AU735519B2 - Tissue type plasminogen activator (t-PA) variants: compositions and methods of use - Google Patents

Description

WO 98/21320 PCTIUS97/20226 -1- TISSUE TYPE PLASMINOGEN ACTIVATOR (t-PA) VARIANTS: COMPOSITIONS AND METHODS OF USE Reference to Related Application This application claims the benefit of U.S. Provisional Application S.N. 60/030,655, filed November 12, 1996, which is incorporated by reference.

Governmental Rights This invention was made with governmental support from the United States Government, National Institutes of Health, Grants HL52475 and HL31950; the United States Government has certain rights in the invention.

The invention comprises protein single chain variants of tissue type plasminogen activator, also referred to as t-PA as well as nucleic acids encoding such protein single chain variants of tissue type plasminogen activator. The t-PA protein variants have higher zymogenicity than the wild-type single chain t-PA form. Methods of making and using the t- PA variant compositions are also described.

Background Tissue-type plasminogen activator (t-PA) is a serine protease that plays a critical role in the process of fibrinolysis, the dissolution of clots, by activating plasminogen to the protease plasmin. t-PA has been fully identified and characterized by underlying DNA sequence and deduced amino acid sequence. See Pennica et al., Nature, 301: 214 (1983) and U.S. Pat. No.

4,853,330, issued Aug. 1, 1989, the teachings of both of which are incorporated by reference.

The nucleotide sequence and deduced primary amino acid sequence of human t-PA is depicted in Fig. 1A, Fig. 1B and Fig. 1C.

The group of amino acid residues from -35 to -1 preceding the sequence of the mature t-PA is the "pro" sequence. The mature t-PA molecule (amino acid residues 1-527) contains five domains that have been defined with reference to homologous or otherwise similar structures identified in various other proteins such as trypsin, chymotrypsin, plasminogen, prothrombin, fibronectin, and epidermal growth factor (EGF). These domains have been WO 98/21320 PCTfUS97/20226 -2designated, starting at the N-terminus of the amino acid sequence of mature t-PA, as 1) the finger region that has variously been defined as including amino acid residues 1 to about 44, 2) the growth factor region that has been variously defined as stretching from about amino acid residues 45 to 91 (based upon its homology with EGF), 3) kringle one (K1) that has been defined as stretching from about amino acid residue 92 to about amino acid residue 173, 4) kringle two (K2) that has been defined as stretching from about amino acid residue 180 to about amino acid residue 261, and 5) the so-called serine protease domain that generally has been defined as stretching from about amino acid residue 264 to the C-terminal end of the molecule at'amino acid residue 527. These domains, which are situated generally adjacent to one aiother, or are separated by sho-t "linker" regio~si aounrfor the entire amino acid sequence of from 1 to 527 amino acid residues of the mature form of t-PA.

Each domain has been described variously as contributing certain specific biologically significant properties. The finger domain has been characterized as containing a sequence of at least major importance for high binding affinity to fibrin. (This activity is thought important for the high specificity that t-PA displays with respect to clot lysis at the locus of a fibrin-rich thrombus.) The growth factor-like region likewise has been associated with cell surface binding activity. The kringle 2 region also has been strongly associated with fibrin binding and with the ability of fibrin to stimulate the activity of t-PA. The serine protease domain is responsible for the enzymatic cleavage ofplasminogen to produce plasmin.

t-PA is unusual among proteases in the level of the enzymatic activity of its precursor.

In general, proteases are synthesized as zymogens, inactive precursors that must either be proteolytically processed or bind to a specific co-factor to develop substantial catalytic activity. The increase in catalytic efficiency after zymogen activation, or zymogenicity, is dramatic in almost all cases, although varying widely among individual members of the chymotrypsin family. For example, strong zymogens, those having high zymogenicity, such as trypsinogen, chymotrypsinogen, or plasminogen are almost completely inactive, with measured zymogenicities of 104 to 106 (Robinson, N. Neurath, and Walsh, K. A. (1973) Biochemistry 12, 420-426; Gertler, Walsh, K. and Neurath, H. (1974) Biochemistry 13, 1302-1310). Other serine proteases exhibit intermediate zymogenicity. For example, the enzymatic activity of Factor XIIa is 4000-fold greater than that of its corresponding zymogen, Factor XII (Silverberg, and Kaplan, A. P. (1982) Blood 60, 64), and the catalytic efficiency ofurokinase is 250-fold greater than that ofpro-urokinase (Lijnen, H. Van Hoef, WO 98/21320 PCTI[US97/20226 -3- Nelles, and Collen, D. (1990) J. Biol. Chem. 265, 5232-5236). By contrast, the catalytic activities of single and two chain t-PA vary by a factor of only 5-10.

The zymogenicity, expressed as the ratio of the activity of the mature cleaved two-chain enzyme to that of the single chain precursor form, is only 5-10 for wild-type t-PA, in contrast to other precursors of other proteases that have little or no catalytic activity. Thus, the single chain form of wild-type t-PA is not a true zymogen.

There have been many attempts to improve the usefulness of t-PA by genetic engineering. These efforts have been only partially successful. The state of the art has been reviewed by Krause, Tanswell, P. Arzneim.-Forsch. 39: 632-637 (1989) and in U.S.

patent Nb'.5-61'"674o67the teachings of both of which are-incorporated by reference. Despite the profound advantages associated with natural t-PA as a clot-dissolving agent, it is not believed that the natural protein necessarily represents the optimal t-PA agent under all circumstances. Therefore, several variants have been proposed or devised to enhance specific properties of t-PA. Certain of those variants address disadvantages associated with the use of natural t-PA in situations where an agent with a longer half-life or slower clearance rate would be preferred, in the treatment of deep-vein thrombosis and following reperfusion of an infarct victim, or where a single-chain agent is preferred.

For example, removal of a substantial portion or all of the finger domain results in a molecule with substantially diminished fibrin binding characteristics, albeit in return there is a decrease in the overall rate of clearance of the resultant entity-See WO 89/00197 published Jan. 12, 1989.

Variants are described in EPO Pat. Publ. No. 199,574 that have amino acid substitutions at the proteolytic cleavage sites at positions 275, 276, and 277. These variants, characterized preferentially as t-PA variants having an amino acid other than arginine at position 275, are referred to as protease-resistant one-chain t-PA variants in that, unlike natural t-PA, which can exist in either a one-chain or two-chain form, they are resistant to protease cleavage at position 275 and are therefore not converted metabolically in vivo into a twochain form. This form is thought to have certain advantages biologically and commercially, in that it is more stable while the fibrin binding and fibrin stimulation are increased relative to two-chain t-PA. Furthermore, plasminogen activators are described that comprise one domain capable of interacting with fibrin and the protease domain of urokinase, with one embodiment WO'98/21320 PCT/US97/20226 -4being urokinase altered to make it less susceptible to forming two-chain urokinase. See WO 88/05081 published Jul. 14, 1988.

For further patent literature regarding modification of the protease cleavage site of t- PA, see, for example, EPO Pat.Nos. 241,209; EP 201,153 published Nov. 12, 1986; EP 233,013 published Aug. 19, 1987; EP 292,009 published Nov. 23, 1988; EP 293,936 published Dec. 7, 1988; and EP 293,934 published Dec. 7, 1988; and WO 88/10119.

Glycosylation mutants at positions 117-119, 184-186, and 448-450 exhibited higher specific activity as the mole percent carbohydrate was reduced. See EPO Pub. No. 227,462 published Jul. 1, 1987. This patent application additionally discloses using an assay of 10 fibrin/fibrin degradation products and teaches that one may also-modify-the t-PA molecule at positions 272-280 or delete up to 25 amino acids from the C-terminus. Further, the t-PA mutants with Asn 119, Ala 186 and Asn 450, which have the N-glycosylation sites selectively removed by DNA modification but contain residual O-linked carbohydrate, were found to be about two-fold as potent as melanoma t-PA in an in vitro lysis assay. See EPO Publ. No. 225,286 published Jun. 10, 1987.

Replacement of the amino acid at position 449 of t-PA with any amino acid except arginine to modify the glycosylation site, as well as modification of Arg 275 or deletion of the 3 to 91 region, is also taught. See WO 87/04722 published Aug. 13, 1987. An amino acid substitution at position 448 of t-PA is disclosed as desirable to remove glycosylation.

See EPO Pub. No. 297,066 published Dec. 28, 1988. The combination of modifications at positions 448-450 and deletion of the N-terminal 1-82 amino acids is disclosed by WO 89/00191 published Jan. 12, 1989. Additionally, urokinase has been modified in the region of Asp 302 -Ser 303 -Thr 304 to prevent glycosylation. See EPO Pub. No. 299,706 published Jan. 18, 1989.

However, alteration of the glycosylation sites, and in particular that at amino acid 117, seems invariably to result in a molecule having affected solubility characteristics that may result additionally in an altered circulating half-life pattern and/or fibrin binding characteristics. See EPO Pat. Publ. No. 238,304, published Sep. 23, 1987.

When the growth factor domain of t-PA is deleted, the resultant variant is still active and binds to fibrin, as reported by A. J. van Zonneveld et al., Thrombos. Haemostas. 54 1 4 (1985). Various deletions in the growth factor domain have also been reported in the patent literature. See EPO Publ. No. 241,209 (del-51-87), EPO Publ. No. 241,208 (del-51-87 and WO 98/21320 PCTIUS97/20226 del-51-173), PCT 87/04722 (deletion of all or part of the N-terminal 1 91), EPO Publ. No.

231,624 (all of growth factor domain deleted), and EPO Publ. No. 242,836 and Jap. Pat.

Appl. Kokai No. 62 269688 (some or all of the growth factor domain deleted).

It has further been shown that t-PA can be modified both in the region of the first kringle domain and in the growth factor domain, resulting in increased circulatory half-life.

See EPO Pat. Publ. No. 241,208 published Oct. 14, 1987. The region between amino acids 51 and 87, inclusive, can be deleted from t-PA to result in a variant having slower clearance from plasma. Browne et al., J. Biol. Chem., 263: 1599-1602 (1988). Also, t-PA can be modified, without adverse biological effects, in the region of amino acids 67 to 69 of the mature, native t-PA, by deletion of certain amino acid residues or replacement of one or more amino acids with different amino acids. See EPO Pat. Publ. No. 240,334 published Oct. 7, 1987.

A hybrid of t-PA/urokinase using the region of t-PA encompassing amino acids 273 527 is also disclosed. See EPO 290,118 published Nov. 9, 1988. Serpin-resistant mutants of human t-PA with alterations in the protease domain, including de1296-302 t-PA, R304S t-PA, and R304E t-PA, are disclosed in Madison et al., Nature, 339: 721-724 (1989). The above list is not an exhaustive review of the numerous variants of t-PA that have described.

As a result of the catalytic activity of precursor t-PA, despite effective clot lysis at targeted sites, nondesirable proteolysis occurs systemically resulting in the deleterious depletion of circulating fibrinogen, a2-anti-plasmin and plasminogen. What is needed are more zymogenic t-PA variant proteins that provide effective local clot lysis is achieved with diminished systemic proteolytic effects.

Summary of the Invention The present invention provides single chain variant t-PA proteins having at least two substitutions of basic amino acid residues by neutral or acidic amino acid residues, compared to the wild-type human t-PA, as well as polynucleotides encoding such single chain variant t- PA proteins. The single chain variant t-PA proteins of the present invention have the R275 amino acid residue substituted by an amino acid residue chosen from the group consisting of glycine, serie, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid.

Preferably the single chain variant t-PA proteins of the present invention have the R275 amino CD/01134020.5 6 acid residue substituted by an amino acid residue chosen from the group consisting of an aspartic acid residue and a glutamic acid residue, and most preferably by a glutamic acid residue.

The single chain variant t-PA proteins of the present invention have additionally at least one other basic amino acid residue in the serine protease region residue substituted by a non-basic amino acid such that the salt bridge interaction normally found in wild type single chain t-PA between aspartate 477 and lysine 429 is disrupted. Preferably, basic amino acids are replaced with polar or acid amino acids, and more preferably, amino acid residues chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid and glutamic acid.

More specifically, the present invention provides a variant single chain human tissue-type plasminogen activator protein having R275 and at least one S: other basic amino acid residue in the serine protease region substituted by a non- 15 basic amino acid residue thereby disrupting the salt bridge interaction between aspartate 477 and lysine 429, wherein the other basic amino acid residue in the serine protease region is neither K277 nor K416.

The salt bridge interaction between aspartate 477 and lysine 429 can be disrupted by a substitution at position 477 or 429, or by an appropriate substitution 20 at a position within the serine protease region that provides an alternative salt bridge interaction partner for at least one of aspartate 477 and lysine 429. In one preferred embodiment, the H417 amino acid residue is substituted by an amino acid residue chosen from the group consisting of glycine, serine, threonine, Sasparagine, tyrosine, glutamine, aspartic acid, and glutamic acid. More preferably the single chain variant t-PA proteins of the present invention have both the R275 amino acid residue and the H417 amino acid residue substituted by an amino acid residue chosen from the group consisting of an aspartic acid residue and a glutamic acid residue. Two exemplary preferred single chain variant t-PA proteins are the t-PA variants designated as R275E, H417E and R275E, H417D.

In another preferred embodiment, the K429 amino acid residue is CD/01134020.5 6A substituted by an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid. More preferably the single chain variant t-PA proteins of the present invention have both the R275 amino acid residue and the K429 amino acid residue substituted by an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid. One preferred single chain variant t-PA protein is the t-PA variant designated as R275E, K429Y.

The single chain variant t-PA proteins of the present invention exhibit greater zymogenicity, expressed as the ratio of the activity of the mature cleaved two-chain enzyme to that of the single chain precursor form, than that of the wild type single chain t-PA protein.

S S

S

*S

S

S eo WO 98/21320 PCTIUS97/20226 -7- The single chain variant t-PA proteins of the present invention have zymogenicity of at least preferably about 50 to about 200.

The single chain variant t-PA proteins of the present invention exhibit a greater fibrin stimulation factor, expressed as the ratio of the catalytic efficiencies in the presence and absence of fibrin, compared to the wild type single chain t-PA protein. The single chain variant t-PA proteins of the present invention have a fibrin stimulation factor of at least 7,000, preferably about 20,000 to about 50,000.

The single chain variant t-PA proteins of the present invention exhibit a reduced inhibition by plasminogen activator inhibitor 1 (PAI-1) to the wild type single chain t-PA protein. The sin'gle chain variant t-PA proteins of the present invention are at least a factor of preferably at least a factor of about 9, most preferably at least a factor of about 200 less inhibited by PAI-1 compared to the wild type single chain t-PA protein.

The single chain variant t-PA proteins of the present invention exhibit a greater fibrin selectivity factor, expressed as the ratio of the catalytic efficiencies in the presence fibrin to that in the presence of fibrinogen, compared to the wild type single chain t-PA protein.

Preferred embodiments of the single chain variant t-PA proteins of the present invention have a fibrin selectivity factor of at least 10, preferably at least 50, more preferably at least 100.

Brief Description of the Drawings In the drawings, Figs. 1A, 1B and 1C show the nucleotide sequence and deduced amino acid sequence of the full-length human t-PA cDNA; and Fig. 2 is a graphical representation of the results of standard chromogenic assays of plasminogen activation in the presence of buffer (open squares), DESAFIB (open diamonds), fibrinogen (open circles), cyanogen bromide fragments of fibrinogen (open triangles) or the stimulatory peptide P368 (hatched squares).

Detailed Description of the Preferred Embodiments As used herein, "wild-type t-PA" refers to the t-PA protein naturally occurring in humans. While this human t-PA is exemplified by the amino acid sequence depicted in Figs.

1A, 1B and 1C, the term wild-type t-PA should be understood to encompass naturally occurring allelic variations.

CD/oil 34020.5 7A As used herein, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude other additives, components, integers or steps.

9.

9 9 9 9 9 99 9 9 9 9 9.9..

9 9 9 999 9 999.

9 9*99 99 9 9 9.9 9 *99999 9 WO 98/21320 PCTIUS97/20226 -8t-PA Variant Compositions The t-PA variant cDNAs and the corresponding expressed recombinant proteins of this invention are useful compounds that function in the serine protease-mediated control of fibrinolysis as described herein.

The t-PA variant cDNAs of the present invention contain at least one nucleotide substitution to generate a t-PA cDNA that encodes a noncleavable single chain t-PA variant, not cleavable by plasmin under normal conditions. The nucleotide substitution results in a substitution of a glutamic acid for an arginine at amino acid residue 275 (or position using the chymotrypsin numbering system) in the t-PA precursor that is responsible for creating a noncleavable variant. Positions 15, 144, 156, and -194 of thre chymotrypsin numbering system correspond to positions 275, 417, 429, and 477, respectively, in the t-PA numbering system as depicted in Fig. 1.

The variants, which are substitution mutants, are designated by the single letter code of the wild type human t-PA amino acid residue, the position of the residue relative to the amino terminus of the mature human t-PA as depicted in Fig. 1, followed by the single letter code of the amino acid residue substituted for the amino acid residue in mature human t-PA. The substitution of glutamic acid for arginine at position 275 is designated as R275E. Equivalent substitutions generating noncleavable single chain t-PA are known in the art (Higgins, et al., (1990) Thrombosis Res. 57: 527-539).

In addition to the R275E substitution, the variant cDNAs of the present invention further comprise at least one other nucleotide substitution at a separate site to create a t-PA variant having at least two amino acid substitutions. Preferred cDNA variants include at least one nucleotide substitution that results in an amino acid substitution of an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid for a histidine at amino acid residue position 417. Preferred embodiments are designated R275E,H417D and R275E,H417E. A further cDNA variant comprises at least one nucleotide substitution resulting in the substitution of an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid for the lysine at amino acid residue position 429. One such preferred embodiment is designated R275E,K429Y.

WO 98/21320 PCT/US97/20226 -9- The variant t-PA cDNAs of the present invention are useful for generating the recombinant expressed variant t-PAs described above. In a further embodiment, the variant t- PA cDNAs have therapeutic uses in gene therapy as described below.

The invention includes embodiments such as expression vectors or plasmids in which the cDNAs for encoding variant t-PAs are operably linked to provide for the expression of recombinant variant t-PAs for use in the methods as described below. One preferred embodiment is the expression of a variant t-PA protein by COS 1 cells comprising pSVT7 expression vector operably linked to a polynucleotide encoding the variant protein.

Constitutive and inducible expression vectors are disclosed. In a further embodiment, transiently and stably transfe'ted cells contain cDNA encoding variant t-PAs.

The resultant recombinant expressed t-PA variants described herein are characterized as having one or more of the following structural and functional properties: 1) The t-PA variant is in the form of a noncleavable single chain protein containing an R275E amino acid substitution or equivalents thereof that prevent cleavage by t-PA activating enzymes; 2) The t- PA variant exhibits increased resistance to inhibition by the serpin plasminogen activator inhibitor, type I (PAl-1); 3) The t-PA variants has diminished catalytic activity on substrates, such as plasminogen, in the absence of co-factors, such as fibrin; 4) The t-PA variants exhibit enhanced stimulation by fibrin; 5) The t-PA variants exhibit comparable catalytic activity to substrates, such as plasminogen, in the presence of co-factors, such as fibrin; and 6) In view of the proceeding properties, the t-PA variants thus are effective at local fibrinolysis function without extensive systemic proteolysis thereby negating the depletion of circulating fibrinogen, a2-anti-plasmin and plasminogen, as is seen with wild type human single chain t- PA precursor.

Preferred recombinant expressed t-PA variants thus include R275E,H417D, R275E,H417E and R275E,K429Y, and conservative substitutions thereof. In general, examples of conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another, the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine, the substitution of one basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another. For further discussion of the classifications of WO 98/21320 PCTIUS97/20226 amino acids see Lehninger, Biochemistry, 2 nd Edition, Worth Publishers, New York, 1975, pp.71-94.

The phrase "conservative substitution" also includes the use of a chemically derivatized residue in place of a non-derivatized residue provided that such protein displays the requisite binding activity. "Chemical derivative" refers to a subject protein having one or more residues chemically derivatized by reaction of a functional side group. Such derivatized molecules include for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, tbutyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups may be derivatized to form salts,methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine. Also included as chemical derivatives are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For example, 4-hydroxyproline may be substituted for proline; 5-hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine. D-amino acids may also be included in place of one or more L-amino acids.

In the specific case of the present invention, basic amino acids, arginine, lysine and histidine are replaced with non-basic amino acids. Preferably basic amino acids are replaced with polar or acidic amino acids, i.e. amino acid residues chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid and glutamic acid.

Conservative substitutions are thus defined, for the purpose of the present invention, as meaning that non-basic amino acids replacing particular basic amino acids in mature wild type human t-PA may be chosen from the group of non-basic amino acids generally, preferably from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid and glutamic acid, and more preferably from the group consisting of tyrosine, aspartic acid and glutamic acid, For example, the use of aspartic acid instead of glutamic acid to replace an histidine residue is a conservative substitution. Preferred variants are R275E,H417D and R275E,H417E, described in Example 1 and the R275E,K429Y variant, described in Example 2.

WO 98/21320 PCT/US97/20226 11 The expressed recombinant t-PA variants having at least two amino acid substitutions, R275E,H417D, R275E,H417E and R275E,K429Y, further exhibit unique properties.

R275E and R275E,H417E are activated by both fibrinogen and fibrin while R275E,K429Y is activated primarily by fibrin and is not sensitive to fibrinogen. The latter is also more resistant than the R275E,H417D and R275E,H417E variants to inhibition by PAI-1. These characteristics provide additional advantages in administering the compounds as therapeutic thrombolytic compositions as further described below. In addition, the t-PA variants described herein are useful in diagnostic applications as described below.

Methods of making and Using t-PA Variant Compositions Methods of Making The t-PA variant cDNA and recombinant expressed variant proteins described above are useful in a number of methodological aspects as described in Examples 1 and 2. In particular, the isolated cDNA clones are useful in an expression vector system to produce encoded t-PA variant proteins of this invention. Thus, expression vector systems having a t- PA variant cDNA operably linked therein, including cells containing the expression vectors, are contemplated for generating the recombinant expressed variant proteins of this invention.

Diagnostic Applications Preferred diagnostic methodological aspects are described herein. In particular, the recombinant expressed t-PA variants of the present invention are useful in diagnostic assays to detect fibrin and fibrin degradation products that have altered activities. The assays are thus indicated in thrombotic conditions. Other diagnostic applications, incuding kits comprising antibodies against the t-PA variants are familiar to one of ordinary skill in the art.

Therapeutic Applications The t-PA variant cDNAs of the present invention are useful in genetic therapeutic applications for use in ameliorating thrombotic disorders including both acute and chronic conditions. Acute conditions include among others both heart attack and stroke while chronic situations include those of arterial and deep vein thrombosis and restenosis. Preferred WO 98/21320 PCT/US97/20226 12therapeutic compositions thus include the cDNA compounds themselves as naked DNA, presented as part of a viral vector delivery system or other vector-based gene expression delivery system, presented in a liposome delivery system and the like.

The recombinant expressed t-PA variant proteins of the present invention are contemplated as thrombolytic therapeutic agents for ameliorating the same conditions outlined above. Based on the individual structural and functional properties of various t-PA variant proteins described above, the selection of the particular t-PA variant is determined by the desired therapeutic outcome. For example, the fibrinogen-mediated activation of endogenous human t-PA is activated by bleeding which then results in a widespread undesired systemic response. Thus, to mediate fibrinolytic processes locally in either an acute or chronic thrombotic condition while simultaneously preventing proteolytic activation systemically, one would therefore use the t-PA variant, namely R275E,K429Y, that is primarily activated by fibrin and not fibrinogen. A composition for use as thrombolytic therapeutic agents generally a physiologically effective amount of the t-PA variant protein in a pharmaceutically suitable excipient. Depending on the mode of administration and the condition to be treated, the thrombolytic therapeutic agents are administered in single or multiple doses. If "bolus" doses are administered, doses of about 0.01 to about 0.6 mg/kg will typically be administered, preferably doses of about 0.05 to about 0.2 mg/kg, with subsequent administrations of about 0.1 to about 0.2 mg/kg to maintain a t-PA blood level of about 3 microgram/ml. One skilled in the art will appreciate that variations in dosage depend on the condition to be treated. In other applications, a composition of variant t-PA in a gel composition is useful in preventing the formation of adhesions.

Other variations and uses of the present invention will be apparent to one skilled in the art.

Example 1 Site Directed Mutagenesis And Construction Of Expression Vectors Encoding Variants Of T-PA Oligonucleotide directed site specific mutagenesis was performed by the method of Zoller and Smith (Zoller, M. and Smith, M. (1984) DNA 3, 479-488) as modified by Kunkel (Kuikel, T. A. (1985) Proc. Natl. Acad. Sci. U.S.A. 82, 488-492). Mutations were introduced into the 290 bp SacI SmaI fragment of cDNA encoding t-PA that had been WO 98/21320 PCT/US97/20226 13previously subcloned into bacteriophage M13mpl8. The mutagenic primers had the following nucleotide sequences: H417D: 5' CTACGGCAAGGACGAGGCCTTGT 3' (SEQ ID NO: 8) H417E: CTACGGCAAGGAGGAGGCCTTGT 3' (SEQ ID NO: 9) Following mutagenesis, ssDNA corresponding to the entire 290 bp SacI Smal fragment was fully sequenced to assure the presence of the desired mutation and the absence of any additional mutations. The sequence corresponding to the 290 bp SacI Smal fragment of the H417D mutation is shown in SEQ ID NO: 5; the corresponding sequence of the H417E mutation is shown in SEQ ID NO: 6. Replicative form (RF) DNA was prepared for appropriate phage, and the mutated 290 bp SacI Smal fragments were recovered after digestion of RF DNA with SacI and Smal and electrophoresis of the digestion products on an agarose gel. The isolated, mutated SacI Smal fragments were used to replace the corresponding fragment in full length cDNAs encoding wild type human t-PA or t-PA/R275E to yield new, full length cDNAs encoding t-PA/H417D; t-PA/H417E; t-PA/R275E,H417D (SEQ ID NO: and t-PA/R275E,H417E (SEQ ID NO: 2).

Expression of enzymes by transient transfection of COS cells.

cDNAs encoding t-PA; t-PA/R275E; t-PA/H417D; t-PA/H417E; t-PA/R275E,H417D; and t-PA/R275E were ligated into the transient expression vector pSVT7 which is described in Madison, E. et al. (1989) Nature 339, 721-724; Bird, et al., (1987) J. Cell Biol. 105: 2905-2914; and Sambrook, et al., (1986) Mol. Biol. Med. 3: 459-481. See also U.S. Pat.

No. 5,550,042, incorporated herein by reference, which describes the construction and use of pSVT7 as well as the deposit with American Type Culture Collection, 12301 Parklawn Dr., Rockville, MD 20852 of cultures comprising other pSVT7 t-PA constructs. Vectors with ligated cDNA inserts were then introduced into COS 1 cells by electroporation using a Bio Rad Gene Pulser. An aliquot containing 20 tg of cDNA, 100 p.g of carrier DNA and approximately 107 COS cells were placed into a 0.4 cm cuvette, and electroporation was performed at 320 V, 960 tFD, and Q oo. Following electroporation, cells were incubated overnight at 37 degrees Celsius in DMEM containing 10% fetal calf serum and 5 mM sodium butyrate. Cells were then washed with serum free medium and incubated in DMEM for 48 hours at 37 degrees Celsius. After the incubation with serum free media, conditioned media WO 98/21320 PCTllUS97/20226 -14were collected. Enzyme concentrations in aliquots of the the collected conditioned media were determined by ELISA.

Kinetic analysis of plasminogen activation using indirect chromogenic assays.

Indirect chromogenic assays of t-PA utilized the substrates lys-plasminogen (American Diagnostica, Greenwich, CT) and Spectrozyme PL (American Diagnostica) and were performed as previously described (Madison, E. Goldsmith, E. Gerard, R. Gething, and Sambrook, J. F. (1989) Nature 339, 721-724; Madison, E. Goldsmith, E. J., Gerard, R. Gething, M. Sambrook, J. and Bassel-Duby,K.- S.7(1990) Proc. Natl.

Acad. Sci. U.S.A. 87, 3530-3533; Madison, E. Goldsmith, E. Gething, M. Sambrook, J. and Gerard, R. D. (1990) J. Biol. Chem. 265, 21423-21426.). Assays were performed both in the presence and absence of the co-factor DESAFIB (American Diagnostica). The concentration of lys-plasminogen was varied from 0.0125 0.2 pM in the presence of DESAFIB and from 0.9 15 pM in the absence of the co-factor.

Kinetic analysis of t-PA activity using a small, synthetic substrate The direct chromogenic assay utilized the substrate methylsulfonyl-D-cyclohexyltyrosylglycyl-arginine-p-nitroaniline (Spectrozyme t-PA, American Diagnostica) and was performed as previously described (Strandberg, and Madison, E. L. (1995) J. Biol. Chem. 270, 23444- 23449; Smith, J. Tachias, and Madison, E. L. (1995) J. Biol. Chem. 270, 30486- 30490).

Measurement of second order rate constants for inhibition by PAl-1 Second order rate constants for the inhibition of wild type human t-PA and variant t- PA were measured under pseudo-first order conditions as previously described. Briefly, enzyme and inhibitor were preincubated at 23 degrees Celsius for periods of time varying from 0 30 minutes. Following preincubation, the mixtures were diluted, and the residual enzymatic activity was measured in a standard indirect chromogenic assay. For each enzyme, the concentrations of enzyme and inhibitor and the times of preincubation were chosen to yield several data points for which the residual enzymatic activity varied between 20% and 80% of WO 98/21320 PCTfS97/20226 the initial activity. Data were analyzed by plotting the natural logarithm of the ratio (residual activity/initial activity) versus time of preincubation and measuring the resulting slopes.

Division of this slope by yielded the second order rate constants shown.

It was found that replacement of histidine 417 of t-PA with an acidic residue selectively suppresses the catalytic activity of single chain t-PA. Histidine 417 was replaced by either an aspartate or glutamate residue to yield two variants: t-PA/H417D and t- PA/H417E. Accurate measurement of the enzymatic activity toward plasminogen of the single chain form of these two variants proved difficult, however, because the plasmin produced in this assay rapidly converted the single chain enzymes into their mature, two-chain form by cleaving the R275-I276 peptide bond. Consequently, to overcome this technical difficulty, we also constructed noncleavable forms of the two mutated enzymes by introducing the additional mutation R275E into the existing mutants.

Wild type human t-PA, t-PA/R275E, and all four variants containing mutations at position 417 were expressed by transient expression of COS-1 cells. Since this procedure yielded predominantly single chain enzymes, two-chain t-PAs were generated by treating the enzyme preparations with plasmin-Sepharose (Strandberg, and Madison, E. L. (1995) J.

Biol. Chem. 270, 23444-23449). Quantitative conversion of the enzymes into their mature, two-chain form was confirmed by SDS-PAGE. As expected, variants containing the mutation R275E were synthesized and secreted exclusively as single chain enzymes and were not cleaved by plasmin-Sepharose.

The enzymatic activity of the single and two-chain forms of wild type human t-PA and each variant toward a small synthetic substrate is listed in Table I below. Mutation of histidine 417 had only very modest effects on the activity of the two-chain enzymes. Two-chain t- PA/H417D and t-PA/H417E displayed 67% or 80%, respectively, the activity of the twochain, wild type human t-PA enzyme in this assay. The H417D and H417E mutations, however, had more significant effects on the activities of the single chain enzymes. Compared to single chain t-PA/R275E, single chain t-PA/R275E,H417D (SEQ ID NO: 1) and t- PA/R275E,H417E (SEQ ID NO: 2) exhibited approximately 16% or 25%, respectively, the activity of single chain t-PA/R275E.

WO 98/21320 PCT/US97/20226 16 Table 1 Kinetic constants for cleavage of the chromogenic substrate Spectrozyme t-PA by single- and two-chain t-PA variants Enzyme K. (mM) Km/Km Two-chain form t-PA 59 0.4 1.5x10 t-PAIH417D 41 0.4 1.0x10 t-PA/H417E 58 0.5 1.2x10 Single-chain form t-PAIR275E 26 0.7 3.7x 10 4 t-PAIR275E,H417D 5.9 1.0 5.9xl0 3 t-PAIR275E,H417E 12 1.3 9.2x10 3 All of the variants analyzed maintained high enzymatic activity towards the natural substrate, plasminogen, in the presence of the co-factor fibrin (Table II below). The catalytic activity of the two-chain form of wild type human t-PA, t-PA/H417D, and t-PAIH417E varied by a factor of only 1.4. Similarly, the activities of single chain t-PAIR275E, t- PAIR275E,H417D, and t-PAIR275E,H417E differed by a factor of less than 1.8.

Table 11 Kinetic constants for activation ofplasminogen by single- and .two-chain t-PA variants in the presence offibrin Enzyme KEj(s) Kc.AQTWK( S" 1 Two-chain form t-PA 0.11 0.017 6.5x10 6 t-PA/H417D 0.11 0.024 4.6x1 0 6 t-PAIH417E 0.10 0.022 4.5x1 0 6 Single-chain form t-PAIR275E 0.16 0.017 9.4x1 0 6 t-PA/R275E,H417D 0.23 0.043 5.3x1 0 6 t-PA/R275E,H417E 0.17 0.028 6.1xl 0 6 WO 98/21320 PCTIS97/20226 -17- In the absence of a co-factor, the mutations at position 417 had little effect on the activity of two-chain t-PA toward plasminogen; however, these mutations significantly reduced the catalytic efficiency of single chain t-PA (Table III below). Compared to that of single chain t-PA/R275E, the activity of t-PA/R275E,H417D and t-PA/R275E,H417E was reduced by a factor of approximately 14 or 6, respectively. In this assay, the "zymogenicity", or ratio of the activities of the two-chain and single chain form of a particular enzyme, were approximately 9 for wild type t-PA. By contrast, for variants containing the H417D or H417E mutation, this ratio increased to approximately 150 or 50, respectively (Table III).

-T -able

III

Kinetic constantsfor activation ofplasminogen by single- and two-chain variants of t-PA in the absence of a cofactor Enzyme K~a,(s IK(M) Kca/K(M-'s- Two-chain form t-PA 0.093 6.7 1.4x10 4 t-PA/H417D 0.110 6.8 1.6x10 4 t-PA/H417E 0.099 8.7 1.1xl0 4 Single-chain form t-PA/R275E 0.014 9.5 1.5x10 3 t-PA/R275E,H417D 0.001 9.4 1.1x10 2 t-PA/R275E,H417E 0.002 8.5 2.4x10 2 Molecular details of the stimulation of t-PA by fibrin, a complex process that almost certainly involves multiple points of contact between the two proteins, remain unclear. While fibrin stimulation of two-chain t-PA may occur through a single mechanism; stimulation of single chain t-PA by fibrin co-factors, however, appears to utilize at least two distinct mechanisms. First, fibrin apparently stimulates both single- and two-chain t-PA through a templating mechanism resulting in formation of a ternary complex which greatly augments the local concentration of enzyme and substrate. Second, because single- and two-chain t-Pa have equivalent activity in the presence but not the absence of fibrin, it seems likely that binding to fibrin induces a conformational change in the activation domain of single chain t-PA. Similar activation of plasminogen upon binding to streptokinase as well as activation of prothrombin WO 98/21320 PCT/US97/20226 -18by binding to staphylocoagulase have been described previously. Although the mechanism of this nonclassical, nonproteolytic activation of serine protease zymogens remains completely unclear, the behavior of single chain t-PA/R275E,H417D and t-PA/R275E,H417E indicates that His 417 does not play an essential role in this process. In addition, the properties of twochain t-PA/H417D and t-PA/H417E indicate that His 417 does not play an essential role during zymogen activation oft-PA through the classical, proteolytic mechanism.

The primary effect of the H417D and H417E mutations was a selective reduction of the activity of single chain t-PA in the absence of fibrin and, consequently, an increase in the zymogenicity of the enzyme. At the molecular level this effect could be mediated either by stabilizing a less active, new conformation of single chain t-PA or by shiftingth- equilibrium between one or more existing conformations, with distinct activities, towards the less active conformation. Without being held to a single hypothesis, based on structural studies of trypsinogen, trypsin, chymotrypsinogen, and chymotrypsin, that the existence of an equilibrium among multiple conformations of the activation domain is likely to be a general feature of chymotrypsinogen family zymogens.

It is believed that the effect produced by converting His 417 to an acidic residue is mediated by disrupting the important salt bridge between Asp 477 and Lys 429 by providing an alternative, electrostatic interaction for Lys 429. The observation of an electrostatic interaction between K429 and E417 in the recently reported structure of the protease domain of two-chain u-PA, although the distance and geometry of this interaction vary somewhat in the two members of the unit cell in this study, lends credence to this hypothesis. Moreover, as observed in this study, formation of a new salt bridge between Lys 429 and Asp/Glu 417 would be expected to selectively suppress the activity of single chain t-PA because Lys 429 does not interact with Asp 477 in the two-chain enzyme. Instead, in two-chain t-PA, as in other mature chymotrypsin like enzymes, the mature amino terminus inserts into the activation pocket and plays this role. Consequently, as observed, two-chain t-PA/H417D and t- PA/H417E are expected to maintain high catalytic activity. Variants of t-PA containing an acidic residue at position 417, therefore, exhibit significantly enhanced zymogenicity.

WO 98/21320 PCT/US97/20226 -19- Table IV Stimulatory effect of fibrin on the catalytic efficiencies for variants of t-PA Enzyme Fold stimulation of kcJ/K Two-Chain form t-PA 460 t-PA/H417D 290 t-PA/H417E 410 Single-chain form t-PA/R275E 6300 t-PA/R275E,H417D 48,200 t-PA/R275E,H417E 25,400 The extent of fibrin stimulation displayed by the single chain form of the mutated enzymes examined in this study is significantly greater than that displayed by wild type t-PA.

Wild type, two-chain t-PA possesses a fibrin stimulation factor, defined as the ratio of the catalytic efficiencies in the presence and absence of fibrin, of approximately 460 (Table IV above). The two-chain variants display similar stimulation factors of 290 (t-PA/H417D) and 410 (t-PA/H417E). Single chain wild type t-PA, with a fibrin stimulation factor of 6300, is stimulated to a substantially greater degree than the two-chain enzymes, presumable reflecting the ability of fibrin to stimulate the single chain enzymes not only through a templating mechanism but also by inducing nonproteolytic zymogen activation. Stimulation of single chain t-PA is further enhanced by the H417D or H417E mutations. The fibrin stimulation factors for single chain t-PA/R275E,H417D and t-PA/H417E are 48,200 and 25,400, respectively (Table IV above). Enhanced fibrin stimulation of the variants did not result from increased activity in the presence of fibrin but rather from decreased activity in the absence of a stimulator, an observation consistent with the belief that the effects of these mutations are mediated by disruption of a salt bridge between Lys 429 and Asp 477 in single chain t-PA.

The single chain form of a zymogen-like variant of t-PA is expected to exhibit reduced activity not only towards substrates (Tables I and III, above) but also towards specific inhibitors. To demonstrate this, we measured the second order rate constant for inhibition of WO 98/21320 PCTfUS97/20226 single chain t-PA/R275E, t-PA/R275E,H417D, and t-PA/R275E,H417E by the serpin plasminogen activator inhibitor, type 1 (PAI-1) (Table V below). As expected, both variants containing mutations at position 417 exhibited resistance to inhibition by PAI-1. The second order rate constant for inhibition by PAI-1 of t-PA/R275E,H417D or t-PA/R275E,H417E was reduced by factors of approximately 12 or 9, respectively, compared with t-PA/R275E.

Table V Inhibition of wild type and variants oft-PA by PAl-1 Enzyme Second Order Rate Constant (M-'s t-PA/R275E 1.8x10 6 t-PA/R275E,H417D 1.5x1 0 t-PA/R275E,H417E 2.1x10 t-PA exhibits unusually high catalytic activity as a single chain enzyme and consequently very low zymogenicity. By contrast, a closely related enzyme urokinase (u-PA) exhibits much lower catalytic activity as a single chain enzyme and substantially higher zymogenicity. An important finding of this study is that the presence or absence of a favorable electrostatic interaction between residues at positions 417 and 429 appears to be the major determinant of this key functional distinction between the two human plasminogen activators.

The zymogenicity of wild type t-PA, u-PA, and t-PA containing an aspartate at position 417 are approximately 9, 250, and 150, respectively.

These studies demonstrated structure/function relationships within the activation domain of t-PA, and elucidated the molecular basis of important functional distinctions between t-PA and u-PA. These results can also aid the design of improved thrombolytic agents. For example t-PA/R275E,H417D, exhibits substantially enhanced fibrin stimulation, resistance to inhibition by PAI-1, and significantly increased zymogenicity, a useful combination of properties that enhances the therapeutic utility of the enzyme.

WO 98/21320 PCTIS97/20226 -21- Example 2 Site Directed Mutagenesis And Construction Of Expression Vectors Encoding Variants Of T-PA.

Oligonucleotide directed site specific mutagenesis was performed as described in Example 1. The K429Y mutation was introduced into the 290 bp Sad Sma fragment of cDNA encoding t-PA that had been previously subcloned into bacteriophage M13mpl8. The mutagenic primer had the following nucleotide sequence: CGGAGCGGCTGTATGAGGCTCATGT 3' (SEQ ID NO: Following mutageiie-is, ssDNA corresponding to the entire 290 bp Sad Smal fragment was fully sequenced to assure the presence of the desired mutation and the absence of any additional mutations. The sequence corresponding to the 290 bp SacI SmaI fragment of the K429Y mutation is shown in SEQ ID NO: 7. Replicative form (RF) DNA was prepared for appropriate phage, and the mutated 290 bp Sad Smal fragment was recovered after digestion of RF DNA with Sad and Smal and electrophoresis of the digestion products on an agarose gel. The isolated, mutated Sac Smal fragment was used to replace the corresponding fragment in full length cDNAs encoding wild type t-PA or t-PA/R275E to yield new, full length cDNAs encoding t-PA/K429Y and t-PA/R275E,K429Y.

Expression of enzymes by transient transfection of COS cells.

cDNAs encoding t-PA, t-PA/R275E, t-PA/K429Y, and t-PA/R275E,K429Y were ligated into the transient expression vector pSVT7 and then introduced into COS cells by electroporation using a Bio Rad Gene pulser as described in Example 1. Following electroporation, cells were incubated overnight at 37 degrees Celsius in DMEM containing 10% fetal calf serum and 5mM sodium butyrate. Cells were then washed with serum free medium and incubated in DMEM for 48 hours at 37 degrees Celsius. After the incubation with serum free media, conditioned media were collected and enzyme concentrations were determined by ELISA.

Purification of wild type and mutated variants of t-PA.

Wild type and mutated variants of t-PA were purified using an FPLC system and a 1 ml HiTrap chelating column (Pharmacia Biotech). The column was charged with 0.1 M WO 98/21320 PCT/US97/20226 -22- CuSO, solution, washed with 5 10 ml distilled water, and equilibrated with start buffer (0.02 M NaHPO 4 pH 7.2, 1 M NaCl and 1 mM Imidizole). Conditioned medium containing wild type or variants of t-PA was adjusted to 1 M NaCI and injected into the column with a 50 ml superloop (Pharmacia Biotech). The column was then washed with 10 column volumes of start buffer and eluted using a 0 0.32 M linear gradient ofimidizole in the same buffer. Peak fractions were collected and pooled. Purified t-PA samples were concentrated, and buffer was exchanged to 25 mM Tris (pH 50 mM NaCI, 1 mM EDTA, using a Centriplus concentrator (Amicon).

-10 Kinetic analysis of t-PA activity using a small, synthetic substrate.

The direct chromogenic assay utilized the substrate methylsulfonyl-Dcyclohexyltyrosyl-glycyl-arginine-p-nitroaniline (Spectrozyme t-PA, American Diagnostica) and was performed as described in Example 1.

Kinetic analysis of plasminogen activation using indirect chromogenic assays.

Indirect chromogenic assays oft-PA utilized the substrates lys-plasminogen (American Diagnostica) and Spectrozyme PL (American Diagnostica) and were performed as previously described in Example 1. Assays were performed both in the presence and absence of the cofactor DESAFIB (American Diagnostica).

Indirect Chromogenic Assays in the presence of Various Fibrin Co-factors.

Standard indirect chromogenic assays were performed. Briefly, 0.25 Ing of enzyme, 0.2 gM lys-plasminogen and 0.62 mM Spectrozyme PL were present in a total volume of 100 gl. Assays were performed either in the presence of buffer, 25 gg/ml DESAFIB, 100 g/ml fibrinogen, 100 gg/ml cyanogen bromide fragments of fibrinogen (American Diagnostica), or 100 tg/ml of the stimulatory, thirteen amino acid peptide P368. P368 was kindly provided by Marshall Runge (University of Texas Medical Center, Galveston, Assays were performed in microtiter plates, and the optical density at 405 nm was measured every seconds for one hour in a Molecular Devices Thermomax. Reactions were performed at 37 degrees Celsius.

WO 98/21320 PCT/US97/20226 -23- Measurement of second order rate constants for inhibition by PAI-1.

Second order rate constants for the inhibition of wild type and mutated t-PA were measured under pseudo-first order conditions as described in Example 1.

Oligonucleotide directed site specific mutagenesis was used to produce a mutation of Lys 429 of t-PA that selectively suppressed the catalytic activity of single chain t-PA. Lysine 429 was replaced by a tyrosine residue to yield t-PA/K429Y. In addition, to permit accurate measurement of the enzymatic activity toward plasminogen of the single chain form of this variant, a noncleavable form of the mutated enzyme was constructed by introducing the additional mutation R275E iifi the exfstiig mutant to yield the R275E,K429Y variant.

Wild type t-PA, t-PA/R275E, t-PA/K429Y, and t-PA/R275E,K429Y were expressed by transient expression in COS 1 cells as described in Example 1. Since this procedure yielded predominantly single chain enzymes, two-chain t-PAs were generated by treating the enzyme preparations with plasmin-Sepharose. Quantitative conversion of the enzymes into their mature, two-chain form was confirmed by SDS-PAGE. As previously demonstrated, variants containing the mutation R275E were synthesized and secreted exclusively as single chain enzymes and were not cleaved by plasmin-Sepharose.

Table VI Kinetic constantsfor cleavage of the chromogenic substrate Spectrozyme t-PA by single- and two-chain t-PA variants.

Enzyme K(mM) K,/K(M's Two-chain form t-PA 40 0.5 8.0x10 4 t-PA/K429Y 35 0.5 7.0x10 4 Single-chain form t-PA/R275E 24 0.7 3.4x10 4 t-PA/R275E,K429Y 0.3 0.5 6.0x10 2 The enzymatic activity of the single and two-chain forms of wild type and t-PAs toward a small synthetic substrate is listed in Table VI above. Mutation of lysine 429 had little effect on the activity of two-chain t-PA. Two-chain t-PA/K429Y displayed approximately WO 98/21320 PCTfUS97/20226 -24of the activity of the two-chain, wild type enzyme in this assay. By contrast, the K429Y mutation had a very substantial effect on the activity of single chain t-PA. Single chain t- PA/R275E,K429Y exhibited approximately 2% of the activity of single chain t-PA/R275E. In this assay, the zymogenicity, defined as the ratio of the activities of the two-chain to that of the single chain form of a particular enzyme, was approximately 2.5 for wild type t-PA. By contrast, for variants containing the K429Y mutation, this ratio increased to approximately 117 (Table VI).

In the absence of a co-factor, the K429Y mutation had little effect on the activity of two-chain t-PA toward plasminogen; however, this mutation significantly reduced the catalytic efficiency of single chain t-PA (Table VII below). Compared with that of single chair t- PA/R275E, the activity of single chain t-PA/R275E,K429Y was reduced by a factor of 17. By contrast, the activities of two-chain t-PA and t-PA/K429Y differed by a factor of only 1.2.

Table VII Kinetic constantsfor activation ofplasminogen by single- and two-chain variants of t-PA in the absence of a cofactor Enzyme K,,(s KI(jM) KI,,aK(M-'s 1 Two-chain form t-PA 0.16 10 1.6x10 4 t-PA/K429Y 0.18 14 1.3xl0 4 Single-chain form t-PA/R275E [0.038] [30] 1.3x10 3 t-PA/R275E,K429Y 0.00046 5.9 7.8x10' All of the variants analyzed in this study maintained reasonably high enzymatic activity towards the natural substrate plasminogen in the presence of the co-factor fibrin (Table VIII below). The single chain form of variants containing the K429Y mutation were, however, affected to a slightly greater extent than the corresponding mature, two-chain enzymes. Two-chain t-PA/K429Y possessed approximately 75% of the activity of two-chain t-PA while single chain t-PA/R275E,K429Y exhibited approximately 40% of the activity of single chain t-PA/R275E.

WO 98/21320 PCTIUS97/20226 Table VIII Kinetic constantsfor activation ofplasminogen by single- and two-chain t-PA variants in the presence offibrin Enzyme K,(pM) Two-chain form t-PA 0.08 0.02 4.0x10 6 t-PA/K429Y 0.08 0.03 3.0x10 6 Single-chain form t-PA/R275E 0.10 0.02 5.0x10 6 t-PA/R275E,K429Y 0.10 0.07 2.0x10 6 The extent of fibrin stimulation displayed by the single chain form of t- PA/R275E,K429Y is significantly greater than that displayed by wild type t-PA. Wild type, two-chain t-PA possesses a fibrin stimulation factor, defined as the ratio of the catalytic efficiencies in the presence and absence of fibrin, of approximately 250 (Table IX below). The two-chain t-PA/K429Y variant displays a similar stimulation factor of 230. Single chain wild type t-PA, with a fibrin stimulation factor of 3800, is stimulated to a substantially greater degree than the two-chain enzymes, presumable reflecting the ability of fibrin to stimulate the single chain enzymes not only through a templating mechanism but also by inducing nonproteolytic zymogen activation. Stimulation of single chain t-Pa is further enhanced by the K429Y mutation. The fibrin stimulation factor for single chain t-PA/R275E,K429Y is approximately 26,000. Enhanced fibrin stimulation of the variant did not result from increased activity in the presence of fibrin but rather from decreased activity in the absence of a stimulator, an observation consistent with our proposal that the effects of these mutations are mediated by disruption of a salt bridge between Lys 429 and Asp 477 in single chain t-PA.

WO 98/21320 PCTIUS9720226 -26- Table IX Stimulatory effect offibrin on the catalytic efficiencies for variants oft-PA Enzyme Fold stimulation of kc,/K Two-chain form t-PA 250 t-PA/K429Y 230 Single-chain form t-PA/R275E 3800 t-PA/R275E,K429Y 26,000 The mutated enzyme t-PA/R275E,K429Y is not only stimulated to a significantly greater extent by soluble fibrin than t-PA (Table IX above), but it is also substantially more discriminating among fibrin co-factors than the wild type enzyme (Fig. The two-chain form of both wild type t-PA and t-PA/K429Y are strongly stimulated by soluble fibrin monomers (DESAFIB), fibrinogen, CNBr fragments of fibrinogen, and a 13 amino acid peptide (P368). Single chain t-PA/R275E, on the other hand, is stimulated strongly by soluble fibrin and fibrinogen and moderately by the CNBr fragments and peptide P368. In striking contrast to these enzymes, single chain t-PA/R275E,K429Y, although dramatically stimulated by fibrin monomers, is virtually nonresponsive to fibrinogen, CNBr fragments of fibrinogen, peptide P368.

The ratio of the specific activity of a plasminogen activator in the presence of fibrin to that in the presence of fibrinogen, or "fibrin selectivity factor", is one indication of the "clot selectivity" an enzyme will demonstrate in vivo. An enzyme with enhanced fibrin selectivity can accomplish efficient thrombolysis while displaying decreased systemic activity. Under the conditions of the assays reported here, the fibrin selectivity is 1.5 for two-chain t-PA, 1.5 for two-chain t-PA/K429Y, and 1.0 for single chain t-PA/R275E. The fibrin selectivity factor for single chain t-PA/R275E,K429Y, however, is 146. This double mutant, therefore, is approximately two orders of magnitude more discriminating between fibrin and fibrinogen than either single or two-chain wild type t-PA.

The single chain form of a zymogen-like variant of t-PA is expected to exhibit reduced activity not only towards substrates (Tables VI and VIII above) but also towards specific WO 98/21320 PCTIU~S97/20226 -27inhibitors. The second order rate constant for inhibition of the single chain form of both t- PA/R275E and t-PA/R275E,K429Y by the serpin plasminogen activator inhibitor, type 1 (PAI-1), the primary physiological inhibitor oft-PA is shown in Table X below. As expected, t-PA/R275E,K429Y exhibited resistance to inhibition by PAI-1. The second order compared with t-PA/R275E.

Table X Inhibition of wild type and variants oft-PA by PAl-1 Enzyme Second order rate constant (M-'s t-PA/R275E 1.8x10 6 t-PA/R275E,K429Y 7.7x10 3 An important finding of this study is that conversion of lysine 429 to tyrosine residue selectively suppresses the activity of single chain t-PA and thereby substantially enhances the zymogenicity of the enzyme. We have demonstrated, in addition, that single chain t- PA/R275E,K429Y is significantly more fibrin stimulated and substantially more fibrin selective than either single or two-chain, wild type t-PA. Single chain t-PA/R275E,K429Y also exhibits marked resistance to inhibition by PAI-1. It is believed that the effects of this mutation are mediated by disruption of a critical salt bridge formed by Lys 429 and Asp 477 that has been predicted to be present in single- but not two-chain t-PA. The primary role of this putative salt bridge is believed to be stabilization of the active conformation of single chain t-PA. Two-chain t-PA/K429Y, therefor, as demonstrated in this study, is expected to maintain high enzymatic activity.

These results aid in the design of improved thrombolytic agents. For Example t- PA/R275E,K429Y, exhibits significantly enhanced fibrin stimulation, dramatically increased discrimination among fibrin co-factors, marked resistance to inhibition by PAI-1, and substantially increased zymogenicity, a combination of properties that enhance the therapeutic utility of the enzyme.

The foregoing is intended to be illustrative of the present invention, but not limiting. Numerous variations and modifications of the present invention may be effected without departing from the true spirit and scope of the invention.

WO 98/21320 PCTfUS97/20226 -28- SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: Madison, Edwin L (ii) TITLE OF INVENTION: TISSUE TYPE PLASMINOGEN ACTIVATOR (t-PA) VARIANTS HAVING ZYMOGEN CHARACTERISTICS: COMPOSITIONS AND METHODS OF USE (iii) NUMBER OF SEQUENCES: 1 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: McDonnell Boehnen Hulbert Berghoff STREET: 300 South Wacker Drive, 32nd Floor CITY: Chicago STATE: IL COUNTRY: USA ZIP: 60606 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version #1.30 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE:

CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION: NAME: Zimmerman, Roger P REGISTRATION NUMBER: 38,670 REFERENCE/DOCKET NUMBER: 97,707 (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: 312-913-0001 TELEFAX: 312-913-0002 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 527 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens WO 98/2 1320 29 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:i: PCT1US97/20226 Ser Tyr Gin Vai Ile Cys Arg Asp Giu Lys Thr Gin Met Ile Tyr Gin GinI Tyr Lys Ala Giy Gly Cys Arg Arg 145 Gly Asn Ser Leu Giy 225 .is Cys Ser s0 Leu Lys Ile Thr Arg 130 Asn Lys Ser Leu Ile 210 Let Gin Trp Cys Tyr Cys Ser Asn 115 Pro Pro Tyr Asp Thr 195 Giy Giy Ser Cys Ser Phe Cys Tyr 100 Trp Asp Asp Ser Cys 180 Giu Lys Lys rrp A~sn Giu Ser Giu Arg Asn Aia Arg Ser 165 Tyr Sex Va] Hi! Leu Arg I Ser Giy3 Pro Arg 55 Asp~ phe 70 Ile Asp Gly Thr Ser Ser Ile Arg 135 Asp Ser 150 Giu Phe Phe Gly Giy Ala LTyr Thr 215 s Asn Tyr 230 ~ro krg I0 ys Lral rhr rrp Ala 120 Leu Lys Cys Asn Ser 200 Aia Cys Vai Al a Phe Cys Arg Ser 1.05 Leu Giy Pro Ser Giy 1.85 Cys Gin Arg iAr G1l 26! iPh~ Leu A Gin C Asn G Gin C Ala '2 90 Thr .Z AlaC Leu Trp Thr 170 Ser Leu Asn Asn Arg 250 rLeu e Ala .rg Ser Asn ys His Ser liy Gly Thr ~ys Pro Giu '5 'hr Cys Tyr lia Giu Ser ln Lys Pro .125 31y Asn His 140 lys Tyr Val 1-55 Pro Aia Cys Ala Tyr Arg Pro Trp Asn 205 Pro Ser Ala 220 Pro Asp Giy krg lal :ys fly flu Gly 110 Tyr Asn Phe Ser Gly 190 Ser Gin Asp Gli SeJ 27( Se Vai C Pro GinC Phe1 Asp Ala Ser Tyr Lys Giu 175 Thr Met Ala Ala iTyr 255 SGin 0 r His flu Tal ln kla 31n flu Gly Cys Ala 160 Gly His Ile Leu Lys 240 Cys Pro Pro Pro Trp Cys His Val Leu Lys Asr Asp Gin Vai *Phe Pro Gilu Ser 260 Ile 245 Cys Lys 235 Leu Arg Asp Ser Gly Thr Gly CyE Let Thr Gin Ile Trp Tyr Ala 275 280 285 Trp Gin Ala Ala Ile Phe Ala Lys His Arg Arg Ser Pro Gly Giu Arg WO 98/21320 WO 98/ 1320PCT/US97/20226 290 Phe Leu Cys Gly Gly 305 295 Ala His Leu Gly Giu Val Asp Asn 370 Ala Gin 385 Leu Gin Asp Glu Val Arg Arg Thr 450 Gly Pro 465 Pro Leu Ser Trp Cys Arg Giu 355 Asp Giu Leu Ala Leu 435 Val Gin Val Gly Phe Thr 340 Lys Ile Ser Pro Leu 420 Tyr Thr Al a Cys Leu 500 Gin 325 Tyr Tyr Ala Ser Asp 405 Ser Pro Asp Asn Leu 485 Gly Ile Leu 310 Giu Arg Arg Vai Ile Val Leu Leu 375 Val Val 390 Trp, Thr Pro Phe Ser Ser Asn Met 455 Leu His 470 Asn Asp Cys Gly Leu Asp Ile Phe Val His 360 Gin Arg Glu Tyr Arg 440 Leu Asp Gly Gin Trp 520 Ser Pro Pro 345 Lys Leu Thr Cys Ser 425 Cys Cys Ala Arg Lys 505 Ser Pro 330 Gly Giu Lys Val Giu 410 Giu Thr Ala Cys Met 490 Asp 300 Cys Trp 315 His His Giu Giu Phe Asp Ser Asp 380 Cys Leu 395 Leu Ser Arg Leu Ser Gin Gly Asp 460 Gin Gly 475 Thr Leu Val Pro Ile Leu Giu Asp 365 Ser Pro Gly Lys His 445 Thr Asp Val Gly Leu Thr Gin 350 Asp Ser Pro Tyr Giu 430 Leu Arg Ser Gly Val 510 Ser Vai 335 Lys Thr Arg Ala Gly 415 Al a Leu Ser Gly Ile 495 Tyr Ala 320 Ile Phe Tyr Cys Asp 400 Lys His Asn Gly Gly 480 Ile Thr Lys Val Thr Asn Tyr 515 Ile Arg Asp Asn Met Arg Pro 525 2) INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 527 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: peptide' (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: WO 98/21320 -31- ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: PCTIUS97/20226 Ser Tyr Gin Val Ile Cys Arg Asp Glu Lys Thr Gin Met Ile Tyr Gin Gin I Tyr Lys Ala i Gly Gly Cys Arg Arg 145 Gly Asn Ser Leu Gly 225 Pro Asp jiS :ys 3er eu Lys Ile rhr Arg 130 Asn Lys Ser Leu Ile 210 Leu Trp Val Gin Trp Cys Tyr Cys Ser Asn 115 Pro Pro Tyr Asp Thr 195 Gly Gly Cys Pro 3er :ys Ser Phe Cys Tyr 100 Trp Asp Asp Ser Cys 180 Glu Lys Lys His Sei Trp Asn Glu Ser Glu Arg Asn Ala Arg Ser 165 Tyr Ser Val His Val 245 Cys Leu Ser Pro Asp 70 Ile Gly Ser Ile Asp 150 Glu Phe Gly Tyr Asr 230 Lei Se Arg I Gly 2 Arg .55 Phe Asp Thr Ser Arg 135 Ser Phe Gly Ala Thr 215 Tyr x Lys r Thr 'ro ~rg :ys Jai [hr rrp Ala 120 Leu Lys Cys As Ser 200 Ala Cys Asn Cys Val I 25 Ala C Phe I Cys Arg J Ser 105 Leu Gly Pro Ser Gly 185 Cys Gin Arg Arg Gly 265 seu In !sn 71n kla 90 hr kia Leu Trp Thr 170 Ser Leu Asn Asn Arc 25( Lei Arg Cys I Gly Cys 75 Thr Ala Gin Gly.

Cys 155 Pro Ala Pro Pro Pro 235 Leu 1 Arg jer lis fly Pro Cys Glu Lys Asn 140 Tyr Ala Tyr Trp Ser 220 Asp Thr Gir Asn 1 Ser Thr Glu Tyr Ser Pro 125 His Val Cys Arg Asn 205 Ala Gly Trp Tyr rg 00 lal :ys fly 3lu Gly ryr Asn Phe Ser Gly 190 Ser Gin Asp Glu Ser 270 Val Pro Gin Phe Asp Ala Ser Tyr Lys Glu 175 Thr Met Ala Ala Tyr 255 Gin .lu lal 31n kla Gln Glu Gly Cys Ala 160 Gly His Ile Leu Lys 240 Cys Pro 260 Gin Phe Glu 275 Ile Lys Gly Gly Leu Phe Ala Asp Ile 280 Ala 285 Ser His Pro WO 98/21320 PCTIUS97/20226 -32- Trp Gin Ala Ala Ile Phe Ala Lys His Arg Arg Ser Pro Gly Glu Arg 290 295 300 Phe Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp Ile Leu Ser Ala 305 310 315 320 Ala His Cys Phe Gin Glu Arg Phe Pro Pro His His Leu Thr Val Ile 325 330 335 Leu Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu Glu Gin Lys Phe 340 345 350 Glu Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp Asp Asp Thr Tyr 355 360 365 ._Asp Asn Asp Ile Ala Leu.Leu Gin Leu Lys Ser Asp Ser Ser Arg..Cys 370 375 380 Ala Gin Glu Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Ala Asp 385 390 395 400 Leu Gin Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser Gly Tyr Gly Lys 405 410 415 Glu Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Glu Ala His 420 425 430 Val Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gin His Leu Leu Asn 435 440 445 Arg Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp Thr Arg Ser Gly 450 455 460 Gly Pro Gin Ala Asn Leu His Asp Ala Cys Gin Gly Asp Ser Gly Gly 465 470 475 480 Pro Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu Val Gly Ile Ile 485 490 495 Ser Trp Gly Leu Gly.Cys Gly Gin Lys Asp Val Pro Gly Val Tyr Thr 500 505 510 Lys Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn Met Arg Pro 515 520 525 2) INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 527 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii)-MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO WO 98/21320 33 (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: PCTIUS97/20226 Ser Tyr Gin Val Ile Cys Arg Asp Glu Gin Tyr Lys Ala Gly Gly Cys Arg Arg 145 Gly Asn Ser His Gin Cys Trp Ser Cys Leu Tyr Lys Cys Ile Ser Thr Asn 115 Arg Pro 130 Asn Pro Lys Tyr Ser Asp Leu Thr 195 Ser Cys Ser Phe Cys Tyr 100 Trp Asp Asp Ser Cys 180 Glu Trp Leu Arg Pro Val 25 Asn Ser Gly Arg Ala Giu Pro Arg Cys Phe Ser Asp Phe Vai Cys 70 Glu Ile Asp Thr Arg Arg Gly Thr Trp Ser 105 Asn Ser Ser Ala Leu 120 Aia Ile Arg Leu Gly 135 Arg Asp Ser Lys Pro 150 Ser Giu Phe Cys Ser 165 Tyr Phe Gly Asn Gly 185 Ser Gly Ala Ser Cys 200 Vai Tyr Thr Ala Gin L~ys Leu Gln Asn Gin Al a 90 Thr Al a Leu Trp Thr 170 Ser Leu Asn Asn chr Gin Met Ile Tyr Gin Arg Cys Giy Cys 75 Thr Ala Gin Gly Cys 155 Pro Ala Pro Pro Pro 235 Ser Hi s Giy Pro Cys Giu Lys Asn 140 Tyr Al a Tyr Trp Ser 220 Asp Asn Ser Thr Giu Tyr Ser Pro 125 His Val Cys Arg Asn 205 Ala Gly Trj Arg Val Cys Gly Giu Gly 110 Tyr Asn Phe Ser Gly 190 Ser Gir Asj Gi Val Pro Gin Phe Asp Al a Ser Tyr Lys Giu 175 *Thr *Met Ala Ala 1Tyr 'iu Val Glm Ala Gin Giu Gly Cys Al a 160 Gly His Ile Leu Lys 240 Cys Leu Ile Gly Lys 210 Gly Leu Gly Lys His Asn 225 230 215 Tyr Cys Arg Pro Trp Cys His Val Leu Lys Asn Arg 245 Arg Leu Thr 250 255 Asp Val Pro Ser Cys Ser Thr Cys Gly 260 265 Leu Arg Gin Tyr Ser Gin Pro 270 WO 98/21320 PCT/US97/20226 -34- Gin Trp Phe 305 Ala Leu .Glu Asp Ala 385 Leu His Val Arg Gly 465 Pro Ser Lys Phe Gin 290 Leu His Gly Val Asn 370 Gin Gin Glu Arg Thr 450 Pro Leu Trp Val Glu 275 Ala Cys Cys Arg Glu 355 Asp Glu Leu Ala Leu 435 Val Gin Val Gly Thr Ile Ala Gly Phe Thr 340 Lys Ile Ser Pro Leu 420 Tyr Thr Ala Cys Leu 500 Asn Lys Ile Gly Gin 325 Tyr Tyr Ala Ser Asp 405 Ser Pro Asp Asn Leu 485 Gly Tyr Gly Phe lie 310 Glu Arg Ile Leu Val 390 Trp Pro Ser Asn Leu 470 Asn Cys Leu Gly Ala 295 Leu Arg Val Val Leu 375 Val Thr Phe Ser Met 455 His Asp Gly Asp Leu 280 Lys Ile Phe Val His 360 Gin Arg Glu Tyr Arg 440 Leu Asp Gly Gin Trp 520 Phe His Ser Pro Pro 345 Lys Leu Thr Cys Ser 425 Cys Cys Ala Arg Lys 505 Ala Arg Ser Pro 330 Gly Glu Lys Val Glu 410 Glu Thr Ala Cys Met 490 Asp Asp Arg Cys 315 His Glu Phe Ser Cys 395 Leu Arg Ser Gly Gin 475 Thr Val Ile Ser 300 Trp His Glu Asp Asp 380 Leu Ser Leu Gin Asp 460 Gly Leu Pro Ala Ser 285 Pro Gly Ile Leu Leu Thr Glu Gin 350 Asp Asp 365 Ser Ser Pro Pro Gly Tyr Tyr Glu 430 His Leu 445 Thr Arg Asp Ser Val Gly Gly Val 510 His Pro Glu Arg Ser Ala 320 Val Ile 335 Lys Phe Thr~.T.

Arg Cys Ala Asp 400 Gly Lys 415 Ala His Leu Asn Ser Gly Gly Gly 480 Ile Ile 495 Tyr Thr Ile Arg Asp Asn Met Arg Pro 525 515 INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS: LENGTH: 290 base pairs TYPE: nucleic acid S(C) STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: cDNA WO 98/21320 PCT/US97/20226 (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CTACGGCAAG CATGAGGCCT TGTCTCCTTT CTATTCGGAG CGGCTGAAGG AGGCTCATGT CAGACTGTAC CCATCCAGCC GCTGCACATC ACAACATTTA CTTAACAGAA CAGTCACCGA 120 CAACATGCTG TGTGCTGGAG ACACTCGGAG-CGGCGGGCCC CAGGCAAACT TGCACGACGC 180 CTGCCAGGGC GATTCGGGAG GCCCCCTGGT GTGTCTGAAC GATGGCCGCA TGACTTTGGT 240 GGGCATCATC AGCTGGGGCC TGGGCTGTGG ACAGAAGGAT GTCCCGGGTG 290 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 290 base pairs TYPE: nucleic acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID CTACGGCAAG GACGAGGCCT TGTCTCCTTT CTATTCGGAG CGGCTGAAGG AGGCTCATGT CAGACTGTAC CCATCCAGCC GCTGCACATC ACAACATTTA CTTAACAGAA CAGTCACCGA 120 CAACATGCTG TGTGCTGGAG ACACTCGGAG CGGCGGGCCC CAGGCAAACT TGCACGACGC 180 CTGCCAGGGC GATTCGGGAG GCCCCCTGGT GTGTCTGAAC GATGGCCGCA TGACTTTGGT 240 GGGCATCATC AGCTGGGGCC TGGGCTGTGG ACAGAAGGAT GTCCCGGGTG 290 INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS: LENGTH: 290 base pairs WO 98/21320 PCT/US97/20226 -36- TYPE: nucleic acid STRANDEDNESS: not relevant TOPOLOGY: not relevant MOLECULE TYPE: cDNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: ORGANISM: Homo sapiens (ii) (iii) (iv) (vi) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CTACGGCAAG GAGGAGGCCT TGTCTCCTTT CTATTCGGAG CGGCTGAAGG AGGCTCATGT CAGACTGTAC CCATCCAGCC GCTGCACATC ACAACATTTA CTTAACAGAA CAGTCACCGA CAACATGCTG TGTGCTGGAG ACACTCGGAG CGGCGGGCCC CAGGCAAACT TGCACGACGC CTGCCAGGGC GATTCGGGAG GCCCCCTGGT GTGTCTGAAC GATGGCCGCA TGACTTTGGT GGGCATCATC AGCTGGGGCC TGGGCTGTGG ACAGAAGGAT GTCCCGGGTG 120 180 240 290 INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS: LENGTH: 290 base pairs TYPE: nucleic acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CTACGGCAAG CATGAGGCCT TGTCTCCTTT CTATTCGGAG CGGCTGTATG AGGCTCATGT CAGACTGTAC CCATCCAGCC GCTGCACATC ACAACATTTA CTTAACAGAA CAGTCACCGA CAACATGCTG TGTGCTGGAG ACACTCGGAG CGGCGGGCCC CAGGCAAACT TGCACGACGC CTGCCAGGGC GATTCGGGAG GCCCCCTGGT GTGTCTGAAC GATGGCCGCA TGACTTTGGT GGGCATCATC AGCTGGGGCC TGGGCTGTGG ACAGAAGGAT GTCCCGGGTG WO 98/21320 PCT/S97/20226 -37- INFORMATION FOR SEQ ID NO:8: SEQUENCE CHARACTERISTICS: LENGTH: 23 base pairs TYPE: nucleic acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: CTACGGCAAG GACGAGGCCT TGT 23 INFORMATION FOR SEQ ID NO:9: SEQUENCE CHARACTERISTICS: LENGTH: 23 base pairs TYPE: nucleic acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CTACGGCAAG GAGGAGGCCT TGT 23 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 25 base pairs TYPE: nucleic acid STRANDEDNESS: not relevant TOPOLOGY: not relevant (ii) MOLECULE TYPE: cDNA WO 98/2 1320 -38- (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens PCTIUS97/20226 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1O: CGGAGCGGCT GTATGAGGCT MCATGT

Claims (24)

1. A variant single chain human tissue-type plasminogen activator protein having R275 and at least one other basic amino acid residue in the serine protease region substituted by a non-basic amino acid residue thereby disrupting the salt bridge interaction between aspartate 477 and lysine 429, wherein the other basic amino acid residue in the serine protease region is neither K277 or K416.

2. The protein of claim 1 wherein the non-basic amino acid residue is chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid and having a zymogenicity of at least

3. The protein of claim 1 having a zymogenicity of at least

4. The protein of claim 1 having a zymogenicity of at least 100.

5. The protein of claim 1 having a fibrin stimulation factor of at least 10,000.

6. The protein of claim 1 having a fibrin stimulation factor of at least 20,000.

7. The protein of claim 2 having a fibrin stimulation factor of at least 10,000.

8. The protein of claim 2 having a fibrin stimulation factor of at least 20,000.

9. The protein of claim 3 having a fibrin stimulation factor of at least 20,000. inhibited by The protein of claim 1 wherein the protein is at least a factor of 5 less PAl-1 compared to wild type single chain human tissue-type CD/01134020.5 plasminogen activator protein.

11. The protein of claim 1 wherein the protein is at least a factor of 9 less inhibited by PAl-1 compared to wild type single chain human tissue-type plasminogen activator protein.

12. The protein of claim 1 wherein the protein is at least a factor of 200 less inhibited by PAl-1 compared to wild type single chain human tissue-type plasminogen activator protein.

13. The protein of claim 8 wherein the protein is at least a factor of 9 less inhibited by PAl-1 compared to wild type single chain human tissue-type plasminogen activator protein.

14. The protein of claim 8 wherein the protein is at least a factor of 200 less inhibited by PAl-1 compared to wild type single chain human tissue-type plasminogen activator protein. 15 factor of at least 100. factor of at least 100.

15. The protein of claim 1 wherein the protein has a fibrin selectivity 15 factor of at least 100. 200: 16. The protein of claim 8 wherein the protein has a fibrin selectivity factor of at least 100.

17. The protein of claim 14 wherein the protein has a fibrin selectivity factor of at least 100.

18. A variant single chain human tissue-type plasminogen activator protein selected from the group consisting of R275E, H417D, R275E, H417E and R275E, K429Y.

19. A variant single chain human tissue-type plasminogen activator protein with the amino acid substitutions R275E and K429Y. A polynucleotide encoding the protein of any one of claims 1 to 19. CD/01134020.5 41

21. An expression vector comprising the polynucleotide of claim

22. A cell comprising the expression vector of claim 21.

23. A composition for the treatment of an thrombotic condition comprising a physiologically effective amount of the protein of any one of claims 1 to 19 in a pharmaceutically suitable excipient.

24. The composition of claim 23 wherein the dose of the protein is from about 0.05 milligram per kilogram body weight to about 0.2 milligrams per kilogram body weight. A diagnostic kit comprising antibodies specific to the protein of any one of claims 1 to 19.

26. A diagnostic kit comprising the protein of any one of claims 1 to 19. the 27. A diagnostic kit comprising polynucleotides capable of hybridizing to the polynucleotide of claim

28. A method of making a variant single chain human tissue-type S 15 plasminogen activator protein comprising the steps of culturing the cell of claim 22.

29. The method of claim 28 further comprising the additional step of purifying the protein. A variant single chain human tissue-type plasminogen activator protein, substantially as hereinbefore described with reference to any one of the examples. The Scripps Research Institute By their Registered Patent Attorneys Freehills Carter Smith Beadle 15 May 2001