any other source or that has been prepared synthetically or that exhibits the same activity.
- MTSPs include, but are not limited to, corin, enterpeptidase, human airway trypsin-like protease (HAT), MTSP1 , TMPRSS2, and TMPRSS4. Sequences of encoding nucleic molecules and the encoded amino acid sequences of exemplary MTSPs and/or domains thereof are set forth, for example in U.S. application
- a "protease domain of a CVSP” refers to a domain of CVSP that exhibits proteolytic activity and shares homology and structural features with the chymotrypsin/trypsin family protease domains. Hence it is at least the minimal portion of the domain that exhibits proteolytic activity as assessed by standard in vitro assays.
- protease domain is the portion of the protease that is structurally equivalent to the trypsin or chymotrypsin fold. Contemplated herein are such protease domains and catalytically active portions thereof. Also provided are truncated forms of the protease domain that include the smallest fragment thereof that acts catalytically as a single chain form.
- the catalytically active domain of a CVSP refers to the protease domain.
- Reference to the protease domain of a CVSP includes refers to the single chain form of the protein. If the two-chain form or both is intended, it is so-specified.
- the zymogen form of each protein is a single chain, which is converted to the active two chain form by activation cleavage.
- a protease domain of a CVSP14 includes at least one or all of or any combination of or a catalytically active portion of: a polypeptide encoded by the sequence of nucleotides set forth in
- SEQ ID No. 5 a polypeptide encoded by a sequence of nucleotides that hybridizes under conditions of low, moderate or high stringency to the sequence of nucleotides set forth in SEQ ID No. 5; a polypeptide that comprises the sequence of amino acids set forth in SEQ ID No. 6; a polypeptide that comprises a sequence of amino acids having at least about 60%, 70%, 80%, 90% or about 95 % sequence identity with the sequence of amino acids set forth in SEQ ID No. 6; and/or a protease domain of a splice variant of the CVSP14.
- the CVSP14 can be from any animal, particularly a mammal, and includes but are not limited to, humans, rodents, fowl, ruminants and other animals.
- the full length zymogen or two-chain activated form is contemplated or any domain thereof, including the protease domain, which can be a two-chain activated form, or a single chain form.
- active form is meant a form active in vivo and/or in vitro.
- the protease domain also can exist as a two-chain form. It is shown herein that, at least in vitro, the single chain forms of the SPs and the catalytic domains or proteolytically active portions thereof (typically C-terminal truncations) thereof exhibit protease activity.
- isolated single chain forms of the protease domains of SPs and their use in in vitro drug screening assays for identification of agents that modulate the activity thereof.
- activation cleavage refers to the cleavage of the protease at the N-terminus of the protease domain (in this instance between R 55 and l 56 ; with reference to SEQ ID Nos. 1 2 and 1 3).
- Cys-Cys pairing between the a Cys outside the protease domain (in this instance C 37 ) and a Cys in the protease domain (in this instance Cys 166 )
- the resulting polypeptide has two chains ("A" chain and the "B" chain, which is the protease domain). Cleavage can be effected by another protease or autocatalytically.
- a two-chain form of the protease domain refers to a two- chain form that is formed from the two-chain form of the protease in which the Cys pairing between, in this instance, Cys 37 and Cys 166 , which links the protease domain to the remainder of the polypeptide, the "A" chain.
- a two chain protease domain form refers to any form in which the "remainder of the polypeptide", i.e. , "A" chain, is shortened and includes at least up to Cys 37 .
- a CVSP14 whenever referenced herein, includes at least one or all of or any combination of: a polypeptide encoded by the sequence of nucleotides set forth in SEQ ID No.
- the CVSP1 polypeptide includes the sequence of amino acids set forth in SEQ ID No. 1 3. Smaller portions thereof that retain protease activity are contemplated.
- the protease domain thereof is set forth in SEQ ID No. 6.
- the protease domains of CVSPs vary in size and constitution, including insertions and deletions in surface loops. They retain conserved structure, including at least one of the active site triad, primary specificity pocket, oxyanion hole and/or other features of serine protease domains of proteases.
- the protease domain is a portion of a CVSP, as defined herein, and is homologous to a domain of other CVSP.
- S1 chymotrypsin
- CVSPs protease domains share a high degree of amino acid sequence identity.
- His, Asp and Ser residues necessary for activity are present in conserved motifs.
- the activation site, whose cleavage creates the N- terminus of protease domain in the two-chain forms has a conserved motif and readily can be identified.
- CVSPs of interest include those that are activated and/or expressed in tumor cells at different levels, typically higher, from non-tumor cells; and those from cells in which substrates therefor differ in tumor cells from non-tumor cells or differ with respect to substrates, co-factors or receptors, or otherwise alter the activity or specificity of the CVSP.
- a human protein is one encoded by nucleic acid, such as DNA, present in the genome of a human, including all allelic variants and conservative variations as long as they are not variants found in other mammals.
- nucleic acid encoding a protease domain or catalytically active portion of a SP shall be construed as referring to a nucleic acid encoding only the recited single chain protease domain or active portion thereof, and not the other contiguous portions of the SP as a continuous sequence.
- catalytic activity refers to the activity of the SP as a serine protease.
- Function of the SP refers to its function in tumor biology, including promotion of or involvement in initiation, growth or progression of tumors, and also roles in signal transduction.
- Catalytic activity refers to the activity of the SP as a protease as assessed in in vitro proteolytic assays that detect proteolysis of a selected substrate.
- a zymogen is an inactive precursor of a proteolytic enzyme. Such precursors are generally larger, although not necessarily larger than the active form.
- zymogens are converted to active enzymes by specific cleavage,, including catalytic and autocatalytic cleavage, or binding of an activating co-factor, which generates the mature active enzyme.
- a zymogen thus, is an enzymatically inactive protein that is converted to a proteolytic enzyme by the action of an activator.
- neoplasm neoplasia
- neoplasm refers to abnormal new growth, and thus means the same as tumor, which can be benign or malignant. Unlike hyperplasia, neoplastic proliferation persists even in the absence of the original stimulus.
- neoplastic disease refers to any disorder involving cancer, including tumor development, growth, metastasis and progression.
- cancer refers to a general term for diseases caused by any type of malignant tumor.
- malignant as applies to tumors, refers to primary tumors that have the capacity of metastasis with loss of growth control and positional control.
- an anti-cancer agent refers to any agents used in the anti-cancer treatment. These include any agents, when used alone or in combination with other compounds, that- can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with neoplastic disease, tumor and cancer, and can be used in methods, combinations and compositions provided herein.
- Non-limiting examples of anti-neoplastic agents include anti-angiogenic agents, alkylating agents, antimetabolite, certain natural products, platinum coordination complexes, anthracenediones, substituted ureas, methylhydrazine derivatives, adrenocortical suppressants, certain hormones, antagonists and anti-cancer polysaccharides.
- a splice variant refers to a variant produced by differential processing of a primary transcript of genomic nucleic acid, such as DNA, that results in more than one type of mRNA. Splice variants of SPs are provided herein.
- angiogenesis is intended to broadly encompass the totality of processes directly or indirectly involved in the establishment and maintenance of new vasculature (neovascularization), including, but not limited to, neovascularization associated with tumors.
- anti-angiogenic treatment or agent refers to any therapeutic regimen and compound, when used alone or in combination with other treatment or compounds, that can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with undesired and/or uncontrolled angiogenesis.
- an anti-angiogenic agent refers to an agent that inhibits the establishment or maintenance of vasculature.
- agents include, but are not limited to, anti-tumor agents, and agents for treatments of other disorders associated with undesirable angiogenesis, such as diabetic retinopathies, restenosis, hyperproliferative disorders and others.
- non-anti-angiogenic anti-tumor agents refer to anti-tumor agents that do not act primarily by inhibiting angiogenesis.
- pro-angiogenic agents are agents that promote the establishment or maintenance of the vasculature. Such agents include agents for treating cardiovascular disorders, including heart attacks and strokes.
- undesired and/or uncontrolled angiogenesis refers to pathological angiogenesis wherein the influence of angiogenesis stimulators outweighs the influence of angiogenesis inhibitors.
- deficient angiogenesis refers to pathological angiogenesis associated with disorders where there is a defect in normal angiogenesis resulting in aberrant angiogenesis or an absence or substantial reduction in angiogenesis.
- the protease domain of an SP protein refers to the protease domain of an SP that exhibits proteolytic activity. Hence it is at least the minimal portion of the protein that exhibits proteolytic activity as assessed by standard assays in vitro. It refers, herein, to a single chain form and also the two chain activated form (where the two chain form is intended it will be so- noted).
- Exemplary protease domains include at least a sufficient portion of sequences of amino acids set forth in SEQ ID No. 6 (encoded by nucleotides in SEQ ID No. 5) to exhibit protease activity.
- nucleic acid molecules that encode a polypeptide that has proteolytic activity in an in vitro proteolysis assay and that have at least 60%, 70%, 80%, 90% or about 95 % sequence identity with the full length of a protease domain of a CVSP1 4 polypeptide, or that hybridize along their full length or along at least about 70%, 80% or 90% of the full length to a nucleic acids that encode a protease domain, particularly under conditions of moderate, generally high, stringency.
- protease domains residues at the N-terminus can be critical for activity. It is shown herein that the protease domain of the single chain form of the CVSP1 4 protease is catalytically active. Hence the protease domain generally requires the N-terminal amino acids thereof for activity; the C-terminus portion can be truncated. The amount that can be removed can be determined empirically by testing the polypeptide for protease activity in an in vitro assay that assesses catalytic cleavage.
- protease domains particularly the single chain domains, thereof that retain protease activity are contemplated.
- Such smaller versions generally are C-terminal truncated versions of the protease domains.
- the protease domains vary in size and constitution, including insertions and deletions in surface loops.
- Such domains exhibit conserved structure, including at least one structural feature, such as the active site triad, primary specificity pocket, oxyanion hole and/or other features of serine protease domains of proteases.
- the protease domain is a single chain portion of a CVSP1 4, as defined herein, but is homologous in its structural features and retention of sequence of similarity or homology the protease domain of chymotrypsin or trypsin.
- the polypeptide exhibits proteolytic activity as a single chain.
- homologous means about greater than 25 % nucleic acid sequence identity, such as 25 % 40%, 60%, 70%, 80%, 90% or 95% . If necessary the percentage homology will be specified.
- the terms "homology” and “identity” are often used interchangeably. In general, sequences are aligned so that the highest order match is obtained (see, e.g.
- nucleic acid molecules that contain degenerate codons in place of codons in the hybridizing nucleic acid molecule.
- nucleic acid molecules have nucleotide sequences that are at least 80%, 85%, 90%, 95 %, 96%, 97% , 98% or 99% "identical” can be determined using known computer algorithms such as the "FAST A” program, using for example, the default parameters as in Pearson et al. ( 1 988) Proc. Natl. Acad. Sci. USA 85:2444 (other programs include the GCG program package (Devereux, J., et al..
- DNAStar “MegAlign” program (Madison, WI) and the University of Wisconsin Genetics Computer Group (UWG) "Gap” program (Madison WI)) .
- Percent homology or identity of proteins and/or nucleic acid molecules can be determined/ for example, by comparing sequence information using a GAP computer program (e.g. , Needleman et al. ( 1 970) J. Mol. Biol. 48:443, as revised by Smith and Waterman (( 1 981 ) Adv. Appl. Math. 2:482).
- the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) which are similar, divided by the total number of symbols in the shorter of the two sequences.
- Default parameters for the GAP program can include: ( 1 ) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of
- the term "identity" represents a comparison between a test and a reference polypeptide or polynucleotide.
- the term at least "90% identical to” refers to percent identities from 90 to 99.99 relative to the reference polypeptides.
- Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polynucleotide length of 1 00 amino acids are compared. No more than 10% (i.e., 10 out of 1 00) amino acids in the test polypeptide differs from that of the reference polypeptides. Similar comparisons can be made between a test and reference polynucleotides. Such differences can be represented as point mutations randomly distributed over the entire length of an amino acid sequence or they can be clustered in one or more locations of varying length up to the maximum allowable, e.g. 10/1 00 amino acid difference (approximately 90% identity). Differences are defined as nucleic acid or amino acid substitutions, or deletions. At the level of homologies or identities above about 85-90%, the result should be independent of the program and gap parameters set; such high levels of identity can be assessed readily, often without relying on software.
- primer refers to an oligonucleotide containing two or more deoxyribonucleotides or ribonucleotides, typically more than three, from which synthesis of a primer extension product can be initiated.
- Experimental conditions conducive to synthesis include the presence, of nucleoside triphosphates and an agent for polymerization and extension, such as DNA polymerase, and a suitable buffer, temperature and pH.
- animals include any animal, such as, but are not limited to, goats, cows, deer, sheep, rodents, pigs and humans.
- Non-human animals exclude humans as the contemplated animal.
- the SPs provided herein are from any source, animal, plant, prokaryotic and fungal.
- Most CVSP1 4s are of animal origin, including mammalian origin.
- genetic therapy involves the transfer of heterologous nucleic acid, such as DNA, into certain cells, target cells, of a mammal, particularly a human, with a disorder or conditions for which such therapy is sought.
- the nucleic acid, such as DNA is introduced into the selected target cells in a manner such that the heterologous nucleic acid, such as DNA, is expressed and a therapeutic product encoded thereby is produced.
- the heterologous nucleic acid, such as DNA can in some manner mediate expression of DNA that encodes the therapeutic product, or it can encode a product, such as a peptide or RNA that in some manner mediates, directly or indirectly, expression of a therapeutic product.
- Genetic therapy can also be used to deliver nucleic acid encoding a gene product that replaces a defective gene or supplements a gene product produced by the mammal or the cell in which it is introduced.
- the introduced nucleic acid can encode a therapeutic compound, such as a growth factor inhibitor thereof, or a tumor necrosis factor or inhibitor thereof, such as a receptor therefor, that is not normally produced in the mammalian host or that is not produced in therapeutically effective amounts or at a therapeutically useful time.
- the heterologous nucleic acid, such as DNA, encoding the therapeutic product can be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof .
- Genetic therapy can also involve delivery of an inhibitor or repressor or other modulator of gene expression.
- heterologous nucleic acid is nucleic acid that (if DNA encodes RNA) and proteins that are not normally produced in vivo by the cell in which it is expressed or that mediates or encodes mediators that alter expression of endogenous nucleic acid, such as DNA, by affecting transcription, translation, or other regulatable biochemical processes.
- Heterologous nucleic acid, such as DNA can also be referred to as foreign nucleic acid, such as DNA. Any nucleic acid, such as DNA, that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which is expressed is herein encompassed by heterologous nucleic acid; heterologous nucleic acid includes exogenously added nucleic acid that is also expressed endogenously.
- heterologous nucleic acid examples include, but are not limited to, nucleic acid that encodes traceable marker proteins, such as a protein that confers drug resistance, nucleic acid that encodes therapeutically effective substances, such as anti-cancer agents, enzymes and hormones, and nucleic acid, such as DNA, that encodes other types of proteins, such as antibodies.
- Antibodies that are encoded by heterologous nucleic acid can be secreted or expressed on the surface of the cell in which the heterologous nucleic acid has been introduced.
- Heterologous nucleic acid is generally not endogenous to the cell into which it is introduced, but has been obtained from another cell or prepared synthetically. Generally, although not necessarily, such nucleic acid encodes RNA and proteins that are not normally produced by the cell in which it is expressed.
- heterologous nucleic acid or foreign nucleic acid includes a nucleic acid molecule not present in the exact orientation or position as the counterpart nucleic acid molecule, such as DNA, found in the genome. It can also refer to a nucleic acid molecule from another organism or species (i.e. , exogenous).
- a therapeutically effective product is a product that is encoded by heterologous nucleic acid, typically DNA, that, upon introduction of the nucleic acid into a host, a product is expressed that ameliorates or eliminates the symptoms, manifestations of an inherited or acquired disease or that cures the disease.
- a polypeptide consists essentially of the protease domain means that the only SP portion of the polypeptide is a protease domain or a catalytically active portion thereof.
- the polypeptide can optionally, and generally will, include additional non-SP-derived sequences of amino acids.
- cancer or tumor treatment or agent refers to any therapeutic regimen and/or compound that, when used alone or in combination with other treatments or compounds, can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with deficient angiogenesis.
- domain refers to a portion of a molecule, e.g. , proteins or the encoding nucleic acids, that is structurally and/or functionally distinct from other portions of the molecule.
- protease refers to an enzyme catalyzing hydrolysis of proteins or peptides. It includes the zymogen form and activated forms thereof. For clarity reference to protease refers to all forms, and particular forms will be specifically designated.
- the protease domain includes single and two chain forms of the protease domain of an SP protein.
- the protease domain also includes two chain forms of the protease domain.
- nucleic acids include DNA, RNA and analogs thereof, including protein nucleic acids (PNA) and mixture thereof. Nucleic acids can be single or double-stranded. When referring to probes or primers, optionally labeled, with a detectable label, such as a fluorescent or radiolabel, single- stranded molecules are contemplated. Such molecules are typically of a length such that their target is statistically unique or of low copy number (typically less than 5, generally less than 3) for probing or priming a library. Generally a probe or primer contains at least 1 4, 1 6 or 30 contiguous of sequence complementary to or identical a gene of interest. Probes and primers can be 10, 20, 30, 50, 1 00 or more nucleic acids long.
- nucleic acid encoding a fragment or portion of an SP refers to a nucleic acid encoding only the recited fragment or portion of SP, and not the other contiguous portions of the SP.
- operative linkage of heterologous nucleic to regulatory and effector sequences of nucleotides refers to the relationship between such nucleic acid, such as DNA, and such sequences of nucleotides.
- operative linkage of heterologous DNA to a promoter refers to the physical relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA in reading frame.
- operatively linked or operationally associated refers to the functional relationship of nucleic acid, such as DNA, with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
- operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
- start codons or other sequences that can interfere with or reduce expression, either at the level of transcription or translation.
- consensus ribosome binding sites see, e.g. , Kozak J. Biol. Chem. 266: 1 9867- 1 9870 ( 1 991 )
- start codons or other sequences that can interfere with or reduce expression, either at the level of transcription or translation.
- consensus ribosome binding sites see, e.g. , Kozak J. Biol. Chem. 266: 1 9867- 1 9870 ( 1 991 )
- the desirability of (or need for) such modification can be empirically determined.
- a sequence complementary to at least a portion of an RNA means a sequence having sufficient complementarily to be able to hybridize with the RNA, generally under moderate or high stringency conditions, forming a stable duplex; in the case of double-stranded SP antisense nucleic acids, a single strand of the duplex DNA (or dsRNA) can thus be tested, or triplex formation can be assayed.
- the ability to hybridize depends on the degree of complementarily and the length of the antisense nucleic acid.
- amino acid substitutions can be made in any of SPs and protease domains thereof provided that the resulting protein exhibits protease activity. Muteins can be made by making conservative amino acid substitutions and also non-conservative amino acid substitutions. For example, amino acid substitutions the desirably alter properties of the proteins can be made. In one embodiment, mutations that prevent degradation of the polypeptide can be made.
- proteases cleave after basic residues, such as R and K; to eliminate such cleavage, the basic residue is replaced with a non-basic residue. Interaction of the protease with an inhibitor can be blocked while retaining catalytic activity by effecting a non-conservative change at the site interaction of the inhibitor with the protease. Receptor binding can be altered without altering catalytic activity.
- Amino acid substitutions contemplated include conservative substitutions, such as those set forth in Table 1 , which do not eliminate proteolytic activity. As described herein, substitutions that alter properties of the proteins, such as removal of cleavage sites and other such sites are also contemplated; such substitutions are generally non-conservative, but can be readily effected by those of skill in the art.
- Suitable conservative substitutions of amino acids are known to those of skill in this art and can be made generally without altering the biological activity, for example enzymatic activity, of the resulting molecule.
- Those of skill in this art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g. , Watson et al. Molecular Biology of the Gene, 4th Edition, 1 987, The Bejacmin/Cummings Pub. co., p.224).
- the catalytically active fragment of an SP particularly a single chain protease portion.
- Conservative amino acid substitutions are made, for example, in accordance with those set forth in TABLE 1 as follows:
- Trp Tyr Tyr (Y) Trp; Phe Val (V) Ile; Leu; Met; Nle; Nv
- a probe or primer based on a nucleotide sequence disclosed herein includes at least 1 0, 14, typically at least 1 6 contiguous sequence of nucleotides of SEQ ID No. 5, and probes of at least 30, 50 or 1 00 contiguous sequence of nucleotides of SEQ ID No. 5.
- the length of the probe or primer for unique hybridization is a function of the complexity of the genome of interest.
- amelioration of the symptoms of a particular disorder by administration of a particular pharmaceutical composition refers to any lessening, whether permanent or temporary, lasting or transient that can be attributed to or associated with administration of the composition.
- antisense polynucleotides refer to synthetic sequences of nucleotide bases complementary to mRNA or the sense strand of double- stranded DNA. Admixture of sense and antisense polynucleotides under appropriate conditions leads to the binding of the two molecules, or hybridization. When these polynucleotides bind to (hybridize with) mRNA, inhibition of protein synthesis (translation) occurs. When these polynucleotides bind to double-stranded DNA, inhibition of RNA synthesis (transcription) occurs. The resulting inhibition of translation and/or transcription leads to an inhibition of the synthesis of the protein encoded by the sense strand.
- Antisense nucleic acid molecule typically contain a sufficient number of nucleotides to specifically bind to a target nucleic acid, generally at least 5 contiguous nucleotides, often at least 14 or 1 6 or 30 contiguous nucleotides or modified nucleotides complementary to the coding portion of a nucleic acid molecule that encodes a gene of interest, for example, nucleic acid encoding a single chain protease domain of an SP.
- an array refers to a collection of elements, such as antibodies, containing three or more members.
- An addressable array is one in which the members of the array are identifiable, typically by position on a solid phase support. Hence, in general the members of the array are immobilized on discrete identifiable loci on the surface of a solid phase.
- antibody refers to an immunoglobulin, whether natural or partially or wholly synthetically produced, including any derivative thereof that retains the specific binding ability the antibody.
- antibody includes any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin binding domain.
- Antibodies include members of any immunoglobulin claims, including IgG, IgM, IgA, IgD and IgE.
- antibody fragment refers to any derivative of an antibody that is less then full length, retaining at least a portion of the full-length antibody's specific binding ability.
- antibody fragments include, but are not limited to, Fab, Fab', F(ab) 2 , single-chain Fvs (scFV), FV, dsFV diabody and Fd fragments.
- the fragment can include multiple chains linked together, such as by disulfide bridges.
- An antibody fragment generally contains at least about 50 amino acids and typically at least 200 amino acids.
- an Fv antibody fragment is composed of one variable heavy domain (V H ) and one variable light domain linked by noncovalent interactions.
- a dsFV refers to an Fv with an engineered intermolecular disulfide bond, which stabilizes the V H -V L pair.
- an F(ab) 2 fragment is an antibody fragment that results from digestion of an immunoglobulin with pepsin at pH 4.0-4.5; it can be recombinantly produced to produce the equivalent fragment.
- Fab fragments is an antibody fragment that results from digestion of an immunoglobulin with papain; it can be recombinantly produced to produce the equivalent fragment.
- scFVs refer to antibody fragments that contain a variable light chain (V L ) and variable heavy chain (V H ) covalently connected by a polypeptide linker in any order.
- the linker is of a length such that the two variable domains are bridged without substantial interference. Included linkers are (Gly-Ser) ⁇ residues with some Glu or Lys residues dispersed throughout to increase solubility.
- humanized antibodies refer to antibodies that are modified to include human sequences of amino acids so that administration to a human does not provoke an immune response.
- Methods for preparation of such antibodies are known.
- the hybridoma that expresses the monoclonal antibody is altered by recombinant DNA techniques to express an antibody in which the amino acid composition of the non-variable regions is based on human antibodies.
- Computer programs have been designed to identify such regions.
- diabodies are dimeric scFV; diabodies typically have shorter peptide linkers than scFvs, and they generally dimerize.
- production by recombinant means by using recombinant DNA methods means the use of the well known methods of molecular biology for expressing proteins encoded by cloned DNA.
- assessing is intended to include quantitative and qualitative determination in the sense of obtaining an absolute value for the activity of an SP, or a domain thereof, present in the sample, and also of obtaining an index, ratio, percentage, visual or other value indicative of the level of the activity. Assessment can be direct or indirect and the chemical species actually detected need not of course be the proteolysis product itself but can for example be a derivative thereof or some further substance.
- biological activity refers to the in vivo activities of a compound or physiological responses that result upon in vivo administration of a compound, composition or other mixture. Biological activity, thus, encompasses therapeutic effects and pharmaceutical activity of such compounds, compositions and mixtures. Biological activities can be observed in in vitro systems designed to test or use such activities.
- the biological activity of a luciferase is its oxygenase activity whereby, upon oxidation of a substrate, light is produced.
- functional activity refers to a polypeptide or portion thereof that displays one or more activities associated with a full-length (complete) protein. Functional activities include, but are not limited to, biological activity, catalytic or enzymatic activity, antigenicity (ability to bind to or compete with a polypeptide for binding to an anti-polypeptide antibody), immunogenicity, ability to form multimers, the ability to specifically bind to a receptor or ligand for the polypeptide.
- a conjugate refers to the compounds provided herein that include one or more SPs, including a CVSP1 4, particularly single chain protease domains thereof, and one or more targeting agents.
- These conjugates include those produced by recombinant means as fusion proteins, those produced by chemical means, such as by chemical coupling, through, for example, coupling to sulfhydryl groups, and those produced by any other method whereby at least one SP, or a domain thereof, is linked, directly or indirectly via linker(s) to a targeting agent.
- a targeting agent is any moiety, such as a protein or effective portion thereof, that provides specific binding of the conjugate to a cell surface receptor, which, can internalize the conjugate or SP portion thereof.
- a targeting agent can also be one that promotes or facilitates, for example, affinity isolation or purification of the conjugate; attachment of the conjugate to a surface; or detection of the conjugate or complexes containing the conjugate.
- an antibody conjugate refers to a conjugate in which the targeting agent is an antibody.
- derivative or analog of a molecule refers to a portion derived from or a modified version of the molecule.
- an effective amount of a compound for treating a particular disease is an amount that is sufficient to ameliorate, or in some manner reduce the symptoms associated with the disease.
- Such amount can be administered as a single dosage or can be administered according to a regimen, whereby it is effective.
- the amount can cure the disease but, typically, is administered in order to ameliorate the symptoms of the disease. Repeated administration can be required to achieve the desired amelioration of symptoms.
- equivalent when referring to two sequences of nucleic acids means that the two sequences in question encode the same sequence of amino acids or equivalent proteins.
- equivalent when equivalent is used in referring to two proteins or peptides, it means that the two proteins or peptides have substantially the same amino acid sequence with only amino acid substitutions (such, as but not limited to, conservative changes such as those set forth in Table 1 , above) that do not substantially alter the activity or function of the protein or peptide.
- equivalent refers to a property, the property does not need to be present to the same extent (e.g. , two peptides can exhibit different rates of the same type of enzymatic activity), but the activities are usually substantially the same.
- Complementary when referring to two nucleotide sequences, means that the two sequences of nucleotides are capable of hybridizing, typically with less than 25 %, 1 5 %, 5 % or 0% mismatches between opposed nucleotides. If necessary the percentage of complementarity will be specified. Typically the two molecules are selected such that they will hybridize under conditions of high stringency.
- an agent that modulates the activity of a protein or expression of a gene or nucleic acid either decreases or increases or otherwise alters the activity of the protein or, in some manner up- or down-regulates or otherwise alters expression of the nucleic acid in a cell.
- inhibitor of the activity of an SP encompasses any substances that prohibit or decrease production, post-translational modification(s), maturation, or membrane localization of the SP or any substances that interferes with or decreases the proteolytic efficacy of thereof, particularly of a single chain form in an in vitro screening assay.
- a method for treating or preventing neoplastic disease means that any of the symptoms, such as the tumor, metastasis thereof, the vascularization of the tumors or other parameters by which the disease is characterized are reduced, ameliorated, prevented, placed in a state of remission, or maintained in a state of remission. It also means that the hallmarks of neoplastic disease and metastasis can be eliminated, reduced or prevented by the treatment. Non-limiting examples of the hallmarks include uncontrolled degradation of the basement membrane and proximal extracellular matrix, migration, division, and organization of the endothelial cells into new functioning capillaries, and the persistence of such functioning capillaries.
- a prodrug is a compound that, upon in vivo administration, is metabolized or otherwise converted to the biologically, pharmaceutically or therapeutically active form of the compound. To produce a prodrug, the pharmaceutically active compound is modified such that the active compound is regenerated by metabolic processes.
- the prodrug can be designed to alter the metabolic stability or the transport characteristics of a drug, to mask side effects or toxicity, to improve the flavor of a drug or to alter other characteristics or properties of a drug.
- a drug identified by the screening methods provided herein refers to any compound that is a candidate for use as a therapeutic or as a lead compound for the design of a therapeutic.
- Such compounds can be small molecules, including small organic molecules, peptides, peptide mimetics, antisense molecules or dsRNA, such as RNAi, antibodies, fragments of antibodies, recombinant antibodies and other such compound which can serve as drug candidate or lead compound.
- a peptidomimetic is a compound that mimics the conformation and certain stereochemical features of the biologically active form of a particular peptide.
- peptidomimetics are designed to mimic certain desirable properties of a compound, but not the undesirable properties. such as flexibility, that lead to a loss of a biologically active conformation and bond breakdown.
- Peptidomimetics may be prepared from biologically active compounds by replacing certain groups or bonds that contribute to the undesirable properties with bioisosteres. Bioisosteres are known to those of skill in the art. For example the methylene bioisostere CH 2 S has been used as an amide replacement in enkephalin analogs (see, e.g., Spatola (1 983) pp.
- Morphine which can be administered orally, is a compound that is a peptidomimetic of the peptide endorphin.
- cyclic peptides are included among pepidomimetics.
- a promoter region or promoter element refers to a segment of DNA or RNA that controls transcription of the DNA or RNA to which it is operatively linked.
- the promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter.
- the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences can be cis acting or can be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, can be constitutive or regulated. Exemplary promoters contemplated for use in prokaryotes include the bacteriophage T7 and T3 promoters.
- a receptor refers to a molecule that has an affinity for a given ligand.
- Receptors can be naturally-occurring or synthetic molecules.
- Receptors can also be referred to in the art as anti-ligands.
- the receptor and anti-ligand are interchangeable.
- Receptors can be used in their unaltered state or as aggregates with other species.
- Receptors can be attached, covalently or noncovalently, or in physical contact with, to a binding member, either directly or indirectly via a specific binding substance or linker.
- receptors include, but are not limited to: antibodies, cell membrane receptors surface receptors and internalizing receptors, monoclonal antibodies and antisera reactive with specific antigenic determinants [such as on viruses, cells, or other materials], drugs, polynucleotides, nucleic acids, peptides, cofactors, lectins, sugars, polysaccharides, cells, cellular membranes, and organelles.
- receptors and applications using such receptors include but are not restricted to: a) enzymes: specific transport proteins or enzymes essential to survival of microorganisms, which could serve as targets for antibiotic [ligand] selection; b) antibodies: identification of a ligand-binding site on the antibody molecule that combines with the epitope of an antigen of interest can be investigated; determination of a sequence that mimics an antigenic epitope can lead to the development of vaccines of which the immunogen is based on one or more of such sequences or lead to the development of related diagnostic agents or compounds useful in therapeutic treatments such as for auto-immune diseases c) nucleic acids: identification of ligand, such as protein or RNA, binding sites; d) catalytic polypeptides: polymers, including polypeptides, that are capable of promoting a chemical reaction involving the conversion of one or more reactants to one or more products; such polypeptides generally include a binding site specific for at least one reactant or reaction intermediate and an active functionality proximate to the
- hormone receptors determination of the ligands that bind with high affinity to a receptor is useful in the development of hormone replacement therapies; for example, identification of ligands that bind to such receptors can lead to the development of drugs to control blood pressure; and f) opiate receptors: determination of ligands that bind to the opiate receptors in the brain is useful in the development of less-addictive replacements for morphine and related drugs.
- sample refers to anything which can contain an analyte for which an analyte assay is desired.
- the sample can be a biological sample, such as a biological fluid or a biological tissue.
- biological fluids include urine, blood, plasma, serum, saliva, semen, stool, sputum, cerebral spinal fluid, tears, mucus, amniotic fluid or the like.
- Biological tissues are aggregate of cells, usually of a particular kind together with their intercellular substance that form one of the structural materials of a human, animal, plant, bacterial, fungal or viral structure, including connective, epithelium, muscle and nerve tissues. Examples of biological tissues also include organs, tumors, lymph nodes, arteries and individual cell(s).
- high stringency 0.1 x SSPE, 0.1 % SDS, 65 °C
- medium stringency 0.2 x SSPE, 0.1 % SDS, 50 °C
- Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 ⁇ g/ml salmon sperm DNA, 1 0% (wt/vol) dextran sulfate, and 5-20 X 1 0 6 cpm 32 P-labeled probe is used. Filters are incubated in hybridization mixture for 1 8-20 hours at 40°C, and then washed for 1 .5 hours at 55 °C in a solution containing 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS. The wash solution is replaced with fresh solution and incubated an additional 1 .5 hours at 60°C.
- Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68 °C and reexposed to film.
- Other conditions of low stringency which can be used are well known in the art (e.g. , as employed for cross-species hybridizations).
- procedures using conditions of moderate stringency include, for example, but are not limited to, procedures using such conditions of moderate stringency are as follows: Filters containing DNA are pretreated for 6 hours at 55 °C in a solution containing 6X SSC, 5X Denhart's solution, 0.5% SDS and 1 00 ⁇ g/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution and 5-20 X 1 0 6 cpm 32 P-labeled probe is used. Filters are incubated in hybridization mixture for 1 8-20 hours at 55 °C, and then washed twice for 30 minutes at 60 °C in a solution containing 1 X SSC and 0.1 % SDS.
- Filters are blotted dry and exposed for autoradiography. Other conditions of moderate stringency which can be used are well-known in the art. Washing of filters is done at 37 °C for 1 hour in a solution containing 2X SSC, 0.1 % SDS.
- procedures using conditions of high stringency are as follows: Prehybridization of filters containing DNA is carried out for 8 hours to overnight at 65 °C in buffer composed of 6X SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 ⁇ g/ml denatured salmon sperm DNA. Filters are hybridized for 48 hours at 65 °C in prehybridization mixture containing 100 ⁇ g/ml denatured salmon sperm DNA and 5-20 X 1 0 6 cpm of 32 P-labeled probe.
- substantially identical or homologous or similar varies with the context as understood by those skilled in the relevant art and generally means at least 60% or 70%, preferably means at least 80%, more preferably at least 90%, and most preferably at least 95 % identity.
- substantially identical to a product means sufficiently similar so that the property of interest is sufficiently unchanged so that the substantially identical product can be used in place of the product.
- substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance.
- TLC thin layer chromatography
- HPLC high performance liquid chromatography
- Methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art.
- a substantially chemically pure compound can, however, be a mixture of stereoisomers or isomers. In such instances, further purification might increase the specific activity of the compound.
- test substance refers to a chemically defined compound (e.g. , organic molecules, inorganic molecules, organic/inorganic molecules, proteins, peptides, nucleic acids, oligonucleotides, lipids, polysaccharides, saccharides, or hybrids among these molecules such as glycoproteins, etc.) or mixtures of compounds (e.g.
- a therapeutic agent As used herein, the terms a therapeutic agent, therapeutic regimen, radioprotectant, chemotherapeutic mean conventional drugs and drug therapies, including vaccines, which are known to those skilled in the art. Radiotherapeutic agents are well known in the art.
- treatment means any manner in which the symptoms of a condition, disorder or disease are ameliorated or otherwise beneficially altered. Treatment also encompasses any pharmaceutical use of the compositions herein.
- vector or plasmid refers to discrete elements that are used to introduce heterologous nucleic acid into cells for either expression or replication thereof. The vectors typically remain episomal, but can be designed to effect integration of a gene or portion thereof into a chromosome of the genome.
- an expression vector includes vectors capable of expressing DNA that is operatively linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments.
- an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA.
- protein binding sequence refers to a protein or peptide sequence that is capable of specific binding to other protein or peptide sequences generally, to a set of protein or peptide sequences or to a particular protein or peptide sequence.
- epitope tag refers to a short stretch of amino acid residues corresponding to an epitope to facilitate subsequent biochemical and immunological analysis of the epitope tagged protein or peptide.
- Epitope tagging is achieved by including the sequence of the epitope tag to the protein-encoding sequence in an appropriate expression vector.
- Epitope tagged proteins can be affinity purified using highly specific antibodies raised against the tags.
- metal binding sequence refers to a protein or peptide sequence that is capable of specific binding to metal ions generally, to a set of metal ions or to a particular metal ion.
- a combination refers to any association between two or among more items.
- composition refers to a any mixture. It can be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof.
- fluid refers to any composition that can flow. Fluids thus encompass compositions that are in the form of semi-solids, pastes, solutions, aqueous mixtures, gels, lotions, creams and other such compositions.
- a cellular extract refers to a preparation or fraction which is made from a lysed or disrupted cell.
- an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of a protein alone or with its associated substrates, binding partners, etc.
- An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism or conditioned medium.
- an agent is said to be rationally selected or designed when the agent is chosen on a non-random basis which takes into account the sequence of the target site and/or its conformation in connection with the agent's action.
- Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up these sites.
- a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to the ATP or calmodulin binding sites or domains.
- SPs serine proteases
- SPs The serine proteases (SPs) are a family of proteins found in mammals and also other species. SPs that share a number of common structural features as described herein. The proteolytic domains share sequence homology including conserved His, Asp, and Ser residues necessary for catalytic activity that are present in conserved motifs. These SPs are synthesized as zymogens, and activated to two chain forms by specific cleavage.
- the SP family can be target for therapeutic intervention and also can serve as diagnostic markers for tumor initiation, development, growth and/or progression.
- members of this family are involved in proteolytic processes that are implicated in tumor development, growth and/or progression. This implication is based upon their functions as proteolytic enzymes in extracellular matrix degradation and remodelling and growth and pro-angiogenic factor activation.
- their levels of expression or level of activation or their apparent activity resulting from substrate levels or alterations in substrates and levels thereof differs in tumor cells and non-tumor cells in the same tissue.
- protocols and treatments that alter their activity such as their proteolytic activities and roles in signal transduction, and/or their expression, such as by contacting them with a compound that modulates their activity and/or expression, could impact tumor development, growth and/or progression.
- the level of activation and/or expression can be altered in tumors, such as pancreas, stomach, uterus, lung, colon and cervical cancers, and also breast, prostate or leukemias.
- the SP thus, can serve as a diagnostic marker for tumors.
- the SP protein can exhibit altered activity by virtue of a change in activity or expression of a co-factor therefor or a substrate therefor.
- Detection of the SPs, particularly the protease domains, in body fluids, such as serum, blood, saliva, cerebral spinal fluid, synovial fluid and interstitial fluids, urine, sweat and other such fluids and secretions can serve as a diagnostic tumor marker.
- detection of higher levels of such polypeptides in a subject compared to a subject known not to have any neoplastic disease or compared to earlier samples from the same subject can be indicative of neoplastic disease in the subject.
- CVSP1 4 a family member designated CVSP1 4.
- CVSP14s are serine proteases that are expressed and/or activated in certain tumors; hence their activation or expression can serve as a diagnostic marker for tumor development, growth and/or progression.
- the CVSP1 4 is also provided for use as a drug target and used in screening assays, including those exemplified herein.
- the single chain proteolytic domain can function in vitro and, hence is useful in in vitro assays for identifying agents that modulate the activity of members of this family.
- the two-chain form or the full-length or truncated forms thereof, such as forms in which the signal peptide is removed can also be used in such assays.
- the CVSP1 4 polypeptide is detectable in a body fluid at a level that differs from its level in body fluids in a subject not having a tumor. In other embodiments, the polypeptide is present in a tumor; and a substrate or cofactor for the polypeptide is expressed at levels that differ from its level of expression in a non-tumor cell in the same type of tissue.
- CVSP14 Provided are substantially purified CVSP1 4 zymogens, activated two chain forms, single chain protease domains and two chain protease domains. A full-length CVSP14 polypeptide, including the signal sequence, is set forth in SEQ ID Nos. 1 2 and 1 3. The signal sequence can be cleaved upon expression or prior to expression.
- substantially purified protein including a sequence of amino acids that has at least 60%, 70%, 80%, 90% or about 95%, identity to the CVSP1 4 where the percentage identity is determined using standard algorithms and gap penalties that maximize the percentage identity.
- a human CVSP14 polypeptide is exemplified, although other mammalia CVSP14 polypeptides are contemplated. Splice variants of the CVSP14, particularly those with a proteolytically active protease domain, are contemplated herein.
- substantially purified polypeptides that include a protease domain of a CVSP14 polypeptide or a catalytically active portion thereof, but that do not include the entire sequence of amino acids set forth in SEQ ID No. 1 3 are provided.
- polypeptides that include a sequence of amino acids that has at least 60%, 70%, 80%, 90%, 95% or 1 00% sequence identity to SEQ ID No. 6.
- substantially purified CVSP14 polypeptides and functional domains thereof including catalytically active domains and portions, that have at least about 60%, 70%, 80%, 90% or about 95% sequence identity with a protease domain that includes the sequence of amino acids set forth in SEQ ID No. 6 or a catalytically active portion thereof or with a protease that includes the sequence of amino acids set forth in SEQ ID No. 1 3 and domains thereof.
- the protease activation cleavage site is between R 55 and l 56 ; the catalytic triad based upon homology is H 9 ⁇ , D 146 , S 244 ; there is a potential N-glycosylation site at N 108 VT; Cys pairing is predicted to be between C 37 -C 166 , which links the protease domain to the remainder of the polypeptide), C 180 -C 250 , C 21 1 -C 229 and C 240 -C 269 .
- C 166 is a free Cys in the protease domain, which also can be provided as a two chain molecule. It is shown herein, however, that the single chain form is proteolytically active.
- polypeptides that are encoded by the nucleic acid molecules provided herein. Included among those polypeptides are the CVSP1 4 protease domain or a polypeptide with amino acid changes such that the specificity and protease activity is not eliminated and is retained at least 1 0%, 20%, 30%, 40%, 50% , 60%, 70% , 80%, 90% or remains substantially unchanged.
- a substantially purified mammalian SP protein is provided that includes a serine protease catalytic domain and can additionally include other domains.
- the CVSP1 4 can form homodimers and can also form heterodimers with some other protein, such as a membrane-bound protein.
- the domains, fragments, derivatives or analogs of a CVSP14 that are functionally active are capable of exhibiting one or more functional activities associated with the CVSP14 polypeptide, such as serine protease activity, immunogenicity and antigenicity, are provided.
- Antigenic epitopes that contain at least 4, 5, 6, 7, 8, 9, 10, 1 1 , 1 2, 1 3, 1 4, 1 5, 20, 25, 30, 40, 50, and typically 1 0-1 5 amino acids of the CVSP1 4 polypeptide are provided. These antigenic epitopes are used, for example, to raise antibodies. Antibodies specific for each epitope or combinations thereof and for single and two-chain forms are also provided.
- CVSP14 polypeptides Full-length CVSP1 4, zymogen and activated forms thereof and CVSP14 protease domains, portions thereof, and muteins and derivatives of such polypeptides are provided.
- the derivatives are those based on animal CVSP1 4s, including, but are not limited to, rodent, such as mouse and rat; fowl, such as chicken; ruminants, such as goats, cows, deer, sheep; ovine, such as pigs; and humans.
- rodent such as mouse and rat
- fowl such as chicken
- ruminants such as goats, cows, deer, sheep
- ovine such as pigs
- CVSP1 4 derivatives can be made by altering their sequences by substitutions, additions or deletions.
- CVSP1 4 derivatives include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of CVSP14, including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a silent change.
- one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent, resulting in a silent alteration.
- Substitutes for an amino acid within the sequence can be selected from other members of the class to which the amino acid belongs.
- the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
- the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
- the positively charged (basic) amino acids include arginine, lysine and histidine.
- the negatively charged (acidic) amino acids include aspartic acid and glutamic acid (see, e.g. , Table 1 ).
- Muteins of the CVSP1 4 or a domain thereof, such as a protease domain, in which up to about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85 %, 90% or 95 % of the amino acids are replaced with another amino acid are provided.
- muteins retain at least about 10%, 20%, 30%, 40% , 50%, 60%, 70%, 80% or 90% of the protease activity the unmutated protein.
- Muteins of the protein are also provided in which amino acids are replaced with other amino acids.
- the muteins are those in which the Cys residues, is/are replaced typically although not necessarily, with a conservative amino acid residues, such as a serine.
- Such muteins are also provided herein. Muteins in which 1 0%, 20%, 30%, 35%, 40%, 45 %, 50% or more of the amino acids are replaced but the resulting polypeptide retains at least about 10%, 20%, 30% , 35 %, 40%, 45 %, 50%, 60%, 70%, 80%, 90% or 95 % of the catalytic activity as the unmodified form for the same substrate.
- protease domains Isolated, substantially pure proteases that include the protease domains or catalytically active portions thereof as single chain forms of SPs are provided.
- the protease domains can be included in a longer protein, and such longer protein is optionally the CVSP1 4 zymogen.
- isolated substantially pure single polypeptides that contain the protease domain of a CVSP1 4 as a single chain.
- the CVSP14 provided herein is expressed or activated by or in tumor cells, typically at a level that differs from the level in which they are expressed by the non-tumor cell of the same type.
- SP is expressed by a prostate or ovarian tumor cell, to be of interest herein with respect to ovarian or prostate cancer, it an expression, extent of activation or activity that is different from that in non-tumor cells.
- CVSP14 is expressed in lung, colon, prostate, breast, uterine, ovarian and other tumor cells.
- SP protease domains include the single chain protease domains of
- CVSP1 4 Provided are the protease domains or proteins that include a portion of an SP that is the protease domain of any SP, particularly a CVSP14.
- the protein can also include other non-SP sequences of amino acids, but includes the protease domain or a sufficient portion thereof to exhibit catalytic activity in any in vitro assay that assess such protease activity, such as any provided herein.
- two chain activated forms of the full length protease and also two chain forms of the protease domain are also provided.
- the substantially purified SP protease is encoded by a nucleic acid that hybridizes to the a nucleic acid molecule containing the protease domain encoded by the nucleotide sequence set forth in SEQ. ID No. 5 under at least moderate, generally high, stringency conditions, such that the protease domain encoding nucleic acid thereof hybridizes along its full length or along at least about 70%, 80% or 90% of the full length.
- the substantially purified SP protease is a single chain polypeptide that includes substantially the sequence of amino acids set forth in SEQ ID No. 6, or a catalytically active portion thereof.
- exemplary protease domains include at least a sufficient portion of sequences of amino acids set forth in SEQ ID No. 6 (encoded by nucleotides in SEQ ID No. 5) to exhibit protease activity in an assay provided herein.
- the signal peptide (amino acids 1 -25 of SEQ ID No. 1 3) is also provided.
- the mature CVSP1 5 polypeptide with the signal sequence removed is provided.
- CVSP14 all forms of the CVSP14, including the pro- polypeptide with the signal sequence, the mature polypeptide and catalytically active portions thereof, the protease domains and catalytically active portions thereof, two-chain and single chain forms of any of these proteins are provided herein and can be used in the screening assays and for preparing antibodies specific therefore.
- the expression, quantity and/or activation of the protein in tumor cells and body fluids can be diagnostic of disease or its absence.
- nucleic sequences which encode substantially the same amino acid sequence as a CVSP1 4 gene can be used. These include but are not limited to nucleotide sequences comprising all or portions of CVSP1 4 genes that are altered by the substitution of different codons that encode the amino acid residue within the sequence, thus producing a silent change. Also provided are nucleic acid molecules that hybridize to the above- noted sequences of nucleotides encoding CVSP1 4 at least at low stringency, at moderate stringency, and/or at high stringency, and that encode the protease domain and/or the full length protein or other domains of a CVSP14 or a splice variant or allelic variant thereof.
- nucleic acid molecules include any isolated nucleic fragment that encodes at least one domain of a serine protease, that ( 1 ) contains a sequence of nucleotides that encodes the protease or a functionally active, such as catalytically active, domain thereof, and (2) is selected from among:
- a sequence of nucleotides that encodes the protease or a domain thereof includes a sequence of nucleotides set forth in SEQ ID Nos. 5 or 1 2;
- the isolated nucleic acid fragment is DNA, including genomic or cDNA, or is RNA, or can include other components, such as protein nucleic acid.
- the isolated nucleic acid can include additional components, such as heterologous or native promoters, and other transcriptional and translational regulatory sequences, these genes can be linked to other genes, such as reporter genes or other indicator genes or genes that encode indicators.
- the CVS14s provided herein are encoded by a nucleic acid that includes sequence encoding a protease domain that exhibits proteolytic activity and that hybridizes to a nucleic acid molecule including the sequence of nucleotides set forth in SEQ ID No. 5, typically under moderate, generally under high stringency, conditions and generally along the full length of the protease domain or along at least about 70%, 80% or 90% of the full length.
- Splice variants are also provided herein.
- a nucleic acid that encodes a CVSP designated CVSP14 is provided.
- the nucleic acid includes the sequence of nucleotides set forth in SEQ ID No. 5 or a portion there of that encodes a catalytically active polypeptide.
- nucleic acid molecules that hybridize under conditions of at least low stringency, generally moderate stringency, more typically high stringency to the SEQ ID No. 5 or degenerates thereof.
- the isolated nucleic acid fragment hybridizes to a nucleic acid molecule containing the nucleotide sequence set forth in SEQ ID No: 5 (or degenerates thereof) under high stringency conditions, in one embodiments contains the sequence of nucleotides set forth in SEQ ID Nos. 5 and 6).
- a full- length CVSP14 is set forth in SEQ ID No. 1 3 and is encoded by SEQ ID No. 1 2 or degenerates thereof.
- nucleic acid molecules that encode a single chain SP protease that have proteolytic activity in an in vitro proteolysis assay and that have at least 60%, 70%, 80%, 85 %, 90% or 95 % sequence identity with the full length of a protease domain of a CVSP1 4 polypeptide, or that hybridize along their full length or along at least about 70%, 80% or 90% of the full length to a nucleic acids that encode a protease domain, particularly under conditions of moderate, generally high, stringency.
- the encoded polypeptides contain the protease as a single chain.
- the isolated nucleic acids can contain least 10 nucleotides, 25 nucleotides, 50 nucleotides, 100 nucleotides, 1 50 nucleotides, or 200 nucleotides or more contiguous nucleotides of a CVSP14-encoding sequence, or a full-length SP coding sequence. In another embodiment, the nucleic acids are smaller than 35, 200 or 500 nucleotides in length. Nucleic acids that hybridize to or are complementary to a CVSP1 4-encoding nucleic acid molecule can be single or double-stranded.
- nucleic acids are provided that include a sequence complementary to (specifically are the inverse complement of) at least 1 0, 25, 50, 100, or 200 nucleotides or the entire coding region of a CVSP1 4 encoding nucleic acid, particularly the protease domain thereof .
- CVSP1 4 the full-length protein or a domain or active fragment thereof is also provided.
- the nucleic acid can be DNA or
- RNA or PNA or other nucleic acid analogs or can include non-natural nucleotide bases are also provided.
- isolated nucleic acid molecules that include a sequence of nucleotides complementary to the nucleotide sequence encoding an SP.
- Probes, primers, antisense oligonucleotides and dsRNA are also provided. fragments thereof or oligonucleotides that can be used as probes or primers and that contain at least about 10, 1 4, 1 6 nucleotides, generally less than 1000 or less than or equal to 1 00, set forth in SEQ ID No.
- probes and primers contain less than about 500, 1 50, 1 00 nucleotides.
- Probes and primers derived from the nucleic acid molecules are provided, Such probes and primers contain at least 8, 14, 1 6, 30, 100 or more contiguous nucleotides with identity to contiguous nucleotides of a CVSP1 4.
- the probes and primers are optionally labelled with a detectable label, such as a radiolabel or a fluorescent tag, or can be mass differentiated for detection by mass spectrometry or other means.
- RNAi Double-stranded RNA (dsRNA), such as RNAi is also provided.
- Plasmids, vectors and cells Plasmids and vectors containing the nucleic acid molecules are also provided.
- Cells containing the vectors, including cells that express the encoded proteins are provided.
- the cell can be a bacterial cell, a yeast cell, a fungal cell, a plant cell, an insect cell or an animal cell.
- Methods for producing an SP or single chain.form of the protease domain thereof by, for example, growing the cell under conditions whereby the encoded SP is expressed by the cell, and recovering the expressed protein, are provided herein.
- CVSP1 4 the full-length zymogens and activated proteins and activated (two chain) protease and single chain protease domains are provided.
- the CVSP14 polypeptide, and catalytically active portions thereof can be expressed as a secreted protein using the native signal sequence or a heterologous signal.
- the protein can be expressed as inclusion bodies in the cytoplasm and isolated therefrom. The resulting protein can be treated to refold (see, e.g. , EXAMPLE 1 ). It is shown herein that active protease domain can be produced by expression in inclusion bodies, isolation therefrom and denaturation followed by refolding.
- Each SP has a characteristic tissue expression profile; the SPs in particular, although not exclusively expressed or activated in tumors, exhibit characteristic tumor tissue expression or activation profiles.
- SPs can have different activity in a tumor cell from a non-tumor cell by virtue of a change in a substrate or cofactor therefor or other factor that would alter the apparent functional activity of the SP.
- each can serve as a diagnostic marker for particular tumors, by virtue of a level of activity and/or expression or function in a subject (i.e. a mammal, particularly a human) with neoplastic disease, compared to a subject or subjects that do not have the neoplastic disease.
- detection of activity (and/or expression) in a particular tissue can be indicative of neoplastic disease.
- Circulating SPs in body fluids can be indicative of neoplastic disease.
- Secreted CVSP1 4 or activated CVSP1 4 is indicative of neoplastic disease.
- they can serve as therapeutic targets, such as by administration of modulators of the activity thereof, or ' , as by administration of a prodrug specifically activated by one of the SPs.
- the CVSP14 is expressed at high levels in an androgen-independent tumor cell line.
- the CVSP14 transcript was detected in normal kidney samples.
- CVSP1 4 signals were diminished in all the matched kidney tumor samples.
- Weak signals were detected in all three pairs of prostate normal/tumor cDNA samples.
- Weak signals were also detected in 3 of 9 normal breast samples.
- a weak signal was also detected in one of the 7 uterine tumors, but not in their normal tissue counterparts.
- Weak signals were also detected in two of the three normal lung tissue samples, but not in their matched tumor samples.
- Very weak signals can be seen in cDNA samples from various tumor cell lines, including HeLa cells, Burkitt's lymphoma Daudi cells, chronic myelogenous leukemia K562, promyelocytic leukemia HL-60 cells, melanoma G361 cells, lung carcinoma A549 cells, lymphoblastic leukemia MOLT-4 and colorectal adenocarcinoma SW480 cells.
- the SP polpeptides can be obtained by methods well known in the art for protein purification and recombinant protein expression. Any method known to those of skill in the art for identification of nucleic acids that encode desired genes can be used. Any method available in the art can be used to obtain a full length (i.e. , encompassing the entire coding region) cDNA or genomic DNA clone encoding an SP protein. In particular, the polymerase chain reaction (PCR) can be used to amplify a sequence identified as being differentially expressed or encoding proteins activated at different levels in tumor and non-tumor cells or tissues, e.g.
- PCR polymerase chain reaction
- nucleic acids encoding a CVSP14 polypeptide " (SEQ. NOs: 5, 6, 1 2 and 1 3), in a genomic or cDNA library.
- Oligonucleotide primers that hybridize to sequences at the 3 ' and 5 ' termini of the identified sequences can be used as primers to amplify by PCR sequences from a nucleic acid sample (RNA or DNA), typically a cDNA library, from an appropriate source (e.g. , tumor or cancer tissue).
- PCR can be carried out, e.g. , by use of a Perkin-Elmer Cetus thermal cycler and Taq polymerase (Gene Amp " ) .
- the DNA being amplified can include mRNA or cDNA or genomic DNA from any eukaryotic species.
- an open reading frame encoding the SP protein gene protein product can be determined by any method well known in the art for determining open reading frames, for example, using publicly available computer programs for nucleotide sequence analysis. Once an open reading frame is defined, it is routine to determine the amino acid sequence of the protein encoded by the open reading frame. In this way, the nucleotide sequences of the entire SP protein genes as well as the amino acid sequences of SP protein proteins and analogs can be identified.
- Any eukaryotic cell potentially can serve as the nucleic acid source for the molecular cloning of the SP protein gene.
- the nucleic acids can be isolated from vertebrate, mammalian, human, porcine, bovine, feline, avian, equine, canine, as well as additional primate sources, insects, plants, etc.
- the DNA can be obtained by standard procedures known in the art from cloned DNA (e.g.
- Clones derived from genomic DNA can contain regulatory and intron DNA regions in addition to coding regions; clones derived from cDNA contains only exon sequences.
- the gene should be molecularly cloned into a suitable vector for propagation of the gene.
- DNA fragments are generated, some of which encode the desired gene.
- the DNA can be cleaved at specific sites using various restriction enzymes.
- the linear DNA fragments can then be separated according to size by standard techniques, including but not limited to, agarose and polyacrylamide gel electrophoresis and column chromatography.
- identification of the specific DNA fragment containing the desired gene can be accomplished in a number of ways.
- a portion of the SP protein (of any species) gene e.g. , a PCR amplification product obtained as described above or an oligonucleotide having a sequence of a portion of the known nucleotide sequence
- its specific RNA or a fragment thereof be purified and labeled
- the generated DNA fragments can be screened by nucleic acid hybridization to the labeled probe (Benton and Davis, Science 736: 1 80 (1 977); Grunstein and Hogness, Proc. Natl. Acad. Sci. U.S.A. 72:3961 ( 1 975)).
- DNA fragments with substantial homology to the probe hybridize. It is also possible to identify the appropriate fragment by restriction enzyme digestion(s) and comparison of fragment sizes with those expected according to a known restriction map if such is available or by DNA sequence analysis and comparison to the known nucleotide sequence of SP protein. Further selection can be carried out on the basis of the properties of the gene. Alternatively, the presence of the gene can be detected by assays based on the physical, chemical, or immunological properties of its expressed product. For example, cDNA clones, or DNA clones which hybrid-select the proper mRNA, can be selected which produce a protein that, e.g.
- the protein has similar or identical electrophoretic migration, isoelectric focusing behavior, proteolytic digestion maps, antigenic properties, serine protease activity. If an anti-SP protein antibody is available, the protein can be identified by binding of labeled antibody to the putatively SP protein synthesizing clones, in an ELISA (enzyme- linked immunosorbent assay)-type procedure.
- ELISA enzyme- linked immunosorbent assay
- Alternatives to isolating the CVSP14 polypeptide genomic DNA include, but are not limited to, chemically synthesizing the gene sequence from a known sequence or making cDNA to the mRNA that encodes the SP protein.
- RNA for cDNA cloning of the SP protein gene can be isolated from cells expressing the protein. The identified and isolated nucleic acids can then be inserted into an appropriate cloning vector.
- vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used.
- Such vectors include, but are not limited to, bacteriophages such as lambda derivatives, or plasmids such as pBR322 or pUC plasmid derivatives or the Bluescript vector (Stratagene, La Jolla, CA).
- the insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini. If the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified.
- any site desired can be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers can comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences.
- the cleaved vector and SP protein gene can be modified by homopolymeric tailing.
- Recombinant molecules can be introduced into host cells via, for example, transformation, transfection, infection, electroporation and sonorporation, so that many copies of the gene sequence are generated. In specific embodiments, transformation of host cells with recombinant
- DNA molecules that incorporate the isolated SP protein gene, cDNA, or synthesized DNA sequence enables generation of multiple copies of the gene.
- the gene can be obtained in large quantities by growing transformants, isolating the recombinant DNA molecules from the transformants and, when necessary, retrieving the inserted gene from the isolated recombinant DNA.
- the nucleic acid containing all or a portion of the nucleotide sequence encoding the SP protein can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein coding sequence.
- an appropriate expression vector i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein coding sequence.
- the necessary transcriptional and translational signals also can be supplied by the native promoter for SP genes, and/or their flanking regions.
- vectors that contain nucleic acid encoding the SPs.
- Cells containing the vectors are also provided.
- the cells include eukaryotic and prokaryotic cells, and the vectors are any suitable for use therein.
- Prokaryotic and eukaryotic cells including endothelial cells, containing the vectors are provided.
- Such cells include bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells.
- the cells are used to produce an SP protein or protease domain thereof by growing the above-described cells under conditions whereby the encoded SP protein or protease domain of the SP protein is expressed by the cell, and recovering the expressed protease domain protein.
- the protease domain can be secreted into the medium.
- the vectors include a sequence of nucleotides that encodes a polypeptide that has protease activity and contains all or a portion of only the protease domain, or multiple copies thereof, of an SP protein are provided. Also provided are vectors that comprise a sequence of nucleotides that encodes the protease domain and additional portions of an SP protein up to and including a full length SP protein, as well as multiple copies thereof, are also provided.
- the vectors can selected for expression of the SP protein or protease domain thereof in the cell or such that the SP protein is expressed as a secreted protein. Alternatively, the vectors can include signals necessary for secretion of encoded proteins.
- the protease domain is expressed the nucleic acid is linked to nucleic acid encoding a secretion signal, such as the Saccharomyces cerevisiae ⁇ mating factor signal sequence or a portion thereof, or the native signal sequence.
- a variety of host-vector systems can be used to express the protein coding sequence. These include but are not limited to mammalian cell systems infected with virus (e.g. vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g. baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
- the expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system used, any one of a number of suitable transcription and translation elements can be used.
- any methods known to those of skill in the art for the insertion of DNA fragments into a vector can be used to construct expression vectors containing a chimeric gene containing of appropriate transcriptional/translational control signals and protein coding sequences. These methods can include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of nucleic acid sequences encoding SP protein, or domains, derivatives, fragments or homologs thereof, can be regulated by a second nucleic acid sequence so that the genes or fragments thereof are expressed in a host transformed with the recombinant DNA molecule(s). For example, expression of the proteins can be controlled by any promoter/enhancer known in the art. In a specific embodiment, the promoter is not native to the genes for SP protein. Promoters which can be used include but are not limited to the SV40 early promoter (Bernoist and Chambon, Nature 230:304-310
- promoter elements from yeast and other fungi such as the Gal4 promoter, the alcohol dehydrogenase promoter, the phosphoglycerol kinase promoter, the alkaline phosphatase promoter, and the following animal transcriptional control regions that exhibit tissue specificity and have been used in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., Cell 35:639-646 (1984); Ornitz et al., Cold Spring Harbor Symp.
- mice mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., Cell 45:485-495 (1986)), albumin gene control region which is active in liver (Pinckert et al., Genes and Devel. 7:268- 276 (1987)), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al., Mol. Cell. Biol.5:1639-1648 (1985); Hammer etal., Science 235:53-581987)), alpha-1 antitrypsin gene control region which is active in liver (Kelsey etal., Genes and Devel.
- beta globin gene control region which is active in myeloid cells (Mogram et al., Nature 375:338-340 (1985); Kollias et al., Cell 46:89-94 (1986)), myelin basic protein gene control region which is active in oligodendrocyte cells of the brain (Readhead et al., Cell 43:703-712 (1987)), myosin light chain-2 gene control region which is active in skeletal muscle (Sani, Nature 374:283-286 (1985)), and gonadotrophic releasing hormone gene control region which is active in gonadotrophs of the hypothalamus (Mason etal., Science 234:1372-1378 (1986)).
- a vector in a specific embodiment, contains a promoter operably linked to nucleic acids encoding an SP protein, or a domain, fragment, derivative or homolog, thereof, one or more origins of replication, and optionally, one or more selectable markers (e.g., an antibiotic resistance gene).
- Expression vectors containing the coding sequences, or portions thereof, of an SP protein is made, for example, by subcloning the coding portions into the EcoRI restriction site of each of the three pGEX vectors (glutathione S-transferase expression vectors (Smith and Johnson, Gene 7:31-40 (1988)). This allows for the expression of products in the correct reading frame.
- Vectors and systems for expression of the protease domains of the SP proteins include the well known Pichia vectors (available, for example, from Invitrogen, San Diego, CA), particularly those designed for secretion of the encoded proteins.
- Pichia vectors available, for example, from Invitrogen, San Diego, CA
- One exemplary vector is described in the EXAMPLES.
- Plasmids for transformation of E. coli cells include, for example, the pET expression vectors (see, U.S patent 4,952,496; available from NOVAGEN, Madison, WI; see, also literature published by Novagen describing the system).
- Such plasmids include pET 1 1 a, which contains the T7lac promoter, T7 terminator, the inducible E. coli lac operator, and the lac repressor gene; pET 1 2a-c, which contains the T7 promoter, T7 terminator, and the E.
- coli ompT secretion signal and pET 1 5b and pET1 9b (NOVAGEN, Madison, WI), which contain a His-TagTM leader sequence for use in purification with a His column and a thrombin cleavage site that permits cleavage following purification over the column; the T7-lac promoter region and the T7 terminator.
- the vectors are introduced into host cells, such as Pichia cells and bacterial cells, such as E. coli, and the proteins expressed therein.
- Pichia strains which are known and readily available, include, for example, GS1 1 5.
- Bacterial hosts can contain chromosomal copies of DNA encoding T7 RNA polymerase operably linked to an inducible promoter, such as the lacUV promoter (see, U.S. Patent No. 4,952,496).
- Such hosts include, but are not limited to, the lysogenic E. coli strain BL2 KDE3). Expression and production of proteins
- the SP domains, derivatives and analogs can be produced by various methods known in the art. For example, once a recombinant cell expressing an SP protein, or a domain, fragment or derivative thereof, is identified, the individual gene product can be isolated and analyzed. This is achieved by assays based on the physical and/or functional properties of the protein, including, but not limited to, radioactive labeling of the product followed by analysis by gel electrophoresis, immunoassay, cross-linking to marker-labeled product.
- CVSP14 polypeptides can be isolated and purified by standard methods known in the art (either from natural sources or recombinant host cells expressing the complexes or proteins), including but not restricted to column chromatography (e.g. , ion exchange, affinity, gel exclusion, reversed-phase high pressure, fast protein liquid, etc.), differential centrifugation, differential solubility, or by any other standard technique used for the purification of proteins. Functional properties can be evaluated using any suitable assay known in the art. Alternatively, once an SP protein or its domain or derivative is identified, the amino acid sequence of the protein can be deduced from the nucleotide sequence of the gene which encodes it.
- the protein or its domain or derivative can be synthesized by standard chemical methods known in the art (e.g. see Hunkapiller et al, Nature 370: 1 05-1 1 1 ( 1 984)). Manipulations of SP protein sequences can be made at the protein level.
- SP protein proteins, domains thereof, derivatives or analogs or fragments thereof which are differentially modified during or after translation, e.g. , by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques, including but not limited to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH 4 , acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
- domains, analogs and derivatives of an SP protein can be chemically synthesized.
- a peptide corresponding to a portion of an SP protein, which includes the desired domain or which mediates the desired activity in vitro can be synthesized by use of a peptide synthesizer.
- nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the SP protein sequence.
- Non-classical amino acids include but are not limited to the D-isomers of the common amino acids, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, e-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionoic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ⁇ -alanine, fluoro-amino acids, designer amino acids such as ⁇ -methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).
- the amino acid sequence of the SP protein isolated from the natural source can be determined from analysis of the DNA sequence, or alternatively, by direct sequencing of the isolated protein. Such analysis can be performed by manual sequencing or through use of an automated amino acid sequenator.
- the protease domain of the CVSP1 4 it was found to be advantageous to express the protein intracellularly without a signal sequence, which results in accumulation or formation of inclusion bodies containing protease domain.
- the inclusion bodies are isolated, denatured, solublized and refolded protease domain, which is then activated by cleavage at the Rl site (see, e.g. , EXAMPLES). Modifications A variety of modification of the SP proteins and domains are contemplated herein.
- An SP-encoding nucleic acid molecule be modified by any of numerous strategies known in the art (Sambrook et al. ( 1 989) Molecular Cloning, A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, Cold
- the SP-encoding nucleic acid molecules can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy pre-existing ones, to facilitate further in vitro modification.
- muteins with primary sequence alterations such as replacements of Cys residues and elimination of glycosylation sites are contemplated.
- Such mutations can be effected by any technique for mutagenesis known in the art, including, but not limited to, chemical mutagenesis and in vitro site-directed mutagenesis (Hutchinson et al., J. Biol. Chem.
- an SP protein or domain thereof is modified to include a fluorescent label.
- the SP protein is modified to have a heterofunctional reagent, such heterofunctional reagents can be used to crosslink the members of the complex.
- the SP proteins can be isolated and purified by standard methods known in the art (either from natural sources or recombinant host cells expressing the complexes or proteins), including but not restricted to column chromatography (e.g.
- the single chain protease domains can be used in a variety of methods to identify compounds that modulate the activity thereof. For SPs that exhibit higher activity or expression in tumor cells, compounds that inhibit the proteolytic activity are of particular interest. For any SPs that are active at lower levels in tumor cells, compounds or agents that enhance the activity are potentially of interest. In all instances the identified compounds include agents that are candidate cancer treatments.
- assays are exemplified and described herein. It is understood that the protease domains can be used in other assays. It is shown here, however, that the single chain protease domains exhibit catalytic activity. As such they are ideal for in vitro screening assays. They can also be used in binding assays.
- CVSP14 full length zymogens, activated enzymes, single and two chain protease domains are contemplated for use in any screening assay known to those of skill in the art, including those provided herein.
- proteolytic assays is intended to apply to use of a single chain protease domain or a catalytically active portion thereof of any SP, including a CVSP1 4.
- Other assays, such as binding assays are provided herein, particularly for use with a CVSP14, including any variants, such as splice variants thereof.
- Methods for identifying a modulator of the catalytic activity of an SP are provided herein.
- the methods can be practiced by: a) contacting the
- the control can be the activity of the CVSP14 assessed by contacting a CVSP1 4, including a full-length zymogen or activated form, and particularly a single-chain domain thereof, particularly a single-chain domain thereof, with a substrate of the CVSP14, and detecting the proteolysis of the substrate, whereby the activity of the CVSP14 is assessed.
- the results in the presence and absence of the test compounds are compared. A difference in the activity indicates that the test substance modulates the activity of the CVSP1 4.
- Activators of activation are also contemplated; such assays are discussed below.
- a plurality of the test substances are screened simultaneously in the above screening method.
- the CVSP1 4 is isolated from a target cell as a means for then identifying agents that are potentially specific for the target cell.
- a test substance is a therapeutic compound, and whereby a difference of the CVSP14 activity measured in the presence and in the absence of the test substance indicates that the target cell responds to the therapeutic compound.
- One method includes the steps of (a) contacting the CVSP14 polypeptide or protease domain thereof with one or a plurality of test compounds under conditions conducive to interaction between the ligand and the compounds; and (b) identifying one or more compounds in the plurality that specifically binds to the ligand.
- Another method provided herein includes the steps of a) contacting a CVSP1 4 polypeptide or protease domain thereof with a substrate of the CVSP1 4 polypeptide, and detecting the proteolysis of the substrate, whereby the activity of the CVSP14 polypeptide is assessed; b) contacting the CVSP14 polypeptide with a substrate of the CVSP1 4 polypeptide in the presence of a test substance, and detecting the proteolysis of the substrate, whereby the activity of the CVSP1 4 polypeptide is assessed; and c) comparing the activity of the CVSP14 polypeptide assessed in steps a) and b), whereby the activity measured in step a) differs from the activity measured in step b) indicates that the test substance modulates the activity of the CVSP1 4 polypeptide.
- a plurality of the test substances are screened simultaneously.
- the combinations include a CVSP1 4 polypeptide and a substrate of the CVSP1 4 polypeptide to be assayed; and, optionally reagents for detecting proteolysis of the substrate.
- the substrates which are can be chromogenic or fluorgenic molecules, including proteins, subject to proteolysis by a particular CVSP1 4 polypeptide, can be identified empirically by testing the ability of the CVSP14 polypeptide to cleave the test substrate. Substrates that are cleaved most effectively (i.e., at the lowest concentrations and/or fastest rate or under desirable conditions), are identified.
- kits containing the above-described combination.
- the kit optionally includes instructions for identifying a modulator of the activity of a CVSP14 polypeptide. Any CVSP14 polypeptide is contemplated as target for identifying modulators of the activity thereof. 2. Binding assays
- the assays are designed to identify agents that bind to the zymogen form, the single chain isolated protease domain (or a protein, other than a CVSP1 4 polypeptide, that contains the protease domain of a CVSP14 polypeptide), and to the activated form, including the activated form derived from the full length zymogen or from an extended protease domain.
- the identified compounds are candidates or leads for identification of compounds for treatments of tumors and other disorders and diseases involving aberrant angiogenesis.
- the CVSP14 polypeptides used in the methods include any CVSP14 polypeptide as defined herein, including the CVSP1 4 single chain protease domain or proteolytically active portion thereof.
- a variety of methods are provided herein. These methods can be performed in solution or in solid phase reactions in which the CVSP1 4 polypeptide(s) or protease domain(s) thereof are linked, either directly or indirectly via a linker, to a solid support. Screening assays are described in the Examples, and these assays have been used to identify candidate compounds. For purposes herein, all binding assays described above are provided for CVSP1 4.
- Methods for identifying an agent, such as a compound, that specifically binds to a CVSP1 4 single chain protease domain, a zymogen or full-length activated CVSP14 or two chain protease domain thereof are provided herein.
- the method can be practiced by (a) contacting the CVSP1 4 with one or a plurality of test agents under conditions conducive to binding between the CVSP1 4 and an agent; and (b) identifying one or more agents within the plurality that specifically binds to the CVSP14.
- the CVSP14 polypeptide is mixed with a potential binding partner or an extract or fraction of a cell under conditions that allow the association of potential binding partners with the polypeptide.
- peptides, polypeptides, proteins or other molecules that have become associated with a CVSP14 are separated from the mixture.
- the binding partner that bound to the CVSP1 4 can then be removed and further analyzed.
- the entire protein for instance the entire disclosed protein of SEQ ID Nos. 6 can be used.
- a fragment of the protein can be used.
- a variety of methods can be used to obtain cell extracts or body fluids, such as blood, serum, urine, sweat, synovial fluid, CSF and other such fluids.
- cells can be disrupted using either physical or chemical disruption methods.
- physical disruption methods include, but are not limited to, sonication and mechanical shearing.
- chemical lysis methods include, but are not limited to, detergent lysis and enzyme lysis.
- a skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods.
- the extract is mixed with the CVSP1 4 under conditions in which association of the protein with the binding partner can occur.
- conditions can be used, including conditions that resemble conditions found in the cytoplasm of a human cell.
- Features such as osmolarity, pH, temperature, and the concentration of cellular extract used, can be varied to optimize the association of the protein with the binding partner.
- methods for isolation of molecules of interest from body fluids are known.
- the bound complex is separated from the mixture.
- a variety of techniques can be used to separate the mixture. For example, antibodies specific to a CVSP14 can be used to immunoprecipitate the binding partner complex. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation can be used.
- the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture.
- the CVSP14 can be immobilized on a solid support.
- the protein can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the protein or a fragment thereof to a solid support aids in separating peptide/binding partner pairs from other constituents found in the extract.
- the identified binding partners can be either a single protein or a complex made up of two or more proteins.
- the nucleic acid molecules encoding the single chain proteases can be used in a yeast two-hybrid system.
- the yeast two-hybrid system has been used to identify other protein partner pairs and can readily be adapted to employ the nucleic acid molecules herein described.
- Another in vitro binding assay particularly for a CVSP1 4, uses a mixture of a polypeptide that contains at least the catalytic domain of one of these proteins and one or more candidate binding targets or substrates. After incubating the mixture under appropriate conditions, the ability of the CVSP1 4 or a polypeptide fragment thereof containing the catalytic domain to bind to or interact with the candidate substrate is assessed.
- one of the components includes or is coupled to a detectable label.
- the label can provide for direct detection, such as radioactivity, luminescence, optical or electron density, etc., or indirect detection such as an epitope tag, an enzyme, etc.
- direct detection such as radioactivity, luminescence, optical or electron density, etc.
- indirect detection such as an epitope tag, an enzyme, etc.
- a variety of methods can be employed to detect the label depending on the nature of the label and other assay components.
- the label can be detected bound to the solid substrate or a portion of the bound complex containing the label can be separated from the solid substrate, and the label thereafter detected.
- CVSPs such as CVSP1 4
- Assays for assessing signal transduction are well known to those of skill in the art, and can be adapted for use with the CVSP1 4 polypeptide.
- Assays for identifying agents that affect or alter signal transduction mediated directly or indirectly, such as via activation of a pro-growth factor, by a CVSP1 4, particularly the full length or a sufficient portion to anchor the extracellular domain or a functional portion thereof of a CVSP on the surface of a cell are provided.
- Such assays include, for example, transcription based assays in which modulation of a transduced signal is assessed by detecting an effect on an expression from a reporter gene (see, e.g. , U.S. Patent No. 5,436, 1 28).
- Another embodiment provides methods for identifying agents that modulate the expression of a nucleic acid encoding a CVSP14.
- Such assays use any available means of monitoring for changes in the expression level of the nucleic acids encoding a CVSP14.
- cell lines that contain reporter gene fusions between the open reading frame of CVSP1 4 or a domain thereof, particularly the protease domain and any assayable fusion partner can be prepared.
- Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al..
- Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells can be prepared from the nucleic acids. It is typical, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic acid hybrids form under conditions of high stringency. Accordingly, the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe:target hybrid and potential probe:non-target hybrids.
- Probes can be designed from the nucleic acids through methods known in the art. For instance, the G + C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available (see, e.g. , Sambrook et al. (1 989)
- Hybridization conditions are modified using known methods (see, e.g. , Sambrook et al. ( 1 989) MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed. Cold Spring Harbor Laboratory Press); and Ausubel et al. (1 995) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing Co., NY), as required for each probe.
- Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format.
- total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support, and the solid support exposed to at least one probe comprising at least one, or part of one of the nucleic acid molecules under conditions in which the probe specifically hybridizes.
- nucleic acid fragments comprising at least one, or part of one of the sequences can be affixed to a solid support, such as a porous glass wafer. The glass wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences specifically hybridize.
- Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/1 1 755).
- agents which up or down regulate the expression of a nucleic acid encoding the CVSP1 4 polypeptide are identified.
- the relative amounts of a protein between a cell population that has been exposed to the agent to be tested compared to an un-exposed control cell population can be assayed (e.g., a prostate cancer cell line, a lung cancer cell line, a colon cancer cell line or a breast cancer cell line).
- probes such as specific antibodies, are used to monitor the differential expression or level of activity of the protein in the different cell populations or body fluiids.
- Cell lines or populations or body fluids are exposed to the agent to be tested under appropriate conditions and time.
- Cellular lysates or body fluids can be prepared from the exposed cell line or population and a control, unexposed cell line or population or unexposed body fluid. The cellular lysates or body fluids are then analyzed with the probe.
- N- and C- terminal fragments of the CVSP1 4 can be expressed in bacteria and used to search for proteins which bind to these fragments.
- Fusion proteins such as His-tag or GST fusion to the N- or C- terminal regions of the CVSP14 can be prepared for use as a substrate. These fusion proteins can be coupled to, for example, Glutathione-Sepharose beads and then probed with cell lysates or body fluids. Prior to lysis, the cells or body fluids can be treated with a candidate agent which can modulate a CVSP14 or proteins that interact with domains thereon. Lysate proteins binding to the fusion proteins can be resolved by SDS-PAGE, isolated and identified by protein sequencing or mass spectroscopy, as is known in the art.
- Antibody probes are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides or proteins if they are of sufficient length (e.g., 4, 5, 6, 7, 8, 9, 1 0, 1 1 , 1 2, 13, 1 4, 1 5, 20, 25, 30, 35, 40 or more consecutive amino acids the CVSP1 4 polypeptide or if required to enhance immunogenicity, conjugated to suitable carriers.
- suitable carriers such as bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH), or other carrier proteins are well known in the art.
- direct conjugation using, for example, carbodiimide reagents can be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, can be desirable to provide accessibility to the hapten.
- Hapten peptides can be extended at either the amino or carboxy terminus with a Cys residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier.
- Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.
- Anti-peptide antibodies can be generated using synthetic peptides corresponding to, for example, the carboxy terminal amino acids of the CVSP14. Synthetic peptides can be as small as 1 -3 amino acids in length, generally at least 4 or more amino acid residues long. The peptides can be coupled to KLH using standard methods and can be immunized into animals, such as rabbits or ungulate. Polyclonal antibodies can then be purified, for example using Actigel beads containing the covalently bound peptide. While the polyclonal antisera produced in this way can be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations are generally used.
- Immortalized cell lines which secrete the desired monoclonal antibodies can be prepared using the standard method of Kohler et al., (Nature 256: 495-7 ( 1 975)) or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known.
- the immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten, polypeptide or protein.
- the cells can be cultured either in vitro or by production in vivo via ascites fluid.
- the zymogen or two-chain form of the CVSP14 can be used to make monoclonal antibodies that recognize conformation epitopes.
- the desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera which contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies.
- Use of immunologically reactive fragments, such as the Fab, Fab', of F(ab') 2 fragments are often used, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
- the antibodies or fragments can also be produced. Regions that bind specifically to the desired regions of receptor also can be produced in the context of chimeras with multiple species origin.
- Agents that are assayed in the above method can be randomly selected or rationally selected or designed.
- the agents can be, as examples, peptides, small molecules, and carbohydrates. A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents.
- the peptide agents can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art.
- the DNA encoding these peptides can be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems. The production using solid phase peptide synthesis is necessitated if non-gene-encoded amino acids are to be included.
- CVSP1 4 are provided.
- the methods include phage display and other methods for assessing alterations in the activity of a CVSP1 4.
- Such methods or assays can use any means of monitoring or detecting the desired activity.
- a variety of formats and detection protocols are known for performing screening assays.
- CVSP1 4 polypeptide activities The following includes a discussion of exemplary protocols.
- the assay can be conducted where a single CVSP1 4 polypeptide is screened, and/or a single test substance is screened in one assay, the assay typically is conducted in a high throughput screening mode, i.e. , a plurality of the SP proteins are screened against and/or a plurality of the test substances are screened simultaneously (See generally, High Throughput Screening: The Discovery of Bioactive Substances (Devlin, Ed.) Marcel Dekker, 1 997; Sittampalam et al., Curr. Opin. Chem. Biol. , 7 :384-91 ( 1 997); and Silverman et al., Curr. Opin. Chem. Biol. , 2:397-403 (1 998)).
- the assay can be conducted in a multi-well (e.g. , 24-, 48-, 96-, 384-, 1 536-well or higher density), chip or array format.
- High-throughput screening is the process of testing a large number of diverse chemical structures against disease targets to identify "hits" (Sittampalam et al., Curr. Opin. Chem. Biol. , 7 :384-91 ( 1 997)).
- Current state-of- the-art HTS operations are highly automated and computerized to handle sample preparation, assay procedures and the subsequent processing of large volumes of data.
- Detection technologies employed in high-throughput screens depend on the type of biochemical pathway being investigated (Sittampalam et al., Curr. Opin. Chem. Biol. , 7 :384-91 ( 1 997)). These methods include, radiochemical methods, such as the scintillation proximity assays (SPA), which can be adapted to a variety of enzyme assays (Lerner et al., J. Biomol. Screening, 7 : 1 35-1 43 ( 1 996); Baker et al., Anal. Biochem. , 239:20-24 ( 1 996); Baum et al., Anal. Biochem. , 237: 1 29-1 34 ( 1 996); and Sullivan et al., J.
- SPA scintillation proximity assays
- Biomol. Screening 2 1 9- 23 ( 1 997)
- protein-protein interaction assays Beckunwalder et al., J. Biomol. Screening 7 :23-26 (1 996); Sonatore et al., Anal. Biochem. 240:289-297 ( 1 996); and Chen et al., J. Biol. Chem. 277 :25308-2531 5 (1 996)
- non-isotopic detection methods including but are not limited to, colorimetric and luminescence detection methods, resonance energy transfer (RET) methods, time-resolved fluorescence (HTRF) methods, cell-based fluorescence assays, such as fluorescence resonance energy transfer (FRET) procedures (see, e.g.
- Test compounds including small molecules, antibodies, proteins, nucleic acids, peptides, and libraries and collections thereof, can be screened in the above-described assays and assays described below to identify compounds that modulate the activity of a CVSP1 4 polypeptide. Rational drug design methodologies that rely on computational chemistry can be used to screen and identify candidate compounds.
- the compounds identified by the screening methods include inhibitors, including antagonists, and can be agonists
- Compounds for screening include any compounds and collections of compounds available, known or that can be prepared. a. Selection of Compounds
- Compounds can be selected for their potency and selectivity of inhibition of serine proteases, especially a CVSP14 polypeptide.
- a target serine protease and its substrate are combined under assay conditions permitting reaction of the protease with its substrate.
- the assay is performed in the absence of test compound, and in the presence of increasing concentrations of the test compound.
- concentration of test compound at which 50% of the serine protease activity is inhibited by the test compound is the IC 50 value (Inhibitory Concentration) or EC 50 (Effective Concentration) value for that compound.
- IC 50 value Inhibitory Concentration
- EC 50 Effective Concentration
- those having lower IC 50 or EC 50 values are considered more potent inhibitors of the serine protease than those compounds having higher IC 50 or EC 50 values.
- the IC 50 measurement is often used for more simplistic assays, whereas the EC 50 is often used for more complicated assays, such as those employing cells.
- candidate compounds typically have an IC 50 value of 1 00 nM or less as measured in an in vitro assay for inhibition of CVSP14 polypeptide activity.
- the test compounds also are evaluated for selectivity toward a serine protease. As described herein, and as generally known, a test compound is assayed for its potency toward a panel of serine proteases and other enzymes and an IC 50 value or EC 50 value is determined for each test compound in each assay system.
- a compound that demonstrates a low IC 50 value or EC 50 value for the target enzyme, e.g. , CVSP1 4 polypeptide, and a higher IC 50 value or EC 50 value for other enzymes within the test panel e.g.
- urokinase tissue plasminogen activator thrombin, Factor Xa
- thrombin thrombin
- Factor Xa urokinase tissue plasminogen activator
- thrombin thrombin
- Factor Xa Factor Xa
- a compound is deemed selective if its IC 50 value or EC 50 value in the target enzyme assay is at least one order of magnitude less than the next smallest IC 50 value or EC 50 value measured in the selectivity panel of enzymes.
- Compounds are also evaluated for their activity in vivo.
- the type of assay chosen for evaluation of test compounds depends on the pathological condition to be treated or prevented by use of the compound, as well as the route of administration to be evaluated for the test compound.
- the procedures described by Jankun et al., Cane. Res. 57:559-563 ( 1 997) to evaluate PAI-1 can be employed. Briefly, the ATCC cell lines DU 145 and LnCaP are injected into SCID mice. After tumors are established, the mice are given test compound according to a dosing regime determined from the compound's in vitro characteristics. The Jankun et al. compound was administered in water. Tumor volume measurements are taken twice a week for about five weeks. A compound is deemed active if an animal to which the compound was administered exhibited decreased tumor volume, as compared to animals receiving appropriate control compounds.
- a murine xenograft selected for high lung colonization potential in injected into C57B1 /6 mice i.v. (experimental metastasis) or s.c. into the abdominal wall (spontaneous metastasis).
- concentrations of the compound to be tested can be admixed with the tumor cells in Matrigel prior to injection. Daily i.p. injections of the test compound are made either on days 1 -6 or days 7-1 3 after tumor inoculation.
- the animals are sacrificed about three or four weeks after tumor inoculation, and the lung tumor colonies are counted. Evaluation of the resulting data permits a determination as to efficacy of the test compound, optimal dosing and route of administration.
- the activit ⁇ of the tested compounds toward decreasing tumor volume and metastasis can be evaluated in model described in Rabbani et al., Int. J. Cancer 63:840-845 ( 1 995) to evaluate their inhibitor.
- Mat LyLu tumor cells were injected into the flank of Copenhagen rats.
- the animals were implanted with osmotic minipumps to continuously administer various doses of test compound for up to three weeks.
- the tumor mass and volume of experimental and control animals were evaluated during the experiment, as were metastatic growths.
- a rabbit cornea neovascularization model can be employed (see, e.g. , Avery et al. (1 990) Arch. Ophthalmol. , 108: 1474-147).
- Avery et al. describes anesthetizing New Zealand albino rabbits and then making a central corneal incision and forming a radial corneal pocket.
- a slow release prostaglandin pellet was placed in the pocket to induce neovascularization.
- Test compound was administered i.p. for five days, at which time the animals were sacrificed.
- test compound is evaluated by review of periodic photographs taken of the limbus, which can be used to calculate the area of neovascular response and, therefore, limbal neovascularization.
- a decreased area of neovascularization as compared with appropriate controls indicates the test compound was effective at decreasing or inhibiting neovascularization.
- An angiogenesis model used to evaluate the effect of a test compound in preventing angiogenesis is described by Min et al. Cane. Res. 56:2428-2433 ( 1 996) .
- C57BL6 mice receive subcutaneous injections of a Matrigel mixture containing bFGF, as the angiogenesis-inducing agent, with and without the test compound. After five days, the animals are sacrificed and the Matrigel plugs, in which neovascularization can be visualized, are photographed.
- An experimental animal receiving Matrigel and an effective dose of test compound exhibits less vascularization than a control animal or an experimental animal receiving a lessor non-effective does of compound.
- the level of CAT detected in various organs provides an indication of the abilit ⁇ of the test compound to inhibit metastasis; detection of less CAT in tissues of a treated animal versus a control animal indicates less CAT-expressing cells migrated to that tissue.
- F3II tumor cell line
- the CAM model (chick embr ⁇ o chorioallantoic membrane model), first described b ⁇ L. Ossowski in 1 998 (J. Cell Biol. 707:2437-2445 (1 988)), provides another method for evaluating the inhibitor ⁇ activit ⁇ of a test compound.
- tumor cells invade through the chorioallantoic membrane containing CAM with tumor cells in the presence of several serine protease inhibitors results in less or no invasion of the tumor cells through the membrane.
- the CAM assa ⁇ is performed with CAM and tumor cells in the presence and absence of various concentrations of test compound. The invasiveness of tumor cells is measured under such conditions to provide an indication of the compound's inhibitor ⁇ activit ⁇ .
- a compound having inhibitor ⁇ activit ⁇ correlates with less tumor invasion.
- the CAM model is also used in a standard assa ⁇ of angiogenesis (i.e. , effect on formation of new blood vessels (Brooks et al. Methods in Molecular Biology 723:257-269 ( 1 999)).
- angiogenesis inducer such as basic fibroblast growth factor (bFDG) is placed onto the CAM. Diffusion of the c ⁇ tokine into the CAM induces local angiogenesis, which can be measured in several wa ⁇ s such as b ⁇ counting the number of blood vessel branch points within the CAM directl ⁇ below the filter disc.
- a test compound can either be added to the filter disc that contains the angiogenesis inducer, be placed directl ⁇ on the membrane or be administered s ⁇ stemicall ⁇ .
- the extent of new blood vessel formation in the presence and/or absence of test compound can be compared using this model.
- the formation of fewer new blood vessels in the presence of a test compound would be indicative of anti-angiogenesis activit ⁇ .
- Demonstration of anti-angiogenesis activit ⁇ for inhibitors of a CVSP14 pol ⁇ peptide indicates a role in angiogenesis for that SP protein.
- Compounds for screening can be serine protease inhibitors, which can be tested for their abilit ⁇ to inhibit the activit ⁇ of a CVSP14.
- serine protease inhibitors for use in the screening assa ⁇ s, include, but are not limited to: Serine Protease Inhibitor 3 (SPI-3) (Chen, etal. Citokine, 77:856-862 (1999)); Aprotinin (lijima, R., et al., J. Biochem. (Tokyo) 726:912- 916 (1999)); Kazal-t ⁇ pe serine protease inhibitor-like proteins (Niimi, et al. Eur. J. Biochem., 266:282-292 (1999)); Kunitz-t ⁇ pe serine protease inhibitor
- SPI-3 Serine Protease Inhibitor 3
- Aprotinin lijima, R., et al., J. Biochem. (Tokyo) 726:912- 916 (1999)
- Kazal-t ⁇ pe serine protease inhibitor-like proteins Naimi, et al. Eur. J. Biochem.,
- TFPI-2/MSPI Tissue factor pathwa ⁇ inhibitor-2/Matrix-associated serine rotease inhibitor
- Bukunin Cui, CY. etal. J. Invest. Dermatol. 773:182-8 (1999)
- Nafmostat mesilate R ⁇ o, R. et al. Vox Sang. 76:241-6 (1999)
- TPCK Human etal.
- AEBSF 4-(2-aminoeth ⁇ l)-benzenesulfon ⁇ l fluoride
- Pathol. 143(31:886-93 (1993)); FOY-305 (Ohkoshi, M., et al., Anticancer Res., 13(4):963-6 (1993)); Camostat mesilate (Senda, S., et al., Intern. Med., 32(4):350-4 (1993)); Pigment epithelium-derived factor (Steele, F.R., et al., Proc. Natl. Acad. Sci.
- the source of compounds for the screening assa ⁇ s can be libraries, including, but are not limited to, combinatorial libraries.
- Methods for s ⁇ nthesizing combinatorial libraries and characteristics of such combinatorial libraries are known in the art (See generally, Combinatorial Libraries: Synthesis, Screening and Application Potential (Cortese Ed.) Walter de Gru ⁇ ter, Inc., 1995; Tietze and Lieb, Curr. Opin. Chem. Biol., 2(3):363-71 (1998); Lam, Anticancer Drug Des., 12(31:145-67 (1997); Blane ⁇ and Martin, Curr. Opin. Chem. Biol., 1(11:54-9 (1997); and Schultz and Schultz, Biotechnol. Prog., 12(61:729-43 (1996)).
- the libraries fall into roughl ⁇ three categories: fusion-protein-displa ⁇ ed peptide libraries in which random peptides or proteins are presented on the surface of phage particles or proteins expressed from plasmids; support-bound s ⁇ nthetic chemical libraries in which individual compounds or mixtures of compounds are presented on insoluble matrices, such as resin beads (see, e.g., Lam et al., Nature, 354:82-84 (1991)) and cotton supports (see, e.g., Eichler et al., Biochemistry 32:11035-11041 (1993)); and methods in which the compounds are used in solution (see, e.g., Houghten et al., Nature, 354:84-86 (1991); Houghten et al., BioTechniques, 313:412-421 (1992); and Scott et al., Curr.
- insoluble matrices such as resin beads (see, e.g., Lam et al., Nature, 354:
- librar ⁇ In the deterministic librar ⁇ , one knows a priori a particular unit's location on each solid support. In a random librar ⁇ , the location of a particular unit is not known a priori although each site still contains a single unique unit. Man ⁇ methods for preparing libraries are known to those of skill in this art (see, e.g., Ge ⁇ sen et al., Proc. Natl. Acad. Sci. USA, 81:3998-4002 (1984), Houghten et al., Proc. Natl. Acad. Sci. USA, 8J_:5131-5135 (1985)).
- Combinatorial librar ⁇ generated b ⁇ the an ⁇ techniques known to those of skill in the art are contemplated (see, e.g., Table 1 of Schultz and Schultz, Biotechnol. Prog., 12(61:729-43 (1996)) for screening; Bartel et al., Science, 261:1411- 1418 (1993); Baumbach et al. BioPharm, (Can):24-35 (1992); Bock et al. Nature, 355:564-566 (1992); Borman, S., Combinatorial chemists focus on samll molecules molecular recognition, and automation, Chem. Eng.
- peptides that bind to a CVSP1 4 pol ⁇ peptide or a protease domain of an SP protein can be identified using phage displa ⁇ libraries.
- this method can include a) contacting phage from a phage librar ⁇ with the CVSP14 pol ⁇ peptide or a protease domain thereof; (b) isolating phage that bind to the protein; and (c) determining the identit ⁇ of at least one peptide coded b ⁇ the isolated phage to identif ⁇ a peptide that binds to a CVSP1 4 pol ⁇ peptide.
- RNAi double-stranded RNA
- Antibodies including pol ⁇ clonal and monoclonal antibodies, that specificall ⁇ bind to the CVSP14 pol ⁇ peptide provided herein, particularl ⁇ to the single chain protease domains thereof or the activated forms of the full-length or protease domain or the z ⁇ mogen form, are provided.
- the antibod ⁇ is a monoclonal antibod ⁇
- t ⁇ picall ⁇ the antibod ⁇ specificall ⁇ binds to the protease domain of the CVSP1 4 pol ⁇ peptide.
- antibodies to each of the single chain of the protease domain of CVSP1 4 are provided.
- antibodies that specificall ⁇ bind to an ⁇ domain of CVSP1 4 and to two chain forms thereof.
- the CVSP1 4 pol ⁇ peptide and domains, fragments, homologs and derivatives thereof can be used as immunogens to generate antibodies that specificall ⁇ bind such immunogens.
- Such antibodies include but are not limited to pol ⁇ clonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression librar ⁇ .
- antibodies to human CVSP1 4 pol ⁇ peptide are produced.
- complexes formed from fragments of CVSP14 pol ⁇ peptide, which fragments contain the serine protease domain are used as immunogens for antibod ⁇ production.
- pol ⁇ clonal antibodies to CVSP1 4 pol ⁇ peptide its domains, derivatives, fragments or analogs.
- various host animals can be immunized b ⁇ injection with the native CVSP14 pol ⁇ peptide or a s ⁇ nthetic version, or a derivative of the foregoing, such as a cross-linked CVSP14 pol ⁇ peptide.
- host animals include but are not limited to rabbits, mice, rats, etc.
- adjuvants can be used to increase the immunological response, depending on the host species, and include but are not limited to Freund's (complete and incomplete), mineral gels such as aluminum h ⁇ droxide, surface active substances such as I ⁇ solecithin, pluronic pol ⁇ ols, pol ⁇ anions, peptides, oil emulsions, dinitrophenol, and potentiall ⁇ useful human adjuvants such as bacille Calmette-Guerin (BCG) and cor ⁇ nebacterium parvum.
- BCG Bacille Calmette-Guerin
- an ⁇ technique that provides for the production of antibod ⁇ molecules b ⁇ continuous cell lines in culture can be used.
- Such techniques include but are not restricted to the h ⁇ bridoma technique originally developed by Kohler and Milstein (Nature 256:495-497 (1975)), the trioma technique, the human B-cell h ⁇ bridoma technique (Kozbor et al., Immunology Today 4:72 ( 1 983)), and the EBV h ⁇ bridoma technique to produce human monoclonal antibodies (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R.
- monoclonal antibodies can be produced in germ-free animals utilizing recent technolog ⁇ (PCT/US90/02545).
- Human antibodies can be used and can be obtained b ⁇ using human h ⁇ bridomas (Cote et al., Proc. Natl. Acad. Sci. USA 80:2026-2030 (1 983)), or b ⁇ transforming human B cells with EBV virus in vitro (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 ( 1 985)).
- Antibod ⁇ fragments that specificall ⁇ bind to CVSP1 4 pol ⁇ eptide or epitopes thereof can be generated b ⁇ techniques known in the art.
- such fragments include but are not limited to: the F(ab')2 fragment, which can be produced b ⁇ pepsin digestion of the antibod ⁇ molecule; the Fab' fragments that can be generated b ⁇ reducing the disulfide bridges of the F(ab')2 fragment, the Fab fragments that can be generated b ⁇ treating the antibod ⁇ molecular with papain and a reducing agent, and Fv fragments.
- screening for the desired antibod ⁇ can be accomplished b ⁇ techniques known in the art, e.g. , ELISA (enz ⁇ me-linked immunosorbent assa ⁇ ).
- ELISA Enz ⁇ me-linked immunosorbent assa ⁇
- the foregoing antibodies can be used in methods known in the art relating to the localization and/or quantitation of CVSP1 pol ⁇ peptide proteins, e.g. , for imaging these proteins, measuring levels thereof in appropriate ph ⁇ siological samples, in, for example, diagnostic methods.
- anti-CVSP1 4 pol ⁇ peptide antibodies, or fragments thereof, containing the binding domain are used as therapeutic agents.
- peptides include peptides, pol ⁇ peptides and peptide mimetics, including c ⁇ clic peptides.
- Peptide mimetics are molecules or compounds that mimic the necessar ⁇ molecular conformation of a ligand or pol ⁇ peptide for specific binding to a target molecule such as a CVSP1 4 pol ⁇ peptide.
- the peptides, peptides, pol ⁇ peptides and peptide mimetics or peptide mimetics bind to the protease domain of the CVSP14 pol ⁇ peptide.
- Such peptides and peptide mimetics include those of antibodies that specificall ⁇ bind to a CVSP14 pol ⁇ peptide and, t ⁇ picall ⁇ , bind to the protease domain of a CVSP1 4 pol ⁇ peptide.
- the peptides, pol ⁇ peptides and peptide mimetics and peptide mimetics identified b ⁇ methods provided herein can be agonists or antagonists of CVSP14 pol ⁇ peptides.
- Such peptides and peptide mimetics are useful for diagnosing, treating, preventing, and screening for a disease or disorder associated with CVSP1 4 pol ⁇ peptide activit ⁇ in a mammal.
- the peptides and peptide mimetics are useful for identif ⁇ ing, isolating, and purif ⁇ ing molecules or compounds that modulate the activit ⁇ of a CVSP1 4 pol ⁇ peptide, or specificall ⁇ bind to a CVSP1 pol ⁇ peptide, generall ⁇ the protease domain of a CVSP1 4 pol ⁇ peptide.
- Low molecular weight peptides and peptide mimetics can have strong binding properties to a target molecule, e.g.
- a CVSP14 pol ⁇ peptide or the protease domain of a CVSP1 4 pol ⁇ peptide a CVSP14 pol ⁇ peptide or the protease domain of a CVSP1 4 pol ⁇ peptide.
- Peptides, pol ⁇ peptides and peptide mimetics that bind to CVSP1 4 pol ⁇ peptides as described herein can be administered to mammals, including humans, to modulate CVSP1 4 pol ⁇ peptide activit ⁇ .
- methods for therapeutic treatment and prevention of neoplastic diseases comprise administering a peptide, pol ⁇ peptides or peptide mimetic compound in an amount sufficient to modulate such activit ⁇ are provided.
- methods for treating a subject having such a disease or disorder in which a peptide, pol ⁇ peptides or peptide mimetic compound is administered to the subject in a therapeuticall ⁇ effective dose or amount are provided.
- compositions containing the peptides, pol ⁇ peptides or peptide mimetics can be administered for proph ⁇ lactic and/or therapeutic treatments.
- compositions can be administered to a patient alread ⁇ suffering from a disease, as described above, in an amount sufficient to cure or at least partially arrest the symptoms of the disease and its complications. Amounts effective for this use will depend on the severit ⁇ of the disease and the weight and general state of the patient and can be empiricall ⁇ determined.
- compositions containing the peptides, pol ⁇ peptides and peptide mimetics are administered to a patient susceptible to or otherwise at risk of a particular disease. Such an amount is defined to be a "proph ⁇ lacticall ⁇ effective dose" .
- the peptides, pol ⁇ peptides and peptide mimetics that bind to a CVSP1 4 pol ⁇ peptide can be used to prepare pharmaceutical compositions containing, as an active ingredient, at least one of the peptides or peptide mimetics in association with a pharmaceutical carrier or diluent.
- the compounds can be administered, for example, b ⁇ oral, pulmonar ⁇ , parental (intramuscular, intraperitoneal, intravenous (IV) or subcutaneous injection), inhalation (via a fine powder formulation), transdermal, nasal, vaginal, rectal, or sublingual routes of administration and can be formulated in dosage forms appropriate for each route of administration (see, e.g. , International PCT application Nos. WO 93/25221 and WO 94/1 7784; and European Patent Application 61 3,683).
- Peptides, pol ⁇ peptides and peptide mimetics that bind to CVSP1 4 pol ⁇ peptides are useful in vitro as unique tools for understanding the biological role of CVSP14 pol ⁇ peptides, including the evaluation of the man ⁇ factors thought to influence, and be influenced b ⁇ , the production of CVSP1 4 pol ⁇ peptide.
- Such peptides, pol ⁇ peptides and peptide mimetics are also useful in the development of other compounds that bind to and modulate the activit ⁇ of a CVSP1 4 pol ⁇ peptide, because such compounds provide important information on the relationship between structure and activit ⁇ that should facilitate such development.
- the peptides, pol ⁇ peptides and peptide mimetics are also useful as competitive binders in assa ⁇ s to screen for new CVSP1 4 pol ⁇ peptides or CVSP14 pol ⁇ peptide agonists.
- the compounds can be used without modification or can be modified in a variet ⁇ of wa ⁇ s; for example, b ⁇ labeling, such as covalentl ⁇ or non-covalentl ⁇ joining a moiet ⁇ which directl ⁇ or indirectl ⁇ provides a detectable signal.
- the materials thereto can be labeled either directl ⁇ or indirectl ⁇ . Possibilities for .
- direct labeling include label groups such as: radiolabels such as 125 l enz ⁇ mes (U.S. Pat. No. 3,645,090) such as peroxidase and alkaline phosphatase, and fluorescent labels (U.S. Pat. No. 3,940,475) capable of monitoring the change in fluorescence intensit ⁇ , wavelength shift, or fluorescence polarization.
- Possibilities for indirect labeling include biotin ⁇ lation of one constituent followed b ⁇ binding to avidin coupled to one of the above label groups.
- the compounds can also include spacers or linkers in cases where the compounds are to be attached to a solid support.
- the peptides, pol ⁇ peptides and peptide mimetics can be used as reagents for detecting CVSP1 4 pol ⁇ peptides in living cells, fixed cells, in biological fluids, in tissue homogenates and in purified, natural biological materials. For example, b ⁇ labelling such peptides, pol ⁇ peptides and peptide mimetics, cells having CVSP14 pol ⁇ peptides can be identified.
- the peptides, pol ⁇ peptides and peptide mimetics can be used in in situ staining, FACS (fluorescence-activated cell sorting), Western blotting, ELISA and other anal ⁇ tical protocols.
- the peptides, pol ⁇ peptides and peptide mimetics can be used in purification of CVSP1 4 pol ⁇ peptide pol ⁇ peptides or in purif ⁇ ing cells expressing the CVSP1 4 pol ⁇ peptide pol ⁇ peptides, e.g. , a pol ⁇ peptide encoding the protease domain of a CVSP14 pol ⁇ peptide.
- the peptides, pol ⁇ peptides and peptide mimetics can also be used as commercial reagents for various medical research and diagnostic uses.
- the activit ⁇ of the peptides and peptide mimetics can be evaluated either in vitro or in vivo in one of the numerous models described in McDonald ( 1 992) Am. J. of Pediatric Hematology /Oncology, 74:8-21 .
- Peptide, polypeptides and peptide mimetic therapy Peptide analogs are commonly used in the pharmaceutical industry as * non-peptide drugs with properties analogous to those of the template peptide. These t ⁇ pes of non-peptide compounds are termed "peptide mimetics” or “peptidomimetics” (Luthman et al. , A Textbook of Drug Design and Development, 14:386-406, 2nd Ed., Harwood Academic Publishers ( 1 996); Joachim Grante (1 994) Angew. Chem. Int. Ed. Engl., 33: 1 699-1 720; Fauchere ( 1 986) J. Adv.
- Peptide mimetics that are structurall ⁇ similar to therapeuticall ⁇ useful peptides can be used to produce an equivalent or enhanced therapeutic or proph ⁇ lactic effect. Preparation of peptidomimetics and structures thereof are known to those of skill in this art. S ⁇ stematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same t ⁇ pe (e.g. , D-l ⁇ sine in place of L-l ⁇ sine) can be used to generate more stable peptides.
- constrained peptides containing a consensus sequence or a substantiall ⁇ identical consensus sequence variation can be generated b ⁇ methods known in the art (Rizo et al. ( 1 992) An. Rev. Biochem., 67 :387, incorporated herein b ⁇ reference); for example, b ⁇ adding internal c ⁇ steine residues capable of forming intramolecular disulfide bridges which c ⁇ clize the peptide.
- the peptides and peptide mimetics can be labeled with a detectable label and, accordingl ⁇ , the peptides and peptide mimetics without such a label can serve as intermediates in the preparation of labeled peptides and peptide mimetics.
- Detectable labels can be molecules or compounds, which when covalentl ⁇ attached to the peptides and peptide mimetics, permit detection of the peptide and peptide mimetics in vivo, for example, in a patient to whom the peptide or peptide mimetic has been administered, or in vitro, e.g. , in a sample or cells.
- Suitable detectable labels are well known in the art and include, b ⁇ wa ⁇ of example, radioisotopes, fluorescent labels (e.g. , fluorescein), and the like.
- the particular detectable label emplo ⁇ ed is not critical and is selected to be detectable at non-toxic levels. Selection of the such labels is well within the skill of the art.
- Covalent attachment of a detectable label to the peptide or peptide mimetic is accomplished b ⁇ conventional methods well known in the art. For example, when the 125 l radioisotope is emplo ⁇ ed as the detectable label, covalent attachment of 125 l to the peptide or the peptide mimetic can be achieved b ⁇ incorporating the amino acid t ⁇ rosine into the peptide or peptide mimetic and then iodinating the peptide (see, e.g. , Weaner et al. ( 1 994) Synthesis and Applications of Isotopically Labelled Compounds, pp. 1 37-140) .
- incorporation of t ⁇ rosine to the N or C terminus of the peptide or peptide mimetic can be achieved b ⁇ well known chemistr ⁇ .
- 32 P can be incorporated onto the peptide or peptide mimetic as a phosphate moiet ⁇ through, for example, a h ⁇ drox ⁇ l group on the peptide or peptide mimetic using conventional chemistr ⁇ .
- Labeling of peptidomimetics usuall ⁇ involves covalent attachment of one or more labels, directl ⁇ or through a spacer (e.g. , an amide group), to non-interfering position(s) on the peptidomimetic that are predicted b ⁇ quantitative structure-activit ⁇ data and/or molecular modeling.
- Such non-interfering positions generall ⁇ are positions that. do not form direct contacts with the macromolecules(s) to which the peptidomimetic binds to produce the therapeutic effect.
- Derivatization (e.g. , labeling) of peptidomimetics should not substantiall ⁇ interfere with the desired biological or pharmacological activit ⁇ of the peptidomimetic.
- Peptides, pol ⁇ peptides and peptide mimetics that can bind to a CVSP1 4 pol ⁇ peptide or the protease domain of CVSP1 4 pol ⁇ peptides and/or modulate the activit ⁇ thereof, or exhibit CVSP1 4 pol ⁇ peptide activit ⁇ , can be used for treatment of neoplastic disease.
- the peptides, pol ⁇ peptides and peptide mimetics can be delivered, in vivo or ex vivo, to the cells of a subject in need of treatment.
- peptides which have CVSP14 pol ⁇ peptide activit ⁇ can be delivered, in vivo or ex vivo, to cells which carr ⁇ mutant or missing alleles encoding the CVSP14 pol ⁇ peptide gene.
- An ⁇ of the techniques described herein or known to the skilled artisan can be used for preparation and in vivo or ex vivo deliver ⁇ of such peptides, pol ⁇ peptides and peptide mimetics that are substantiall ⁇ free of other human proteins.
- the peptides, pol ⁇ peptides and peptide mimetics can be readil ⁇ prepared b ⁇ expression in a microorganism or s ⁇ nthesis in vitro.
- the peptides or peptide mimetics can be introduced into cells, in vivo or ex vivo, b ⁇ microinjection or b ⁇ use of liposomes, for example.
- the peptides, pol ⁇ peptides or peptide mimetics can be taken up b ⁇ cells, in vivo or ex vivo, activel ⁇ or b ⁇ diffusion.
- extracellular application of the peptide, pol ⁇ peptides or peptide mimetic can be sufficient to effect treatment of a neoplastic disease.
- the goal of rational drug design is to produce structural analogs of biologically active polypeptides or peptides of interest or of small molecules or peptide mimetics with which the ⁇ interact (e.g. , agonists and antagonists) in order to fashion drugs which are, e.g., more active or stable forms thereof; or which, for example, enhance or interfere with the function of a pol ⁇ peptide in vivo (e.g., a CVSP14 pol ⁇ peptide) .
- an amino acid residue is replaced b ⁇ Ala, and its effect on the peptide's activit ⁇ is determined.
- Each of the amino acid residues of the peptide is anal ⁇ zed in this manner to determine the important regions of the peptide.
- a pol ⁇ peptide or peptide that binds to a CVSP1 4 pol ⁇ peptide or, generall ⁇ , the protease domain of a CVSP1 4 pol ⁇ peptide can be selected b ⁇ a functional assa ⁇ , and then the cr ⁇ stal structure of this pol ⁇ peptide or peptide can be determined.
- the pol ⁇ peptide can be, for example, an antibod ⁇ specific for a CVSP14 pol ⁇ peptide or the protein domain of a CVSP14 pol ⁇ peptide. This approach can ⁇ ield a pharmacophore upon which subsequent drug design can be based.
- anti-idiot ⁇ pic pol ⁇ peptides or peptides (anti-ids) to a functional, pharmacologicall ⁇ active pol ⁇ peptide or peptide that binds to a CVSP1 4 pol ⁇ peptide or protease domain of a CVSP14 pol ⁇ peptide.
- the binding site of the anti-ids is expected to be an analog of the original target molecule, e.g., a CVSP1 4 pol ⁇ peptide or pol ⁇ peptide having a CVSP1 4 pol ⁇ peptide.
- the anti-id could then be used to identif ⁇ and isolate peptides from banks of chemicall ⁇ or biologically produced banks of peptides. Selected peptides would then act as the pharmacophore.
- modulators e.g., inhibitors, agonists, antagonists
- the knowledge of the amino acid sequence of a CVSP1 4 pol ⁇ peptide or the protease domain thereof, e.g., the protease domain encoded b ⁇ the amino acid sequence of SEQ ID Nos. 5 and 6, can provide guidance on computer modeling techniques in place of, or in addition to, X-ra ⁇ cr ⁇ stallograph ⁇ .
- Methods of identifying peptides and peptide mimetics that bind to CVSP14 polypeptides Peptides having a binding affinit ⁇ to the CVSP14 pol ⁇ peptide pol ⁇ peptides provided herein (e.g. , a CVSP14 pol ⁇ peptide or a pol ⁇ peptide having a protease domain of a CVSP1 4 pol ⁇ peptide) can be readil ⁇ identified, for example, b ⁇ random peptide diversit ⁇ generating s ⁇ stems coupled with an affinit ⁇ enrichment process. Specificall ⁇ , random peptide diversit ⁇ generating s ⁇ stems include the "peptides on plasmids" s ⁇ stem (see, e.g.
- random peptides can generall ⁇ be designed to have a defined number of amino acid residues in length (e.g. , 1 2) .
- NNK codon motif
- NNK motif encodes all of the amino acids, encodes onl ⁇ one stop codon, and reduces codon bias.
- the random peptides can be presented, for example, either on the surface of a phage particle, as part of a fusion protein containing either the pill or the pVIII coat protein of a phage fd derivative (peptides on phage) or as a fusion protein with the Lacl peptide fusion protein bound to a plasmid (peptides on plasmids).
- the phage or plasmids, including the DNA encoding the peptides can be identified and isolated b ⁇ an affinit ⁇ enrichment process using immobilized CVSP14 pol ⁇ peptide pol ⁇ peptide having a protease domain.
- t ⁇ picall ⁇ involves multiple rounds of incubating the phage, plasmids, or pol ⁇ somes with the immobilized CVSP1 4 pol ⁇ peptide pol ⁇ peptide, collecting the phage, plasmids, or pol ⁇ somes that bind to the CVSP1 4 pol ⁇ peptide pol ⁇ peptide (along with the accompan ⁇ ing DNA or mRNA), and producing more of the phage or plasmids (along with the accompan ⁇ ing Lacl-peptide fusion protein) collected.
- Characteristics of peptides and peptide mimetics Among the peptides, pol ⁇ peptides and peptide mimetics for therapeutic application are those of having molecular weights from about 250 to about 8,000 daltons. If such peptides are oligomerized, dimerized and/or derivatized with a h ⁇ drophilic pol ⁇ mer (e.g. , to increase the affinit ⁇ and/or activit ⁇ of the compounds), the molecular weights of such peptides can be substantiall ⁇ greater and can range an ⁇ where from about 500 to about 1 20,000 daltons, generall ⁇ from about 8,000 to about 80,000 daltons.
- Such peptides can contain 9 or more amino acids that are naturall ⁇ occurring or s ⁇ nthetic (non-naturall ⁇ occurring) amino acids.
- One skilled in the art can determine the affinit ⁇ and molecular weight of the peptides and peptide mimetics suitable for therapeutic and/or diagnostic purposes (e.g. , see Dower et al. , U.S. Patent No. 6, 1 21 ,238).
- the peptides can be covalentl ⁇ attached to one or more of a variet ⁇ of h ⁇ drophilic pol ⁇ mers.
- Suitable h ⁇ drophilic pol ⁇ mers include, but are not limited to, pol ⁇ alk ⁇ lethers as exemplified b ⁇ pol ⁇ eth ⁇ lene gl ⁇ col and pol ⁇ prop ⁇ lene gl ⁇ col, pol ⁇ lactic acid, pol ⁇ gl ⁇ colic acid, pol ⁇ ox ⁇ alkenes, pol ⁇ vin ⁇ lalcohol, pol ⁇ vin ⁇ lp ⁇ rrolidone, cellulose and cellulose derivatives, dextran and dextran derivatives.
- pol ⁇ alk ⁇ lethers as exemplified b ⁇ pol ⁇ eth ⁇ lene gl ⁇ col and pol ⁇ prop ⁇ lene gl ⁇ col
- pol ⁇ lactic acid pol ⁇ gl ⁇ colic acid
- pol ⁇ ox ⁇ alkenes pol ⁇ vin ⁇ lalcohol
- pol ⁇ vin ⁇ lp ⁇ rrolidone cellulose and cellulose derivatives
- dextran and dextran derivatives dextran and dextran
- the peptide compounds can be dimerized and each of the dimeric subunits can be covalentl ⁇ attached to a h ⁇ drophilic pol ⁇ mer.
- the peptide compounds can be PEG ⁇ lated, i.e., covalentl ⁇ attached to pol ⁇ eth ⁇ lene gl ⁇ col (PEG). 5. Methods of preparing peptides and peptide mimetics
- Peptides that bind to CVSP1 4 pol ⁇ peptides can be prepared b ⁇ classical methods known in the art, for example, b ⁇ using standard solid phase techniques.
- the standard methods include exclusive solid phase s ⁇ nthesis, partial solid phase s ⁇ nthesis methods, fragment condensation, classical solution s ⁇ nthesis, and even b ⁇ recombinant DNA technolog ⁇ (see, e.g. , Merrifield ( 1 963) J. Am. Chem. Soc, 55:21 49, incorporated herein b ⁇ reference.)
- CVSP14 pol ⁇ peptide or, generall ⁇ , the protease domain of a CVSP1 4 pol ⁇ peptide.
- This immobilized pol ⁇ mer s ⁇ nthesis s ⁇ stem or other peptide s ⁇ nthesis methods can also be used to s ⁇ nthesize truncation analogs and deletion analogs and combinations of truncation and deletion analogs of the peptide compounds.
- s ⁇ nthetic amino acids that can be substituted into the peptides include L-h ⁇ drox ⁇ prop ⁇ l, L-3, 4-dih ⁇ drox ⁇ -phen ⁇ lalan ⁇ l, d amino acids such as L-d-h ⁇ drox ⁇ l ⁇ s ⁇ l and D-d-meth ⁇ lalan ⁇ l, L- ⁇ -meth ⁇ lalan ⁇ l, ⁇ amino acids, and isoquinol ⁇ l.
- D amino acids and non-naturall ⁇ occurring s ⁇ nthetic amino acids can also be incorporated into the peptides (see, e.g. , Roberts et al. ( 1 983) Unusual Amino/Acids in Peptide Synthesis, 5(6):341 -449).
- the peptides can also be modified b ⁇ phosphor ⁇ lation (see, e.g. , W. Bannwarth et al. ( 1 996) Biorganic and Medicinal Chemistry Letters,
- peptide compounds also serve as a basis to prepare peptide mimetics with similar biological activit ⁇ .
- Amino terminus modifications include, but are not limited to, alk ⁇ lating, acet ⁇ lating and adding a carbobenzo ⁇ l group, forming a succinimide group (see, e.g. , Murra ⁇ et al. (1 995) Burger's Medicinal Chemistry and Drug Discovery, Sth ed., Vol. 1, Manfred E. Wolf, ed., John Wile ⁇ and Sons, Inc.).
- C-terminal modifications include mimetics wherein the C-terminal carbox ⁇ l group is replaced b ⁇ an ester, an amide or modifications to form a c ⁇ clic peptide.
- the peptide compounds can advantageousl ⁇ be modified with or covalentl ⁇ coupled to one or more of a variet ⁇ of h ⁇ drophilic pol ⁇ mers. It has been found that when peptide compounds are derivatized with a h ⁇ drophilic pol ⁇ mer, their solubility and circulation half-lives can be increased and their immunogenicity is masked, with little, if an ⁇ , diminishment in their binding activit ⁇ .
- Suitable nonproteinaceous pol ⁇ mers include, but are not limited to, pol ⁇ alk ⁇ lethers as exemplified b ⁇ pol ⁇ eth ⁇ lene gl ⁇ col and pol ⁇ prop ⁇ lene gl ⁇ col, pol ⁇ lactic acid, pol ⁇ gl ⁇ colic acid, pol ⁇ ox ⁇ alkenes, pol ⁇ vin ⁇ lalcohol, pol ⁇ vin ⁇ lp ⁇ rrolidone, cellulose and cellulose derivatives, dextran and dextran derivatives.
- such h ⁇ drophilic pol ⁇ mers have an average molecular weight ranging from about 500 to about 1 00,000 daltons, including from about 2,000 to about 40,000 daltons and, from about 5,000 to about 20,000 daltons.
- the h ⁇ drophilic pol ⁇ mers also can have an average molecular weights of about 5,000 daltons, 1 0,000 daltons and 20,000 daltons.
- peptide derivatives are described, for example, in Hrub ⁇ et al. ( 1 990), Biochem J., 26S(2):249-262, which is incorporated herein b ⁇ reference.
- the peptide compounds also serve as structural models for non-peptidic compounds with similar biological activit ⁇ .
- Those of skill in the art recognize that a variet ⁇ of techniques are available for constructing compounds with the same or similar desired biological activit ⁇ as a particular peptide compound but with more favorable activit ⁇ with respect to solubility, stability, and susceptibility to h ⁇ drol ⁇ sis and proteol ⁇ sis (see, e.g. , Morgan et al. ( 1 989) An. Rep. Med.
- Peptide compounds can exist in a c ⁇ clized form with an intramolecular disulfide bond between the thiol groups of the c ⁇ steines.
- an intermolecular disulfide bond between the thiol groups of the c ⁇ steines can be produced to ⁇ ield a dimeric (or higher oligomeric) compound.
- One or more of the c ⁇ steine residues can also be substituted with a homoc ⁇ steine.
- a conjugate containing: a) a single chain protease domain (or proteol ⁇ ticall ⁇ active portion thereof) of a CVSP14 pol ⁇ peptide or a full length z ⁇ mogen, activated form thereof, or two or single chain protease domain thereof; and b) a targeting agent linked to the CVSP14 pol ⁇ peptide directl ⁇ or via a linker, wherein the agent facilitates: i) affinit ⁇ isolation or purification of the conjugate; ii) attachment of the conjugate to a surface; iii) detection of the conjugate; or iv) targeted deliver ⁇ to a selected tissue or cell, is provided herein.
- the conjugate can be a chemical conjugate or a fusion protein mixture thereof .
- the targeting agent can be a protein or peptide fragment, such as a tissue specific or tumor specific monoclonal antibod ⁇ or growth factor or fragment thereof linked either directl ⁇ or via a linker to a CVSP14 pol ⁇ peptide or a protease domain thereof.
- the targeting agent can also be a protein or peptide fragment that contains a protein binding sequence, a nucleic acid binding sequence, a lipid binding sequence, a pol ⁇ saccharide binding sequence, or a metal binding sequence, or a linker for attachment to a solid support.
- the conjugate contains a) the CVSP14 or portion thereof, as described herein; and b) a targeting agent linked to the CVSP14 pol ⁇ peptide directl ⁇ or via a linker.
- Conjugates such as fusion proteins and chemical conjugates, of the CVSP1 4 pol ⁇ peptide with a protein or peptide fragment (or plurality thereof) that functions, for example, to facilitate affinity isolation or purification of the CVSP1 4 pol ⁇ peptide domain, attachment of the CVSP1 4 pol ⁇ peptide domain to a surface, or detection of the CVSP1 4 pol ⁇ peptide domain are provided.
- the conjugates can be produced b ⁇ chemical conjugation, such as via thiol linkages, and can be produced b ⁇ recombinant means as fusion proteins.
- the peptide or fragment thereof is linked to either the N-terminus or C- terminus of the CVSP1 4 pol ⁇ peptide domain.
- the peptide or fragment thereof can be linked an ⁇ where that conjugation can be effected, and there can be a plurality of such peptides or fragments linked to a single CVSP1 4 polypeptide domain or to a plurality thereof.
- the targeting agent is for in vitro or in vivo delivery to a cell or tissue, and includes agents such as cell or tissue-specific antibodies, growth factors and other factors that bind to moieties expressed on specific cells; and other cell or tissue specific agents that promote directed deliver ⁇ of a linked protein.
- the targeting agent can be one that specificall ⁇ delivers the CVSP1 4 pol ⁇ peptide to selected cells b ⁇ interaction with a cell surface protein and internalization of conjugate or CVSP14 pol ⁇ peptide portion thereof.
- conjugates are used in a variet ⁇ of methods and are particularl ⁇ suited for use in methods of activation of prodrugs, such as prodrugs that upon cleavage b ⁇ the particular CVSP1 4, which is localized at or near the targeted cell or tissue, protein are c ⁇ totoxic.
- the prodrugs are administered prior to, or simultaneousl ⁇ with, or subsequentl ⁇ to the conjugate.
- the protease activates the prodrug, which then exhibits a therapeutic effect, such as a c ⁇ totoxic effect. 1 .
- Conjugates with linked CVSP14 pol ⁇ peptide domains can be prepared either b ⁇ chemical conjugation, recombinant DNA technolog ⁇ , or combinations of recombinant expression and chemical conjugation.
- the CVSP1 4 pol ⁇ peptide domains and the targeting agent can be linked in an ⁇ orientation and more than one targeting agents and/or CVSP14 pol ⁇ peptide domains can be present in a conjugate. a. Fusion proteins
- a fusion protein contains: a) one or a plurality of domains of a CVSP14 polypeptides and b) a targeting agent.
- the fusion proteins are generall ⁇ produced b ⁇ recombinant expression of nucleic acids that encode the fusion protein. b. Chemical conjugation
- the CVSP14 pol ⁇ peptide domain is linked via one or more selected linkers or directl ⁇ to the targeting agent.
- Chemical conjugation must be used if the targeted agent is other than a peptide or protein, such a nucleic acid or a non-peptide drug.
- An ⁇ means known to those of skill in the art for chemicall ⁇ conjugating selected moieties can be used.
- the conjugates can include one or more linkers between the CVSP1 4 pol ⁇ peptide portion and the targeting agent. Additionall ⁇ , linkers are used for facilitating or enhancing immobilization of a CVSP14 pol ⁇ peptide or portion thereof on a solid support, such as a microtiter plate, silicon or silicon-coated chip, glass or plastic support, such as for high throughput solid phase screening protocols.
- An ⁇ linker known to those of skill in the art for preparation of conjugates can be used herein. These linkers are t ⁇ picall ⁇ used in the preparation of chemical conjugates; peptide linkers can be incorporated into fusion proteins.
- Linkers can be an ⁇ moiet ⁇ suitable to associate a domain of CVSP1 4 pol ⁇ peptide and a targeting agent.
- Such linkers and linkages include, but are not limited to, peptidic linkages, amino acid and peptide linkages, t ⁇ picall ⁇ containing between one and about 60 amino acids, more generall ⁇ between about 10 and 30 amino acids, chemical linkers, such as heterobifunctional cleavable cross- linkers, including but are not limited to, N-succinimid ⁇ l (4-iodoacet ⁇ l)- aminobenzoate, sulfosuccinim ⁇ dil (4-iodoacet ⁇ l)-aminobenzoate, 4-succinimid ⁇ l- ox ⁇ carbon ⁇ l-a- (2-p ⁇ rid ⁇ ldithio)toluene, sulfosuccinimid ⁇ l-6- [a-meth ⁇ l-a- (p ⁇ rid ⁇ ldithiol)-toluamid
- linkers include, but are not limited to peptides and other moieties that reduce stearic hindrance between the domain of CVSP14 pol ⁇ peptide and the targeting agent, intracellular enz ⁇ me substrates, linkers that increase the flexibility of the conjugate, linkers that increase the solubility of the conjugate, linkers that increase the serum stability of the conjugate, photocleavable linkers and acid cleavable linkers.
- linkers and linkages that are suitable for chemicall ⁇ linked conjugates include, but are not limited to, disulfide bonds, thioether bonds, hindered disulfide bonds, and covalent bonds between free reactive groups, such as amine and thiol groups. These bonds are produced using heterobifunctional reagents to produce reactive thiol groups on one or both of the pol ⁇ peptides and then reacting the thiol groups on one pol ⁇ peptide with reactive thiol groups or amine groups to which reactive maleimido groups or thiol groups can be attached on the other.
- linkers include, acid cleavable linkers, such as bismaleimideothox ⁇ propane, acid labile-transferrin conjugates and adipic acid diih ⁇ drazide, that would be cleaved in more acidic intracellular compartments; cross linkers that are cleaved upon exposure to UV or visible light and linkers, such as the various domains, such as C H 1 , C H 2, and C H 3, from the constant region of human IgG, (see, Batra et al. Molecular Immunol. , 30:379-386 (1 993)).
- linkers can be included in order to take advantage of desired properties of each linker.
- Chemical linkers and peptide linkers can be inserted b ⁇ covalentl ⁇ coupling the linker to the domain of CVSP14 pol ⁇ peptide and the targeting agent.
- the heterobifunctional agents described below, can be used to effect such covalent coupling.
- Peptide linkers can also be linked b ⁇ expressing DNA encoding the linker and therapeutic agent (TA), linker and targeted agent, or linker, targeted agent and therapeutic agent (TA) as a fusion protein.
- Flexible linkers and linkers that increase solubility of the conjugates are contemplated for use, either alone or with other linkers are also contemplated herein. a) Acid cleavable, photocleavable and heat sensitive linkers
- Acid cleavable linkers, photocleavable and heat sensitive linkers can also be used, particularly where it can be necessar ⁇ to cleave the domain of CVSP14 pol ⁇ peptide to permit it to be more readil ⁇ accessible to reaction.
- Acid cleavable linkers include, but are not limited to, bismaleimideothox ⁇ propane; and adipic acid dih ⁇ drazide linkers (see, e.g. , Fattom et al. (1 992) Infection & Immun. 60:584-589) and acid labile transferrin conjugates that contain a sufficient portion of transferrin to permit entr ⁇ into the intracellular transferrin c ⁇ cling pathwa ⁇ (see, e.g. , Welh ⁇ ner et al. ( 1 991 ) J. Biol. Chem. 266:4309-4314).
- Photocleavable linkers are linkers that are cleaved upon exposure to light (see, e.g. , Goldmacher et al. ( 1 992) Bioconj. Chem. 3: 1 04-107, which linkers are herein incorporated b ⁇ reference), thereb ⁇ releasing the targeted agent upon exposure to light.
- Photocleavable linkers that are cleaved upon exposure to light are known (see, e.g. , Hazum et al. ( 1 981 ) in Pept., Proc. Eur. Pept. Symp. , 1 6th, Brunfeldt, K (Ed), pp.
- linkers are useful in connection with diagnostic protocols in which it is desirable to remove the targeting agent to permit rapid clearance from the bod ⁇ of the animal.
- Other linkers for chemical conjugation Other linkers include trit ⁇ l linkers, particularl ⁇ , derivatized trit ⁇ l groups to generate a genus of conjugates that provide for release of therapeutic agents at various degrees of acidit ⁇ or alkalinity.
- the flexibility thus afforded b ⁇ the abilit ⁇ to preselect the pH range at which the therapeutic agent is released allows selection of a linker based on the known ph ⁇ siological differences between tissues in need of deliver ⁇ of a therapeutic agent (see, e.g. , U.S. Patent No. 5,61 2,474). For example, the acidit ⁇ of tumor tissues appears to be lower than that of normal tissues.
- Peptide linkers include trit ⁇ l linkers, particularl ⁇ , derivatized trit ⁇ l groups to generate a genus of conjugates that provide for release of therapeutic agents at various degrees of acidit ⁇ or alkal
- the linker moieties can be peptides.
- Peptide linkers can be emplo ⁇ ed in fusion proteins and also in chemicall ⁇ linked conjugates.
- the peptide t ⁇ picall ⁇ has from about 2 to about 60 amino acid residues, for example from about 5 to about 40, or from about 10 to about 30 amino acid residues. The length selected depends upon factors, such as the use for which the linker is included.
- linker moiet ⁇ can be a flexible spacer amino acid sequence, such as those known in single-chain antibod ⁇ research.
- linker moieties include, but are not limited to, peptides, such as (Gl ⁇ m Ser) n and (Ser m Gl ⁇ ) n , in which n is 1 to 6, including 1 to 4 and 2 to 4, and m is 1 to 6, including 1 to 4, and 2 to 4, enz ⁇ me cleavable linkers and others.
- linking moieties are described, for example, in Huston et al. , Proc. Natl. Acad. Sci. U. S.A. 35:5879-5883, 1 988; Whitlow, M., et al. , Protein Engineering 6:989-995, 1 993; Newton et al. , Biochemistry 35:545-553, 1 996; A. J. Cumber et al., Bioconj. Chem. 3:397-401 , 1 992; Ladumer et al., J. Mol. Biol. 273:330-337, 1 997; and U.S. Patent. No. 4,894,443.
- several linkers can be included in order to take advantage of desired properties of each linker. 3.
- an ⁇ agent that facilitates detection, immobilization, or purification of the conjugate is contemplated for use herein.
- the targeting agent is a protein, peptide or fragment thereof that is sufficient to effects the targeting activit ⁇ .
- Contemplated targeting agents include those that deliver the CVSP1 4 pol ⁇ peptide or portion thereof to selected cells and tissues. Such agents include tumor specific monoclonal antibodies and portions thereof, growth factors, such as FGF, EGF, PDGF, VEGF, c ⁇ tokines, including chemokines, and other such agents. 4. Nucleic acids, plasmids and cells
- the nucleic acid fragment that encodes the fusion protein includes: a) nucleic acid encoding a protease domain of a CVSP1 4 pol ⁇ peptide; and b) nucleic acid encoding a protein, peptide or effective fragment thereof that facilitates: i) affinit ⁇ isolation or purification of the fusion protein; ii) attachment of the fusion protein to a surface; or iii) detection of the fusion protein.
- the nucleic acid is DNA.
- Plasmids for replication and vectors for expression that contain the above nucleic acid fragments are also provided.
- Cells containing the plasmids and vectors are also provided.
- the cells can be an ⁇ suitable host including, but are not limited to, bacterial cells, ⁇ east cells, fungal cells, plant cells, insect cell and animal cells.
- the nucleic acids, plasmids, and cells containing the plasmids can be prepared according to methods known in the art including an ⁇ described herein.
- An exemplar ⁇ method includes the steps of growing, i.e. culturing the cells so that the proliferate, cells containing a plasmid encoding the fusion protein under conditions whereb ⁇ the fusion protein is expressed b ⁇ the cell, and recovering the expressed fusion protein.
- Methods for expressing and recovering recombinant proteins are well known in the art (See generally. Current Protocols in Molecular Biology (1 998) ⁇ 1 6, John Wile ⁇ & Sons, Inc.) and such methods can be used for expressing and recovering the expressed fusion proteins.
- the recovered fusion proteins can be isolated or purified b ⁇ methods known in the art such as centrifugation, filtration, chromatograph, electrophoresis, immunoprecipitation, etc., or b ⁇ a combination thereof (See generally. Current Protocols in Molecular Biology (1 998) ⁇ 10, John Wile ⁇ & Sons, Inc.). Generall ⁇ the recovered fusion protein is isolated or purified through affinit ⁇ binding between the protein or peptide fragment of the fusion protein and an affinit ⁇ binding moiet ⁇ . As discussed in the above sections regarding the construction of the fusion proteins, an ⁇ affinit ⁇ binding pairs can be constructed and used in the isolation or purification of the fusion proteins.
- the affinit ⁇ binding pairs can be protein binding sequences/protein, DNA binding sequences/DNA sequences, RNA binding sequences/RNA sequences, lipid binding sequences/lipid, pol ⁇ saccharide binding sequences/pol ⁇ saccharide, or metal binding sequences/metal.
- the CVSP1 4 pol ⁇ peptide can be attached b ⁇ linkage such as ionic or covalent, non-covalent or other chemical interaction, to a surface of a support or matrix material. Immobilization can be effected directl ⁇ or via a linker.
- the CVSP14 pol ⁇ peptide can be immobilized on an ⁇ suitable support, including, but are not limited to, silicon chips, and other supports described herein and known to those of skill in the art.
- a plurality of CVSP14 polypeptide or protease domains thereof can be attached to a support, such as an arra ⁇ (i.e. , a pattern of two or more) of conjugates on the surface of a silicon chip or other chip for use in high throughput protocols and formats.
- the domains of the CVSP1 4 pol ⁇ peptide can be linked directl ⁇ to the surface or via a linker without a targeting agent linked thereto.
- chips containing arra ⁇ s of the domains of the CVSP14 pol ⁇ peptide can be linked directl ⁇ to the surface or via a linker without a targeting agent linked thereto.
- the matrix material or solid supports contemplated herein are generall ⁇ an ⁇ of the insoluble materials known to those of skill in the art to immobilize ligands and other molecules, and are those that used in man ⁇ chemical s ⁇ ntheses and separations. Such supports are used, for example, in affinit ⁇ chromatograph ⁇ , in the immobilization of biologicall ⁇ active materials, and during chemical s ⁇ ntheses of biomolecules, including proteins, amino acids and other organic molecules and pol ⁇ mers.
- the preparation of and use of supports is well known to those of skill in this art; there are man ⁇ such materials and preparations thereof known.
- naturall ⁇ -occurring support materials such as agarose and cellulose, can be isolated from their respective sources, and processed according to known protocols, and s ⁇ nthetic materials can be prepared in accord with known protocols.
- the supports are t ⁇ picall ⁇ insoluble materials that are solid, porous, deformable, or hard, and have an ⁇ required structure and geometr ⁇ , including, but not limited to: beads, pellets, disks, capillaries, hollow fibers, needles, solid fibers, random shapes, thin films and membranes.
- the item can be fabricated from the matrix material or combined with it, such as b ⁇ coating all or part of the surface or impregnating particles.
- T ⁇ picall ⁇ when the matrix is particulate, the particles are at least about 10-2000 ⁇ m, but can be smaller or larger, depending upon the selected application. Selection of the matrices is governed, at least in part, b ⁇ their ph ⁇ sical and chemical properties, such as solubility, functional groups, mechanical stability, surface area swelling propensity, hydrophobic or h ⁇ drophilic properties and intended use. If necessar ⁇ , the support matrix material can be treated to contain an appropriate reactive moiet ⁇ . In some cases, the support matrix material alread ⁇ containing the reactive moiet ⁇ can be obtained commerciall ⁇ . The support matrix material containing the reactive moiet ⁇ can thereb ⁇ serve as the matrix support upon which molecules are linked.
- Materials containing reactive surface moieties such as amino silane linkages, h ⁇ drox ⁇ l linkages or carbox ⁇ silane linkages can be produced b ⁇ well established surface chemistr ⁇ techniques involving silanization reactions, or the like.
- these materials are those having surface silicon oxide moieties, covalentl ⁇ linked to gamma-amino- prop ⁇ lsilane, and other organic moieties; N-[3-(trieth ⁇ ox ⁇ sil ⁇ !prop ⁇ l]phthelamic acid; and bis-(2-h ⁇ drox ⁇ eth ⁇ l)aminoprop ⁇ ltriethox ⁇ silane.
- Exemplar ⁇ of readil ⁇ available materials containing amino group reactive functionalities include, but are not limited to, para-aminophen ⁇ ltrieth ⁇ ox ⁇ silane. Also derivatized pol ⁇ st ⁇ renes and other such pol ⁇ mers are well known and readil ⁇ available to those of skill in this art (e.g. , the Tentagel ® Resins are available with a multitude of functional groups, and are sold b ⁇ Rapp Pol ⁇ mere, Tubingen, German ⁇ ; see, U.S. Patent No. 4,908,405 and U.S. Patent No. 5,292,81 4; see, also Butz et al., Peptide Res.
- matrix materials include an ⁇ material that can act as a support matrix for attachment of the molecules of interest. Such materials are known to those of skill in this art, and include those that are used as a support matrix.
- These materials include, but are not limited to, inorganics, natural pol ⁇ mers, and s ⁇ nthetic pol ⁇ mers, including, but are not limited to: cellulose, cellulose derivatives, acr ⁇ lic resins, glass, silica gels, pol ⁇ st ⁇ rene, gelatin, pol ⁇ vin ⁇ l p ⁇ rrolidone, co-pol ⁇ mers of vin ⁇ l and acr ⁇ lamide, pol ⁇ st ⁇ rene cross-linked with divin ⁇ lbenzene and others (see, Merrifield, Biochemistry, 3: 1 385-1 390 (1 964)), pol ⁇ acr ⁇ lamides, latex gels, pol ⁇ st ⁇ rene, dextran, pol ⁇ acr ⁇ lamides, rubber, silicon, plastics, nitrocellulose, celluloses, natural sponges.
- inorganics including, but are not limited to: cellulose, cellulose derivatives, acr ⁇ lic resins, glass, silica gels, pol ⁇ s
- S ⁇ nthetic supports include, but are not limited to: acr ⁇ lamides, dextran- derivatives and dextran co-pol ⁇ mers, agarose-pol ⁇ acr ⁇ lamide blends, other pol ⁇ mers and co-pol ⁇ mers with various functional groups, methacr ⁇ late derivatives and co-pol ⁇ mers, pol ⁇ st ⁇ rene and pol ⁇ st ⁇ rene copol ⁇ mers (see, e.g. , Merrifield, Biochemistry, 3: 1 385-1 390 ( 1 964); Berg et al., in Innovation
- Such materials include those made from pol ⁇ mers and co-pol ⁇ mers such as pol ⁇ vin ⁇ lalcohols, acr ⁇ lates and acr ⁇ lic acids such as pol ⁇ eth ⁇ lene-co-acr ⁇ lic acid, pol ⁇ eth ⁇ lene-co-methacr ⁇ lic acid, pol ⁇ eth ⁇ - lene-co-eth ⁇ iacr ⁇ late, pol ⁇ eth ⁇ lene-co-meth ⁇ l acr ⁇ late, pol ⁇ prop ⁇ lene-co-acr ⁇ lic acid, pol ⁇ prop ⁇ lene-co-meth ⁇ l-acr ⁇ lic acid, pol ⁇ prop ⁇ lene-co-eth ⁇ lacr ⁇ late, pol ⁇ prop ⁇ lene-co-meth ⁇ l acr ⁇ late, pol ⁇ prop ⁇ lene-co-meth ⁇ l acr ⁇ late, pol ⁇ prop ⁇ lene-co-meth ⁇ l acr ⁇ late, pol ⁇ prop ⁇ lene-co-eth ⁇ lacr ⁇ late
- a composition containing the protein or other biomolecule is contacted with a support material such as alumina, carbon, an ion-exchange resin, cellulose, glass or a ceramic.
- a support material such as alumina, carbon, an ion-exchange resin, cellulose, glass or a ceramic.
- Fluorocarbon pol ⁇ mers have been used as supports to which biomolecules have been attached b ⁇ adsorption (see, U.S. Patent No. 3,843,443; Published International PCT Application WO/86 03840).
- CVSP1 4 pol ⁇ peptide proteins, domains, analogs, and derivatives thereof, and encoding nucleic acids (and sequences complementar ⁇ thereto), and anti- CVSP14 pol ⁇ peptide antibodies can be used in diagnostics, particularl ⁇ diagnosis of cervical cancer, colon or pancreatic cancers.
- Such molecules can be used in assa ⁇ s, such as immunoassa ⁇ s, to detect, prognose, diagnose, or monitor various conditions, diseases, and disorders affecting CVSP1 4 pol ⁇ peptide expression, or monitor the treatment thereof.
- assa ⁇ s such as immunoassa ⁇ s
- an immunoassa ⁇ is carried out b ⁇ a method including contacting a sample derived from a patient with an anti-CVSP1 4 pol ⁇ peptide antibod ⁇ under conditions such that specific binding can occur, and detecting or measuring the amount of an ⁇ specific binding b ⁇ the antibod ⁇ .
- Such binding of antibod ⁇ , in tissue sections, can be used to detect aberrant CVSP1 4 pol ⁇ peptide localization or aberrant (e.g. , increased, decreased or absent) levels of CVSP1 4 pol ⁇ peptide.
- antibod ⁇ to CVSP1 4 pol ⁇ peptide can be used to assa ⁇ in a patient tissue or serum sample for the presence of CVSP14 pol ⁇ peptide where an aberrant level of CVSP1 4 pol ⁇ peptide is an indication of a diseased condition.
- the immunoassa ⁇ s which can be used include but are not limited to competitive and non-competitive assa ⁇ s ⁇ stems using techniques such as western blots, radioimmunoassa ⁇ s, ELISA (enz ⁇ me linked immunosorbent assa ⁇ ), "sandwich” immunoassa ⁇ s, immunoprecipitation assa ⁇ s, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assa ⁇ s, agglutination assa ⁇ s, complement-fixation assa ⁇ s, immunoradiometric assa ⁇ s, fluorescent immunoassa ⁇ s and protein A immunoassa ⁇ s.
- CVSP14 pol ⁇ peptide nucleic acid sequences, or subsequences thereof containing about at least 8 nucleotides, generall ⁇ 14 or 1 6 or 30 or more, generall ⁇ less than 1000 or up to 100, continugous nucleotides can be used as h ⁇ bridization probes.
- H ⁇ bridization assa ⁇ s can be used to detect, prognose, diagnose, or monitor conditions, disorders, or disease states associated with aberrant changes in CVSP1 4 pol ⁇ peptide expression and/or activit ⁇ as described herein.
- such a h ⁇ bridization assa ⁇ is carried out b ⁇ a method b ⁇ contacting a sample containing nucleic acid with a nucleic acid probe capable of h ⁇ bridizing to CVSP1 4 pol ⁇ peptide encoding DNA or RNA, under conditions such that h ⁇ bridization can occur, and detecting or measuring an ⁇ resulting h ⁇ bridization.
- a method of diagnosing a disease or disorder characterized b ⁇ detecting an aberrant level of a CVSP1 4 pol ⁇ peptide in a subject b ⁇ measuring the level of the DNA, RNA, protein or functional activit ⁇ of the CVSP1 4 pol ⁇ peptide in a sample derived from the subject, wherein an increase or decrease in the level of the DNA, RNA, protein or functional activit ⁇ of the CVSP14 pol ⁇ peptide, relative to the level of the DNA, RNA, protein or functional activit ⁇ found in an analogous sample not having the disease or disorder indicates the presence of the disease or disorder in the subject.
- Kits for diagnostic use contain in one or more containers an anti-CVSP14 pol ⁇ peptide antibod ⁇ , and, optionall ⁇ , a labeled binding partner to the antibod ⁇ .
- the anti-CVSP1 4 pol ⁇ peptide antibod ⁇ can be labeled (with a detectable marker, e.g. , a chemiluminescent, enz ⁇ matic, fluorescent, or radioactive moiet ⁇ ).
- a kit is also provided that includes in one or more containers a nucleic acid probe capable of h ⁇ bridizing to SP protein-encoding RNA.
- a kit can comprise in one or more containers a pair of primers (e.g.
- kits can optionall ⁇ further comprise in a container a predetermined amount of a purified CVSP1 4 pol ⁇ peptide or nucleic acid, e.g. , for use as a standard or control.
- K Pharmaceutical compositions and modes of administration
- compositions containing the identified compounds that modulate the activit ⁇ of a CVSP14 pol ⁇ peptide are provided herein. Also provided are combinations of a compound that modulates the activit ⁇ of a CVSP1 4 pol ⁇ peptide and another treatment or compound for treatment of a neoplastic disorder, such as a chemotherapeutic compound.
- the CVSP1 4 pol ⁇ peptide modulator and the anti-tumor agent can be packaged as separate compositions for administration together or sequentiall ⁇ or intermittentl ⁇ . Alternativel ⁇ , the ⁇ can provided as a single composition for administration or as two compositions for administration as a single composition.
- the combinations can be packaged as kits. a. CVSP14 pol ⁇ peptide inhibitors
- An ⁇ CVSP1 pol ⁇ peptide inhibitors including those described herein when used alone or in combination with other compounds, that can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical s ⁇ mptoms or diagnostic markers associated with neoplastic diseases, including undesired and/or uncontrolled angiogenesis, can be used in the present combinations.
- the CVSP1 4 pol ⁇ peptide inhibitor is an antibod ⁇ or fragment thereof that specificall ⁇ reacts with a CVSP14 pol ⁇ peptide or the protease domain thereof, an inhibitor of the CVSP1 4 pol ⁇ peptide production, an inhibitor of CVSP1 4 pol ⁇ peptide membrane-localization, or an ⁇ inhibitor of the expression of or, especiall ⁇ , the activit ⁇ of a CVSP14 pol ⁇ peptide.
- An ⁇ anti-angiogenic agents and anti-tumor agents when used alone or in combination with other compounds, that can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical s ⁇ mptoms or diagnostic markers associated with undesired and/or uncontrolled angiogenesis and/or tumor growth and metastasis, particularl ⁇ solid neoplasms, vascular malformations and cardiovascular disorders, chronic inflammator ⁇ diseases and aberrant wound repairs, circulator ⁇ disorders, crest s ⁇ ndromes, dermatological disorders, or ocular disorders, can be used in the combinations. Also contemplated are anti-tumor agents for use in combination with an inhibitor of a CVSP14 pol ⁇ peptide. c. Anti-tumor agents and anti-angiogenic agents
- the compounds herein and agents can be formulated as pharmaceutical compositions, t ⁇ picall ⁇ for single dosage administration.
- concentrations of the compounds in the formulations are effective for deliver ⁇ of an amount, upon administration, that is effective for the intended treatment.
- T ⁇ picall ⁇ the compositions are formulated for single dosage administration.
- To formulate a composition the weight fraction of a compound or mixture thereof is dissolved, suspended, dispersed or otherwise mixed in a selected vehicle at an effective concentration such that the treated condition is relieved or ameliorated.
- Pharmaceutical carriers or vehicles suitable for administration of the compounds provided herein include an ⁇ such carriers known to those skilled in the art to be suitable for the particular mode of administration.
- the compounds can be formulated as the sole pharmaceuticall ⁇ active ingredient in the composition or can be combined with other active ingredients.
- Liposomal suspensions including tissue-targeted liposomes, can also be suitable as pharmaceuticall ⁇ acceptable carriers. These can be prepared according to methods known to those skilled in the art. For example, liposome formulations can be prepared as described in U.S. Patent No. 4,522,81 1 .
- the active compound is included in the pharmaceuticall ⁇ acceptable carrier in an amount sufficient to exert a therapeuticall ⁇ useful effect in the absence of undesirable side effects on the patient treated.
- the therapeuticall ⁇ effective concentration can be determined empiricall ⁇ b ⁇ testing the compounds in known jn vitro and m vivo s ⁇ stems, such as the assa ⁇ s provided herein.
- the concentration of active compound in the drug composition depends on absorption, inactivation and excretion rates of the active compound, the ph ⁇ sicochemical characteristics of the compound, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
- T ⁇ picali ⁇ a therapeuticall ⁇ effective dosage is contemplated.
- the amounts administered can be on the order of 0.001 to 1 mg/ml, including about 0.005-0.05 mg/ml and about 0.01 mg/ml, of blood volume.
- Pharmaceutical dosage unit forms are prepared to provide from about 1 mg to about 1 000 mg, including from about 1 0 to about 500 mg, and including about 25-75 mg of the essential active ingredient or a combination of essential ingredients per dosage unit form.
- the precise dosage can be empiricall ⁇ determined.
- the active ingredient can be administered at once, or can be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and can be determined empiricall ⁇ using known testing protocols or b ⁇ extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values can also var ⁇ with the severit ⁇ of the condition to be alleviated.
- compositions for an ⁇ particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplar ⁇ onl ⁇ and are not intended to limit the scope or use of the claimed compositions and combinations containing them.
- Pharmaceuticall ⁇ acceptable derivatives include acids, salts, esters, h ⁇ drates, solvates and prodrug forms. The derivative is t ⁇ picall ⁇ selected such that its pharmacokinetic properties are superior to the corresponding neutral compound.
- compositions are mixed with a suitable pharmaceutical carrier or vehicle for s ⁇ stemic, topical or local administration to form pharmaceutical compositions.
- a suitable pharmaceutical carrier or vehicle for s ⁇ stemic, topical or local administration to form pharmaceutical compositions.
- Compounds are included in an amount effective for ameliorating or treating the disorder for which treatment is contemplated.
- concentration of active compound in the composition depends on absorption, inactivation, excretion rates of the active compound, the dosage schedule, amount administered, particular formulation as well as other factors known to those of skill in the art.
- Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include an ⁇ of the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, pol ⁇ eth ⁇ lene gl ⁇ col, gl ⁇ cerine, prop ⁇ lene gl ⁇ col or other s ⁇ nthetic solvent; antimicrobial agents, such as benz ⁇ l alcohol and meth ⁇ l parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as eth ⁇ lenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; and agents for the adjustment of tonicit ⁇ such as sodium chloride or dextrose.
- Parenteral preparations can be enclosed in ampules, disposable s ⁇ ringes or single or multiple dose vials made of glass, plastic or other suitable material.
- solubilizing compounds can be used. Such methods are known to those of skill in this art, and include, but are not limited to, using cosolvents, such as dimethylsulfoxide (DMSO), using surfactants, such as Tween ® , or dissolution in aqueous sodium bicarbonate. Derivatives of the compounds, such as prodrugs of the compounds can also be used in formulating effective pharmaceutical compositions.
- the compositions are formulated in an ophthalmicall ⁇ acceptable carrier.
- local administration either b ⁇ topical administration or b ⁇ injection are contemplated.
- Time release formulations are also desirable. T ⁇ picall ⁇ , the compositions are formulated for single dosage administration, so that a single dose administers an effective amount.
- the resulting mixture can be a solution, suspension, emulsion or other composition.
- the form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle. If necessary, pharmaceutically acceptable salts or other derivatives of the compounds are prepared.
- the compound is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated. It is understood that number and degree of side effects depends upon the condition for which the compounds are administered. For example, certain toxic and undesirable side effects are tolerated when treating life-threatening illnesses that would not be tolerated when treating disorders of lesser consequence.
- the compounds also can be mixed with other active materials, that do not impair the desired action, or with materials that supplement the desired action known to those of skill in the art.
- the formulations of the compounds and agents for use herein include those suitable for oral, rectal, topical, inhalational, buccal (e.g. , sublingual), parenteral (e.g. , subcutaneous, intramuscular, intradermal, or intravenous), transdermal administration or an ⁇ route.
- the most suitable route in an ⁇ given case depends on the nature and severit ⁇ of the condition being treated and on the nature of the particular active compound which is being used.
- the formulations are provided for administration to humans and animals in unit dosage forms, such as tablets, capsules, pills, powders, granules, sterile parenteral solutions or suspensions, and oral solutions or suspensions, and oil-water emulsions containing suitable quantities of the compounds or pharmaceuticall ⁇ acceptable derivatives thereof.
- the pharmaceuticall ⁇ therapeuticall ⁇ active compounds and derivatives thereof are t ⁇ picall ⁇ formulated and administered in unit-dosage forms or multiple-dosage forms.
- Unit-dose forms as used herein refers to ph ⁇ sicall ⁇ discrete units suitable for human and animal subjects and packaged individuall ⁇ as is known in the art.
- Each unit-dose contains a predetermined quantit ⁇ of the therapeuticall ⁇ active compound sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical carrier, vehicle or diluent.
- unit-dose forms include ampoules and s ⁇ ringes and individuall ⁇ packaged tablets or capsules.
- Unit-dose forms can be administered in fractions or multiples thereof.
- a multiple-dose form is a plurality of identical unit-dosage forms packaged in a single container to be administered in segregated unit-dose form.
- Examples of multiple-dose forms include vials, bottles of tablets or capsules or bottles of pints or gallons.
- multiple dose form is a multiple of unit-doses which are not segregated in packaging.
- the composition can contain along with the active ingredient: a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymeth ⁇ lcellulose; a lubricant, such as magnesium stearate, calcium stearate and talc; and a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polvin ⁇ lp ⁇ rrolidine, celluloses and derivatives thereof, povidone, crospovidones and other such binders known to those of skill in the art.
- a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymeth ⁇ lcellulose
- a lubricant such as magnesium stearate, calcium stearate and talc
- a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polvin ⁇ lp ⁇ rrolidine, celluloses and derivatives thereof, po
- Liquid pharmaceuticall ⁇ administrable compositions can, for example, be prepared b ⁇ dissolving, dispersing, or otherwise mixing an active compound as defined above and optional pharmaceutical adjuvants in a carrier, such as, for example, water, saline, aqueous dextrose, gl ⁇ cerol, gl ⁇ cols, ethanol, and the like, to thereb ⁇ form a solution or suspension.
- a carrier such as, for example, water, saline, aqueous dextrose, gl ⁇ cerol, gl ⁇ cols, ethanol, and the like
- the pharmaceutical composition to be administered can also contain minor amounts of nontoxic auxiliar ⁇ substances such as wetting agents, emulsif ⁇ ing agents, or solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, c ⁇ clodextrine derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, and other such agents.
- auxiliar ⁇ substances such as wetting agents, emulsif ⁇ ing agents, or solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, c ⁇ clodextrine derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, and other such agents.
- Methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art (see, e.g. , Remington's Pharmaceutical Sciences, Mack Publishing Compan ⁇ , Easton, Pa., 1 5th Edition, 1 975).
- the pharmaceutical compositions can take the form of, for example, tablets or capsules prepared b ⁇ conventional means with pharmaceuticall ⁇ acceptable excipients such as binding agents (e.g. , pregelatinized maize starch, pol ⁇ vin ⁇ l p ⁇ rrolidone or h ⁇ drox ⁇ prop ⁇ l meth ⁇ lcellulose); fillers (e.g. , lactose, microcr ⁇ stalline cellulose or calcium h ⁇ drogen phosphate); lubricants (e.g. , magnesium stearate, talc or silica); disintegrants (e.g. , potato starch or sodium starch gl ⁇ colate); or wetting agents (e.g. , sodium laur ⁇ l sulphate).
- the tablets can be coated b ⁇ methods well- known in the art.
- the pharmaceutical preparation can also be in liquid form, for example, solutions, s ⁇ rups or suspensions, or can be presented as a drug product for reconstitution with water or other suitable vehicle before use.
- Such liquid preparations can be prepared b ⁇ conventional means with pharmaceuticall ⁇ acceptable additives such as suspending agents (e.g. , sorbitol s ⁇ rup, cellulose derivatives or h ⁇ drogenated edible fats); emulsif ⁇ ing agents (e.g. , lecithin or acacia); non-aqueous vehicles (e.g. , almond oil, oil ⁇ esters, or fractionated vegetable oils); and preservatives (e.g. , meth ⁇ l or prop ⁇ l-p-h ⁇ drox ⁇ benzoates or sorbic acid).
- suspending agents e.g. , sorbitol s ⁇ rup, cellulose derivatives or h ⁇ drogenated edible fats
- emulsif ⁇ ing agents e.g. , lecithin
- Formulations suitable for rectal administration can be presented as unit dose suppositories. These can be prepared b ⁇ admixing the active compound with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.
- one or more conventional solid carriers for example, cocoa butter
- Formulations suitable for topical application to the skin or to the e ⁇ e generall ⁇ are formulated as an ointment, cream, lotion, paste, gel, spra ⁇ , aerosol and oil.
- Carriers which can be used include vaseline, lanoline, pol ⁇ eth ⁇ lene gl ⁇ cols, alcohols, and combinations of two or more thereof.
- the topical formulations can further advantageousl ⁇ contain 0.05 to 1 5 percent b ⁇ weight of thickeners selected from among h ⁇ drox ⁇ prop ⁇ l meth ⁇ l cellulose, meth ⁇ l cellulose, pol ⁇ vin ⁇ lp ⁇ rrolidone, pol ⁇ vin ⁇ l alcohol, pol ⁇ (alk ⁇ lene gl ⁇ cols), pol ⁇ /h ⁇ drox ⁇ alk ⁇ l, (meth)acr ⁇ lates or pol ⁇ (meth)acr ⁇ lamides.
- a topical formulation is often applied b ⁇ instillation or as an ointment into the conjunctival sac. It also can be used for irrigation or lubrication of the e ⁇ e, facial sinuses, and external auditor ⁇ meatus.
- the topical formulations in the liquid state can be also present in a h ⁇ drophilic three-dimensional pol ⁇ mer matrix in the form of a strip, contact lens, and the like from which the active components are released.
- the compounds for use herein can be delivered in the form of an aerosol spra ⁇ presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g. , dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit can be determined b ⁇ providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g. , gelatin, for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- Formulations suitable for buccal (sublingual) administration include, for example, lozenges containing the active compound in a flavored base, usuall ⁇ sucrose and acacia or tragacanth; and pastilles containing the compound in an inert base such as gelatin and gl ⁇ cerin or sucrose and acacia.
- the compounds can be formulated for parenteral administration b ⁇ injection, e.g. , b ⁇ bolus injection or continuous infusion.
- Formulations for injection can be presented in unit dosage form, e.g. , in ampules or in multi-dose containers, with an added preservative.
- the compositions can be suspensions, solutions or emulsions in oil ⁇ or aqueous vehicles, and can contain formulator ⁇ agents such as suspending, stabilizing and/or dispersing agents.
- the active ingredient can be in powder form for reconstitution with a suitable vehicle, e.g. , sterile p ⁇ rogen-free water or other solvents, before use.
- Formulations suitable for transdermal administration can be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. Such patches suitabl ⁇ contain the active compound as an optionall ⁇ buffered aqueous solution of, for example, 0.1 to 0.2 M concentration with respect to the active compound. Formulations suitable for transdermal administration can also be delivered b ⁇ iontophoresis (see, e.g. , Pharmaceutical Research 3 (6), 31 8 ( 1 986)) and t ⁇ picall ⁇ take the form of an optionall ⁇ buffered aqueous solution of the active compound.
- compositions can also be administered b ⁇ controlled release means and/or deliver ⁇ devices (see, e.g. , in U.S. Patent Nos. 3,536,809; 3,598, 1 23; 3,630,200; 3,845,770; 3,847,770; 3,91 6,899; 4,008,71 9; 4,687,610; 4,769,027; 5,059,595; 5,073,543; 5, 1 20,548; 5,354,566; 5,591 ,767; 5,639,476; 5,674,533 and 5,733,566).
- Desirable blood levels can be maintained b ⁇ a continuous infusion of the active agent as ascertained b ⁇ plasma levels. It should be noted that the attending ph ⁇ sician would know how to and when to terminate, interrupt or adjust therap ⁇ to lower dosage due to toxicit ⁇ , or bone marrow, liver or kidne ⁇ d ⁇ sfunctions. Conversely, the attending physician would also know how to and when to adjust treatment to higher levels if the clinical response is not adequate (precluding toxic side effects).
- the efficac ⁇ and/or toxicit ⁇ of the CVSP14 pol ⁇ peptide inhibitor(s), alone or in combination with other agents also can be assessed b ⁇ the methods known in the art (See generall ⁇ , O'Reilly, Investigational New Drugs, J_5 :5-1 3 ( 1 997)).
- the active compounds or pharmaceutically acceptable derivatives can be prepared with carriers that protect the compound against rapid elimination from the body, such as time release formulations or coatings.
- Kits containing the compositions and/or the combinations with instructions for administration thereof are provided.
- the kit can further include a needle or s ⁇ ringe, typically packaged in sterile form, for injecting the complex, and/or a packaged alcohol pad.
- Instructions are optionally included for administration of the active agent b ⁇ a clinician or b ⁇ the patient.
- the compounds or CVSP14 polypeptides or protease domains thereof or compositions containing an ⁇ of the preceding agents can be packaged as articles of manufacture containing packaging material, a compound or suitable derivative thereof provided herein, which is effective for treatment of a diseases or disorders contemplated herein, within the packaging material, and a label that indicates that the compound or a suitable derivative thereof is for treating the diseases or disorders contemplated herein.
- the label can optionall ⁇ include the disorders for which the therap ⁇ is warranted. L.
- the compounds identified b ⁇ the methods herein are used for treating or preventing neoplastic diseases in an animal, particularl ⁇ a mammal, including a human, is provided herein.
- the method includes administering to a mammal an effective amount of an inhibitor of a CVSP14 pol ⁇ peptide, whereb ⁇ the disease or disorder is treated or prevented.
- the CVSP14 pol ⁇ peptide inhibitor used in the treatment or prevention is administered with a pharmaceuticall ⁇ acceptable carrier or excipient.
- the mammal treated can be a human.
- the inhibitors provided herein are those identified b ⁇ the screening assa ⁇ s.
- antibodies and antisense nucleic acids or double-stranded RNA (dsRNA), such as RNAi, are contemplated.
- the treatment or prevention method can further include administering an anti-angiogenic treatment or agent or anti-tumor agent simultaneousl ⁇ with, prior to or subsequent to the CVSP1 4 pol ⁇ peptide inhibitor, which can be an ⁇ compound identified that inhibits the activit ⁇ of a CVSP14 pol ⁇ peptide.
- Such compounds include small molecule modulators, an antibod ⁇ or a fragment or derivative thereof containing a binding region thereof against the CVSP14 pol ⁇ peptide, an antisense nucleic acid or double-stranded RNA (dsRNA), such as RNAi, encoding the CVSP14 pol ⁇ peptide, and a nucleic acid containing at least a portion of a gene encoding the CVSP14 pol ⁇ peptide into which a heterologous nucleotide sequence has been inserted such that the heterologous sequence inactivates the biological activit ⁇ of at least a portion of the gene encoding the CVSP1 4 pol ⁇ peptide, in which the portion of the gene encoding the CVSP1 4 pol ⁇ peptide flanks the heterologous sequence to promote homologous recombination with a genomic gene encoding the CVSP1 4 pol ⁇ peptide.
- dsRNA double-stranded RNA
- RNAi double-stranded RNA
- CVSP14 pol ⁇ peptide function is reduced or inhibited b ⁇ CVSP1 4 pol ⁇ peptide antisense nucleic acids, to treat or prevent neoplastic disease.
- a CVSP14 pol ⁇ peptide "antisense" nucleic acid as used herein refers to a nucleic acid capable of h ⁇ bridizing to a portion of a CVSP1 4 pol ⁇ peptide RNA (generall ⁇ mRNA) b ⁇ virtue of some sequence complementarit ⁇ , and generall ⁇ under high stringenc ⁇ conditions.
- the antisense nucleic acid can be complementar ⁇ to a coding and/or noncoding region of a CVSP1 4 pol ⁇ peptide mRNA.
- Such antisense nucleic acids have utilit ⁇ as therapeutics that reduce or inhibit CVSP1 4 pol ⁇ peptide function, and can be used in the treatment or prevention of disorders as described supra.
- the CVSP14 pol ⁇ peptide antisense nucleic acids are of at least six nucleotides and are generall ⁇ oligonucleotides (ranging from 6 to about 1 50 nucleotides including 6 to 50 nucleotides).
- the antisense molecule can be complementar ⁇ to all or a portion of the protease domain.
- the oligonucleotide is at least 10 nucleotides, at least 1 5 nucleotides, at least 100 nucleotides, or at least 1 25 nucleotides.
- the oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single- stranded or double-stranded.
- the oligonucleotide can be modified at the base moiet ⁇ , sugar moiet ⁇ , or phosphate backbone.
- the oligonucleotide can include other appending groups such as peptides, or agents facilitating transport across the cell membrane (see, e.g. , Letsinger et al., Proc. Natl. Acad. Sci. U. S.A. 86:6553-6556 ( 1 989); Lemaitre et al., Proc. Natl. Acad. Sci. U.S.A. 84:648-652 ( 1 987); PCT Publication No. WO 88/09810, published December 1 5, 1 988) or blood-brain barrier (see, e.g.
- the CVSP1 4 pol ⁇ peptide antisense nucleic acid generall ⁇ is an oligonucleotide, t ⁇ picall ⁇ single-stranded DNA or RNA or an analog thereof or mixtures thereof.
- the oligonucleotide includes a sequence antisense to a portion of human CVSP1 4 pol ⁇ peptide.
- the oligonucleotide can be modified at an ⁇ position on its structure with substituents generall ⁇ known in the art.
- the CVSP14 pol ⁇ peptide antisense oligonucleotide can include at least one modified base moiet ⁇ which is selected from the group including, but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, h ⁇ poxanthine, xanthine, 4-acet ⁇ lc ⁇ tosine, 5-(carbox ⁇ h ⁇ drox ⁇ lmeth ⁇ l) uracil, 5-carbox ⁇ meth ⁇ laminometh ⁇ l-2-thiouridine, 5-carbox ⁇ meth ⁇ laminometh ⁇ luracil, dih ⁇ drouracil, beta-D-galactos ⁇ lqueosine, inosine, N6-isopenten ⁇ ladenine, 1 -meth ⁇ lguanine, 1 -meth ⁇ linosine, 2,2-dimeth ⁇ lguanine, 2-meth ⁇ ladenine, 2-meth ⁇ lguanine, 3-meth ⁇ lc ⁇ tosine,
- the oligonucleotide includes at least one modified sugar moiet ⁇ selected from the group including but not limited to arabinose, 2-fluoroarabinose, x ⁇ lulose, and hexose.
- the oligonucleotide can include at least one modified phosphate backbone selected from a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a meth ⁇ lphosphonate, an alk ⁇ l phosphotriester, and a formacetal or analog thereof.
- the oligonucleotide can be an ⁇ -anomeric oligonucleotide.
- An ⁇ -anomeric oligonucleotide forms specific double-stranded h ⁇ brids with complementar ⁇ RNA in which the strands run parallel to each other (Gautier et al., Nucl. Acids Res. 15:6625-6641 ( 1 9871).
- the oligonucleotide can be conjugated to another molecule, e.g. , a peptide, h ⁇ bridization triggered cross-linking agent, transport agent and h ⁇ bridization-triggered cleavage agent.
- another molecule e.g. , a peptide, h ⁇ bridization triggered cross-linking agent, transport agent and h ⁇ bridization-triggered cleavage agent.
- the oligonucleotides can be s ⁇ nthesized b ⁇ standard methods known in the art, e.g. b ⁇ use of an automated DNA s ⁇ nthesizer (such as are commerciall ⁇ available from Biosearch, Applied Bios ⁇ stems, etc.).
- phosphorothioate oligonucleotides can be s ⁇ nthesized b ⁇ the method of Stein et al. (Nucl. Acids Res. 16:3209 ( 1 988)), meth ⁇ lphosphonate oligonucleotides can be prepared b ⁇ use of controlled pore glass pol ⁇ mer supports (Sarin et al., Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451 ( 1 988)), etc.
- the CVSP1 4 pol ⁇ peptide antisense oligonucleotide includes catal ⁇ tic RNA or a riboz ⁇ me (see, e.g. , PCT International Publication WO 90/1 1 364, published October 4, 1 990; Sarver et al., Science 247: 1 222-1 225 ( 1 990)).
- the oligonucleotide ' is a 2'-0- meth ⁇ lribonucleotide (Inoue et al., Nucl. Acids Res. 15:61 31 -6148 ( 1 987)1, or a chimeric RNA-DNA analogue (Inoue et al., FEBS Lett. 21 5 :327-330 (1 987)).
- the oligonucleotide can be double-stranded RNA (dsRNA) such as RNAi.
- the CVSP14 pol ⁇ peptide antisense nucleic acid is produced intracellularl ⁇ b ⁇ transcription from an exogenous sequence.
- a vector can be introduced in vivo such that it is taken up b ⁇ a cell, within which cell the vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA).
- RNA antisense nucleic acid
- Such a vector would contain a sequence encoding the CVSP14 pol ⁇ peptide antisense nucleic acid.
- Such a vector can remain episomal or become chromosomall ⁇ integrated, as long as it can be transcribed to produce the desired antisense RNA.
- Such vectors can be constructed b ⁇ recombinant DNA technolog ⁇ methods standard in the art.
- Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
- Expression of the sequence encoding the CVSP1 4 pol ⁇ peptide antisense RNA can be b ⁇ an ⁇ promoter known in the art to act in mammalian, including human, cells. Such promoters can be inducible or constitutive.
- Such promoters include but are not limited to: the SV40 earl ⁇ promoter region (Bernoist and Chambon, Nature 290:304-31 0 ( 1 981 ), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787- 797 ( 1 980), the herpes th ⁇ midine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78: 1441 -1 445 ( 1 981 ), the regulator ⁇ sequences of the metallothionein gene (Brinster et al., Nature 296:39-42 (1 982), etc.
- the antisense nucleic acids include sequence complementar ⁇ to at least a portion of an RNA transcript of a CVSP1 4 pol ⁇ peptide gene, including a human CVSP1 4 pol ⁇ peptide gene. Absolute complementaril ⁇ is not required.
- the amount of CVSP1 4 pol ⁇ peptide antisense nucleic acid (dsRNA) that is effective in the treatment or prevention of neoplastic disease depends on the nature of the disease, and can be determined empiricall ⁇ b ⁇ standard clinical techniques. Where possible, it is desirable to determine the antisense c ⁇ totoxicit ⁇ in cells in vitro, and then in useful animal model s ⁇ stems prior to testing and use in humans. 2.
- RNA interference RNA interference
- RNA interference (RNAi) (see, e.g. Chuang et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 37:4985) can be emplo ⁇ ed to inhibit the expression of a gene encoding a CVSP1 4.
- Interfering RNA (RNAi) fragments, particularl ⁇ double- stranded (ds) RNAi, can be used to generate loss-of-CVSP14 function.
- Methods relating to the use of RNAi to silence genes in organisms including, mammals, C. elegans, Drosophila and plants, and humans are known (see, e.g. , Fire et al.
- Double-stranded RNA (dsRNA)-expressing constructs are introduced into a host, such as an animal or plant using, a replicable vector that remains episomal or integrates into the genome.
- RNAi can interfere with accumulation of endogenous mRNA encoding a CVSP1 4.
- RNAi also can be used to inhibit expression in vitro. Regions include at least about 21 (or 21 ) nucleotides that are selective (i.e. unique) for CVSP14 are used to prepare the RNAi. Smaller fragments of about 21 nucleotides can be transformed directl ⁇ into cells; larger RNAi dsRNA molecules are generall ⁇ introduced using vectors that encode them. dsRNA molecules are at least about 21 bp long or longer, such as 50, 1 00, 1 50, 200 and longer.
- nucleic acids that include a sequence of nucleotides encoding a CVSP1 4 pol ⁇ peptide or functional domains or derivative thereof, are administered to promote CVSP14 pol ⁇ peptide function, b ⁇ wa ⁇ of gene therap ⁇ .
- Gene therap ⁇ refers to therap ⁇ performed b ⁇ the administration of a nucleic acid to a subject.
- the nucleic acid produces its encoded protein that mediates a therapeutic effect b ⁇ promoting CVSP1 4 pol ⁇ peptide function.
- one therapeutic composition for gene therap ⁇ includes a CVSP1 4 pol ⁇ peptide-encoding nucleic acid that is part of an expression vector that expresses a CVSP1 4 pol ⁇ peptide or domain, fragment or chimeric protein thereof in a suitable host.
- a nucleic acid has a promoter operabl ⁇ linked to the CVSP1 4 pol ⁇ peptide coding region, the promoter being inducible or constitutive, and, optionall ⁇ , tissue-specific.
- a nucleic acid molecule in which the CVSP1 4 pol ⁇ peptide coding sequences and an ⁇ other desired sequences are flanked b ⁇ regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the SP protein nucleic acid (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 ( 1 989); Zijlstra et al., Nature 342:435-438 ( 1 989)).
- Deliver ⁇ of the nucleic acid into a patient can be either direct, in which case the patient is directl ⁇ exposed to the nucleic acid or nucleic acid-carr ⁇ ing vector, or indirect, in which case, cells are first transformed with the nucleic acid in vitro, then transplanted into the patient.
- These two approaches are known, respectivel ⁇ , as in vivo or ex vivo gene therap ⁇ .
- the nucleic acid is directl ⁇ administered in vivo, where it is expressed to produce the encoded product.
- This can be accomplished b ⁇ an ⁇ of numerous methods known in the art, e.g. , b ⁇ constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g. , b ⁇ infection using a defective or attenuated retroviral or other viral vector (see U.S. Patent No. 4,980,286), or b ⁇ direct injection of naked DNA, or b ⁇ use of microparticle bombardment (e.g.
- a gene gun Biolistic, Dupont
- a nucleic acid-ligand complex can be formed in which the ligand is a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid I ⁇ sosomal degradation.
- the nucleic acid can be targeted in vivo for cell specific uptake and expression, b ⁇ targeting a specific receptor (see, e.g., PCT Publications WO 92/061 80 dated April 1 6, 1 992 (Wu et al.); WO 92/22635 dated December 23, 1 992 (Wilson et al.); WO92/2031 6 dated November 26, 1 992 (Findeis et al.); W093/1 41 88 dated Jul ⁇ 22, 1 993 (Clarke et al.), WO 93/20221 dated October 1 4, 1 993 (Young)).
- the nucleic acid can be introduced intracellularl ⁇ and incorporated within host cell DNA for expression, b ⁇ homologous recombination (Koller and Smithies, Proc. Natl. Acad. 5c/. USA 86:8932-8935 ( 1 989); Zijlstra et al., Nature 342:435-438 ( 1 989)).
- a viral vector that contains the CVSP1 4 pol ⁇ peptide nucleic acid is used.
- a retroviral vector can be used (see Miller et al., Meth. Enzymol. 21 7:581 -599 ( 1 993)).
- retroviral vectors have been modified to delete retroviral sequences that are not necessar ⁇ for packaging of the viral genome and integration into host cell DNA.
- the CVSP1 4 pol ⁇ peptide nucleic acid to be used in gene therap ⁇ is cloned into the vector, which facilitates deliver ⁇ of the gene into a patient. More detail about retroviral vectors can be found in Boesen et al., Biotherapy 6:291 -302 ( 1 994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherap ⁇ .
- Adenoviruses are other viral vectors that can be used in gene therap ⁇ .
- Adenoviruses are especiall ⁇ attractive vehicles for delivering genes to respirator ⁇ epithelia.
- Adenoviruses naturall ⁇ infect respirator ⁇ epithelia where the ⁇ cause a mild disease.
- Other targets for adenovirus-based deliver ⁇ s ⁇ stems are liver, the central nervous s ⁇ stem, endothelial cells, and muscle.
- Adenoviruses have the advantage of being capable of infecting non-dividing cells.
- Kozarsk ⁇ and Wilson Current Opinion in Genetics and Development 3:499-503 ( 1 993) present a review of adenovirus-based gene therap ⁇ .
- Adeno-associated virus has also been proposed for use in gene therap ⁇ (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 ( 1 993).
- Another approach to gene therap ⁇ involves transferring a gene to cells in tissue culture b ⁇ such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection.
- the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient.
- the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell.
- Such introduction can be carried out b ⁇ an ⁇ method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc.
- Numerous techniques are known in the art for the introduction of foreign genes into cells (see e.g. , Loeffler and Behr, Meth. Enzymol. 2 T7:599-61 8 ( 1 993); Cohen et al., Meth. Enzymol. 21 7:61 8-644 ( 1 993); Cline, Pharmac Ther.
- the technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible b ⁇ the cell and generall ⁇ heritable and expressible b ⁇ its cell progen ⁇ .
- the resulting recombinant cells can be delivered to a patient b ⁇ various methods known in the art.
- epithelial cells are injected, e.g. , subcutaneousl ⁇ .
- recombinant skin cells can be applied as a skin graft onto the patient.
- Recombinant blood cells e.g. , hematopoietic stem or progenitor cells
- the amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined b ⁇ one skilled in the art.
- Cells into which a nucleic acid can be introduced for purposes of gene therap ⁇ encompass an ⁇ desired, available cell t ⁇ pe, and include but are not limited to epithelial cells, endothelial cells, keratinoc ⁇ tes, fibroblasts, muscle cells, hepatoc ⁇ tes; blood cells such as T I ⁇ mphoc ⁇ tes, B I ⁇ mphoc ⁇ tes, monoc ⁇ tes, macrophages, neutrophils, eosinophils, megakar ⁇ oc ⁇ tes, granuloc ⁇ tes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g. , such as stem cells obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, and other sources thereof.
- a cell used for gene therap ⁇ is autologous to the patient.
- a CVSP1 4 pol ⁇ peptide nucleic acid is introduced into the cells such that it is expressible b ⁇ the cells or their progen ⁇ , and the recombinant cells are then administered in vivo for therapeutic effect.
- stem or progenitor cells are used.
- An ⁇ stem and/or progenitor cells which can be isolated and maintained in vitro can potentiall ⁇ be used in accordance with this embodiment.
- stem cells include but are not limited to hematopoietic stem cells (HSC), stem cells of epithelial tissues such as the skin and the lining of the gut, embr ⁇ onic heart muscle cells, liver stem cells (PCT Publication WO 94/08598, dated April 28, 1 994), and neural stem cells (Stemple and Anderson, Cell 71:973-985 ( 1 992)).
- HSC hematopoietic stem cells
- stem cells of epithelial tissues such as the skin and the lining of the gut
- embr ⁇ onic heart muscle cells such as the skin and the lining of the gut
- liver stem cells PCT Publication WO 94/08598, dated April 28, 1 994
- neural stem cells Stemple and Anderson, Cell 71:973-985 ( 1 992)
- Epithelial stem cells (ESCs) or keratinoc ⁇ tes can be obtained from tissues such as the skin and the lining of the gut b ⁇ known procedures (Rheinwald, Meth. Cell Bio. 27/1 :229
- ESCs or keratinoc ⁇ tes obtained from the skin or lining of the gut of a patient or donor can be grown in tissue culture (Rheinwald, Meth. Cell Bio. 27A :229 ( 1 980); Pittelkow and Scott, Cano Clinic Proc. 67 :771 ( 1 986)). If the ESCs are provided b ⁇ a donor, a method for suppression of host versus graft reactivit ⁇ (e.g.
- HSC hematopoietic stem cells
- Techniques b ⁇ which this can be accomplished include (a) the isolation and establishment of HSC cultures from bone marrow cells isolated from the future host, or a donor, or (b) the use of previousl ⁇ established long-term HSC cultures, which can be allogeneic or xenogeneic.
- Non-autologous HSC generall ⁇ are used with a method of suppressing transplantation immune reactions of the future host/patient.
- human bone marrow cells can be obtained from the posterior iliac crest b ⁇ needle aspiration (see, e.g. , Kodo et al., J. Clin. Invest. 73: 1 377-1 384 ( 1 984)).
- the HSCs can be made highl ⁇ enriched or in substantiall ⁇ pure form. This enrichment can be accomplished before, during, or after long- term culturing, and can be done b ⁇ an ⁇ techniques known in the art.
- Long-term cultures of bone marrow cells can be established and maintained b ⁇ using, for example, modified Dexter cell culture techniques (Dexter et al., J. Cell Physio/. 37 :335 ( 1 977) or Witlock-Witte culture techniques (Witlock and Witte, Proc Natl. Acad. Sci. USA 73:3608-361 2 ( 1 982)).
- the nucleic acid to be introduced for purposes of gene therap ⁇ includes an inducible promoter operabl ⁇ linked to the coding region, such that expression of the nucleic acid is controllable b ⁇ controlling the presence or absence of the appropriate inducer of transcription.
- a method for treating tumors is provided.
- the method is practiced b ⁇ administering a prodrug that is cleaved at a specific site b ⁇ a CVSP1 4 to release an active drug.
- the prodrug Upon contact with a cell that expresses CVSP14 activit ⁇ , the prodrug is converted into an active drug.
- the prodrug can be a conjugate that contains the active agent, such as an anti-tumor drug, such as a c ⁇ totoxic agent, or other therapeutic agent (TA), linked to a substrate for the targeted CVSP14, such that the drug or agent is inactive or unable to enter a cell, in the conjugate, but is activated upon cleavage.
- the active agent such as an anti-tumor drug, such as a c ⁇ totoxic agent, or other therapeutic agent (TA)
- the prodrug for example, can contain an oligopeptide, t ⁇ picall ⁇ a relativel ⁇ short, less than about 10 amino acids peptide, that is proteol ⁇ ticall ⁇ cleaved b ⁇ the targeted CVSP1 4.
- C ⁇ totoxic agents include, but are not limited to, alk ⁇ lating agents, antiproliferative agents and tubulin binding agents. Others include, vinca drugs, mitom ⁇ cins, bleom ⁇ cins and taxanes.
- Transgenic animal models and animals such as rodents, including mice an rats, cows, chickens, pigs, goats, sheep, gorillas and other primates, are provided herein.
- rodents including mice an rats, cows, chickens, pigs, goats, sheep, gorillas and other primates.
- transgenic non-human animals that contain heterologous nucleic acid encoding a CVSP1 4 pol ⁇ peptide or a transgenic animal in which expression of the pol ⁇ peptide has been altered, such as b ⁇ replacing or modif ⁇ ing the promoter region or other regulator ⁇ region of the endogenous gene are provided.
- Such an animal can b ⁇ produced b ⁇ promoting recombination between an exogenous CVSP1 4 gene that could be over-expressed or mis-expressed, such as b ⁇ expression under a strong promoter, via homologous or other recombination event.
- transgenic animals can be produced b ⁇ introducing the nucleic acid using vectors or other modes of gene deliver ⁇ into a germline cell, such as an embr ⁇ onic stem cell.
- the nucleic acid is introduced, such as an embr ⁇ onic stem cell, which is then injected b ⁇ transforming embr ⁇ o- derived stem (ES) cells with a vector containing the CVSP14 pol ⁇ peptide- encoding nucleic acid followed b ⁇ injecting the ES cells into a blastoc ⁇ st, and implanting the blastoc ⁇ st into a foster mother, followed b ⁇ the birth of a transgenic animal.
- ES transforming embr ⁇ o- derived stem
- Generall ⁇ introduction into a chromosome of the animal occurs b ⁇ a recombination between the heterologous CVSP1 4-encoding nucleic acid and endogenous nucleic acid.
- the heterologous nucleic acid can be targeted to a specific chromosome.
- knockout animals can be produced.
- Such an animal can be initially produced by promoting homologous recombination between a CVSP1 4 pol ⁇ peptide gene in its chromosome and an exogenous CVSP1 4 pol ⁇ peptide gene that has been rendered biologicall ⁇ inactive (t ⁇ picall ⁇ b ⁇ insertion of a heterologous sequence, e.g. , an antibiotic resistance gene).
- this homologous recombination is performed b ⁇ transforming embr ⁇ o-derived stem (ES) cells with a vector containing the insertionall ⁇ inactivated CVSP14 pol ⁇ peptide gene, such that homologous recombination occurs, followed b ⁇ injecting the ES cells into a blastoc ⁇ st, and implanting the blastoc ⁇ st into a foster mother, followed b ⁇ the birth of the chimeric animal ("knockout animal") in which a CVSP14 pol ⁇ peptide gene has been inactivated (see Capecchi, Science 244: 1 288-1 292 (1 989)).
- the chimeric animal can be bred to produce homoz ⁇ gous knockout animals, which can then be used to produce additional knockout animals.
- Knockout animals include, but are not limited to, mice, hamsters, sheep, pigs, cattle, and other non-human mammals.
- a knockout mouse is produced.
- Such knockout animals are expected to develop or be predisposed to developing neoplastic diseases and thus can have use as animal models of such diseases e.g. , to screen for or test molecules for the ability to treat or prevent such diseases or disorders.
- Such an animal can be initially produced by promoting homologous recombination between a CVSP14 gene in its chromosome and an exogenous CVSP1 4 pol ⁇ peptide gene that would be over- expressed or mis-expressed (generall ⁇ b ⁇ expression under a strong promoter).
- this homologous recombination is carried out b ⁇ transforming embr ⁇ o-derived stem (ES) cells with a vector containing the over-expressed or mis-expressed CVSP14 pol ⁇ peptide gene, such that homologous recombination occurs, followed b ⁇ injecting the ES cells into a blastoc ⁇ st, and implanting the blastoc ⁇ st into a foster mother, followed b ⁇ the birth of the chimeric animal in which a CVSP14 gene has been over-expressed or mis-expressed (see Capecchi, Science 244: 1 288-1 292 ( 1 989)).
- the chimeric animal can be bred to produce additional animals with over-expressed or mis-expressed CVSP14 pol ⁇ peptide.
- Such animals include, but are not limited to, mice, hamsters, sheep, pigs, cattle and other non-human mammals.
- a mouse with over- expressed or mis-expressed CVSP14 pol ⁇ peptide is produced.
- Serine Protease Profiling by Degenerate Primer PCR Serine protease domains were amplified using degenerate primers designed from the consensus sequences flanking the catal ⁇ tic histidine (DSPP1 ) and the catal ⁇ tic serine (DSPP2).
- the sequence of the sense primer (DSPP1 ) used is as follows (SEQ ID No. 7) : 5'-TGG (GA)TI (ACG)TI (TA)(CG)I GCI (AG)CI CA(TC) TG-3' (nucleotides in parentheses represent equal molar mixtures and I represents deox ⁇ inosine).
- the sequence of antisense primer (DSPP2) used is as follows (SEQ ID No.
- Random hexamer and oligo(dT) primed cDNA were used as templates for PCR reactions.
- PCR products were separated on agarose gels, and all products between 450- to 550-bp were extracted from the gels and subcloned into the pCR2.1 -TOPO cloning vector (Invitrogen).
- Plasmids containing PCR-generated inserts were identified b ⁇ electrophoresis of EcoR I digestion products on agarose gels. Plasmids containing 450-550 bp inserts were subjected to DNA sequencing.
- One of these clones contained a 474 bp insert that encoded a portion of the protease domain of a serine protease, which is referred to as CVSP14 herein.
- a BLAST search against the human genomic database htgs revealed that this sequence matches a genomic sequence AC01 2228 that is derived from human chromosome 1 1 .
- Cloning of cDNA Encoding the Protease Domain of CVSP14- ClonCapture cDNA Selection Kit (Clontech) was used to obtain cDNA encoding the CVSP14 protease domain.
- a biotin ⁇ lated 474 bp partial cDNA clone for CVSP1 4 was generated b ⁇ PCR using DSPP1 and DSPP2 primers in the presence of biotin-21 -dUTP.
- the biotin ⁇ lated product was gel purified and used as probe in RecA-mediated ClonCapture procedures.
- Human prostate adenocarcinoma cDNA librar ⁇ (Gibco BRL Cat. # 1 1 597-01 0) was used as the cDNA source.
- the captured cDNAs were transformed into ElectroMAX DH 1 0B cells b ⁇ electroporation, and positive clones containing CVSP14 protease domain were identified b ⁇ colon ⁇ h ⁇ bridization using a non-biotin ⁇ lated DSPP1 and DSPP2 PCR product. Positive clones were verified b ⁇ DNA sequencing.
- DNA sequencing anal ⁇ sis of four positive clones indicated that all clones contained cDNAs encoding the protease domain of a serine protease.
- the cDNA encoding CVSP1 4 protease domain is composed of 756 bp, which translates into 251 -amino acids.
- BLAST anal ⁇ sis of the protein database indicated that this serine protease has highest homolog ⁇ to one of the serine protease domains of Xenopus oviductin (Genbank accession number U81291 and T30338) with 47% identit ⁇ .
- GCTCTCCTGGGTCTGTCTGGCTTAAGTC-3' SEQ ID NO. 19 (using first 5'- RACE product as template).
- the PCR products from RACE reactions, which were greater than 500 bp, were purified from agarose gel and subcloned into pCR2.1-TOPO cloning vector (Invitrogen, Carlsbad, CA). Colon ⁇ h ⁇ bridization was then performed to identif ⁇ positive colonies containing CVSP14 sequence.
- An additional sequence of 279 bp was obtained from the second 5'-RACE products including an ATG start codon within a sequence of AAAACTATGAGT (SEQ ID NO.20).
- nucleotide and Amino Acid sequences of Human CVSP14 are set forth below and in SEQ ID Nos. 12 and 13: GAT TCA CCA CGT CTT GGT TAA TGA ATA AAC TTG TTT TAA ATT GGC TTA TTG CTG
- GTC TCT CAA GGC TTC CTA TTT TTG TTT GCT TTA
- GTC TCT CTA AAA TTT CAG GGA AAA ACT
- CVSP14 DNA and protein sequences were anal ⁇ zed using DNA Strider (version 1 .2).
- the ORF of CVSP1 4 is composed of 921 bp, which translate into a 306-amino acid protein.
- Protein sequence anal ⁇ sis using the SMART (Simple Modular Architecture Research Tool) program at http://smart.embl-heidelberg.de indicates that CVSP14 is a secreted serine protease with a signal peptide (amino acids 1 -25) at the N-terminus followed b ⁇ a tr ⁇ psin-like serine protease domain (amino acids 55-306).
- the amino acid and nucleoide sequences are set forth in SEQ ID No. 1 2 and 1 3.
- Gene expression profile of CVSP14 in normal and tumor tissues To obtain information regarding the gene expression profile of the CVSP14 transcript, PCR anal ⁇ sis was carried out on cDNA panels made from several human adult tissues (Clontech, Cat. #K1420-1 ), fetal tissues (Cat. #K1425-1 ) and primar ⁇ tumors (human tumor multiple tissue cDNA panel, catalog number K1 522-1 , CLONTECH) using CVSP14-specific primers GX-SP1 -1 (SEQ ID No. 9) (5'-GACTTAAGCCAGACAGACCCAGGAGAGC-3') and GX-SP1 -2AS (5'-TTGTGAGAGGACGCCACCTTCAGTTAAGC-3') (SEQ ID No. 10).
- a PCR product of 474 bp generated b ⁇ DSPP1 and DSPP2 primers was used to probe a cDNA blot composed of cDNA s ⁇ nthesized from 68 human tumors and corresponding normal tissue from the same individual (catalog number 7840-1 human matched tumor/normal expression arra ⁇ ; CLONTECH) as well as a dot blot composed of RNA extracted from 72 different human tissues (Human Multiple Tissue Expression (MTE) Arra ⁇ ; Clontech, Palo Alto, CA; catalog no. 7776-1 ).
- MTE Human Multiple Tissue Expression
- CVSP14 Strong signals, indicating high expression of CVSP14, were detected in 6 of the 1 5 normal kidne ⁇ cDNA samples and moderate to weak signals could also be detected in 8 additional normal kidne ⁇ cDNA samples.
- CVSP1 4 signals were diminished in all the matched kidne ⁇ tumor samples.
- Weak signals were detected in all three pairs of prostate normal/tumor cDNA samples.
- Weak signals were also detected in 3 of 9 normal breast samples.
- a weak signal was also detected in one of the 7 uterine tumors , but not in their normal tissue counterparts.
- Weak signals were also detected in two of the three normal lung tissue samples, but not in their matched tumor samples.
- Ver ⁇ weak signals can be seen in cDNA samples from various tumor cell lines, including HeLa cells, Burkitt's I ⁇ mphoma Daudi cells, chronic m ⁇ elogenous leukemia K562, prom ⁇ eloc ⁇ tic leukemia HL-60 cells, melanoma G361 cells, lung carcinoma A549 cells, I ⁇ mphoblastic leukemia MOLT-4 and colorectal adenocarcinoma SW480 cells.
- CVSP14 transcript is expressed moderatel ⁇ in I ⁇ mph node and weal ⁇ in heart, stomach, duodenum, jejunum, ileum, ilocecum, colon (ascending, transverse, and descending), kidne ⁇ , skeletal muscle, lung, placenta, liver, pancreas and salivar ⁇ gland.
- Nucleic acid encoding each the CVSP14 and protease domain thereof can be cloned into a derivative of the Pichia pastoris vector pPIC9K (available from
- Plasmid pPIC9K features include the 5' AOX1 promoter fragment at 1 -948; 5' AOX 1 primer site at 855-875; alpha-factor secretion signal(s) at 949-1 21 8; alpha-factor primer site at 1 1 52-1 1 72; multiple cloning site at 1 1 92-1 241 ; 3' AOX1 primer site at 1 327-1 347; 3' AOX1 transcription termination region at 1 253-1 586; HIS4 ORF at 4514-1 980; kanam ⁇ cin resistance gene at 5743-4928; 3' AOX1 fragment at 61 22-6879;
- the plasmid is derived from pPIC9K b ⁇ eliminating the Xhol site in the kanam ⁇ cin resistance gene and the resulting vector is herein designated pPIC9Kx.
- PCR SOE PCR-based splicing b ⁇ overlap extension
- CVSP1 4 SEQ ID No. 1 3) with a serine Two overlapping gene fragments, each containing the AGT codon for serine at position 1 66 were PCR amplified using the following primers: for the 5' gene fragment:
- the amplified gene fragments were purified on a 1 % agarose gel, mixed and reamplified b ⁇ PCR to produce the full length coding sequence for for the protease domain of CVSP1 4 C 1 22S (C ⁇ s 166 Seq ID No 1 3; C ⁇ s u 1 SEQ ID NO: 1 7).
- the amplified gene fragments were purified on a 1 % agarose gel, mixed and reamplified b ⁇ PCR to produce the full length coding sequence for for the protease domain of CVSP1 4 C 1 22S (C ⁇ s 166 Seq ID No 1 3; C ⁇ s u 1 SEQ ID
- CVSP14 expression vector cDNA encoding CVSP14 containing the C 1 22S point mutation i.e., CVSP14C 1 22S, position C, 66 in SEQ ID Nos. 1 2 and 1 3) was cloned from pPIC9Kx:CVSP14C 1 22S.
- the primers CVSP14-5' GGAATTCCATATGAGCAGCGGCCATATCGACGACGACGACAAAATTCTTGGAG GAAGCCAAGTGGAG (containing a Ndel restriction site; SEQ ID No.
- CVSP14-3' CCGCTCGAGGTTACCAGTTTGGATGTGTTCGTGG (containing a Xhol restriction site; SEQ ID No. 22) were used to PCR amplif ⁇ the human CVSP14 protease domain utilizing an enterokinase recognition sequence (DDDDK) for z ⁇ mogen activation.
- DDDDK enterokinase recognition sequence
- Amplification was conducted in a total volume of 50ul containing 20mM tris-HCI (pH 8.75 at 25 °C), 10mM KCI, 10 mM (NH 4 ) 2 S0 4 , 2mM MgS0 4 , 0.1 % triton X-100, 0.1 mg/ml BSA, 0.2mM dNTPs, 1 .0 unit ACCUZYME DNA pol ⁇ merase (Bioline USA, Inc., New Jerse ⁇ ), and 1 00 pmol of primers.
- the reaction mixture was heated to 95 °C for 5 min, followed b ⁇ 25 c ⁇ cles of 95, 60, and 75 °C for 30 s each and a final extension of 75 °C for 2 min.
- PCR products were purified using a QIAquick PCR purification kit (QIAGEN Inc., Chatsworth, CA). PCR products were doubl ⁇ digested with 1 0 units Ndel and 10 units Xhol for 2 hrs at 37 °C. The digested fragments were purified on a 1 .4% agarose gel and stained with ethidium bromide. The band containing CVSP1 4 cDNA was excised and purified using a QIAEX II gel extraction kit (QIAGEN Inc., Chatsworth, CA). CVSP14 cDNA was then cloned into the Ndel and Xhol sites of the pET21 b expression vector (Novagen, Inc., Madison, WI) using standard methods.
- This vector allows the fusion of a C- terminal 6xHIS tag for purification b ⁇ immobilized metal affinit ⁇ chromatograph ⁇ (IMAC). Competent XL1 0 cells (Stratagene) were transformed with the pET21 bCVSP14 vector and used to produce plasmid stocks. Proper insertion and DNA sequence were confirmed b ⁇ fluorescent thermal d ⁇ e DNA sequencing methods as well as restriction digests. Protein Expression, Purification, and Refolding
- the resulting solution was filtered through a 0.2um s ⁇ ringe filter before loading onto 25ml Ni-NTA resin (QIAGEN Inc., Chatsworth, CA) pre-equilibrated with 6M GuHCI, 20 mM tris-HCI, 300 mM NaCl, pH 8.0.
- the column was washed with two column volumes equilibration buffer followed b ⁇ three column volumes 8M urea, 20 mM tris-HCI, 300 mM NaCl, pH 8.0.
- Purified inclusion bodies are then eluted with two column volumes 8M urea, 20 mM tris-HCI, 300 mM NaCl, 1 M imidazole, pH 8.0.
- CVSP14 was refolded b ⁇ slowl ⁇ adding the inclusion bod ⁇ mixture to 8L 100mM tris-HCI, 1 50mM NaCl, 7.5mM c ⁇ steine, 1 mM c ⁇ stine, 0.5M arginine, 3g/L cholic acid, pH 8.0 using a peristaltic pump.
- the refolding mixture was allowed to stir at 4°C for 7 da ⁇ s or until thiol concentration was below 1 mM as detected b ⁇ Ellman's reagent.
- the refolding solution was filtered through a 1 uM filter, concentrated b ⁇ ultrafiltration and the buffer exchanged in PBS, 3g/L cholic acid, pH 8.0.
- Activation of CVSP14 was performed by the addition . of 1 -10 U/ml EKMax (Invitrogen, Carlsbad, CA) and incubation at 4°C until the reaction was deemed complete (generall ⁇ 4-8 da ⁇ s). Residual EKMax was removed b ⁇ treating the solution with a small amount of ConA resin that binds the gl ⁇ cos ⁇ lated enterokinase. Complete removal of EKMax was confirmed b ⁇ measuring the activit ⁇ of the solution towards a specific enterokinase fluorogenic substrate.
- CVSP14 exhibited some activit ⁇ towards a number of these substrates, but was most active towards S-2366 (DiaPharma, Westchester, OH).
- test compounds to act as inhibitors of catal ⁇ tic activit ⁇ of a CVSP1 4 can be assessed in an amidol ⁇ tic assa ⁇ .
- the inhibitor-induced inhibition of amidol ⁇ tic activit ⁇ b ⁇ a recombinant CVSP or the protease domain portions thereof, can be measured b ⁇ IC50 values in such an assa ⁇ .
- the protease domain of CVSP14 expressed as described above is assa ⁇ ed in Costar 96 well tissue culture plates (Corning NY) for inhibition b ⁇ various test compounds as follows . Approximatel ⁇ 1 -10 nM protease is added without inhibitor, or with 100000 nM inhibitor and seven 1 :6 dilutions into 1 X direct buffer (29.2 mM Tris, pH 8.4, 29.2 mM Imidazole, 21 7 mM NaCl ( 100 ⁇ L final volume)), and allowed to incubate at room temperature for 30 minutes.
- 1 X direct buffer 29.2 mM Tris, pH 8.4, 29.2 mM Imidazole, 21 7 mM NaCl ( 100 ⁇ L final volume
- Particular substrates for use in the assa ⁇ s can be identified empiricall ⁇ b ⁇ testing substrates.
- the following list of substrates are exemplar ⁇ of those that can be tested.
- pNA para-nitranilide (chromogenic)
- AMC amino meth ⁇ l coumarin (fluorescent)
- a coupled assa ⁇ can be used. Briefl ⁇ , test the abilit ⁇ of the protease to activate and enz ⁇ me, such as plasminogen and tr ⁇ psinogen. To perform these assa ⁇ s, the single chain protease is incubated with a z ⁇ mogen, such as plasminogen or tr ⁇ psinogen, in the presence of the a known substrate, such, I ⁇ s-plasminogen, for the z ⁇ mogen. If the single chain activates the z ⁇ mogen, the activated enz ⁇ me, such as plasmin and tr ⁇ psin, will degrade the substrate therefor.
- a z ⁇ mogen such as plasminogen or tr ⁇ psinogen
- test compounds to act as inhibitors of rMAP catal ⁇ tic activit ⁇ was assessed b ⁇ determining the inhibitor-induced inhibition of amidol ⁇ tic activit ⁇ b ⁇ the MAP, as measured b ⁇ IC 50 values.
- the assa ⁇ buffer was HBSA (10 mM Hepes, 1 50mM sodium chloride, pH 7.4, 0.1 % bovine serum albumin). All reagents were from Sigma Chemical Co. (St. Louis, MO), unless otherwise indicated.
- Two IC 50 assa ⁇ s (a) one at either 30-minutes or 60-minutes (a 30-minute or a 60-minute preincubation of test compound and enz ⁇ me) and (b) one at 0-minutes (no preincubation of test compound and enz ⁇ me) were conducted.
- IC 50 assa ⁇ at either 30-minutes or 60-minutes, the following reagents were combined in appropriate wells of a Corning microtiter plate: 50 microliters of HBSA, 50 microliters of the test compound, diluted (covering a broad concentration range) in HBSA (or HBSA alone for uninhibited velocit ⁇ measurement), and 50 microliters of the rMAP (Corvas International) diluted in buffer, ⁇ ielding a final enz ⁇ me concentration of 250 pM as determined b ⁇ active site filtration.
- the assa ⁇ was initiated b ⁇ the addition of 50 microliters of the substrate S-2765 (N- ⁇ -Benz ⁇ lox ⁇ carbon ⁇ l-D-argin ⁇ l-L-gl ⁇ c ⁇ l-L-arginine-p- nitroaniline dih ⁇ drochloride; DiaPharma Group, Inc.; Franklin, OH) to each well, ⁇ ielding a final assa ⁇ volume of 200 microliters and a final substrate concentration of 100 ⁇ M (about 4-times K m ). Before addition to the assay mixture, S-2765 was reconstituted in deionized water and diluted in HBSA.
- IC 50 assay For the IC 50 assay at 0 minutes; the same reagents were combined: 50 microliters of HBSA, 50 microliters of the test compound, diluted (covering the identical concentration range) in HBSA (or HBSA alone for uninhibited velocit ⁇ measurement), and 50 microliters of the substrate S-2765.
- the assa ⁇ was initiated b ⁇ the addition of 50 microliters of rMAP.
- the final concentrations of all components were identical in both IC 50 assa ⁇ s (at 30- or 60- and 0-minute) .
- the initial velocit ⁇ of chromogenic substrate h ⁇ drol ⁇ sis was measured in both assa ⁇ s b ⁇ the change of absorbance at 405 nM using a Thermo Max ® Kinetic Microplate Reader (Molecular Devices) over a 5 minute period, in which less than 5 % of the added substrate was used.
- the concentration of added inhibitor, which caused a 50% decrease in the initial rate of h ⁇ drol ⁇ sis was defined as the respective IC 50 value in each of the two assa ⁇ s (30- or 60-minutes and 0-minute).
- the buffer used for all assa ⁇ s was HBSA ( 1 0 mM HEPES, pH 7.5, 1 50 mM sodium chloride, 0.1 % bovine serum albumin) .
- the assa ⁇ for IC 50 determinations was conducted b ⁇ combining in appropriate wells of a Corning microtiter plate, 50 microliters of HBSA, 50 microliters of the test compound at a specified concentration (covering a broad concentration range) diluted in HBSA (or HBSA alone for V 0 (uninhibited velocit ⁇ ) measurement), and 50 microliters of the enz ⁇ me diluted in HBSA. Following a 30 minute incubation at ambient temperature, 50 microliters of the substrate at the concentrations specified below were added to the wells, ⁇ ielding a final total volume of 200 microliters. The initial velocit ⁇ of chromogenic substrate h ⁇ drol ⁇ sis was measured b ⁇ the change in absorbance at 405 nm using a
- Thermo Max ® Kinetic Microplate Reader over a 5 minute period in which less than 5 % of the added substrate was used.
- the concentration of added inhibitor which caused a 50% decrease in the initial rate of h ⁇ drol ⁇ sis was defined as the IC 50 value.
- Enzyme activit ⁇ was determined using the chromogenic substrate, Pefachrome t-PA (CH 3 S0 2 -D-hexah ⁇ drot ⁇ rosine-gl ⁇ c ⁇ l-L-Arginine-p-nitroaniline, obtained from Pentapharm Ltd.). The substrate was reconstituted in deionized water prior to use. Purified human ⁇ -thrombin was obtained from Enz ⁇ me Research Laboratories, Inc. The buffer used for all assa ⁇ s was HBSA ( 10 mM HEPES, pH 7.5, 1 50 mM sodium chloride, 0.1 % bovine serum albumin).
- IC 50 determinations were conducted where HBSA (50 ⁇ L), ⁇ -thrombin (50 ⁇ l) (the final enz ⁇ me concentration is 0.5 nM) and inhibitor (50 ⁇ l) (covering a broad concentration range), were combined in appropriate wells and incubated for 30 minutes at room temperature prior to the addition of substrate Pefachrome-t-PA (50 ⁇ l) (the final substrate concentration is 250 ⁇ M, about 5 times Km).
- the initial velocit ⁇ of Pefachrome t-PA h ⁇ drol ⁇ sis was measured b ⁇ the change in absorbance at 405 nm using a Thermo Max ® Kinetic Microplate Reader over a 5 minute period in which less than 5 % of the added substrate was used.
- the concentration of added inhibitor which caused a 50% decrease in the initial rate of h ⁇ drol ⁇ sis was defined as the IC 50 value.
- Factor Xa catal ⁇ tic activit ⁇ was determined using the chromogenic substrate S-2765 (N-benz ⁇ lox ⁇ carbon ⁇ l-D-arginine-L-gl ⁇ cine-L-arginine-p-nitro- aniline), obtained from DiaPharma Group (Franklin, OH). All substrates were reconstituted in deionized water prior to use. The final concentration of S-2765 was 250 ⁇ M (about 5-times Km). Purified human Factor X was obtained from Enz ⁇ me Research Laboratories, Inc. (South Bend, IN) and Factor Xa (FXa) was activated and prepared from it as described [Bock, P.E., Craig, P. A., Olson, S ., and Singh, P.
- rt-PA tissue plasminogen activator
- Assa ⁇ rt-PA catal ⁇ tic activit ⁇ was determined using the substrate, Pefachrome t-PA (CH 3 SQ 2 -D-hexah ⁇ drot ⁇ rosine-gl ⁇ c ⁇ l-L-arginine-p-nitroaniline, obtained from Pentapharm Ltd.).
- the substrate was made up in deionized water followed b ⁇ dilution in HBSA prior to the assa ⁇ in which the final concentration was 500 micromolar (about 3-times Km).
- Human rt-PA (Activase ® ) was obtained from Genentech Inc.
- the enz ⁇ me was reconstituted in deionized water and diluted into HBSA prior to the assa ⁇ in which the final concentration was 1 .0 nM.
- Plasmin catal ⁇ tic activit ⁇ was determined using the chromogenic substrate, S-2366 (L-p ⁇ roglutam ⁇ l-L-prol ⁇ l-L-arginine-p-nitroaniline h ⁇ drochloride), which was obtained from DiaPharma group.
- the substrate was made up in deionized water followed b ⁇ dilution in HBSA prior to the assa ⁇ in which the final concentration was 300 micromolar (about 2.5-times Km).
- Purified human plasmin was obtained from Enz ⁇ me Research Laboratories, Inc. The enz ⁇ me was diluted into HBSA prior to assa ⁇ in which the final concentration was 1 .0 nM.
- Activated Protein C (aPC) Assay aPC catal ⁇ tic activit ⁇ was determined using the chromogenic substrate, Pefachrome PC (delta-carbobenzlox ⁇ -D-l ⁇ sine-L-prol ⁇ l-L-arginine-p-nitroaniline dih ⁇ drochloride), obtained from Pentapharm Ltd.). The substrate was made up in deionized water followed b ⁇ dilution in HBSA prior to the assa ⁇ in which the final concentration was 400 micromolar (about 3-times Km). Purified human aPC was obtained from Hematologic Technologies, Inc. The enz ⁇ me was diluted into HBSA prior to assa ⁇ in which the final concentration was 1 .0 nM.
- Ch ⁇ motr ⁇ psin catal ⁇ tic activit ⁇ was determined using the chromogenic substrate, S-2586 (methox ⁇ -succin ⁇ l-L-arginine-L-prol ⁇ l-L-t ⁇ ros ⁇ l-p-nitroanilide), which was obtained from DiaPharma Group.
- the substrate was made up in deionized water followed b ⁇ dilution in HBSA prior to the assa ⁇ in which the final concentration was 100 micromolar (about 9-times Km).
- Purified (3X-cr ⁇ stallized; CDI) bovine pancreatic alpha-ch ⁇ motr ⁇ psin was obtained from Worthington Biochemical Corp.
- the enz ⁇ me was reconstituted in deionized water and diluted into HBSA prior to assa ⁇ in which the final concentration was 0.5 nM. Trypsin Assay
- Trypsin catal ⁇ tic activit ⁇ was determined using the chromogenic substrate, S-2222 (benzo ⁇ l-L-isoleucine-L-glutamic acid-[gamma-meth ⁇ l ester]-L- arginine-p-nitroanilide), which was obtained from DiaPharma Group.
- the substrate was made up in deionized water followed b ⁇ dilution in HBSA prior to the assa ⁇ in which the final concentration was 250 micromolar (about 4-times Km).
- Purified (3X-cr ⁇ stallized; TRL3) bovine pancreatic tr ⁇ psin was obtained from Worthington Biochemical Corp.
- the enz ⁇ me was reconstituted in deionized water and diluted into HBSA prior to assa ⁇ in which the final concentration was 0.5 nM.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2002575305A JP2004535166A (ja) | 2001-03-22 | 2002-03-20 | セリンプロテアーゼcvsp14をコードする核酸分子、コードされるポリペプチドおよびそれに基づく方法 |
| CA002441378A CA2441378A1 (en) | 2001-03-22 | 2002-03-20 | Nucleic acid molecules encoding serine protease cvsp14, the encoded polypeptides and methods based thereon |
| EP02723586A EP1383884A4 (en) | 2001-03-22 | 2002-03-20 | SERINE PROTEASE CVSP14 CODING NUCLEIC ACID MOLECULES, THE CODED POLYPEPTIDES AND METHODS THEREOF |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US27816601P | 2001-03-22 | 2001-03-22 | |
| US60/278,166 | 2001-03-22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2002077263A2 true WO2002077263A2 (en) | 2002-10-03 |
| WO2002077263A3 WO2002077263A3 (en) | 2003-09-25 |
Family
ID=23063936
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/009039 Ceased WO2002077263A2 (en) | 2001-03-22 | 2002-03-20 | Nucleic acid molecules encoding serine protease cvsp14, the encoded polypeptides and methods based thereon |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US7172892B2 (https=) |
| EP (1) | EP1383884A4 (https=) |
| JP (1) | JP2004535166A (https=) |
| KR (1) | KR20040011480A (https=) |
| AU (1) | AU2002254357A1 (https=) |
| CA (1) | CA2441378A1 (https=) |
| WO (1) | WO2002077263A2 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7112430B2 (en) | 2001-05-14 | 2006-09-26 | Dendreon Corporation | Nucleic acid molecules encoding a transmembrane serine protease 10, the encoded polypeptides and methods based thereon |
| US9795655B2 (en) | 2005-10-21 | 2017-10-24 | Catalyst Biosciences, Inc. | Modified MT-SP1 proteases that inhibit complement activation |
| US10160961B2 (en) | 2008-04-11 | 2018-12-25 | Catalyst Biosciences, Inc. | Factor VII polypeptides that are modified and uses thereof |
| CN114107352A (zh) * | 2012-04-17 | 2022-03-01 | 弗·哈夫曼-拉罗切有限公司 | 使用修饰的核酸表达多肽的方法 |
| US11266724B2 (en) | 2019-08-15 | 2022-03-08 | Catalyst Biosciences, Inc. | Modified factor VII polypeptides for subcutaneous administration and on-demand treatment |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003514524A (ja) | 1999-11-18 | 2003-04-22 | コルバス・インターナショナル・インコーポレイテッド | エントセリアーゼをコードしている核酸、エンドセリアーゼおよびその使用 |
| US7700341B2 (en) * | 2000-02-03 | 2010-04-20 | Dendreon Corporation | Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon |
| CZ303658B6 (cs) * | 2001-02-01 | 2013-02-06 | F. Hoffmann-La Roche Ag | Zpusob rekombinantní produkce trypsinu |
| WO2002072786A2 (en) | 2001-03-13 | 2002-09-19 | Corvas International, Inc. | Nucleic acid molecules encoding a transmembrane serine protease 7, the encoded polypeptides and methods based thereon |
| US7172892B2 (en) | 2001-03-22 | 2007-02-06 | Dendreon Corporation | Nucleic acid molecules encoding serine protease CVSP14, the encoded polypeptides and methods based thereon |
| CA2442089A1 (en) | 2001-03-27 | 2002-10-03 | Dendreon San Diego Llc | Nucleic acid molecules encoding a transmembran serine protease 9, the encoded polypeptides and methods based thereon |
| US20040001801A1 (en) * | 2002-05-23 | 2004-01-01 | Corvas International, Inc. | Conjugates activated by cell surface proteases and therapeutic uses thereof |
| EP1851543A2 (en) | 2005-02-24 | 2007-11-07 | Compugen Ltd. | Novel diagnostic markers, especially for in vivo imaging, and assays and methods of use thereof |
| KR101778174B1 (ko) | 2006-07-05 | 2017-09-13 | 카탈리스트 바이오사이언시즈, 인코포레이티드 | 프로테아제 스크리닝 방법 및 이에 의해 확인된 프로테아제 |
| JP5864856B2 (ja) * | 2007-08-07 | 2016-02-17 | オックスフォード ビオトヘラペウトイクス エルティーディー. | マトリプターゼタンパク質及びその使用 |
| EP3074423A1 (en) | 2013-11-25 | 2016-10-05 | Oxford BioTherapeutics Ltd | Antibodies anti matriptase for the treatment of cancer |
| US12428445B2 (en) * | 2018-11-08 | 2025-09-30 | Adarsha Koirala | Mini-nucleosome core proteins and use in nucleic acid delivery |
| IL297250A (en) | 2020-04-13 | 2022-12-01 | Summation Bio Inc | Modified mini-nucleosome core proteins and use in nucleic acid delivery |
Family Cites Families (155)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US170630A (en) * | 1875-11-30 | Improvement in spinning-wheels | ||
| US143219A (en) * | 1873-09-30 | Improvement in separators for coal, ores | ||
| US186329A (en) * | 1877-01-16 | Improvement in buckles | ||
| US50251A (en) * | 1865-10-03 | Improved apparatus for carbureting air | ||
| US19006A (en) * | 1857-12-29 | Paint compound | ||
| US134794A (en) * | 1873-01-14 | Improvement in leather punches and cutters | ||
| US64856A (en) * | 1867-05-21 | Daniel fobes | ||
| US166851A (en) * | 1875-08-17 | Improvement in coal-hods | ||
| US134298A (en) * | 1872-12-24 | Improvement in raiiway | ||
| US119168A (en) * | 1871-09-19 | Improvement in fur-boxes | ||
| US77697A (en) * | 1868-05-05 | Tokwald wiittbe | ||
| US235900A (en) * | 1880-12-28 | Buo kel | ||
| US1801A (en) * | 1840-10-08 | Construction of self-acting mules fob | ||
| US3536809A (en) | 1969-02-17 | 1970-10-27 | Alza Corp | Medication method |
| US3598123A (en) | 1969-04-01 | 1971-08-10 | Alza Corp | Bandage for administering drugs |
| US3630200A (en) | 1969-06-09 | 1971-12-28 | Alza Corp | Ocular insert |
| DE2031216A1 (de) | 1969-06-19 | 1971-01-14 | Citizen Watch Co Ltd , Tokio | Tag und Datum Stellvorrichtung fur Uhren mit Kalender |
| US3940475A (en) | 1970-06-11 | 1976-02-24 | Biological Developments, Inc. | Radioimmune method of assaying quantitatively for a hapten |
| US3845770A (en) | 1972-06-05 | 1974-11-05 | Alza Corp | Osmatic dispensing device for releasing beneficial agent |
| US4006117A (en) | 1973-01-24 | 1977-02-01 | Hooker Chemicals & Plastics Corporation | Amine phosphite antioxidants |
| US3843443A (en) | 1973-03-30 | 1974-10-22 | J Fishman | Polypeptide materials bound to fluorocarbon polymers |
| US3916899A (en) | 1973-04-25 | 1975-11-04 | Alza Corp | Osmotic dispensing device with maximum and minimum sizes for the passageway |
| US4179337A (en) | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
| US4008719A (en) | 1976-02-02 | 1977-02-22 | Alza Corporation | Osmotic system having laminar arrangement for programming delivery of active agent |
| US4244721A (en) | 1979-01-31 | 1981-01-13 | Pedro Buarque De Macedo | Method of making composite borosilicate glass articles |
| JPS6023084B2 (ja) | 1979-07-11 | 1985-06-05 | 味の素株式会社 | 代用血液 |
| US4640835A (en) | 1981-10-30 | 1987-02-03 | Nippon Chemiphar Company, Ltd. | Plasminogen activator derivatives |
| US4507230A (en) | 1982-05-12 | 1985-03-26 | Research Corporation | Peptide synthesis reagents and method of use |
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US4496689A (en) | 1983-12-27 | 1985-01-29 | Miles Laboratories, Inc. | Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer |
| US4952496A (en) | 1984-03-30 | 1990-08-28 | Associated Universities, Inc. | Cloning and expression of the gene for bacteriophage T7 RNA polymerase |
| US4769027A (en) | 1984-08-15 | 1988-09-06 | Burroughs Wellcome Co. | Delivery system |
| US4778767A (en) | 1984-12-17 | 1988-10-18 | Akzo N.V. | Solid phase immunoassay using immunoreagents immobilized on inert synthetic resin surfaces |
| DE3500180A1 (de) | 1985-01-04 | 1986-07-10 | Ernst Prof. Dr. 7400 Tübingen Bayer | Pfropfcopolymerisate aus vernetzten polymeren und polyoxyethylen, verfahren zu ihrer herstellung und ihre verwendung |
| JPH0645649B2 (ja) | 1985-04-09 | 1994-06-15 | 日東紡績株式会社 | 新規なイソニトリル基含有重合体の製造方法 |
| US4980286A (en) | 1985-07-05 | 1990-12-25 | Whitehead Institute For Biomedical Research | In vivo introduction and expression of foreign genetic material in epithelial cells |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US4687610A (en) | 1986-04-30 | 1987-08-18 | E. I. Du Pont De Neumours And Company | Low crystallinity polyester yarn produced at ultra high spinning speeds |
| US4791192A (en) | 1986-06-26 | 1988-12-13 | Takeda Chemical Industries, Ltd. | Chemically modified protein with polyethyleneglycol |
| US4902505A (en) | 1986-07-30 | 1990-02-20 | Alkermes | Chimeric peptides for neuropeptide delivery through the blood-brain barrier |
| DE3626468A1 (de) | 1986-08-05 | 1988-02-11 | Hoechst Ag | Verfahren und testkit zur bestimmung freier wirkstoffe in biologischen fluessigkeiten |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5071773A (en) | 1986-10-24 | 1991-12-10 | The Salk Institute For Biological Studies | Hormone receptor-related bioassays |
| US5116742A (en) | 1986-12-03 | 1992-05-26 | University Patents, Inc. | RNA ribozyme restriction endoribonucleases and methods |
| US5292814A (en) | 1987-04-29 | 1994-03-08 | Ernst Bayer | Process for the preparation of monodispersed polymer beads |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| AU622426B2 (en) | 1987-12-11 | 1992-04-09 | Abbott Laboratories | Assay using template-dependent nucleic acid probe reorganization |
| US5073543A (en) | 1988-07-21 | 1991-12-17 | G. D. Searle & Co. | Controlled release formulations of trophic factors in ganglioside-lipsome vehicle |
| AU618640B2 (en) | 1988-11-11 | 1992-01-02 | Boehringer Mannheim Gmbh | Process for the expression of a recombinant gene |
| US5866413A (en) | 1989-03-06 | 1999-02-02 | Board Of Regents Of The University Of Texas System | Pai-1 mutants |
| US5304482A (en) | 1989-03-06 | 1994-04-19 | The Board Of Regents Of The University Of Texas System | Serine protease mutants of the chymotrypsin superfamily resistant to inhibition by their cognate inhibitors |
| CA2047702C (en) | 1989-03-06 | 2000-10-24 | Joseph F. Sambrook | Serpin resistant chymotrypsin superfamily proteases particularly pai-1 resistant t-pa, complementary inhibitor mutants; compositions; genes; expression |
| US5550042A (en) | 1989-03-06 | 1996-08-27 | The Board Of Regents Of The University Of Texas System | Serine protease mutants of the chymotrypsin superfamily resistant to inhibition by their cognate inhibitors and genes encoding the same and serine protease inhibitor mutants and genes encoding the same |
| IT1229203B (it) | 1989-03-22 | 1991-07-25 | Bioresearch Spa | Impiego di acido 5 metiltetraidrofolico, di acido 5 formiltetraidrofolico e dei loro sali farmaceuticamente accettabili per la preparazione di composizioni farmaceutiche in forma a rilascio controllato attive nella terapia dei disturbi mentali organici e composizioni farmaceutiche relative. |
| AU5554190A (en) | 1989-05-08 | 1990-11-29 | Mark I. Farber | Process and apparatus for the recovery of precious metals from slag, tailings and other materials |
| US5925525A (en) | 1989-06-07 | 1999-07-20 | Affymetrix, Inc. | Method of identifying nucleotide differences |
| US5547839A (en) | 1989-06-07 | 1996-08-20 | Affymax Technologies N.V. | Sequencing of surface immobilized polymers utilizing microflourescence detection |
| US5120548A (en) | 1989-11-07 | 1992-06-09 | Merck & Co., Inc. | Swelling modulated polymeric drug delivery device |
| US5215899A (en) | 1989-11-09 | 1993-06-01 | Miles Inc. | Nucleic acid amplification employing ligatable hairpin probe and transcription |
| US5861274A (en) | 1990-03-22 | 1999-01-19 | The Salk Institute For Biological Studies | Nucleic acids encoding peroxisome proliferator-activated receptor |
| US6552170B1 (en) | 1990-04-06 | 2003-04-22 | Amgen Inc. | PEGylation reagents and compounds formed therewith |
| US5733566A (en) | 1990-05-15 | 1998-03-31 | Alkermes Controlled Therapeutics Inc. Ii | Controlled release of antiparasitic agents in animals |
| US5256643A (en) | 1990-05-29 | 1993-10-26 | The Government Of The United States | Human cripto protein |
| US5401629A (en) | 1990-08-07 | 1995-03-28 | The Salk Institute Biotechnology/Industrial Associates, Inc. | Assay methods and compositions useful for measuring the transduction of an intracellular signal |
| WO1992006180A1 (en) | 1990-10-01 | 1992-04-16 | University Of Connecticut | Targeting viruses and cells for selective internalization by cells |
| EP0620761A1 (en) | 1991-01-04 | 1994-10-26 | Perseptive Biosystems, Inc. | Sulfonamide bonded hydrophilic coatings |
| ES2154637T3 (es) | 1991-05-14 | 2001-04-16 | Univ Connecticut | Aportacion de genes dirigidos que codifican proteinas inmunogenicas. |
| ES2149774T3 (es) | 1991-06-05 | 2000-11-16 | Univ Connecticut | Aportacion dirigida de genes que codifican proteinas secretoras. |
| WO1993006215A1 (en) | 1991-09-17 | 1993-04-01 | The Salk Institute For Biological Studies | Receptor of the thyroid/steroid hormone receptor superfamily |
| US5270170A (en) | 1991-10-16 | 1993-12-14 | Affymax Technologies N.V. | Peptide library and screening method |
| US5580578A (en) | 1992-01-27 | 1996-12-03 | Euro-Celtique, S.A. | Controlled release formulations coated with aqueous dispersions of acrylic polymers |
| AU3434393A (en) | 1992-01-17 | 1993-08-03 | Regents Of The University Of Michigan, The | Targeted virus |
| US5643578A (en) | 1992-03-23 | 1997-07-01 | University Of Massachusetts Medical Center | Immunization by inoculation of DNA transcription unit |
| JPH07505773A (ja) | 1992-04-03 | 1995-06-29 | ヤング アレキサンダー ティー | 標的化されたウイルスベクターを用いた遺伝子治療 |
| ES2181691T5 (es) | 1992-06-11 | 2007-10-01 | Alkermes Controlled Therapeutics, Inc. | Sistema de distribucion de proteina eritropoyetina. |
| WO1994005807A1 (en) | 1992-08-28 | 1994-03-17 | Dickson Robert B | Matrix-degrading metalloproteinase |
| KR950703640A (ko) | 1992-10-09 | 1995-09-20 | 가일 케이,나우톤. | 간 보존 세포(liver reserve cells) |
| US5591767A (en) | 1993-01-25 | 1997-01-07 | Pharmetrix Corporation | Liquid reservoir transdermal patch for the administration of ketorolac |
| US5354934A (en) | 1993-02-04 | 1994-10-11 | Amgen Inc. | Pulmonary administration of erythropoietin |
| US5354566A (en) | 1993-06-02 | 1994-10-11 | Kraft General Foods, Inc. | Preparation of yeast-leavened dough crusts |
| ATE424927T1 (de) | 1993-10-28 | 2009-03-15 | Houston Advanced Res Ct | Mikrofabriziertes poröses durchflussgerät zur diskreten bestimmung von bindungsreaktionen |
| IL112759A0 (en) | 1994-02-25 | 1995-05-26 | Khepri Pharmaceuticals Inc | Novel cysteine protease inhibitors |
| US5612474A (en) | 1994-06-30 | 1997-03-18 | Eli Lilly And Company | Acid labile immunoconjugate intermediates |
| IT1270594B (it) | 1994-07-07 | 1997-05-07 | Recordati Chem Pharm | Composizione farmaceutica a rilascio controllato di moguisteina in sospensione liquida |
| ES2125530T3 (es) | 1994-07-29 | 1999-03-01 | Teijin Ltd | Secuencia de acidos nucleicos que codifica una enzima semejante a tripsina y procedimiento para producir la enzima. |
| US5589154A (en) | 1994-11-22 | 1996-12-31 | Rutgers, The State University Of New Jersey | Methods for the prevention or treatment of vascular hemorrhaging and Alzheimer's disease |
| AU713492B2 (en) | 1995-03-24 | 1999-12-02 | Axys Pharmaceuticals, Inc. | Reversible protease inhibitors |
| US5767174A (en) | 1995-05-25 | 1998-06-16 | Asahi Glass Company, Ltd. | Vinyl chloride resin composition |
| US5869451A (en) | 1995-06-07 | 1999-02-09 | Glaxo Group Limited | Peptides and compounds that bind to a receptor |
| US5795872A (en) | 1995-09-19 | 1998-08-18 | Pharmadigm, Inc. | DNA construct for immunization |
| EP0910564B1 (en) | 1995-11-28 | 2007-10-31 | Cephalon, Inc. | D-amino acid derived inhibitors of cysteine and serine proteases |
| AU1821397A (en) | 1995-12-21 | 1997-11-07 | Scripps Research Institute, The | Targeted therapeutic or diagnostic agents and methods of making and using same |
| ATE279203T1 (de) | 1996-06-10 | 2004-10-15 | Scripps Research Inst | Verwendung von substrat-subtraktionsbibliotheken zur unterscheidung von enzymspezifitäten |
| WO2000053756A2 (en) | 1999-03-08 | 2000-09-14 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CN1244894A (zh) | 1996-11-12 | 2000-02-16 | 斯克里普斯研究所 | 组织型纤溶酶原活化剂(t-PA)变体:组合物及使用方法 |
| WO1998032619A1 (fr) | 1997-01-27 | 1998-07-30 | Alain Bonnet | Dispositif d'attelage d'un vehicule a bras porteur de charge sur un vehicule routier, et vehicule a bras destine a cette application |
| WO2000078961A1 (en) | 1999-06-23 | 2000-12-28 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US6150378A (en) | 1997-10-07 | 2000-11-21 | Cephalon, Inc. | Peptidyl-containing α-ketoamide cysteine and serine protease inhibitors |
| US6203979B1 (en) | 1998-01-16 | 2001-03-20 | Incyte Pharmaceuticals, Inc. | Human protease molecules |
| US6323332B1 (en) | 1998-01-21 | 2001-11-27 | The Burnham Institute | Sulfotransferase for HNK-1 glycan |
| US5972616A (en) | 1998-02-20 | 1999-10-26 | The Board Of Trustees Of The University Of Arkansas | TADG-15: an extracellular serine protease overexpressed in breast and ovarian carcinomas |
| JP3868740B2 (ja) | 1998-03-10 | 2007-01-17 | ジェネンテック・インコーポレーテッド | 新規なポリペプチド及びそれをコードする核酸 |
| US6337072B1 (en) | 1998-04-03 | 2002-01-08 | Hyseq, Inc. | Interleukin-1 receptor antagonist and recombinant production thereof |
| NZ531664A (en) | 1998-09-01 | 2005-07-29 | Genentech Inc | Pro1317 polypeptides and sequences thereof with homology to the semaphorin B glycoprotein family |
| WO2000046406A2 (en) * | 1999-02-05 | 2000-08-10 | Alphagene, Inc. | Arrays for investigating protein protein interactions |
| CA2296792A1 (en) | 1999-02-26 | 2000-08-26 | Genset S.A. | Expressed sequence tags and encoded human proteins |
| WO2000050061A1 (en) | 1999-02-26 | 2000-08-31 | The Ohio State University Research Foundation | Detecting the expression of the desc1 gene in squamous cell carcinoma |
| US6291663B1 (en) | 1999-03-03 | 2001-09-18 | Board Of Trustees Of The University Of Arkansas | TADG-12: a novel transmembrane serine protease overexpressed in a ovarian carcinoma |
| HK1039110A1 (zh) | 1999-03-15 | 2002-04-12 | Axys Pharmaceuticals, Inc. | 以新颖的合成物及组分作为蛋白酶抑制剂 |
| US20030186329A1 (en) | 1999-03-22 | 2003-10-02 | The Scripps Research Institute | Use of substrate subtraction libraries to distinguish enzyme specificities |
| AU4700300A (en) | 1999-05-07 | 2000-11-21 | Human Genome Sciences, Inc. | Serine proteases |
| US20030175938A1 (en) | 1999-05-07 | 2003-09-18 | Human Genome Sciences, Inc. | Serine protease polynucleotides, polypeptides, and antibodies |
| CA2378796A1 (en) | 1999-07-12 | 2001-01-18 | Merck Patent Gesellschaft Mit Beschraenkter Haftung | Seripancrin |
| US20020165376A1 (en) * | 1999-12-22 | 2002-11-07 | Walke D. Wade | Novel human proteases and polynucleotides encoding the same |
| US6268737B1 (en) * | 1999-10-07 | 2001-07-31 | Detroit Diesel Corporation | Method and system for determining oil quality |
| WO2001027624A2 (en) | 1999-10-08 | 2001-04-19 | Superarray, Inc. | Compositions and methods for detecting protein modification and enzymatic activity |
| CA2386270A1 (en) | 1999-10-15 | 2001-04-26 | University Of Massachusetts | Rna interference pathway genes as tools for targeted genetic interference |
| US20030077697A1 (en) | 1999-11-17 | 2003-04-24 | Gerlach Valerie L. | Novel serine/threonine protein-kinase like proteins and nucleic acids encoding the same |
| JP2003533174A (ja) | 1999-11-17 | 2003-11-11 | キュラジェン コーポレイション | 新規なポリペプチドおよびこのポリペプチドをコードする核酸 |
| JP2003514524A (ja) | 1999-11-18 | 2003-04-22 | コルバス・インターナショナル・インコーポレイテッド | エントセリアーゼをコードしている核酸、エンドセリアーゼおよびその使用 |
| WO2001036351A2 (en) | 1999-11-19 | 2001-05-25 | Corvas International, Inc. | Plasminogen activator inhibitor antagonists related applications |
| CA2402360A1 (en) | 2000-01-06 | 2001-07-12 | Lexicon Genetics Incorporated | Novel human proteases and polynucleotides encoding the same |
| EP1285084A1 (en) | 2000-01-25 | 2003-02-26 | Hyseq, Inc. | Novel nucleic acids and polypeptides |
| CA2395872A1 (en) | 2000-01-31 | 2001-08-02 | Human Genome Sciences, Inc. | Nucleic acids, proteins, and antibodies |
| CA2395838A1 (en) | 2000-01-31 | 2001-08-02 | Human Genome Sciences, Inc. | Nucleic acids, proteins, and antibodies |
| IL150168A0 (en) | 2000-02-03 | 2002-12-01 | Corvas Int Inc | Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods bsed thereon |
| US6797504B1 (en) | 2000-09-08 | 2004-09-28 | Dendreon San Diego Llc | Inhibitors of serine protease activity of matriptase or MTSP1 |
| US7700341B2 (en) | 2000-02-03 | 2010-04-20 | Dendreon Corporation | Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon |
| AU6802801A (en) | 2000-03-01 | 2001-09-24 | Genentech Inc | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US6436703B1 (en) | 2000-03-31 | 2002-08-20 | Hyseq, Inc. | Nucleic acids and polypeptides |
| CA2411971A1 (en) * | 2000-06-16 | 2001-12-27 | Incyte Genomics, Inc. | Proteases |
| US20020064856A1 (en) * | 2000-06-26 | 2002-05-30 | Gregory Plowman | Novel proteases |
| JP2004504026A (ja) | 2000-07-18 | 2004-02-12 | バイエル アクチェンゲゼルシャフト | ヒトdesc1様セリンプロテアーゼの調節 |
| SK742003A3 (en) | 2000-07-21 | 2003-06-03 | Schering Corp | Novel peptides as NS3-serine protease inhibitors of hepatitis C virus |
| JP2004515220A (ja) | 2000-07-21 | 2004-05-27 | インサイト・ゲノミックス・インコーポレイテッド | プロテアーゼ |
| WO2002008251A2 (en) | 2000-07-21 | 2002-01-31 | Corvas International, Inc. | Peptides as ns3-serine protease inhibitors of hepatitis c virus |
| NZ547626A (en) | 2000-08-11 | 2007-10-26 | Wilex Ag | Non-covalent inhibitors of urokinase and blood vessel formation |
| ATE517910T1 (de) | 2000-08-11 | 2011-08-15 | Wilex Ag | NICHT-KOVALENTE INHIBITOREN VON UROKINASE UND BLUTGEFÄßBILDUNG |
| US7157596B2 (en) | 2000-09-08 | 2007-01-02 | Dendreon Corporation | Inhibitors of serine protease activity of matriptase or MTSP1 |
| US6541234B1 (en) * | 2000-09-11 | 2003-04-01 | University Of Maryland Biotechnology Institute | Calcium free subtilisin mutants |
| US6365391B1 (en) | 2000-09-27 | 2002-04-02 | Pe Corporation (Ny) | Isolated human serine protease, nucleic acid molecules encoding human serine protease, and uses thereof |
| US6541235B1 (en) * | 2000-09-29 | 2003-04-01 | University Of Maryland Biotechnology Institute | Calcium free subtilisin mutants |
| AU2002232558A1 (en) | 2000-12-12 | 2002-06-24 | Corvas International, Inc. | Compounds, compositions and methods for treatment of parasitic infections |
| US20030170630A1 (en) | 2000-12-21 | 2003-09-11 | Alsobrook John P. | Proteins and nucleic acids encoding same |
| WO2002072786A2 (en) | 2001-03-13 | 2002-09-19 | Corvas International, Inc. | Nucleic acid molecules encoding a transmembrane serine protease 7, the encoded polypeptides and methods based thereon |
| US7172892B2 (en) | 2001-03-22 | 2007-02-06 | Dendreon Corporation | Nucleic acid molecules encoding serine protease CVSP14, the encoded polypeptides and methods based thereon |
| CA2442089A1 (en) | 2001-03-27 | 2002-10-03 | Dendreon San Diego Llc | Nucleic acid molecules encoding a transmembran serine protease 9, the encoded polypeptides and methods based thereon |
| JP2005506832A (ja) | 2001-05-14 | 2005-03-10 | デンドレオン・サンディエゴ・リミテッド・ライアビリティ・カンパニー | トランスメンブランセリンプロテアーゼ10をコードする核酸分子、コードされるポリペプチドおよびそれに基づく方法 |
| KR20040004642A (ko) | 2001-05-23 | 2004-01-13 | 덴드레온 샌 디에고 엘엘씨 | 세포 표면 프로테아제에 의해 활성화되는 접합체 및 이의치료학적 용도 |
| US20030134298A1 (en) | 2001-07-03 | 2003-07-17 | Madison Edwin L. | Nucleic acid molecules encoding a transmembrane serine protease 20, the encoded polypeptides and methods based thereon |
| AU2002347858A1 (en) | 2001-10-09 | 2003-04-22 | Dendreon Corporation | Transmembrane serine protease 25 |
| AU2002357004A1 (en) | 2001-11-20 | 2003-06-10 | Dendreon San Diego Llc | Nucleic acid molecules encoding serine protease 17, the encoded polypeptides and methods based thereon |
| WO2003104391A2 (en) | 2001-11-29 | 2003-12-18 | Wyeth Holdings Corporation | Antibacterial targets in alloiococcus otitidis |
| US20040001801A1 (en) | 2002-05-23 | 2004-01-01 | Corvas International, Inc. | Conjugates activated by cell surface proteases and therapeutic uses thereof |
| US20050112579A1 (en) | 2002-07-02 | 2005-05-26 | Dendreon San Diego Llc, A Delaware Corporation | Nucleic acid molecules encoding serine protease 16, the encoded polypeptides and methods based thereon |
-
2002
- 2002-03-20 US US10/104,271 patent/US7172892B2/en not_active Expired - Fee Related
- 2002-03-20 EP EP02723586A patent/EP1383884A4/en not_active Withdrawn
- 2002-03-20 JP JP2002575305A patent/JP2004535166A/ja active Pending
- 2002-03-20 AU AU2002254357A patent/AU2002254357A1/en not_active Abandoned
- 2002-03-20 WO PCT/US2002/009039 patent/WO2002077263A2/en not_active Ceased
- 2002-03-20 CA CA002441378A patent/CA2441378A1/en not_active Abandoned
- 2002-03-20 KR KR20037012261A patent/KR20040011480A/ko not_active Withdrawn
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7112430B2 (en) | 2001-05-14 | 2006-09-26 | Dendreon Corporation | Nucleic acid molecules encoding a transmembrane serine protease 10, the encoded polypeptides and methods based thereon |
| US9795655B2 (en) | 2005-10-21 | 2017-10-24 | Catalyst Biosciences, Inc. | Modified MT-SP1 proteases that inhibit complement activation |
| US10160961B2 (en) | 2008-04-11 | 2018-12-25 | Catalyst Biosciences, Inc. | Factor VII polypeptides that are modified and uses thereof |
| US11203749B2 (en) | 2008-04-11 | 2021-12-21 | Catalyst Biosciences, Inc. | Factor VII polypeptides that are modified and uses thereof |
| CN114107352A (zh) * | 2012-04-17 | 2022-03-01 | 弗·哈夫曼-拉罗切有限公司 | 使用修饰的核酸表达多肽的方法 |
| US12577293B2 (en) | 2012-04-17 | 2026-03-17 | Hoffmann-La Roche Inc. | Method for the expression of polypeptides using modified nucleic acids |
| US11266724B2 (en) | 2019-08-15 | 2022-03-08 | Catalyst Biosciences, Inc. | Modified factor VII polypeptides for subcutaneous administration and on-demand treatment |
Also Published As
| Publication number | Publication date |
|---|---|
| US7172892B2 (en) | 2007-02-06 |
| KR20040011480A (ko) | 2004-02-05 |
| JP2004535166A (ja) | 2004-11-25 |
| EP1383884A2 (en) | 2004-01-28 |
| WO2002077263A3 (en) | 2003-09-25 |
| EP1383884A4 (en) | 2004-12-15 |
| US20030181658A1 (en) | 2003-09-25 |
| CA2441378A1 (en) | 2002-10-03 |
| AU2002254357A1 (en) | 2002-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7700341B2 (en) | Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon | |
| EP1252300B1 (en) | Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon | |
| US7172892B2 (en) | Nucleic acid molecules encoding serine protease CVSP14, the encoded polypeptides and methods based thereon | |
| US7105333B2 (en) | Nucleic acid molecules encoding a transmembrane serine protease 9, the encoded polypeptides and methods based thereon | |
| US7112430B2 (en) | Nucleic acid molecules encoding a transmembrane serine protease 10, the encoded polypeptides and methods based thereon | |
| WO2003004681A2 (en) | Nucleic acid molecules encoding a transmembrane serine protease 20, the encoded polypeptides and methods based thereon | |
| US7125703B2 (en) | Nucleic acid molecules encoding a transmembrane serine protease 7, the encoded polypeptides and methods based thereon | |
| US20030143219A1 (en) | Nucleic acid molecules encoding a transmembrane serine protease 25, the encoded polypeptides and methods based thereon | |
| US20050112579A1 (en) | Nucleic acid molecules encoding serine protease 16, the encoded polypeptides and methods based thereon | |
| US7276364B1 (en) | Nucleic acids encoding endotheliases, endotheliases and uses thereof | |
| WO2003044179A2 (en) | Nucleic acid molecules encoding serine protease 17, the encoded polypeptides and methods based thereon | |
| WO2003104394A2 (en) | Nucleic acid molecules encoding a transmembrane serine protease 12, the encoded polypeptides and methods based thereon | |
| AU2002252531A1 (en) | Nucleic acid molecules encoding a transmembran serine protease 9, the encoded polypeptides and methods based thereon | |
| AU2002305595A1 (en) | Nucleic acid molecules encoding a transmembrane serine protease 10, the encoded polypeptides and methods based thereon | |
| NZ529387A (en) | An endotheliase 1 protease or protease domain thereof, nucleic acids encoding therefor, uses thereof and recombinant non-human animals comprising the protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 527970 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002254357 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2441378 Country of ref document: CA Ref document number: 1020037012261 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002575305 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002723586 Country of ref document: EP |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWP | Wipo information: published in national office |
Ref document number: 2002723586 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |