WO2002074806A2 - New interferon beta-like molecules - Google Patents

New interferon beta-like molecules Download PDF

Info

Publication number
WO2002074806A2
WO2002074806A2 PCT/DK2002/000128 DK0200128W WO02074806A2 WO 2002074806 A2 WO2002074806 A2 WO 2002074806A2 DK 0200128 W DK0200128 W DK 0200128W WO 02074806 A2 WO02074806 A2 WO 02074806A2
Authority
WO
WIPO (PCT)
Prior art keywords
ifnb
polypeptide
amino acid
variant
molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DK2002/000128
Other languages
English (en)
French (fr)
Other versions
WO2002074806A3 (en
Inventor
Poul Baad Rasmussen
Jørn DRUSTRUP
Grethe Rasmussen
Anders Hjelholt Pedersen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Maxygen ApS
Original Assignee
Maxygen ApS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BR0207576-8A priority Critical patent/BR0207576A/pt
Priority to DE60232434T priority patent/DE60232434D1/de
Priority to EP02702228A priority patent/EP1366075B1/en
Priority to IL15605902A priority patent/IL156059A0/xx
Priority to JP2002573813A priority patent/JP2004534523A/ja
Priority to AT02702228T priority patent/ATE432288T1/de
Priority to MXPA03007619A priority patent/MXPA03007619A/es
Priority to HU0303251A priority patent/HUP0303251A2/hu
Priority to SK1188-2003A priority patent/SK11882003A3/sk
Application filed by Maxygen ApS filed Critical Maxygen ApS
Priority to CA002469846A priority patent/CA2469846A1/en
Priority to RU2003128955/13A priority patent/RU2003128955A/ru
Publication of WO2002074806A2 publication Critical patent/WO2002074806A2/en
Publication of WO2002074806A3 publication Critical patent/WO2002074806A3/en
Priority to IS6927A priority patent/IS6927A/is
Priority to NO20033781A priority patent/NO20033781L/no
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/565IFN-beta
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/36Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
    • A61K47/40Cyclodextrins; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/642Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a cytokine, e.g. IL2, chemokine, growth factors or interferons being the inactive part of the conjugate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to new interferon ⁇ (IFNB) molecules, methods of preparing such molecules and the use of such molecules in therapy, in particular for the treatment of multiple sclerosis, viral infections or cancer.
  • IFNB interferon ⁇
  • Interferons are important cyto ines characterized by antiviral, antiproliferative, and immunomodulatory activities. These activities form a basis for the clinical benefits that have been observed in a number of diseases, including hepatitis, various cancers and multiple sclerosis.
  • the interferons are divided into the type I and type II classes.
  • IFNB belongs to the class of type I interferons, which also includes interferons ⁇ , ⁇ and ⁇ , whereas interferon ⁇ is the only known member of the distinct type II class.
  • Human IFNB is a regulatory polypeptide with a molecular weight of 22 kDa consisting of 166 amino acid residues. It can be produced by most cells in the body, in particular fibroblasts, in response to viral infection or exposure to other biologies. It binds to a multimeric cell surface receptor, and productive receptor binding results in a cascade of intracelMar events leading to the expression of IFNB inducible genes which in turn produces effects which can be classified as antiviral, antiproliferative and immunomodulatory.
  • IFNB molecules with a particular glycosylation pattern and methods for their preparation have been reported (EP 287075 and EP 529300).
  • WO 99/03887 discloses PEGylated variants of polypeptides belonging to the growth hormone superfamily, wherein a cysteine residue has been susbstituted with a non-essential amino acid residue located in a specified region of the polypeptide.
  • IFNB is mentioned as one example of a polypeptide belonging to the growth hormone superfamily.
  • WO 00/23114 discloses glycosylated and pegylated IFNB.
  • WO 00/23472 discloses IFNB fusion proteins.
  • WO 00/26354 discloses a method of producing a glycosylated polypeptide variant with reduced allergenicity, which as compared to a corresponding parent polypeptide comprises at least one additional glycosylation site.
  • US 5,218,092 discloses modification of granulocyte colony stimulating factor (G-CSF) and other polypeptides so as to introduce at least one additional carbohydrate chain as compared to the native polypeptide.
  • G-CSF granulocyte colony stimulating factor
  • IFNB is mentioned as one example among many polypeptides that allegedly can be modified according to the technology described in US 5,218,092.
  • Betaseron® also termed interferon ⁇ lb, which is non-glycosylated, produced using recornbinant bacterial cells, has a deletion of the N-terminal methionine residue and the C17S mutation
  • AvonexTM and Rebif® also termed interferon ⁇ la, which is glycosylated, produced using recornbinant mammalian cells
  • IFNB is the first therapeutic intervention shown to delay the progression of multiple sclerosis, a relapsing then progressive inflammatory degenerative disease of the central nervous system. Its mechanism of action, however, remains largely unclear. It appears that IFNB has inhibitory effects on the proliferation of leukocytes and antigen presentation. Furthermore, IFNB may modulate the profile of cytokine production towards an anti-inflammatory phenotype. Finally, IFNB can reduce T-cell migration by inhibiting the activity of T-cell matrix metalloproteases. These activities are likely to act in concert to account for the mechanism of IFNB in MS (Neural. 51 :682-689, 1998).
  • IFNB may be used for the treatment of osteosarcoma, basal cell carcinoma, cervical dysplasia, glioma, acute myeloid leukemia, multiple myeloma, Hodgkk s disease, breast carcinoma, melanoma, and viral infections such as papilloma virus, viral hepatitis, herpes genitalis, herpes zoster, herpetic keratitis, herpes simplex, viral encephalitis, cytomegalovirus pneumonia, and rhinovirus.
  • Various side effects are associated with the use of current preparations of IFNB, including injection site reactions, fever, chills, myalgias, arthralgias, and other flu-like symptoms (Clin. Therapeutics, 19:883-893, 1997).
  • PCT/DK00/00471 discloses novel IFNB conjugates comprising a non-polypeptide moiety attached to an IFNB polypeptide which have been modified by introduction and/or deletion of attachment sites for a non-polypeptide moiety such as PEG and of glycosylation sites.
  • the molecules have improved properties, such as improved half-life and/or reduced reactivity with neutralizing antibodies raised against current IFNB products.
  • This application discloses improved IFNBmolecules having desired properties.
  • the invention relates a glycosylated variant of a parent IFNB polypeptide comprising at least one in vivo glycosylation site, wherein an amino acid residue of said parent polypeptide located close to said glycosylation site has been modified to obtain a variant polypeptide having increased glycosylation as compared to the glycosylation of the parent IFNB polypeptide.
  • the invention relates to a method of increasing in vivo glycosylation of a parent IFNB molecule that comprises at least one in vivo glycosylation site, which method comprises i) substituting an amino acid residue occupying a first position located close to the in vivo glycosylation site of the parent IFNB molecule with a second amino acid residue to produce a variant IFNB molecule, ii) measuring the degree of glycosylation of the variant relative to that of the parent
  • IFNB molecule as obtained from expression in a glycosylating host cell under comparable conditions, iii) if necessary repeating step i) to substitute the second amino acid residue with a third amino acid residue and/or to substitute an amino acid residue located in a second position close to the glycosylation site with a second amino acid residue and repeating step ii) of either the parent molecule or the variant molecule resulting from step i) , steps i)-iii) being repeated until an increased in vivo glycosylation is obtained.
  • the invention relates to an interferon ⁇ polypeptide having an amino acid sequence which differs from that of wild-type human interferon ⁇ with the amino acid sequence shown in SEQ ID NO 2 and comprising one of the following sets of mutations: D110F; C17S+D110F; C17S+Q49N+Q51T; C17S+F111N+R113T;
  • the invention relates to an interferon ⁇ polypeptide having the amino acid sequence: MSYNLLGFLQ RSSNFQSQKL LWQLNGRLEY CLKDRMNFDI PEEIKQLQNF
  • LRNFYFLNRL TGYLRN optionally comprising one or more polymers, eg one or more PEG molecules.
  • the invention relates to an interferon ⁇ polypeptide having the amino acid sequence:
  • the invention relates to a glycosylated variant of an interferon ⁇ polypeptide having an amino acid sequence which differs from that of wild-type human interferon ⁇ with the amino acid sequence shown in SEQ ID NO 2 and comprising one of the following sets of mutations:
  • C17S+K19R+K33R+K45R optionally comprising one or more polymers, eg one or more PEG molecules.
  • the invention relates to a glycosylated variant of an interferon ⁇ polypeptide having the amino acid sequence:
  • LRNFYFLNRL TGYLRN optionally comprising one or more polymers, eg one or more PEG molecules.
  • the invention relates to a glycosylated variant of an interferon ⁇ polypeptide having the amino acid sequence:
  • LRNFYFLNRL TGYLRN optionally comprising one or more polymers, eg one or more PEG molecules.
  • the invention relates to means and methods for preparing a variant polypeptide of the invention, including nucleotide sequences and expression vectors encoding the polypeptide as well as methods for preparing the polypeptide.
  • the invention relates to a therapeutic composition comprising a variant of the invention, to a composition of the invention for use in therapy, to the use of a composition in therapy or for the manufacture of a medicament for treatment of diseases.
  • Fig. 1 is a Western blot of optimised glycosylation variants of hlFNB (as described in
  • Lane 1 wt hlFNB, lane 2, [Q49N, Q51T]hIFNB, lane 3, [Q48F, Q49N, Q51T]hIFNB, lane 4, [Q48V, Q49N, Q51T]hIFNB, lane 5, [Q48W, Q49N, Q51T]hIFNB, lane 6, Marker, lane 7, [Fl 1 IN, Rl 13T]hIFNB, lane 8, [Dl 10F, Fl 1 IN, Rl 13T]hIFNB, and lane 9 [D110V, F111N, R113T]hIFNB.
  • PCT/DKOO/00471 Parts of co-pending PCT/DKOO/00471 are essential for fully describing the present invention and have been incorporated into the present description. These parts are indicated by reference to PCT/DKOO/00471. It will be understood that those parts form part of the present invention to the extent that, e.g., the polypeptide variants described in PCT/DKOO/00471, may be used as parent IFNB polypeptides for the modifications described herein. Also, novel inventive concepts based on the conjugates or polypeptides disclosed in PCT/DKOO/00471 are disclosed in the present application.
  • conjugate (or interchangeably “conjugated polypeptide”) is intended to indicate a heterogeneous (in the sense of composite or chimeric) molecule formed by the covalent attachment of one or more polypeptide(s) to one or more non-polypeptide moieties.
  • covalent attachment means that the polypeptide and the non-polypeptide moiety are either directly covalently joined to one another, or else are indirectly covalently joined to one another through an intervening moiety or moieties, such as a bridge, spacer, or linkage moiety or moieties using an attachment group present in the polypeptide.
  • the conjugate is soluble at relevant concentrations and conditions, i.e. soluble in physiological fluids such as blood.
  • conjugated polypeptides of the invention include glycosylated and/or PEGylated polypeptides.
  • the term “non-conjugated polypeptide” may be used about the polypeptide part of the conjugate.
  • non-polypeptide moiety is intended to indicate a molecule that is capable of conjugating to an attachment group of a polypeptide of the invention. Preferred examples of such molecule include polymer molecules, sugar moieties, lipophilic compounds, or organic derivatizing agents. When used in the context of a conjugate as described herein it will be understood that the non-polypeptide moiety is linked to the polypeptide part of the conjugate through an attachment group of the polypeptide.
  • polymer molecule is defined as a molecule formed by covalent linkage of two or more monomers, wherein none of the monomers is an amino acid residue, except where the polymer is human albumin or another abundant plasma protein.
  • polymer may be used interchangeably with the term “polymer molecule”.
  • the term is intended to cover carbohydrate molecules attached by in vitro glycosylation, i.e. a synthetic glycosylation performed in vitro normally involving covalently linking a carbohydrate molecule to an attachment group of the polypeptide, optionally using a cross-linking agent.
  • Carbohydrate molecules attached by in vivo glycosylation are referred to herein as "a sugar moiety".
  • a sugar moiety Carbohydrate molecules attached by in vivo glycosylation, such as N- or O-glycosylation (as further described below) are referred to herein as "a sugar moiety".
  • non-polypeptide moieties such as polymer molecule(s) or sugar moieties in the conjugate
  • every reference to "a non-polypeptide moiety" contained in a conjugate or otherwise used herein shall be a reference to one or more non-polypeptide moieties, such as polymer molecule(s) or sugar moieties, in the conjugate.
  • attachment group is intended to indicate an amino acid residue group of the polypeptide capable of coupling to the relevant non-polypeptide moiety.
  • a frequently used attachment group is the ⁇ -amino group of lysine or the N-terminal amino group.
  • Other polymer attachment groups include a free carboxylic acid group (e.g. that of the C-terminal amino acid residue or of an aspartic acid or glutamic acid residue), suitably activated carbonyl groups, mercapto groups (e.g. that of cysteine residue), aromatic acid residues (e.g. Phe, Tyr, Trp), hydroxy groups (e.g.
  • attachment group is used in an unconventional way to indicate the amino acid residues constituting an N-glycosylation site (with the sequence N-X'-S/T/C-X", wherein X' is any amino acid residue except proline, X" any amino acid residue that may or may not be identical to X' and preferably is different from proline, N is asparagine and S/T/C is either serine, threonine or cysteine, preferably serine or threonine, and most preferably threonine).
  • the asparagine residue of the N- glycosylation site is the one to which the sugar moiety is attached during glycosylation, such attachment cannot be achieved unless the other amino acid residues of the N-glycosylation site is present.
  • the term "amino acid residue comprising an attachment group for the non-polypeptide moiety" as used in connection with alterations of the amino acid sequence of the parent polypeptide is to be understood as amino acid residues constituting an N-glycosylation site is/are to be altered in such a manner that either a functional N-glycosylation site is introduced into the amino acid sequence or removed from said sequence.
  • the attachment group is the OH-group of a serine or threonine residue.
  • one difference or “differs from” as used in connection with specific mutations is intended to allow for additional differences being present apart from the specified amino acid difference.
  • the IFNB polypeptide may comprise other substitutions that are not related to introduction and/or removal of such amino acid residues.
  • at least one as used about a non-polypeptide moiety, an amino acid residue, a substitution, etc is intended to mean one or more.
  • substitution and “substitution” are used interchangeably herein.
  • amino acid names and atom names are used as defined by the Protein DataBank (PDB) (www.pdb.org) which are based on the IUPAC nomenclature (IUPAC Nomenclature and Symbolism for Amino Acids and Peptides (residue names, atom names e.t.c), Eur. J. Biochem., 138, 9-37 (1984) together with their corrections in Eur. J. Biochem., 152, 1 (1985).
  • PDB Protein DataBank
  • amino acid residue is intended to indicate an amino acid residue contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (He or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gin or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Val or V), tryptophan (Trp or W), and tyrosine (Tyr or Y) residues.
  • C17 (indicates position #17 occupied by a cysteine residue in the amino acid sequence shown in SEQ ID NO 2).
  • C17S (indicates that the cysteine residue of position 17 has been replaced with a serine).
  • the numbering of amino acid residues made herein is made relative to the amino acid sequence shown in SEQ ID NO 2.
  • Ml del is used about a deletion of the methionine residue occupying position 1. Multiple substitutions are indicated with a "+”, e.g.
  • R71N+D73T/S means an amino acid sequence which comprises a substitution of the arginine residue in position 71 with an asparagine and a substitution of the aspartic acid residue in position 73 with a threonine or serine residue, preferably a threonine residue.
  • T/S as used about a given substitution herein means either a T or S residue, preferably a T residue.
  • nucleotide sequence is intended to indicate a consecutive stretch of two or more nucleotide molecules.
  • the nucleotide sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
  • IFNB protein sequence family is used in its conventional meaning, i.e. to indicate a group of polypeptides with sufficiently homologous amino acid sequences to allow alignment of the sequences, e.g. using the CLUSTALW program.
  • An IFNB sequence family is available, e.g. from the PFAM families, version 4.0, or may be prepared by use of a suitable computer program such as CLUSTALW version 1.74 using default parameters (Thompson et al., 1994, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Research, 22:4673-4680).
  • Cell Cell
  • host cell cell
  • cell line cell culture
  • Transformation and “transfection” are used interchangeably to refer to the process of introducing DNA into a cell.
  • operably linked refers to the covalent joining of two or more nucleotide sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed.
  • the nucleotide sequence encoding a presequence or secretory leader is operably linked to a nucleotide sequence for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • operably linked means that the nucleotide sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used, in conjunction with standard recornbinant DNA methods.
  • introduction is primarily intended to mean substitution of an existing amino acid residue, but may also mean insertion of an additional amino acid residue.
  • remove is primarily intended to mean substitution of the amino acid residue to be removed by another amino acid residue, but may also mean deletion (without substitution) of the amino acid residue to be removed.
  • immunogenicity as used in connection with a given substance is intended to indicate the ability of the substance to induce a response from the immune system.
  • the immune response may be a cell or antibody mediated response (see, e.g., Roitt: Essential Immunology (8 th Edition, Blackwell) for further definition of immunogenicity). Immunogenicity may be determined by use of any suitable method known in the art, e.g. in vivo or in vitro, e.g. using the in vitro immunogenicity test outlined in the Materials and Methods section below.
  • reduced immunogenicity as used about a given polypeptide or conjugate is intended to indicate that the conjugate or polypeptide gives rise to a measurably lower immune response than a reference molecule, such as wildtype human IFNB e.g. Rebif or Avonex, or a variant of wild-type human IFNB such as Betaseron, as determined under comparable conditions.
  • a reference molecule such as wildtype human IFNB e.g. Rebif or Avonex
  • Betaseron a variant of wild-type human IFNB such as Betaseron
  • the term "functional in vivo half-life” is used in its normal meaning, i.e. the time at which 50% of a given functionality of the polypeptide or conjugate is retained (such as the time at which 50% of the biological activity of the polypeptide or conjugate is still present in the body/target organ, or the time at which the activity of the polypeptide or conjugate is 50% of the initial value).
  • “serum half-life” may be determined, i.e. the time in which 50% of the polypeptide or conjugate molecules circulate in the plasma or bloodstream prior to being cleared.
  • serum half-life Determination of serum half-life is often more simple than determining functional in vivo half-life and the magnitude of serum half-life is usually a good indication of the magnitude of functional in vivo half-life.
  • Alternative terms to serum half-life include "plasma half-life”, “circulating half-life”, “serum clearance”, “plasma clearance” and “clearance half-life”.
  • the functionality to be retained is normally selected from antiviral, antiproliferative, immunomodulatory or receptor binding activity.
  • Functional in vivo half-life and serum half-life may be determined by any suitable method known in the art as further discussed in the Materials and Methods section hereinafter.
  • the polypeptide or conjugate is normally cleared by the action of one or more of the reticuloendothelial systems (RES), kidney, spleen or liver, or by specific or unspecific proteolysis. Clearance taking place by the kidneys may also be referred to as "renal clearance" and is e.g. accomplished by glomerular filtration, tubular excretion or tubular elimination. Normally, clearance depends on physical characteristics of the polypeptide or conjugate, including molecular weight, size (diameter) (relative to the cut-off for glomerular filtration), charge, symmetry, shape/rigidity, attached carbohydrate chains, and the presence of cellular receptors for the protein. A molecular weight of about 67 kDa is considered to be an important cut-off- value for renal clearance.
  • Reduced renal clearance may be established by any suitable assay, e.g. an established in vivo assay.
  • the renal clearance is determined by administering a labelled (e.g. radiolabelled or fluorescence labelled) polypeptide or polypeptide conjugate to a patient and measuring the label activity in urine collected from the patient.
  • Reduced renal clearance is determined relative to the corresponding non-conjugated polypeptide or the non- conjugated corresponding wild-type polypeptide or a commercial IFNB product under comparable conditions.
  • the term “increased” as used about the functional in vivo half-life or serum half- life is used to indicate that the relevant half-life of the conjugate or polypeptide is statistically significantly increased relative to that of a reference molecule, such as an un-conjugated wildtype human IFNB (e.g. Avonex or Rebif) or an unconjugated variant human IFNB (e.g. Betaseron) as determined under comparable conditions.
  • a reference molecule such as an un-conjugated wildtype human IFNB (e.g. Avonex or Rebif) or an unconjugated variant human IFNB (e.g. Betaseron) as determined under comparable conditions.
  • the term “reduced immunogenicity and/or increased functional in vivo half-life and/or increased serum half-life” is to be understood as covering any one, two or all of these properties.
  • a conjugate or polypeptide as described herein has at least two of these properties, i.e.
  • the conjugate or polypeptide has all properties.
  • the term "under comparable conditions" as used about measuring of relative (rather than absolute) properties of a molecule of the invention and a reference molecule is intended to indicate that the relevant property of the two molecules is assayed using the same assay (i.e. the assay is performed under the same conditions including the same internal standard), and, when relevant, the same type of animals.
  • exhibiting IFNB activity is intended to indicate that the polypeptide or conjugate has one or more of the functions of native IFNB, in particular human wildtype IFNB with the amino acid sequence shown in SEQ ID NO 2 (which is the mature sequence) optionally expressed in a glycosylating host cell or any of the commercially available IFNB products.
  • Such functions include capability to bind to an interferon receptor that is capable of binding IFNB and initiating intracellular signalling from the receptor, in particular a type I interferon receptor constituted by the receptor subunits IFNAR-2 and IFNAR-1 (Domanski et al., The Journal of Biological Chemistry, Vol. 273, No.
  • IFNB activity may be assayed by methods known in the art as exemplified in the Materials and Methods section hereinafter.
  • the polypeptide or conjugate "exhibiting" or “having" IFNB activity is considered to have such activity, when it displays a measurable function, e.g. a measurable receptor binding and stimulating activity (e.g. as determined by the primary or secondary assay described in the Materials and Methods section).
  • IFNB molecule IFNB variant polypeptide
  • IFNB polypeptide IFNB polypeptide
  • parent IFNB is intended to indicate the starting molecule to be improved in accordance with the present invention or, when relevant, the invention according to PCT/DKOO/00471.
  • the parent IFNB belongs to the IFNB sequence family. While the parent IFNB may be of any origin, such as vertebrate or mammalian origin (e.g. any of the origins defined in WO 00/23472), the parent IFNB is preferably wild-type human IFNB with the amino acid sequence shown in SEQ ID NO 2 or a variant thereof.
  • a "variant" is a polypeptide, which differs in one or more amino acid residues from a parent polypeptide, normally in 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid residues.
  • wild-type human IFNB include the polypeptide part of
  • the parent IFNB polypeptide may comprise an amino acid sequence, which is a hybrid molecule between IFNB and another homologous polypeptide, such as interferon ⁇ , optionally containing one or more additional substitutions introduced into the hybrid molecule.
  • a hybrid molecule may contain an amino acid sequence, which differs in more than 10 amino acid residues from the amino acid sequence shown in SEQ ID NO 2.
  • the hybrid molecule exhibits IFNB activity (e.g. as determined in the secondary assay described in the Materials and Methods section herein).
  • variants of wild-type human IFNB that may serve as parent IFNB molecules in the present invention are the variants described in PCT/DKOO/00471 having introduced and/or removed amino acid residues comprising an attachment group for a non-polypeptide moiety, any IFNB molecule described in WO 00/23114, WO 00/23472, WO 99/3887 or otherwise available in the art.
  • the term "functional site" as used about a polypeptide or conjugate of the invention according to PCT/DKOO/00471 or according to the present invention is intended to indicate one or more amino acid residues which is/are essential for or otherwise involved in the function or performance of IFNB, and thus "located at" the functional site.
  • the functional site is e.g. a receptor binding site and may be determined by methods known in the art, preferably by analysis of a structure of the polypeptide complexed to a relevant receptor, such as the type I interferon receptor constituted by IFNAR-1 and IFNAR-2.
  • glycosylation at a given glycosylation site of an IFNB molecule may be increased by modifying one or more amino acid residues located close to said glycosylation site, whether it is an introduced site or a naturally-occurring site.
  • the present invention relates to a glycosylated variant of a parent IFNB polypeptide comprising at least one in vivo glycosylation site, wherein an amino acid residue of said parent polypeptide located close to said glycosylation site has been modified to obtain a variant polypeptide having an increased glycosylation as compared to the glycosylation of the parent polypeptide.
  • variant is used to denote that amino acid residues of the parent polypeptide have been changed.
  • the glycosylated variant may also be termed an IFNB conjugate (comprising a non-polypeptide moiety being a sugar moiety attached to the polypeptide part of the conjugate).
  • the in vivo glycosylation site is an N-glycosylation site, but also an O- glycosylation site is contemplated as relevant for the present invention.
  • the term "increased glycosylation” is intended to indicate increased levels of attached carbohydrate molecules, normally obtained as a consequence of increased (or better) utilization of glycosylation site(s).
  • the increased glycosylation may be determined by any suitable method known in the art for analyzing attached carbohydrate structures.
  • One convenient assay for determining attached carbohydrate structures is the method described in Example 7 and 8 hereinafter.
  • amino acid residue "located close to" a glycosylation site is usually located in position —4, -3. -2, -1, +1, +2, +3 or +4 relative to the amino acid residue of the glycosylation site to which the carbohydrate is attached, in particular in position -2, -1, +1, or +2, such as position -1 or +1.
  • the amino acid residue located close to an N-glycosylation site may be located in position -4, -3, -2, -1 relative to the N- residue, at position X' or X" (in which case the amino acid residue to be introduced is preferably different from proline), or at position +1 relative to the X' ' residue.
  • the amino acid modification is normally a substitution, the substitution being made with any other amino acid residue that gives rise to an increased glycosylation of the IFNB variant as compared to that of the parent IFNB polypeptide.
  • Such other amino acid residue may be determined by trial and error type of experiments (i.e. by substitution of the amino acid residue of the relevant position to any other amino acid residue, and determination of the resulting glycosylation of the resulting variant).
  • parent IFNB polypeptide to be modified in accordance with the present invention may be any polypeptide exhibiting IFNB activity and having at least one glycosylation site, in particular an N-glycosylation site.
  • Suitable parent polypeptides are given in the section hereinabove entitled "Definitions" and may include a wildtype IFNB e.g. wt human IFNB, or a non-naturally occurring IFNB polypeptide, e.g. a variant or fragment of wt human IFNB.
  • the parent IFNB polypeptide may comprise more than one glycosylation site, e.g. 2-10, such as 2-7 or 2-5 glycosylation sites.
  • the glycosylation site may be a naturally-occurring glycosylation site or an introduced glycosylation site, preferably an N-glycosylation site.
  • the N-glycosylation site defined by N80 and T82 of wildtype human IFNB is an example of a naturally occurring glycosylation site.
  • the parent IFNB polypeptide comprises at least one introduced N-glycosylation site
  • said site is preferably located in a position which is equivalent to or being any of those described in the section entitled "Conjugate of the invention according to PCT/DKOO/00471" or “Conjugate of the invention according to PCT/DKOO/00471 wherein the non-polypeptide moiety is a sugar moiety".
  • An "equivalent position” is intended to indicate a position in the amino acid sequence of a given IFNB polypeptide, which is homologous (i.e. corresponding in position in either primary or tertiary structure) to the relevant position in the amino acid sequence shown in SEQ ID NO 2.
  • the "equivalent position” is conveniently determined on the basis of an alignment of members of the IFNB protein sequence family, e.g. using the program CLUSTALW version 1.74 using default parameters (Thompson et al., 1994, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Research, 22:4673-4680) or from published alignments.
  • the parent IFNB polypeptide is wt human IFNB comprising one or more introduced glycosylation sites, which site(s) is/are introduced by means of substitution(s) as defined in the section entitled "Conjugate of the invention according to PCT/DKOO/00471 wherein the non-polypeptide moiety is a sugar moiety".
  • the parent IFNB polypeptide is derived from wt human IFNB it normally also comprises naturally- occurring glycosylation site at position N80.
  • the parent IFNB polypeptide comprises an introduced glycosylation site in a position equivalent to at least one of the following positions 2, 49, 51 or 111 of the amino acid sequence of wt human IFNB with the amino acid sequence shown in SEQ ID NO 2 (as defined by the amino acid substitutions S2N+N4T/S, Q49N+Q51T/S, Q51N+E53T/S or Fl 11N+R113T/S, respectively) and/or comprises a glycosylation site in a corresponding position of that of the wt human IFNB sequence defined by N80+T82.
  • the variant according to the invention prepared from such parent IFNB polypeptide further comprises an amino acid substitution in a position located close to the N- glycosylation site, e.g. in a position corresponding to or being position 1, 48, 50, 79 or 110 of SEQ ID NO 2, the substitution being with an amino acid residue which is different from that occupying the relevant position in the parent polypeptide and capable of giving rise to an increased glycosylation at the relevant glycosylation site as compared to the parent IFNB polypeptide.
  • the variant is prepared from a parent IFNB polypeptide comprising an introduced glycosylation site defined by a substitution equivalent to or being Q49N+Q51T/S of SEQ ID NO 2, the variant further comprising a substitution of the amino acid residue located in an equivalent position to or being K45, Q46, L47, Q48, F50, or K52 of SEQ ID NO 2, the substitution being made to an amino acid residue which gives rise to increased glycosylation at said introduced glycosylation site as compared to that of the parent IFNB polypeptide.
  • the amino acid residue to be substituted is located in a position equivalent to or being Q48.
  • the variant is prepared from a parent IFNB polypeptide comprising an introduced glycosylation site defined by a substitution equivalent to or being Fl 11N+R113.T/S of SEQ ID NO 2, the variant further comprising a substitution of the amino acid residue located in an equivalent position to or being E107, K108, E109, DUO, Tl 12, or Gl 14 of SEQ ID NO 2, the substitution being made to an amino acid residue which gives rise to increased glycosylation at said introduced glycosylation site as compared to that of the parent IFNB polypeptide.
  • the amino acid residue to be substituted is located in a position equivalent to or being DUO.
  • the variant is prepared from a parent IFNB polypeptide comprising an introduced glycosylation site defined by a substitution equivalent to or being Q51N+E53T/S of SEQ ID NO 2, the variant further comprising a substitution of the amino acid residue located in an equivalent position to or being L47, Q48, Q49, F50, K52, or D54 of SEQ ID NO 2, the substitution being made to an amino acid residue which gives rise to increased glycosylation at said introduced glycosylation site as compared to that of the parent IFNB polypeptide.
  • the amino acid residue to be substituted is located in a position equivalent to or being Q49.
  • the variant is prepared from a parent IFNB polypeptide comprising an introduced glycosylation site defined by a substitution equivalent to or being S2N+N4T/S of SEQ ID NO 2, the variant further comprising a substitution of the amino acid residue located in an equivalent position to or being Ml, Y3 or L5 of SEQ ID NO 2, the substitution being made to an amino acid residue which gives rise to increased glycosylation at said introduced glycosylation site as compared to that of the parent IFNB polypeptide.
  • the amino acid residue to be substituted is located in a position equivalent to or being Ml .
  • the amino acid residue to be substituted is located in a position equivalent to or being Ml .
  • the variant is prepared from a parent IFNB polypeptide comprising a naturally occurring glycosylation site located in a position equivalent to or being N80 and T82 of SEQ ID NO 2, the variant further comprising a substitution of the amino acid residue located in an equivalent position to or being S76, T77, E78, W79, E81 or 183 of SEQ ID NO 2, the substitution being made to an amino acid residue which gives rise to increased glycosylation at said introduced glycosylation site as compared to that of the parent IFNB polypeptide.
  • the amino acid residue to be substituted is located in a position equivalent to or being W79.
  • the variant according to this aspect comprises at least one of the following sets of mutations: Q48F,V,W,Y + Q49N+Q51T/S; D 110F,V,Y + F 111N+R113T/S all mutations being indicated relative to the amino acid sequence shown in SEQ ID NO 2. It will be understood that glycosylation from glycosylation sites introduced in other positions than those specifically mentioned above (e.g. in a position occupied by any surface exposed amino acid residue as defined in PCT/DKOO/00471) may be modified analogously to what has been described above.
  • the parent IFNB polypeptide to be modified according to this aspect is free from a free cysteine residue, e.g. from the cysteine residue located in position 17 of SEQ ID NO 2.
  • the parent polypeptide when the parent polypeptide is derived from wt human IFNB the parent comprises a non-cysteine amino acid residue in position 17, e.g. the mutation C17S, relative to the amino acid sequence shown in SEQ ID NO 2.
  • the parent IFNB polypeptide to be modified in accordance with this aspect comprises at least one introduced and/or removed amino acid residue comprising an attachment group for a second non-polypeptide moiety.
  • the introduced and/or removed amino acid residue is as described in the section entitled "Conjugate of the invention according to PCT/DKOO/00471", “Conjugate of the invention according to PCT/DKOO/00471 wherein the non-polypeptide moiety is a molecule that has lysine as an attachment group", "Conjugate of the invention according to PCT/DKOO/00471 wherein the non-polypeptide moiety binds to a cysteine residue", or “Conjugate of the invention according to PCT/DKOO/00471 wherein the non-polypeptide moiety binds to an acid group”, and thus the parent IFNB polypeptide is the polypeptide part of a conjugate as described in any of these sections.
  • the amino acid residue comprising an attachment group for a non-polypeptide moiety is, e.g., a lysine residue.
  • the parent IFNB polypeptide comprises at least one substitution of an amino acid residue located in an equivalent position to or being K19, K33, K45 and K123, the lysine residue preferably being substituted with an R residue. More specifically, the parent IFNB polypeptide may comprise one of the following sets of mutations (indicated relative to SEQ ID NO 2):
  • the variant according to this aspect preferably further comprises the substitution Q48F,N,W,Y.
  • the variant preferably further comprises the substitution Dl 10F,V,Y. It will be understood that when the parent IF ⁇ B polypeptide and thus the variant comprises an introduced and/or removed amino acid residue comprising an attachment group for a second non-polypeptide moiety, the variant is preferably not only glycosylated, but also conjugated to the second non-polypeptide moiety via at least one introduced and/or removed attachment group.
  • the second non-polypeptide moiety is usually different from a sugar moiety, and is normally a polymer, such as PEG.
  • the section entitled " ⁇ on-polypeptide moiety of a conjugate of the invention" describes suitable polymers and other types of non-polypeptide moieties which can be used as second non-polypeptide moieties for conjugation of the variants according to this aspect.
  • the invention relates to an interferon ⁇ polypeptide having an amino acid sequence which differs from that of wild-type human interferon ⁇ with the amino acid sequence shown in SEQ ID NO 2 and comprising one of the following sets of mutations:
  • the invention relates to an interferon ⁇ polypeptide having the amino acid sequence:
  • LRNFYFLNRL TGYLRN optionally comprising one or more polymers, eg one or more PEG molecules.
  • the interferon ⁇ polypeptide further comprises a PEG molecule, in particular a 12kDa or 20kDa PEG, eg. mono-PEG 20kDa.
  • a PEG molecule in particular a 12kDa or 20kDa PEG, eg. mono-PEG 20kDa.
  • PEGylated it usually comprises 1-5 polyethylene glycol (PEG) molecules.
  • the interferon molecule comprises 1-5 PEG molecules, such as 1, 2 or 3 PEG molecules.
  • each PEG molecule has a molecular weight of about 5 kDa (kilo Dalton) to 100 kDa.
  • each PEG molecule has a molecular weight of about 10 kDa to 40 kDa.
  • each PEG molecule has a molecular weight of about 12 kDa.
  • each PEG molecule has a molecular weight of about 20 kDa.
  • the interferon molecule comprises 1-3 PEG molecules each having a molecular weight of about 12 kDa, or 1 PEG molecule having a molecular weight of about 20 kDa.
  • Suitable PEG molecules are available from Shearwater Polymers, Inc. and Enzon, Inc. and may be selected from SS-PEG, NPC-PEG, aldehyd-
  • the invention relates to a method of increasing in vivo glycosylation 5 of a parent IFNB polypeptide that comprises at least one in vivo glycosylation site, which method comprises i) substituting an amino acid residue occupying a first position located close to the in vivo glycosylation site of the parent IFNB polypeptide with a second amino acid residue to produce a variant IFNB polypeptide, l o ii) measuring the degree of glycosylation of the variant relative to that of the parent IFNB polypeptide as obtained from expression in a glycosylating host cell, under comparable conditions, iii) if necessary repeating step i) to substitute the second amino acid residue with a third amino acid residue and/or to substitute an amino acid residue located in a second position close 15 to the glycosylation site with a second amino acid residue and repeating step ii) of either the parent polypeptide or the variant polypeptide resulting from step i), steps i)-iii
  • the parent polypeptide may comprise a naturally-occurring or a non-naturally occurring glycosylation site, and is e.g. a parent polypeptides as defined herein above. 0
  • the amino acid residue located close to a glycosylation site is, e.g., any of those identified in the present section.
  • the invention relates to a glycosylated variant of an interferon ⁇ polypeptide having an amino acid sequence which differs from that of wild-type human interferon ⁇ with the amino acid sequence shown in SEQ ID NO 2 and comprising one of the 5 following sets of mutations:
  • C17S+K19R+K33R+K45R optionally comprising one or more polymers, eg one or more PEG molecules.
  • the invention relates to a glycosylated variant of an interferon ⁇ polypeptide having the amino acid sequence:
  • LRNFYFLNRL TGYLRN optionally comprising one or more polymers, eg one or more PEG molecules.
  • the invention relates to a glycosylated variant of an interferon ⁇ polypeptide having the amino acid sequence:
  • LRNFYFLNRL TGYLRN optionally comprising one or more polymers, eg one or more PEG molecules.
  • the interferon molecule is glycosylated and PEGylated. In a further embodiment, the interferon molecule is glycosylated. In a further embodiment the glycosylated interferon ⁇ polypeptide comprises one to five sugar moieties, such as one to three sugar moieties. When the interferon molecule is glycosylated it is preferably N-glycosylated. When the interferon molecule is glycosylated it usually comprises 1-5 sugar moieties, such as 1-3 sugar moieties. In a further embodiment, the interferon molecule is N-glycosylated, and comprises 1-5 sugar moieties, such as 1-3 sugar moieties.
  • the interferon molecule is N-glycosylated, and comprises 3 sugar moieties.
  • the interferon ⁇ polypeptide has three sugar moieties, that is in position N49, N80, and Nl 11.
  • the glycosylated interferon ⁇ polypeptide further comprises a PEG molecule, in particular a 12kDa or 20kDa PEG, eg. mono-PEG 20kDa.
  • the interferon molecule is PEGylated it usually comprises 1-5 polyethylene glycol (PEG) molecules.
  • the interferon molecule comprises 1-5 PEG molecules, such as 1 , 2 or 3 PEG molecules.
  • each PEG molecule has a molecular weight of about 5 kDa (kilo Dalton) to 100 kDa. In a further embodiment each PEG molecule has a molecular weight of about 10 kDa to 40 kDa. In a further embodiment each PEG molecule has a molecular weight of about 12 kDa. In a further embodiment each PEG molecule has a molecular weight of about 20 kDa.
  • the interferon molecule comprises 1-3 PEG molecules each having a molecular weight of about 12 kDa, or 1 PEG molecule having a molecular weight of about 20 kDa.
  • the interferon ⁇ polypeptide contains 1-3 12 kDa PEG molecules. According to the specific aspects above, in a particular embodiment, the interferon ⁇ polypeptide contains one 20 kDa PEG molecule. Suitable PEG molecules are available from Shearwater Polymers, Inc. and Enzon, Inc. and may be selected from SS-PEG, NPC-PEG, aldehyd-PEG, mPEG-SPA, mPEG-SCM, mPEG-BTC, SC-PEG, tresylated mPEG (US 5,880,255), or oxycarbonyl-oxy-N- dicarboxyimide-PEG (US 5,122,614).
  • glycosylated variants according to this aspect are expressed recombinantiy in a glycosylating host cell, preferably a mammalian host cell such as any of those mentioned in the section entitled "Coupling to a sugar moiety”.
  • the variant according to this aspect has retained most or all of the IFNB expression level (IU/ml) of the parent IFNB polypeptide.
  • IU/ml IFNB expression level
  • the variants according to this aspect normally has any of the improved properties that are described for conjugates according to PCT/DKOO/00471, e.g. any of the improved properties described further above in the section entitled "Conjugate of the invention according to PCT/DK00/00471 ".
  • the variant is one which comprises the mutation L98P relative to a parent IFNB molecule, in particular wild-type human IFNB with the amino acid sequence shown in SEQ ID NO 1.
  • the variant may comprise L98P as the only mutation, or may comprise additional mutations, e.g. any of the mutations described in any of the sections herein, the title of which starts with "Conjugate of the invention according to
  • the variant may comprise the following mutations:
  • variants according to this aspect normally has any of the improved properties that are described for conjugates according to PCT/DKOO/00471, e.g. any of the improved properties described further above in the section entitled "Conjugate of the invention according to PCT/DKOO/00471".
  • the invention relates to a variant IFNB polypeptide which is a fusion protein comprising a) an IFNB polypeptide and b) a human serum albumin polypeptide (HSA).
  • the variant IFNB polypeptide is, e.g., the polypeptide part of conjugate as described in PCT/DKOO/00471 or a glycosylated variant according to the present invention.
  • the HSA is, e.g., wt human serum albumin or a fragment or variant thereof, e.g. any of the human serum albumin fragments disclosed in WO 97/24445. Fusion to human serum albumin is also described in WO 93/15199, WO 93/15200 and EP 413 622.
  • the IFNB polypeptide and the human serum albumin part of the fusion protein may be directly linked or linked via a linker peptide, e.g. as disclosed in WO 97/24445.
  • HSA may be linked to the C-terminal end of the IFNB polypeptide or to the N-terminal end, optionally via a linker peptide.
  • fusion of an IFNB polypeptide to human serum albumin or a variant or fragment thereof results in an overall increased stability of the resulting fusion protein.
  • the variants according to this aspect normally has any of the improved properties that are described for conjugates according to PCT/DKOO/00471, e.g. any of the improved properties described further above in the section entitled "Conjugate of the invention according to PCT/DK00/00471 ".
  • a first aspect of the invention according to PCT/DKOO/00471 relates to a conjugate exhibiting IFNB activity and comprising at least one first non-polypeptide moiety covalently attached to an IFNB polypeptide, the amino acid sequence of which differs from that of wildtype human IFNB in at least one introduced and at least one removed amino acid residue comprising an attachment group for said first non-polypeptide moiety.
  • the IFNB polypeptide is boosted or otherwise altered in the content of the specific amino acid residues to which the relevant non-polypeptide moiety binds, whereby a more efficient, specific and/or extensive conjugation is achieved.
  • removal of one or more attachment groups it is possible to avoid conjugation to the non- polypeptide moiety in parts of the polypeptide in which such conjugation is disadvantageous, e.g.
  • amino acid residue comprising an attachment group for a non-polypeptide moiety is selected on the basis of the nature of the non-polypeptide moiety and, in most instances, on the basis of the conjugation method to be used.
  • the non-polypeptide moiety is a polymer molecule, such as a polyethylene glycol or polyalkylene oxide derived molecule
  • amino acid residues capable of functioning as an attachment group may be selected from the group consisting of lysine, cysteine, aspartic acid, glutamic acid and arginine.
  • the attachment group is an in vivo glycosylation site, preferably an N-glycosylation site.
  • the position of the IFNB polypeptide to be modified is conveniently selected as follows: The position is preferably located at the surface of the IFNB polypeptide, and more preferably occupied by an amino acid residue that has more than 25% of its side chain exposed to the solvent, preferably more than 50% of its side chain exposed to the solvent.
  • positions have been identified on the basis of an analysis of a 3D structure of the human IFNB molecule as described in the Methods section herein.
  • the position to be modified is identified on the basis of an analysis of an IFNB protein sequence family. More specifically, the position to be modified can be one, which in one or more members of the family other than the parent IFNB, is occupied by an amino acid residue comprising the relevant attachment group (when such amino acid residue is to be introduced) or which in the parent IFNB, but not in one or more other members of the family, is occupied by an a ino acid residue comprising the relevant attachment group (when such amino acid residue is to be removed).
  • the distance between amino acid residues located at the surface of the IFNB molecule is calculated on the basis of a 3D structure of the IFNB polypeptide. More specifically, the distance between the CB's of the amino acid residues comprising such attachment groups, or the distance between the functional group (NZ for lysine, CG for aspartic acid, CD for glutamic acid, SG for cysteine) of one and the CB of another amino acid residue comprising an attachment group are determined. In case of glycine, CA is used instead of CB. In the IFNB polypeptide part of a conjugate of the invention according to PCT/DKOO/00471, any of said distances is preferably more than 8 A, in particular more than lOA in order to avoid or reduce heterogeneous conjugation.
  • IFNB polypeptide part of a conjugate of the invention according to PCT/DKOO/00471 attachment groups located at the receptor-binding site of IFNB has preferably been removed, preferably by substitution of the amino acid residue comprising such group.
  • a still further generally applicable approach for modifying an IFNB polypeptide is to shield, and thereby destroy or otherwise inactivate an epitope present in the parent IFNB, by conjugation to a non-polypeptide moiety.
  • Epitopes of human IFNB may be identified by use of methods known in the art, also known as epitope mapping, see, e.g. RomagnoH et al., J.
  • One method is to establish a phage display library expressing random oligopeptides of e.g. 9 amino acid residues. IgGl antibodies from specific antisera towards human IFNB are purified by immunoprecipitation and the reactive phages are identified by immunoblotting.
  • the sequence of the oligopeptide can be determined followed by localization of the sequence on the 3D-structure of the IFNB.
  • epitopes can be identified according to the method described in US 5,041,376. The thereby identified region on the structure constitutes an epitope that then can be selected as a target region for introduction of an attachment group for the non-polypeptide moiety.
  • at least one epitope such as two, three or four epitopes of human recornbinant IFNB (optionally comprising the C17S mutation) are shielded by a non-polypeptide moiety according to the invention described in PCT/DKOO/00471.
  • the conjugate of the invention according to PCT/DKOO/00471 has at least one shielded epitope as compared to wild type human IFNB, optionally comprising the C17S mutation, including any commercially available IFNB.
  • the conjugate of the invention according to PCT/DKOO/00471 comprises a polypeptide that is modified so as to shield the epitope located in the vicinity of amino acid residue Q49 and/or Fi ll. This may be done by introduction of an attachment group for a non-polypeptide moiety into a position located in the vicinity of (i.e. within 4 amino acid residues in the primary sequence or within about lOA in the tertiary sequence) of Q49 and/or Fill. The lOA distance is measured between CB's (CA's in case of glycine). Such specific introductions are described in the following sections.
  • the relevant amino acid residue comprising such group and occupying a position as defined above is preferably substituted with a different amino acid residue that does not comprise an attachment group for the non-polypeptide moiety in question.
  • an amino acid residue comprising such group is introduced into the position, preferably by substitution of the amino acid residue occupying such position.
  • the exact number of attachment groups available for conjugation and present in the IFNB polypeptide is dependent on the effect desired to be achieved by conjugation.
  • the effect to be obtained is, e.g., dependent on the nature and degree of conjugation (e.g. the identity of the non-polypeptide moiety, the number of non-polypeptide moieties desirable or possible to conjugate to the polypeptide, where they should be conjugated or where conjugation should be avoided, etc.).
  • the number (and location of) attachment groups should be sufficient to shield most or all epitopes. This is normally obtained when a greater proportion of the IFNB polypeptide is shielded. Effective shielding of epitopes is normally achieved when the total number of attachment groups available for conjugation is in the range of 1-10 attachment groups, in particular in the range of 2-8, such as 3-7.
  • the conjugate of the invention according to PCT/DKOO/00471 has a molecular weight of at least 67 kDa, in particular at least 70 kDa as measured by SDS-PAGE according to Laemmli, U.K., Nature Vol 227 (1970), p680-85.
  • IFNB has a molecular weight of about 20 kDa, and therefore additional about 50kDa is required to obtain the desired effect. This may be, e.g., be provided by 5, 10, 12, or 20kDa PEG molecules or as otherwise described herein.
  • the total number of amino acid residues to be altered in accordance with the invention according to PCT/DKOO/00471 typically does not exceed 15.
  • the IFNB polypeptide comprises an amino acid sequence, which differs in 1-15 amino acid residues from the amino acid sequence shown in SEQ ID NO 2, such as in 1-8 or in 2-8 amino acid residues, e.g. in 1-5 or in 2-5 amino acid residues from the amino acid sequence shown in SEQ ID NO 2.
  • the IFNB polypeptide comprises an amino acid sequence that differs from the amino acid sequence shown in SEQ ID NO 2 in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid residues.
  • the above numbers represent either the total number of introduced or the total number of removed amino acid residues comprising an attachment group for the relevant non- polypeptide moiety, or the total number of introduced and removed amino acid residues comprising such group.
  • conjugate of the invention according to PCT/DKOO/00471 it is preferred that at least about 50% of all conjugatable attachment groups, such as at least about 80% and preferably all of such groups are occupied by the relevant non-polypeptide moiety. Accordingly, in a preferred embodiment the conjugate of the invention according to PCT/DKOO/00471 comprises, e.g., 1-10 non-polypeptide moieties, such as 2-8 or 3-6.
  • the conjugate of the invention according to PCT/DKOO/00471 has one or more of the following improved properties (determined under comparable conditions):
  • wild-type human IFNB e.g. Avonex or Rebif
  • Betaseron e.g. a reduction of at least 25%, such as at least 50%, and more preferably at least 75%
  • Reduced or no reaction with neutralizing antibodies from patients treated with wildtype human IFNB e.g. Rebif or Avonex
  • Betaseron e.g. a reduction of neutralisation of at least 25%, such as of at least 50%, and preferably of at least 75% as compared to the wildtype human IFNB.
  • the magnitude of the antiviral activity of a conjugate of the invention according to PCT/DKOO/00471 may not be critical, and thus be reduced (e.g. by up to 75%) or increased (e.g. by at least 5%) or equal to that of wild-type human IFNB ((e.g. Avonex or Rebif) or to Betaseron as determined under comparable conditions.
  • wild-type human IFNB (e.g. Avonex or Rebif) or to Betaseron as determined under comparable conditions.
  • the degree of antiviral activity as compared to antiproliferative activity of a conjugate of the invention according to PCT/DKOO/00471 may vary, and thus be higher, lower or equal to that of wildtype human IFNB.
  • Conjugate of the invention according to PCT/DKOO/00471, wherein the non-polypeptide moiety is a molecule that has lysine as an attachment group is a molecule that has lysine as an attachment group
  • the first non- polypeptide moiety has lysine as an attachment group, and thus the IFNB polypeptide is one that comprises an amino acid sequence that differs from that of wildtype human IFNB in at least one introduced and/or at least one removed lysine residue. While the non-polypeptide moiety may be any of those binding to a lysine residue, e.g.
  • the ⁇ -amino group thereof such as a polymer molecule, a lipophilic group, an organic derivatizing agent or a carbohydrate moiety, it is preferably any of the polymer molecule mentioned in the section entitled "Conjugation to a polymer molecule", in particular a branched or linear PEG or polyalkylene oxide.
  • the polymer molecule is PEG and the activated molecule to be used for conjugation is SS-PEG, NPC-PEG, aldehyd-PEG, mPEG-SPA, mPEG-SCM, mPEG-BTC from Shearwater Polymers, Inc, SC-PEG from Enzon, Inc., tresylated mPEG as described in US 5,880,255, or oxycarbonyl-oxy-N-dicarboxyimide-PEG (US 5,122,614).
  • the non-polypeptide moiety has a molecular weight of about 5, 10, 12 or 20 kDa.
  • the amino acid sequence of the IFNB polypeptide differs from that of human wildtype IFNB in at least one removed lysine residue, such as 1-5 removed lysine residues, in particular 1-4 or 1-3 removed lysine residues.
  • the lysine residue(s) to be removed preferably by replacement, is selected from the group consisting of K19, K33, K45, K52, K99, K105, K108, Kl 15, K123, K134, and K136.
  • the lysine residue(s) may be replaced with any other amino acid residue, but is preferably replaced by an arginine or a glutamine residue in order to give rise to the least structural difference.
  • the polypeptide part may be one, wherein K19, K45, K52 and/or K123, preferably K19, K45 and/or K123 has/have been replaced with another any other amino acid residue, preferably arginine or glutamine.
  • the IFNB polypeptide part of a conjugate of the invention according to PCT/DKOO/00471 comprises a combination of amino acid substitutions selected from the following list: K19R+K45R+K123R; K19Q+K45R+K123R; K19R+K45Q+K123R; K19R+K45R+K123Q; K19Q+K45Q+K123R; K19R+K45Q+K123Q;
  • K19R+K45Q or K19Q+K45Q.
  • polypeptide part may comprise at least one substitution selected from the group consisting of K33R, K33Q, K52R, K52Q, K99R, K99Q, K105R, K105Q, K108R, K108Q, K115R,
  • K115Q, K134R, K134Q, K136R, and K136Q e.g. at least one of the following substitutions: K52R+K134R;
  • the amino acid sequence of the IFNB polypeptide differs from that shown in SEQ ID NO 2 in that a lysine residue has been introduced by substitution of at least one amino acid residue occupying a position that in the parent IFNB molecule is occupied by a surface exposed amino acid residue, preferably an amino acid residue having at least 25%, such as at least 50% of its side chain exposed to the surface.
  • the amino acid residue to be substituted is selected from the group consisting of N4, F8, L9, Rl l, S12, F15, Q16, Q18, L20, W22, Q23, G26, R27, L28, E29, Y30, L32, R35, M36, N37, D39, P41, E42, E43, L47, Q48, Q49, T58, Q64, N65, F67, A68, R71, Q72, D73, S75, S76, G78, N80, E81, 183, E85, N86, A89, N90, Y92, H93, H97, T100, L102, E103, L106, E107, E109, DUO, Fi l l, R113, G114, L116, M117, L120, H121, R124, G127, R128, L130, H131, E137, Y138, H140, 1145, R147, V148, E149, R152, Y155
  • the amino acid sequence of the IFNB polypeptide differs from the amino acid sequence shown in SEQ ID NO 2 in that a lysine residue has been introduced, by substitution, of at least one amino acid residue occupying a position selected from the group consisting of N4, F8, L9, Rl l, S12, G26, R27, E29, R35, N37, D39, E42, L47, Q48, Q49, A68, R71, Q72, D73, S75, G78, N80, E85, N86, A89, Y92, H93, Dl 10, Fl 11, Rl 13, LI 16, H121, R124, G127, R128, R147, V148, Y155, N158, R159, G162 and R165, even more preferably selected from the group consisting of N4, Rl l, G26, R27, Q48, Q49, R71, D73, S75, N80, E85, A89, Y92, H93, Fi l l, R
  • the IFNB polypeptide comprises a substitution to lysine in one or more of the above positions, in particular in 1-15, such as 1-8 or 1-5, and preferably in at least two positions, such as 2-8 or 2-5 positions.
  • the amino acid sequence of the IFNB polypeptide part of a conjugate differs in at least one removed and at least one introduced lysine residue, such as 1-5 or 2-5 removed lysine residues and 1-5 or 2-5 introduced lysine residues.
  • the lysine residues to be removed and introduced preferably are selected from those described in the present section.
  • the total number of conjugatable lysine residues is preferably in the range of 1-10, such as 2-8 or 3-7.
  • the IFNB polypeptide part of the conjugate according to this embodiment of the invention according to PCT/DKOO/00471 may comprise at least one of the following substitutions: R11K, Q48K, Q49K, R71K, S75K, N80K, E85K, A89K, H93K, F111K, R113K, LI 16K and Y155K; more preferably Rl IK, Q49K, R71K, S75K, N80K, E85K, A89K, H93K, Fl 1 IK, Rl 13K, LI 16K and Y155K, in combination with at least one of the substitutions:
  • the IFNB polypeptide comprises at least one of the following substitutions Rl IK, Q49K, R71K, S75K, N80K, E85K, A89K, H93K, Fl 1 IK, Rl 13K, LI 16K and Yl 55K, in particular Q49K, Fl 1 IK and/or N80K, in combination with substitution of at least one of K19, K45, K52 and/or K123, preferably to an R or a Q residue.
  • the IFNB polypeptide comprises at least one of the following substitutions Rl IK, Q49K, R71K, S75K, N80K, E85K, A89K, H93K, Fl 1 IK, Rl 13K, LI 16K and Yl 55K, in particular Q49K, Fl 1 IK and/or N80K, in combination with substitution of at least one of K19, K45, K52 and/or K123, preferably to an R or a Q residue.
  • the IFNB polypeptide comprises at least
  • IFNB polypeptide comprises at least one of the substitutions Q49K, Fl 1 IK and N80K in combination with at least one of the substitutions mentioned above for removal of a lysine residue.
  • the IFNB polypeptide may comprise the following substitutions:
  • Y+Z+Kl 9R+K45Q or Y+Z+Kl 9Q+K45Q, wherein Y is selected from the group of Q49K, F 11 IK, N80K,
  • Q49K+F11 IK, Q49K+N80K, Fl 11K+N80K and Q49K+F111K+N80K and Z is absent or comprises at least one substitution selected from the group consisting of K33R, K33Q, K52R,
  • the IFNB polypeptide comprises the following substitution
  • the IFNB polypeptide may comprise one of the following substitutions: K19R+K45R+F111K+K123R;
  • the IFNB polypeptide may contain the substitution N80K or C17S+N80K, optionally in combination with one or more of K19R/Q; K45R/Q; K52R/Q or K123R/Q.
  • the substitution N80K is of particular interest, when the IFNB polypeptide is expressed in a non-glycosylating host cell, since N80 constitutes part of an inherent glycosylation site of human IFNB and conjugation at such site may mimick natural glycosylation.
  • conjugate according to this aspect of the invention according to PCT/DKOO/00471 comprises at least two first non-polypeptide moieties, such as 2-
  • the invention according to PCT/DKOO/00471 relates a conjugate exhibiting IFNB activity and comprising at least one first non-polypeptide conjugated to at least one cysteine residue of an IFNB polypeptide, the amino acid sequence of which differs from that of wildtype human IFNB in that at least one cysteine residue has been introduced, prefererably by substitution, into a position that in the parent IFNB molecule is occupied by an amino acid residue that is exposed to the surface of the molecule, preferably one that has at least 25%, such as at least 50% of its side chain exposed to the surface.
  • the amino acid residue is selected from the group consisting of F8, L9, Rl 1, SI 2, F15, Q16, Q18, L20, W22, L28, L32, M36, P41, T58, Q64, N65, F67, 183, E85, N86, A89, N90, Y92, H93, H97, TlOO, L102, E103, L106, Ml 17, L120, H121, R124, G127, R128, L130, H131, H140, 1145, R147, V148, E149, R152, Y155, and F156 of SEQ ID NO 2. Additionally or alternatively, the substitution is preferably performed at a position occupied by a threonine or serine residue.
  • such position is selected from the group consisting of S2, S12, S13, T58, S74, S75, S76, T77, T82, TlOO, T112, S118, S119, S139, T144, and T161, more preferably S2, S12, S13, S74, S75, S76, T77, T82, TlOO, T112, S118, SI 19, S139, and T144 (side chain surface exposed), still more preferably S2, S12, S75, S76, T82, TlOO, SI 19 and S139 (at least 25% of its side chain exposed), and even more preferably S12, S75, T82 and TlOO (at least 50% of its side chain exposed).
  • the position is selected from the group consisting of S2, S12, S13, S74, S75, S76, S118, S119 and S139, more preferably S2, S12, S13, S74, S75, S76, S118, S119 and S139, even more preferably S2, S12, S75, S76, SI 19 and S139, and still more preferably S12 and S75.
  • cysteine residues are introduced into the IFNB polypeptide in order to avoid formation of disulphide bridges between two or more introduced cysteine residues.
  • Cl 7 present in wildtype human IFNB may be removed, preferably by substitution, in particular by substitution with S or A.
  • two or more cysteine residues are introduced, such as 2-6 or 2-4 cysteine residues.
  • the IFNB polypeptide part of the conjugate according to this embodiment of the invention according to PCT/DKOO/00471 comprises the mutation L47C, Q48C, Q49C, Dl 10C, Fl 1 IC or Rl 13C, in particular only one of these mutations, optionally in combination with the mutation C17S.
  • the IFNB polypeptide may comprise the substitution C17S+N80C.
  • the first non-polypeptide moiety according to this aspect of the invention according to PCT/DKOO/00471 may be any molecule which, when using the given conjugation method has cysteine as an attachment group (such as a carbohydrate moiety, a lipophilic group or an organic derivatizing agent), it is preferred that the non-polypeptide moiety is a polymer molecule.
  • the polymer molecule may be any of the molecules mentioned in the section entitled "Conjugation to a polymer molecule", but is preferably selected from the group consisting of linear or branched polyethylene glycol or polyalkylene oxide. Most preferably, the polymer molecule is VS-PEG.
  • the conjugation between the polypeptide and the polymer may be achieved in any suitable manner, e.g. as described in the section entitled "Conjugation to a polymer molecule", e.g. in using a one step method or in the stepwise manner referred to in said section.
  • the IFNB polypeptide comprises only one conjugatable cysteine residue, this is preferably conjugated to a first non-polypeptide moiety with a molecular weight of at least 20kDa, either directly conjugated or indirectly through a low molecular weight polymer (as disclosed in WO 99/55377).
  • the conjugate comprises two or more first non-polypeptide moieties, normally each of these has a molecular weight of 5 or lOkDa.
  • the invention according to PCT/DKOO/00471 relates to a conjugate exhibiting IFNB activity and comprising at least one first non-polypeptide moiety having an acid group as the attachment group, which moiety is conjugated to at least one aspartic acid residue or one glutamic acid residue of an IFNB polypeptide, the amino acid sequence of which differs from that of wildtype human IFNB in at least one introduced and/or at least one removed aspartic acid or glutamic acid residue, respectively.
  • the relevant amino acid residue may be introduced in any position occupied by a surface exposed amino acid residue, preferably by an amino acid residue having more than 25% of its side chain surface exposed.
  • At least one amino acid residue occupying a position selected from the group consisting of N4, L5, L6, F8, L9, Q10, Rll, S12, S13, F15, Q16, Q18, K19, L20, W22, Q23, L24, N25, G26, R27, Y30, M36, Q46, Q48, Q49, 166, F67, A68, 169, F70, R71, S75, T82, 183, L87, A89, N90, V91, Y92, H93, Q94, 195, N96, H97, K108, Fi ll, LI 16, L120, K123, R124, Y126, G127, R128, L130, H131, Y132, K134, A135, H140, T144, R147, Y155, F156, Nl 58, Rl 59, Gl 62, Yl 63 and Rl 65 has been substituted with an aspartic acid residue or a glutamic acid
  • the position is selected from the group consisting of N4, L5, F8, L9, Rl l, S12, F15, Q16, Q18, K19, W22, Q23, G26, R27, Y30, M36, Q46, Q48, Q49, A68, R71, S75, T82, A89, 90, Y92, H93, N96, H97, K108, Fill, LI 16, L120, K123, R124, G127, R128, L130, H131, K134, A135, H140, Y155, N158, R159, G162, Y163 and R165, such as from the group consisting of N4, L5, F8, S12, F15, Q16, K19, W22, Q23, R27, Y30, M36, Q46, Q48, Q49, R71, S75, T82, A89, Y92, H93, K108, Fi l l, L116, K123, R124, G127, H131, K134
  • the conjugate according to this aspect of the invention according to PCT/DKOO/00471 comprises at least two first non-polypeptide moieties.
  • the amino acid sequence of the IFNB polypeptide differs from that of human wildtype IFNB in at least one removed aspartic acid or glutamic acid residue, such as 1-5 removed residues, in particular 1-4 or 1-3 removed aspartic acid or glutamic acid residues.
  • the residue(s) to be removed, preferably by replacement, is selected from the group consisting of D34, D39, D54, D73, DUO, E29, E42, E43, E53, E61, E81, E85, E103, E104, E107, E109, E137 and E149.
  • the aspartic acid or glutamic acid residue(s) may be replaced with any other amino acid residue, but is preferably replaced by an arginine or a glutamine residue.
  • the first non-polypeptide moiety can be any non- polypeptide moiety with such property, it is presently preferred that the non-polypeptide moiety is a polymer molecule or an organic derivatizing agent having an acid group as an attachment group, in particular a polymer molecule such as PEG, and the conjugate is prepared, e.g., as described by Sakane and Pardridge, Pharmceutical Research, Vol. 14, No. 8, 1997, pp 1085- 1091. Normally, for conjugation to an acid group the non-polypeptide moiety has a molecular weight of about 5 or 10 kDa.
  • the conjugate of the invention according to PCT/DKOO/00471 may comprise a second non- polypeptide moiety of a different type as compared to the first non-polypeptide moiety.
  • a second non- polypeptide moiety is a sugar moiety, in particular an N-linked sugar moiety. While the second non-polypeptide moiety may be attached to a natural glycosylation site of human IFNB, e.g.
  • N80 it is normally advantageous to introduce at least one additional glycosylation site in the IFNB polypeptide.
  • site is e.g. any of those described in the immediately subsequent section entitled "Conjugate of the invention according to PCT/DKOO/00471 wherein the non-polypeptide moiety is a sugar moiety".
  • at least one additional glycosylation site is introduced this may be accompanied by removal of an existing glycosylation site as described below.
  • the IFNB polypeptide may be modified in the number and distribution of attachment groups for the first as well as the second non-polypeptide moiety so as to have e.g. at least one removed attachment group for the first non-polypeptide moiety and at least one introduced attachment group for the second non-polypeptide moiety or vice versa.
  • the IFNB polypeptide comprises at least two (e.g. 2-5) removed attachment groups for the first non-polypeptide moiety and at least one (e.g. 1-5) introduced attachment groups for the second non-polypeptide moiety or vice versa.
  • the first non-polypeptide moiety is a polymer molecule such as PEG having lysine as an attachment group
  • the second non- polypeptide moiety is an N-linked sugar moiety
  • the conjugate of the invention according to PCT/DKOO/00471 maybe one exhibiting IFNB activity and comprising at least one polymer molecule, preferably PEG, and at least one sugar moiety covalently attached to an IFNB polypeptide, the amino acid sequence of which differs from that of wild-type human IFNB in a) at least one introduced and/or at least one removed amino acid residue comprising an attachment group for the polymer molecule; and b) at least one introduced and/or at least one removed in vivo glycosylation site, in particular an N-glycosylation site.
  • the IFNB polypeptide comprises one of the following sets of mutations:
  • the conjugate of the invention according to PCT/DKOO/00471 comprises at least one sugar moiety attached to an in vivo glycosylation site, in particular an N-glycosylation site
  • this is either the natural N-glycosylation site of wild-type human IFNB at position N80, i.e. defined by amino acid residues N80, E81, T82 and 183, or a new in vivo glycosylation site introduced into the IFNB polypeptide.
  • the in vivo glycosylation site may be an O-glycosylation site, but is preferably an N-glycosylation site.
  • one aspect the invention according to PCT/DKOO/00471 relates to a conjugate exhibiting IFNB activity and comprising an IFNB polypeptide, the amino acid sequence of which differs from that of wild-type human IFNB in at least one introduced glycosylation site, the conjugate further comprising at least one un-PEGylated sugar moiety attached to an introduced glycosylation site.
  • the invention according to PCT/DKOO/00471 relates to a conjugate exhibiting IFNB activity and comprising an IFNB polypeptide, the amino acid sequence of which differs from that of wild-type human IFNB in that a glycosylation site has been introduced or removed. For instance, an in vivo glycosylation site is introduced into a position of the parent
  • IFNB molecule occupied by an amino acid residue exposed to the surface of the molecule, preferably with more than 25% of the side chain exposed to the solvent, in particular more than 50% exposed to the solvent (these positions are identified in the Methods section herein).
  • the N-glycosylation site is introduced in such a way that the N-residue of said site is located in said position.
  • an O-glycosylation site is introduced so that the S or T residue making up such site is located in said position.
  • the in vivo glycosylation site in particular the N residue of the N-glycosylation site or the S or T residue of the O-glycosylation site, is located within the first 141 amino acid residues of the IFNB polypeptide, more preferably within the first 116 amino acid residues. Still more preferably, the in vivo glycosylation site is introduced into a position wherein only one mutation is required to create the site (i.e. where any other amino acid residues required for creating a functional glycosylation site is already present in the molecule).
  • Substitutions that lead to introduction of an additional N-glycosylation site at positions exposed at the surface of the IFNB molecule and occupied by amino acid residues having more than 25% of the side chain exposed to the surface include: S2N+N4S/T, L6S/T, L5N+G7S/T, F8N+Q10S/T, L9N+R11S/T, RUN, R11N+S13T, S12N+N14S/T, F15N+C17S/T, Q16N+Q18S/T, Q18N+L20S/T, K19N+L21S/T, W22N+L24S/T, Q23N+H25S/T, G26N+L28S/T, R27N+E29S/T, L28S+Y30S/T, Y30N+L32S/T, L32N+D34S/T, K33N+R35S/T, R35N+N37S/T, M36N+
  • Substitutions that lead to introduction of an additional N-glycosylation site at positions exposed at the surface of the IFNB molecule having more than 50% of the side chain exposed to the surface include: L6S/T, L5N+G7S/T, F8N+Q10S/T, L9N+R11S/T, S12N+N14S/T, F15N+C17S/T, Q16N+Q18S/T, K19N+L21S/T, W22N+L24S/T, Q23N+H25S/T, G26N+L28S/T,
  • Substitutions that lead to introduction of an N-glycosylation site by only one amino acid substitution include: L6S/T, RUN, D39S/T, Q72N, D73N, S75N, L88S/T, Y92S/T, L98S/T,
  • Dl ION, LI 16N, E137N, R159N and L160S/T are preferred that is selected from the group consisting of L6S/T, RUN, D39S/T, Q72N, D73N, S75N, L88S/T, Y92S/T, L98S/T, Dl 1 ON and LI 16N, more preferably from the group consisting of L6S/T,
  • the presently most preferred IFNB polypeptide according to this aspect of the invention according to PCT/DKOO/00471 includes at least one of the following substitutions: S2N+N4T/S, L9N+R11T/S, Rl IN, S12N+N14T/S, F15N+C17S/T, Q16N+Q18T/S,
  • the IFNB polypeptide comprises one of the following sets of substitutions :
  • amino acid residue in between the N-residue and the S/T residue is different from proline.
  • amino acid residue in between will be that occupying the relevant position in the amino acid sequence shown in SEQ ID NO 2.
  • position 50 is the position in between.
  • the IFNB polypeptide part of a conjugate of the invention according to PCT/DKOO/00471 may contain a single in vivo glycosylation site.
  • the polypeptide comprises more than one in vivo glycosylation site, in particular 2-7 in vivo glycosylation sites, such as 2, 3, 4, 5, 6 or 7 in vivo glycosylation sites.
  • the IFNB polypeptide may comprise one additional glycosylation site, or may comprise two, three, four, five, six, seven or more introduced in vivo glycosylation sites, preferably introduced by one or more substitutions described in any of the above lists.
  • existing glycosylation sites may have been removed from the IFNB polypeptide.
  • any of the above listed substitutions to introduce a glycosylation site may be combined with a substitution to remove the natural N-glycosylation site of human wild-type IFNB.
  • the IFNB polypeptide may comprise a substitution of N80, e.g. one of the substitutions N80K/C/D/E, when a first non-polypeptide polypeptide is one having one of K, C, D, E as an attachment group.
  • the IFNB polypeptide may comprise at least one of the following substitutions: S2N+N4T/S, L9N+R11T/S, RUN, S12N+N14T/S, F15N+C17S/T, Q16N+Q18T/S, K19N+L21T/S, Q23N+H25T/S, G26N+L28T/S, R27N+E29T/S, L28N+Y30T/S, D39T/S, K45N+L47T/S, Q46N+Q48T/S, Q48N+F50T/S, Q49N+Q51T/S, Q51N+E53T/S, R71N+D73T/S, Q72N, D73N, S75N, S76N+G78T/S, L88T/S, Y92T/S, N93N+I95T/S, L98T/S, E103N+K105T/S, E104N+
  • the IFNB polypeptide may comprise the substitution: Q49N+Q51T or Fl 1 IN+Rl 13T or R71N+D73T, in particular Q49N+Q51T+F11 IN+Rl 13T or Q49N+Q51T+R71N+D73T+ Fl 11N+ Rl 13T, in combination with N80K/C/D/E.
  • any of the glycosylated variants disclosed in the present section having introduced and/or removed at least one glycosylation site may further be conjugated to a polymer molecule, such as PEG, or any other non-polypeptide moiety.
  • the conjugation may be achieved by use of attachment groups already present in the IFNB polypeptide or attachment groups may have been introduced and/or removed, in particular such that a total of 1-6, in particular 3-4 or 1, 2, 3, 4, 5, or 6 attachment groups are available for conjugation.
  • the number and molecular weight of the non-polypeptide moiety is chosen so as that the total molecular weight added by the non-polypeptide moiety is in the range of 20- 40 kDa, in particular about 20 kDa or 30 kDa.
  • the glycosylated variant may be conjugated to a non-polypeptide moiety via a lysine attachment group, and one or more lysine residues of the parent polypeptide may have been removed, e.g. by any of the substitutions mentioned in the section entitled "Conjugate of the invention, wherein the non-polypeptide moiety is a molecule which has lysine as an attachment group", in particular the substitutions K19R+K45R+K123R.
  • a lysine residue may have been introduced, e.g. by any of the substitutions mentioned in said section, in particular the substitution R71K.
  • one specific conjugate of the invention according to PCT/DKOO/00471 is one, which comprises a glycosylated IFNB polypeptide comprising the mutations Q49N + Q51T + Fl 1 IN + Rl 13T + K19R + K45R + K123R or Q49N + Q51T + Fl l lN + R113T + K19R + K45R + K123R + R71K further conjugated to PEG.
  • the glycosylated polypeptide part of said conjugate is favourably produced in CHO cells and PEGylated subsequent to purification using e.g.
  • the glycosylated conjugate according to this embodiment of the invention according to PCT/DKOO/00471 may be PEGylated via a cysteine group as described in the section entitled "Conjugate of the invention according to PCT/DKOO/00471, wherein the non-polypeptide moiety is a molecule that has cysteine as an attachment group" (for this purpose the IFNB polypeptide may, e.g.
  • the IFNB polypeptide part of the conjugate may contain further substitutions.
  • a preferred example is a substitution of any of the residues, Ml, C17, N80 or V101, e.g. one or more of the following substitutions: C17S; N80K/C/D/E; V101Y/W/F/,H; a deletion of Ml; or M1K.
  • the substitution M1K is of particular interest when the IFNB polypeptide is expressed with a tag, e.g. a His- 14tag, where such tag is to be removed by DAP (diaminopeptidase) subsequent to purification and/or conjugation.
  • non-polypeptide moiety of the conjugate of the present invention and of the invention according to PCT/DKOO/00471 is preferably selected from the group consisting of a polymer molecule, a lipophilic compound, a sugar moiety (by way of in vivo glycosylation) and an organic derivatizing agent. All of these agents may confer desirable properties to the polypeptide part of the conjugate, in particular reduced immunogenicity and/or increased functional in vivo half-life and/or increased serum half-life.
  • the polypeptide part of the conjugate may be conjugated to only one type of non-polypeptide moiety, but may also be conjugated to two or more different types of non-polypeptide moieties, e.g.
  • non-polypeptide moieties may be done simultaneous or sequentially.
  • the choice of non-polypeptide moiety/ies e.g. depends on the effect desired to be achieved by the conjugation. For instance, sugar moieties have been found particularly useful for reducing immunogenicity, whereas polymer molecules such as PEG are of particular use for increasing functional in vivo half-life and/or serum half-life.
  • Using a polymer molecule as a first non- polypeptide moiety and a sugar moiety as a second non-polypeptide moiey may result in reduced immunogenicity and increased functional in vivo or serum half-life.
  • polypeptide groups may function as attachment groups: the N-terminal or C-terminal of the polypeptide, the hydroxy groups of the amino acid residues Ser, Thr or Tyr, the ⁇ -amino group of Lys, the SH group of Cys or the carboxyl group of Asp and Glu.
  • the polypeptide and the lipophilic compound may be conjugated to each other, either directly or by use of a linker.
  • the lipophilic compound may be a natural compound such as a saturated or unsaturated fatty acid, a fatty acid diketone, a terpene, a prostaglandin, a vitamine, a carotenoide or steroide, or a synthetic compound such as a carbon acid, an alcohol, an amine and sulphonic acid with one or more alkyl-, aryl-, alkenyl- or other multiple unsaturated compounds.
  • the conjugation between the polypeptide and the lipophilic compound, optionally through a linker may be done according to methods known in the art, e.g. as described by Bodanszky in Peptide Synthesis, John Wiley, New York, 1976 and in WO 96/12505.
  • the polymer molecule to be coupled to the polypeptide may be any suitable polymer molecule, such as a natural or synthetic homo-polymer or heteropolymer, typically with a molecular weight in the range of 300-100,000 Da, such as 300-20,000 Da, more preferably in the range of 500-10,000 Da, even more preferably in the range of 500-5000 Da.
  • a suitable polymer molecule such as a natural or synthetic homo-polymer or heteropolymer, typically with a molecular weight in the range of 300-100,000 Da, such as 300-20,000 Da, more preferably in the range of 500-10,000 Da, even more preferably in the range of 500-5000 Da.
  • homo-polymers examples include a polyol (i.e. poly-OH), apolyamine (i.e. poly-NH 2 ) and a polycarboxylic acid (i.e. poly-COOH).
  • a hetero-polymer is a polymer, which comprises one or more different coupling groups, such as, e.g., a hydroxyl group and an amine group.
  • suitable polymer molecules include polymer molecules selected from the group consisting of polyalkylene oxide (PAO), including polyalkylene glycol (PAG), such as polyethylene glycol (PEG) and polypropylene glycol (PPG), branched PEGs, poly-vinyl alcohol (PVA), poly-carboxylate, poly-(vinylpyrolidone), polyethylene-co-maleic acid anhydride, polystyrene-co-malic acid anhydride, dextran including carboxymethyl-dextran, or any other biopolymer suitable for reducing immunogenicity and/or increasing functional in vivo half-life and/or serum half-life.
  • PEO polyalkylene oxide
  • PAG polyalkylene glycol
  • PEG polyethylene glycol
  • PPG polypropylene glycol
  • PVA poly-vinyl alcohol
  • PVA poly-carboxylate
  • poly-(vinylpyrolidone) polyethylene-co-maleic acid anhydride
  • PEG is the preferred polymer molecule to be used, since it has only few reactive groups capable of cross-linking compared, e.g., to polysaccharides such as dextran, and the like.
  • monofunctional PEG e.g monomethoxypolyethylene glycol (mPEG)
  • mPEG monomethoxypolyethylene glycol
  • the coupling chemistry is relatively simple (only one reactive group is available for conju- gating with attachment groups on the polypeptide). Consequently, the risk of cross-linking is eliminated, the resulting polypeptide conjugates are more homogeneous and the reaction of the polymer molecules with the polypeptide is easier to control.
  • the interferon molecule is PEGylated it usually comprises 1-5 polyethylene glycol (PEG) molecules.
  • the interferon molecule comprises 1-5 PEG molecules, such as 1, 2 or 3 PEG molecules.
  • each PEG molecule has a molecular weight of about 5 kDa (kilo Dalton) to 100 kDa.
  • each PEG molecule has a molecular weight of about 10 kDa to 40 kDa.
  • each PEG molecule has a molecular weight of about 12 kDa.
  • each PEG molecule has a molecular weight of about 20 kDa.
  • the interferon molecule comprises 1-3 PEG molecules each having a molecular weight of about 12 kDa, or 1 PEG molecule having a molecular weight of about 20 kDa.
  • Suitable PEG molecules are available from Shearwater Polymers, Inc. and Enzon, Inc. and may be selected from SS-PEG, NPC-PEG, aldehyd-PEG, mPEG-SPA, mPEG-SCM, mPEG- BTC, SC-PEG, tresylated mPEG (US 5,880,255), or oxycarbonyl-oxy-N-dicarboxyimide-PEG (US 5,122,614).
  • the hydroxyl end groups of the polymer molecule must be provided in activated form, i.e. with reactive functional groups (examples of which include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl proprionate (SPA), succinimidyl carboxymethylate (SCM), benzotriazole carbonate (BTC), N-hydroxysuccinimide (NHS), aldehyde, nitrophenylcarbonate (NPC), and tresylate (TRES)).
  • reactive functional groups include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl proprionate (SPA), succinimidyl carboxymethylate (SCM), benzotriazole carbonate (BTC), N-hydroxysuccinimide (NHS
  • activated polymer molecules are commercially available, e.g. from Shearwater Polymers, Inc., Huntsville, AL, USA or PolyMasc, UK.
  • the polymer molecules can be activated by conventional methods known in the art, e.g. as disclosed in WO 90/13540.
  • Specific examples of activated linear or branched polymer molecules for use in the present invention are described in the Shearwater Polymers, Inc. 1997 and 2000 Catalogs (Functionalized Biocompatible Polymers for Research and pharmaceuticals, Polyethylene Glycol and Derivatives, incorporated herein by reference).
  • Specific examples of activated PEG polymers include the following linear PEGs: NHS-PEG (e.g.
  • SPA-PEG SSPA-PEG, SBA- PEG, SS-PEG, SSA-PEG, SC-PEG, SG-PEG, and SCM-PEG), and NOR-PEG
  • BTC-PEG EPOX-PEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES-PEG, VS-PEG, IODO-PEG, and MAL-PEG
  • branched PEGs such as PEG2-NHS and those disclosed in US 5,932,462 and US 5,643,575, both of which references are incorporated herein by reference.
  • the conjugation of the polypeptide and the activated polymer molecules is conducted by use of any conventional method, e.g. as described in the following references (which also describe suitable methods for activation of polymer molecules): Harris and Zalipsky, eds., Poly(ethylene glycol) Chemistry and Biological Applications, AZC, Washington; R.F. Taylor, (1991), “Protein immobilisation. Fundamental and applications", Marcel Dekker, N.Y.; S.S. Wong, (1992), “Chemistry of Protein Conjugation and Crosslinking", CRC Press, Boca Raton; G.T. Hermanson et al., (1993), “Immobilized Affinity Ligand Techniques", Academic Press, N.Y.).
  • the activation method and/or conjugation chemistry to be used depends on the attachment group(s) of the IFNB polypeptide as well as the functional groups of the polymer (e.g. being amino, hydroxyl, carboxyl, aldehyde or sulfydryl).
  • the PEGylation may be directed towards conjugation to all available attachment groups on the polypeptide (i.e. such attachment groups that are exposed at the surface of the polypeptide) or may be directed towards specific attachment groups, e.g. the N-terminal amino group (US 5,985,265).
  • the conjugation may be achieved in one step or in a stepwise manner (e.g. as described in WO 99/55377).
  • the PEGylation is designed so as to produce the optimal molecule with respect to the number of PEG molecules attached, the size and form (e.g. 5 whether they are linear or branched) of such molecules, and where in the polypeptide such molecules are attached.
  • the molecular weight of the polymer to be used may be chosen on the basis of the desired effect to be achieved. For instance, if the primary purpose of the conjugation is to achieve a conjugate having a high molecular weight (e.g. to reduce renal clearance) it is usually desirable to conjugate as few high Mw polymer molecules as possible to l o obtain the desired molecular weight.
  • a high degree of epitope shielding when a high degree of epitope shielding is desirable this may be obtained by use of a sufficiently high number of low molecular weight polymer (e.g. with a molecular weight of about 5,000 Da) to effectively shield all or most epitopes of the polypeptide. For instance, 2-8, such as 3-6 such polymers may be used.
  • a sufficiently high number of low molecular weight polymer e.g. with a molecular weight of about 5,000 Da
  • 2-8, such as 3-6 such polymers may be used.
  • the polymer molecule which may be linear or branched, has a high molecular weight, e.g. about 20 kDa.
  • the polymer conjugation is performed under conditions aiming at reacting all available polymer attachment groups with polymer molecules.
  • the molar ratio of activated polymer molecules to polypeptide is 1000-1, in particular 200-1, preferably 100-1, such 20 as 10-1 or 5-1 in order to obtain optimal reaction.
  • equimolar ratios may be used.
  • Suitable linkers are well known to the skilled person.
  • a preferred example is cyanuric chloride (Abuchowski et al., (1977), J. Biol. Chem., 252, 3578-3581; US 4,179,337; Shafer et al., (1986), J. 5 Polym. Sci. Polym. Chem. Ed., 24, 375-378.
  • Covalent in vitro coupling of a carbohydrate moiety to amino acid residues of IFNB 30 may be used to modify or increase the number or profile of carbohydrate substituents.
  • the carbohydrate(s) may be attached to a) arginine and histidine (Lundblad and Noyes, Chemical Reagents for Protein Modification, CRC Press Inc. Boca Raton, Fl), b) free carboxyl groups (e.g. of the C-terminal amino acid residue, asparagine or glutamine), c) free sulfhydryl groups such as that of cysteine, d) free hydroxyl groups such as those of serine, threonine, tyrosine or hydroxyproline, e) aromatic residues such as those of phenylalanine or tryptophan or f) the amide group of glutamine.
  • arginine and histidine Longblad and Noyes, Chemical Reagents for Protein Modification, CRC Press Inc. Boca Raton, Fl
  • free carboxyl groups e.g. of the C-terminal amino acid residue, asparagine or glutamine
  • free sulfhydryl groups such as that of cysteine
  • an IFNB polypeptide as described herein e.g. one that has been modified by introduction of one or more glycosylation sites (see the section "Conjugates of the invention according to PCT/DKOO/00471 wherein the non- polypeptide moiety is a sugar moiety") or by modification of an amino acid residue located close to a glycosylation site (as described in the section entitled "Variants with increased glycosylation")
  • the nucleotide sequence encoding the polypeptide part of the conjugate must be inserted in a glycosylating, eucaryotic expression host.
  • the expression host cell may be selected from fungal (filamentous fungal or yeast), insect, mammalian, animal and fransgenic plant cells or from fransgenic animals. Furthermore, the glycosylation may be achieved in the human body when using a nucleotide sequence encoding a polypeptide described herein in gene therapy.
  • the host cell is a mammalian cell, such as an CHO cell, BHK or HEK cell, e.g. HEK293, or an insect cell, such as an SF9 cell, or a yeast cell, e.g. Saccharomyces cerevisiae, Pichia pastoris or any other suitable glycosylating host, e.g. as described further below.
  • sugar moieties attached to the IFNB polypeptide by in vivo glycosylation are further modified by use of glycosyltransferases, e.g. using the glycoAdvanceTM technology marketed by Neose, Horsham, PA, USA.
  • glycosyltransferases e.g. using the glycoAdvanceTM technology marketed by Neose, Horsham, PA, USA.
  • Covalent modification of the IFNB polypeptide may be performed by reacting (an) attachment group(s) of the polypeptide with an organic derivatizing agent.
  • organic derivatizing agent Suitable derivatizing agents and methods are well known in the art. For example, cysteinyl residues most commonly are reacted with -haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives.
  • Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, ⁇ -bromo- ⁇ -(4-imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2- oxa-l,3-diazole.
  • Histidyl residues are derivatized by reaction with diethylpyrocarbonateat pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain.
  • Para-bromophenacyl bromide also is useful; the reaction is preferably performed in 0.1 M sodium cacodylate at pH 6.0.Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides. Derivatization with these agents has the effect of reversing the charge of the lysinyl residues.
  • Suitable reagents for derivatizing ⁇ -amino-containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4-pentanedione; and transaminase-catalyzed reaction with glyoxylate.
  • Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin.
  • arginine residues requires that the reaction be performed in alkaline conditions because of the high pKa of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine guanidino group.
  • R and R' are different alkyl groups, such as l-cyclohexyl-3-(2-morpholinyl-4-ethyl) carbodiimide or l-ethyl-3-(4-azonia-4,4- dimethylpentyl) carbodiimide.
  • aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
  • polypeptide of the present invention or described in PCT/DKOO/00471, optionally in glycosylated form, may be produced by any suitable method known in the art. Such methods include constructing a nucleotide sequence encoding the polypeptide and expressing the sequence in a suitable transformed or transfected host. However, polypeptides of the invention may be produced, albeit less efficiently, by chemical synthesis or a combination of chemical synthesis or a combination of chemical synthesis and recornbinant DNA technology.
  • the nucleotide sequence of the invention encoding an IFNB polypeptide may be constructed by isolating or synthesizing a nucleotide sequence encoding the parent IFNB, e.g. with the amino acid sequence shown in SEQ ID NO 2, and then changing the nucleotide sequence so as to effect introduction (i.e. insertion or substitution) or deletion (i.e. removal or substitution) of the relevant amino acid residue(s).
  • nucleotide sequence is conveniently modified by site-directed mutagenesis in accordance with well-known methods, see, e.g., Mark et al., "Site-specific Mutagenesis of the Human Fibroblast Interferon Gene", Proc. Natl. Acad. Sci. USA, 81, pp. 5662-66 (1984); and US 4,588,585.
  • the nucleotide sequence is prepared by chemical synthesis, e.g. by using an oligonucleotide synthesizer, wherein oligonucleotides are designed based on the amino acid sequence of the desired polypeptide, and preferably selecting those codons that are favored in the host cell in which the recornbinant polypeptide will be produced.
  • oligonucleotides coding for portions of the desired polypeptide may be synthesized and assembled by PCR, ligation or ligation chain reaction (LCR).
  • LCR ligation chain reaction
  • the individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.
  • the nucleotide sequence encoding the IFNB polypeptide is inserted into a recornbinant vector and operably linked to control sequences necessary for expression of the IFNB in the desired transformed host cell.
  • vectors and expression control sequences function equally well to express the nucleotide sequence encoding a polypeptide variant described herein. Neither will all hosts function equally well with the same expression system. However, one of skill in the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation. For example, in selecting a vector, the host must be considered because the vector must replicate in it or be able to integrate into the chromosome. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. In selecting an expression control sequence, a variety of factors should also be considered.
  • Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the nucleotide sequence, their secretion characteristics, their ability to fold the polypeptide correctly, their fermentation or culture requirements, and the ease of purification of the products coded for by the nucleotide sequence.
  • the recornbinant vector may be an autonomously replicating vector, i.e. a vector which exists as an exfrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
  • the vector is one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
  • the vector is preferably an expression vector, in which the nucleotide sequence encoding the polypeptide of the invention is operably linked to additional segments required for transcription of the nucleotide sequence.
  • the vector is typically derived from plasmid or viral DNA.
  • suitable expression vectors for expression in the host cells mentioned herein are commercially available or described in the literature.
  • Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus.
  • Specific vectors are, e.g., pCDNA3.1(+) ⁇ Hyg (Invitrogen, Carlsbad, CA, USA) and pCI-neo (Stratagene, La Jola, CA, USA).
  • Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E. coli, including pBR322, p ⁇ T3a and pET12a (both from Novagen Inc., WI, USA), wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g.
  • Useful expression vectors for yeast cells include the 2 ⁇ plasmid and derivatives thereof, the POT1 vector (US 4,931,373), the pJSO37 vector described in (Okkels, Ann. New York Acad. Sci. 782, 202-207, 1996) and pPICZ A, B or C (Invitrogen).
  • Useful vectors for insect cells include pVL941, pBG311 (Gate et al., "Isolation of the Bovine and Human Genes for Mullerian Inhibiting Substance And Expression of the Human Gene In Animal Cells", Cell, 45, pp. 685-98 (1986), pBluebac 4.5 and pMelbac (both available from Invitrogen).
  • vectors for use in this invention include those that allow the nucleotide sequence encoding the polypeptide variant to be amplified in copy number.
  • amplifiable vectors are well known in the art. They include, for example, vectors able to be amplified by DHFR amplification (see, e.g., Kaufman, U.S. Pat. No. 4,470,461, Kaufman and Sharp, "Construction Of A Modular Dihydrofolate Reductase cDNA Gene: Analysis Of Signals Utilized For Efficient Expression", Mol. Cell. Biol., 2, pp. 1304-19 (1982)) and glutamine synthetase ("GS”) amplification (see, e.g., US 5,122,464 and EP 338,841).
  • the recornbinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
  • a DNA sequence enabling the vector to replicate in the host cell in question.
  • An example of such a sequence is the SV40 origin of replication.
  • suitable sequences enabling the vector to replicate are the yeast plasmid 2 ⁇ replication genes REP 1-3 and origin of replication.
  • the vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g. ampicillin, kanamycin, tetracyclin, chloramphenicol, neomycin, hygromycin or methotrexate.
  • selectable markers include amdS, pyrG, arcB, niaD, sC.
  • control sequences is defined herein to include all components, which are necessary or advantageous for the expression of the IFNB polypeptide.
  • Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, enhancer or upstream activating sequence, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter.
  • a wide variety of expression control sequences may be used in the present invention.
  • Such useful expression control sequences include the expression control sequences associated with structural genes of the foregoing expression vectors as well as any sequence known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • suitable control sequences for directing transcription in mammalian cells include the early and late promoters of SV40 and adenovirus, e.g.
  • the adenovirus 2 major late promoter the MT-1 (metallothionein gene) promoter, the human cytomegalovirus immediate- early gene promoter (CMV), the human elongation factor l ⁇ (EF-l ⁇ ) promoter, the Drosophila minimal heat shock protein 70 promoter, the Rous Sarcoma Virus (RSV) promoter, the human ubiquitin C (UbC) promoter, the human growth hormone terminator, SV40 or adenovirus Elb region polyadenylation signals and the Kozak consensus sequence (Kozak, M. J Mol Biol 1987 Aug 20;196(4):947-50).
  • CMV cytomegalovirus immediate- early gene promoter
  • EF-l ⁇ human elongation factor l ⁇
  • EF-l ⁇ Drosophila minimal heat shock protein 70 promoter
  • RSV Rous Sarcoma Virus
  • UbC human ubiquitin C
  • the human growth hormone terminator SV40 or adenovirus Elb region polya
  • a synthetic intron may be inserted in the 5' untranslated region of the nucleotide sequence encoding the polypeptide of interest.
  • An example of a synthetic intron is the synthetic intron from the plasmid pCI-Neo (available from Promega Corporation, WI, USA).
  • suitable control sequences for directing transcription in insect cells include the polyhedrin promoter, the P10 promoter, the Autographa calif ornica polyhedrosis virus basic protein promoter, the baculo virus immediate early gene 1 promoter and the baculo virus 39K delayed-early gene promoter, and the SV40 polyadenylation sequence.
  • control sequences for use in yeast host cells include the promoters of the yeast ⁇ -mating system, the yeast triose phosphate isomerase (TPI) promoter, promoters from yeast glycolytic genes or alcohol dehydogenase genes, the ADH2-4c promoter and the inducible GAL promoter.
  • TPI yeast triose phosphate isomerase
  • control sequences for use in filamentous fungal host cells include the ADH3 promoter and terminator, a promoter derived from the genes encoding Aspergillus oryzae TAKA amylase triose phosphate isomerase or alkaline protease, an A. niger ⁇ -amylase, A. niger or A. nidulans glucoamylase, A. nidulans acetamidase, Rhizomucor miehei aspartic proteinase or lipase, the TPI1 terminator and the ADH3 terminator.
  • control sequences for use in bacterial host cells include promoters of the lac system, the trp system, the TA C or TRC system and the major promoter regions of phage lambda.
  • the nucleotide sequence of the invention encoding an IFNB polypeptide may or may not also include a nucleotide sequence that encode a signal peptide.
  • the signal peptide is present when the polypeptide is to be secreted from the cells in which it is expressed. Such signal peptide, if present, should be one recognized by the cell chosen for expression of the polypeptide.
  • the signal peptide may be homologous (e.g. be that normally associated with human IFNB) or heterologous (i.e. originating from another source than human IFNB) to the polypeptide or may be homologous or heterologous to the host cell, i.e.
  • the signal peptide may be prokaryotic, e.g. derived from a bacterium such as E. coli, or eukaryotic, e.g. derived from a mammalian, or insect or yeast cell.
  • the presence or absence of a signal peptide will, e.g., depend on the expression host cell used for the production of the polypeptide, the protein to be expressed (whether it is an intracellular or extracellular protein) and whether it is desirable to obtain secretion.
  • the signal peptide may conveniently be derived from a gene encoding an Aspergillus sp. amylase or glucoamylase, a gene encoding a Rhizomucor miehei lipase or protease or a Humicola lanuginosa lipase.
  • the signal peptide is preferably derived from a gene encoding A. oryzae TAKA amylase, A.
  • the signal peptide may conveniently be derived from an insect gene (cf. WO 90/05783), such as the lepidopteran Manduca sexta adipokinetic hormone precursor, (cf. US 5,023,328), the honeybee melittin (Invitrogen), ecdysteroid UDPglucosylfransferase (egt) (Murphy et al., Protein Expression and Purification 4, 349-357 (1993) or human pancreatic lipase (hpl) (Methods in Enzymology 284, pp. 262-272, 1997).
  • insect gene cf. WO 90/05783
  • the lepidopteran Manduca sexta adipokinetic hormone precursor cf. US 5,023,328
  • the honeybee melittin Invitrogen
  • ecdysteroid UDPglucosylfransferase egt
  • hpl human pancreatic lipase
  • a preferred signal peptide for use in mammalian cells is that of human IFNB apparent from the examples hereinafter or the murine Ig kappa light chain signal peptide (Coloma, M (1992) J. Imm. Methods 152:89-104).
  • suitable signal peptides have been found to be the ⁇ -factor signal peptide from S. cereviciae. (cf. US 4,870,008), the signal peptide of mouse salivary amylase (cf. O. Hagenbuchle et al.,Nature 289, 1981, pp. 643-646), a modified carboxypeptidase signal peptide (cf. L.A. Vails et al., Cell 48, 1987, pp.
  • Any suitable host may be used to produce the IFNB polypeptide, including bacteria, fungi (including yeasts), plant, insect, mammal, or other appropriate animal cells or cell lines, as well as fransgenic animals or plants.
  • bacterial host cells include grampositive bacteria such as strains of Bacillus, e.g. B. brevis or B.
  • a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff- Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).
  • filamentous fungal host cells examples include strains of Aspergillus, e.g. A. oryzae, A. niger, or A. nidulans, Fusarium or Trichoderma.
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
  • Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and US 5,679,543.
  • Suitable methods for transforming Fusarium species are described by Malardier et al, 1989, Gene 78: 147-156 and WO 96/00787.
  • Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N.
  • yeast host cells examples include strains of Saccharomyces, e.g. S. cerevisiae, Schizosaccharomyces, Klyveromyces, Pichia, such as P. pastoris or P. methanolica, Hansenula, such as H. Polymorpha or Yarrowia.
  • suitable insect host cells include aLepidoptora cell line, such as Spodoptera frugiperda Sf9 or Sf21) or Trichoplusioa ni cells (High Five) (US 5,077,214). Transformation of insect cells and production of heterologous polypeptides therein may be performed as described by Invitrogen.
  • Suitable mammalian host cells include Chinese hamster ovary (CHO) cell lines, (e.g. CHO-K1; ATCC CCL-61), Green Monkey cell lines (COS) (e.g. COS 1 (ATCC CRL-1650), COS 7 (ATCC CRL-1651)); mouse cells (e.g. NS/O), Baby Hamster Kidney (BHK) cell lines (e.g. ATCC CRL-1632 or ATCC CCL-10), and human cells (e.g. HEK 293 (ATCC CRL-1573)), as well as plant cells in tissue culture.
  • COS Green Monkey cell lines
  • BHK Baby Hamster Kidney
  • HEK 293 ATCC CRL-1573
  • Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland.
  • the mammalian cell such as a CHO cell
  • sialyltransferase e.g. 1,6-sialyltransferase, e.g. as described in US 5,047,335, in order to provide improved glycosylation of the IFNB polypeptide.
  • Methods for introducing exogeneous DNA into mammalian host cells include calcium phosphate-mediated transfection, electroporation, DEAE-dextran mediated transfection, liposome-mediated transfection, viral vectors and the transfection methods described by Life Technologies Ltd, Paisley, UK using Lipofectamin 2000 and Roche Diagnostics Corporation, Indianapolis, USA using FuGENE 6. These methods are well known in the art and e.g.
  • the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art.
  • the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art.
  • suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture
  • polypeptide If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
  • the resulting polypeptide may be recovered by methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.
  • polypeptides may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), elecfrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • elecfrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction
  • the biological activity of the IFNB polypeptides can be assayed by any suitable method known in the art.
  • assays include antibody neutralization of antiviral activity, induction of protein kinase, oligoadenylate 2,5-A synthetase or phosphodiesterase activities, as described in EP 41313 Bl.
  • assays also include immunomodulatory assays (see, e.g., US 4,753,795), growth inhibition assays, and measurement of binding to cells that express interferon receptors.
  • Specific assays for determining the biological activity of polypeptides or conjugates of the invention are disclosed in the Materials and Methods section hereinafter.
  • the IFNB molecule of the invention is administered at a dose approximately paralleling that employed in therapy with human IFNB such as Avonex, Rebif and Betaseron, or a higher dosis.
  • the exact dose to be administered depends on the circumstances. Normally, the dose should be capable of preventing or lessening the severity or spread of the condition or indication being treated. It will be apparent to those of skill in the art that an effective amount of an IFNB molecule depends, inter alia, upon the disease, the dose, the administration schedule, whether the molecule is administered alone or in conjunction with other therapeutic agents, the serum half-life of the compositions, and the general health of the patient.
  • the IFNB molecules of the invention can be used "as is" and/or in a salt form thereof.
  • Suitable salts include, but are not limited to, salts with alkali metals or alkaline earth metals, such as sodium, potassium, lithium, calcium and magnesium, as well as e.g. zinc salts. These salts or complexes may by present as a crystalline and/or amorphous structure.
  • the molecule of the invention is preferably administered in a composition further including a pharmaceutically acceptable carrier or excipient.
  • a pharmaceutically acceptable carrier or excipient means a carrier or excipient that does not cause any untoward effects in patients to whom it is administered. Such pharmaceutically acceptable carriers and excipients are well known in the art.
  • the molecule of the invention can be formulated into pharmaceutical compositions by well-known methods. Suitable formulations are described in US 5,183,746, Remington's Pharmaceutical Sciences by E.W.Martin, 18 th edition, A. R. Gennaro, Ed., Mack Publishing Company [1990]; Pharmaceutical Formulation Development of Peptides and Proteins, S. Frokjaer and L. Hovgaard, Eds., Taylor & Francis [2000]; and Handbook of Pharmaceutical Excipients, 3rd edition, A. Kibbe, Ed., Pharmaceutical Press [2000]).
  • the molecule of the invention may be formulated into a pharmaceutical composition in a variety of forms, including liquid, gel, lyophilized, pulmonary dispersion, or any other suitable form, e.g. as a compressed solid.
  • suitable form e.g. as a compressed solid. The preferred form will depend upon the particular indication being treated and will be apparent to one of skill in the art.
  • composition of the invention may be administered parenterally (e.g. intravenously, intramuscularly, intraperitoneally, or subcutaneously), orally, intracerebrally, intradermally, intranasally, intrapulmonary, by inhalation, or in any other acceptable manner, e.g. using PowderJect or ProLease technology.
  • parenterally e.g. intravenously, intramuscularly, intraperitoneally, or subcutaneously
  • intracerebrally e.g. intradermally, intranasally, intrapulmonary, by inhalation, or in any other acceptable manner, e.g. using PowderJect or ProLease technology.
  • the preferred mode of administration will depend upon the particular indication being treated and will be apparent to one of skill in the art.
  • composition comprising an IFNB polypeptide without free cysteine
  • IFNB polypeptides that do not have a free cysteine, e.g., the C17 of human IFNB derived polypeptides, has a significantly reduced tendency to aggregate as compared to IFNB polypeptides comprising a free cysteine. This observation has important implications not only in the production of IFNB polypeptides (which becomes less complicated), but also with respect to the need of using stabilizers minimizing the aggregation of IFNB polypeptides when formulated into pharmaceutical products.
  • the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a glycosylated IFNB polypeptide that comprises the substitution C17S (relative to SEQ ID NO 2), the composition comprising a reduced amount of stabilizer as compared to the amount required to prepare a pharmaceutical composition comprising a glycosylated IFNB polypeptide comprising C17 but otherwise having the same amino acid sequence.
  • the amount of stabilizer may be reduced by at least 50%, such as by at least 75% or an even higher percentage.
  • composition comprising an IFNB polypeptide that comprises the substitution C17S (relative to SEQ ID NO 2), the composition being substantially free from a stabilizer.
  • the IFNB polypeptide according to this aspect may be any glycosylated IFNB free from a free cysteine, and may, e.g., by any of the parent IFNB molecules, the polypeptide part of a conjugate (glycosylated and optionally conjugated to a second non-polypeptide moiety), or a glycosylated variant as described herein (i.e. in the sections "Conjugate of the invention according to PCT/DKOO/00471 wherein the non-polypeptide moiety is a sugar moiety" or "Variants with increased glycosylation").
  • the IFNB polypeptide is derived from human IFNB it has an amino acid residue different from cysteine in position 17, and comprises, e.g., the mutation C 17S .
  • the stabilizer which is reduced or not present may be any of those mentioned in the sections below.
  • the stabilizer is HAS or a non-ionic surfactant such as Tween, e.g. Tween 20 or Tween 80.
  • compositions designed for parenteral administration.
  • parenteral formulations may also be provided in frozen or in lyophilized form.
  • the composition must be thawed prior to use.
  • the latter form is often used to enhance the stability of the active compound contained in the composition under a wider variety of storage conditions, as it is recognized by those skilled in the art that lyophilized preparations are generally more stable than their liquid counterparts.
  • Such lyophilized preparations are reconstituted prior to use by the addition of one or more suitable pharmaceutically acceptable diluents such as sterile water for injection or sterile physiological saline solution.
  • parenterals In case of parenterals, they are prepared for storage as lyophilized formulations or aqueous solutions by mixing, as appropriate, the polypeptide having the desired degree of purity with one or more pharmaceutically acceptable carriers, excipients or stabilizers typically employed in the art (all of which are termed "excipients"), for example buffering agents, stabilizing agents, preservatives, isotonifiers, non-ionic detergents, antioxidants and/or other miscellaneous additives.
  • excipients typically employed in the art
  • Buffering agents help to maintain the pH in the range which approximates physiological conditions. They are typically present at a concentration ranging from about 2 mM to about 50 mM Suitable buffering agents for use with the present invention include both organic and inorganic acids and salts thereof such as citrate buffers (e.g., monosodium mecanicte-disodium citrate mixture, citric acid-trisodium citrate mixture, citric acid-monosodium citrate mixture, etc.), succinate buffers (e.g., succinic acid-monosodium succinate mixture, succinic acid- sodium hydroxide mixture, succinic acid-disodium succinate mixture, etc.), tartrate buffers (e.g., tartaric acid-sodium tartrate mixture, tartaric acid-potassium tartrate mixture, tartaric acid- sodium hydroxide mixture, etc.), fumarate buffers (e.g., fumaric acid-monosodium fumarate mixture, fumaric acid-disodium
  • Preservatives are added to retard microbial growth, and are typically added in amounts of about 0.2%-l% (w/v).
  • Suitable preservatives for use with the present invention include phenol, benzyl alcohol, meta-cresol, methyl paraben, propyl paraben, octadecyldimethylbenzyl ammonium chloride, benzalkonium halides (e.g. benzalkonium chloride, bromide or iodide), hexamethonium chloride, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol and 3- ⁇ entanol.
  • Isotonicifiers are added to ensure isotonicity of liquid compositions and include polyhydric sugar alcohols, preferably trihydric or higher sugar alcohols, such as glycerin, erythritol, arabitol, xylitol, sorbitol and mannitol.
  • Polyhydric alcohols can be present in an amount between 0.1% and 25% by weight, typically 1% to 5%, taking into account the relative amounts of the other ingredients.
  • Stabilizers refer to a broad category of excipients which can range in function from a bulking agent to an additive which solubilizes the therapeutic agent or helps to prevent denaturation or adherence to the container wall.
  • Typical stabilizers can be polyhydric sugar alcohols
  • amino acids such as arginine, lysine, glycine, glutamine, asparagine, histidine, alanine, omithine, L-leucine, 2-phenylalanine, glutamic acid, threonine, etc.
  • organic sugars or sugar alcohols such as lactose, trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol, myoinisitol, galactitol, glycerol and the like, including cyclitols such as inositol; polyethylene glycol; amino acid polymers; sulfur-containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, ⁇ -monothioglycerol and sodium thiosulfate; low molecular weight polypeptides (i.e.
  • proteins such as human serum albumin, bovine serum albumin, gelatin or immunoglobulins
  • hydrophilic polymers such as polyvinylpyrrolidone
  • monosaccharides such as xylose, mannose, fructose and glucose
  • disaccharides such as lactose, maltose and sucrose
  • trisaccharides such as raffinose
  • polysaccharides such as dextran.
  • Non-ionic surfactants or detergents also known as "wetting agents” may be present to help solubilize the therapeutic agent as well as to protect the 5 therapeutic polypeptide against agitation-induced aggregation, which also permits the formulation to be exposed to shear surface stress without causing denaturation of the polypeptide.
  • Suitable non-ionic surfactants include polysorbates (20, 80, etc.), polyoxamers (184, 188 etc.), Pluronic® polyols, polyoxyethylene sorbitan monoethers (Tween®-20, Tween®-80, etc.).
  • l o Stabilizers are typically present in the range of from 0.1 to 10,000 parts by weight based on the active protein weight, but may be reduced or absent in case of a pharmaceutical composition of the invention as defined in the section entitled "Pharmaceutical composition comprising an IFNB polypeptide without free cysteine". Additional miscellaneous excipients include bulking agents or fillers (e.g. starch), chelating
  • agents e.g. EDTA
  • antioxidants e.g., ascorbic acid, methionine, vitamin E
  • cosolvents e.g., ascorbic acid, methionine, vitamin E
  • the active ingredient may also be entrapped in microcapsules prepared, for example, by coascervation techniques or by interfacial polymerization, for example hydroxymethylcellulose, gelatin or poly-(methylmethacylate) microcapsules, in colloidal drug delivery systems (for example liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules)
  • Parenteral formulations to be used for in vivo administration must be sterile. This is readily accomplished, for example, by filtration through sterile filtration membranes.
  • sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing the molecule of the invention, the matrices having a suitable form such as a film or microcapsules.
  • sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate) or poly(vinylalcohol)),
  • polylactides copolymers of L-glutamic acid and ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the ProLease® technology or Lupron Depot® (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene- vinyl acetate and lactic acid-glycolic acid enable release of molecules for long periods such as up to or over 100 days, certain hydrogels release proteins for shorter time periods.
  • encapsulated polypeptides When encapsulated polypeptides remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
  • Conjugate or polypeptide formulations suitable for use with a nebulizer, either jet or ultrasonic will typically comprise the molecule dissolved in water at a concentration of, e.g., about 0.01 to 25 mg of conjugate per mL of solution, preferably about 0.1 to 10 mg/mL.
  • the formulation may also include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure), and/or human serum albumin ranging in concentration from 0.1 to 10 mg/ml.
  • buffers that may be used are sodium acetate, citrate and glycine.
  • the buffer has a composition and molarity suitable to adjust the solution to a pH in the range of 3 to 9.
  • buffer molarities of from 1 mM to 50 mM are suitable for this purpose.
  • sugars which can be utilized are lactose, maltose, mannitol, sorbitol, trehalose, and xylose, usually in amounts ranging from 1% to 10% by weight of the formulation.
  • the nebulizer formulation may also contain a surfactant to reduce or prevent surface induced aggregation of the protein caused by atomization of the solution in forming the aerosol.
  • a surfactant to reduce or prevent surface induced aggregation of the protein caused by atomization of the solution in forming the aerosol.
  • Various conventional surfactants can be employed, such as polyoxyethylene fatty acid esters and alcohols, and polyoxyethylene sorbitan fatty acid esters. Amounts generally range between 0.001% and 4% by weight of the formulation.
  • An especially preferred surfactant for purposes of this invention is polyoxyethylene sorbitan monooleate.
  • nebulizers suitable for the practice of this invention are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo., the Acorn II nebulizer, manufactured by Marquest Medical Products, Englewood, Colorado, and the AERx pulmonary drug delivery system manufactured by Aradigm Corporation, Hayward, California.
  • Formulations of the invention for use with a metered dose inhaler device generally comprise a finely divided powder.
  • This powder may be produced by lyophilizing and then milling a liquid formulation and may also contain a stabilizer such as human serum albumin (HSA). Typically, more than 0.5% (w/w) HSA is added.
  • HSA human serum albumin
  • one or more sugars or sugar alcohols may be added to the preparation if necessary. Examples include lactose maltose, mannitol, sorbitol, sorbitose, trehalose, xylitol, and xylose.
  • the amount added to the formulation can range from about 0.01 to 200% (w/w), preferably from approximately 1 to 50%, of the conjugate present.
  • Such formulations are then lyophilized and milled to the desired particle size.
  • the properly sized particles are then suspended in a propellant with the aid of a surfactant.
  • the propellant may be any conventional material employed for this purpose, such as a cnlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof.
  • Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid may also be useful as a surfactant.
  • This mixture is then loaded into the delivery device.
  • An example of a commercially available metered dose inhaler suitable for use in the present invention is the Ventolin metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, N.C.
  • Such formulations for powder inhalers will comprise a finely divided dry powder containing the IFNB molecule and may also include a bulking agent, such as lactose, sorbitol, sucrose, or mannitol in amounts which facilitate dispersal of the powder from the device, e.g., 50% to 90% by weight of the formulation.
  • the particles of the powder shall have aerodynamic properties in the lung corresponding to particles with a density of about 1 g/cm 2 having a median diameter less than 10 micrometers, preferably between 0.5 and 5 micrometers, most preferably of between 1.5 and 3.5 micrometers.
  • powder inhaler suitable for use in accordance with the teachings herein is the Spinhaler powder inhaler, manufactured by Fisons Corp., Bedford, Mass.
  • the powders for these devices may be generated and/or delivered by methods disclosed in US 5997848, US 5993783, US 5985248, US 5976574, US 5922354, US 5785049, US 6,123,936 and US 55654007.
  • composition containing the molecule of the invention may be administered by a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those of skill in the art.
  • Some specific examples of commercially available devices suitable for the practice of this invention are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Missouri; the Acorn II nebulizer, manufactured by Marquest Medical Products, Englewood, Colorado; the Ventolin metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, North Carolina; the Spinhaler powder inhaler, manufactured by Fisons Corp., Bedford, Massachusetts; the "standing cloud” device of Inhale Therapeutic Systems, Inc., San Carlos, California; the AIR inhaler manufactured by Alkermes, Cambridge, Massachusetts; and the AERx pulmonary drug delivery system manufactured by Aradigm Corporation, Hayward, California.
  • compositions of the invention and the invention according to PCT/DKOO/00471 may be administered in conjunction with other therapeutic agents. These agents may be incorporated as part of the same pharmaceutical composition or may be administered separately from the IFNB molecule of the invention, either concurrently or in accordance with any other acceptable treatment schedule. In addition, the molecule or pharmaceutical composition of the invention may be used as an adjunct to other therapies.
  • this invention provides compositions and methods for treating most types of viral infections, cancers or tumors or tumour angiogenesis, Chrohn's disease, ulcerative colitis, Guillain-Barre syndrome, glioma, idiopathic pulmonary fibrosis, abnormal cell growth, or for immunomodulation in any suitable animal, preferably mammal, and in particular human.
  • the molecule or composition of the invention or the invention according to PCT/DKOO/00471 may be used in the treatment of osteosarcoma, basal cell carcinoma, ovarian carcinoma, cervical dysplasia, cervical carcinoma, laryngeal papillomatosis, mycosis fungoides, glioma, acute myeloid leukemia, multiple myeloma, Hodgk s disease, melanoma, breast carcinoma, non-small cell lung cancer, malignant melanoma (adjuvant, late stage, as well as prophylactic), carcinoid tumour, B-cell lymphoma, T-cell lymphoma, follicular lymphoma, Kaposi's sarcoma, chronic myelogenous leukaemia, renal cell carcinoma, recurrent superfiecial bladder cancer, colorectal carcinoma, hairy cell leukaemia, and viral infections such as papilloma virus, viral hepatitis, herpes genitalis, her
  • a conjugate according to PCT/DKOO/00471 or a variant according to the present invention may be used for CML monotherapy or in combination with cytarabne, for B-cell lymphoma monotherapy or in combination with doxorubicin-based regimens, for follicular lymphoma therapy as an adjunct to CHOP-like regimen, for hepatitis C monotherapy or in combination with ribavirin, for multiple myeloma monotherapy or in combination with VBMCP, BCNU or VBMCP + HiCy, or for renal carcinoma monotherapy or in combination with Vinblastine, floxuridine, 5-fluoruouracil or IL-10.
  • the molecule or composition of the invention may be used for the treatment of multiple sclerosis (MS), such as any of the generally recognized four types of MS (benign, relapsing remitting MS (RRMS), primary progressive MS (PPMS) and secondary progressive MS (SPMS)) and for monosymptomatic MS), cancer or tumours, hepatitis, e.g. hepatitis B and hepatitis C, or a herpes infection (the latter treatment optionally being combined with a treatment with IL-10).
  • MS multiple sclerosis
  • RRMS relapsing remitting MS
  • PPMS primary progressive MS
  • SPMS secondary progressive MS
  • cancer or tumours cancer or tumours
  • hepatitis e.g. hepatitis B and hepatitis C
  • herpes infection the latter treatment optionally being combined with a treatment with IL-10.
  • the invention in a further aspect relates to a method of treating a mammal having circulating antibodies against IFNB la, such as AvonexTM or Rebif®, or lb, such as Betaseron®, which method comprises administering a variant of the invention which has a reduced or no reaction with said antibodies.
  • the compound is administered in an effective amount.
  • the mammal is preferably a human being.
  • the mammals to be treated may suffer from any of the diseases listed above for which interferon ⁇ is a useful treatment.
  • this aspect of the invention is of interest for the treatment of multiple sclerosis (any of the types listed above), hepatitis or cancer.
  • the invention relates to a method of making a pharmaceutical product for use in treatment of mammals having circulating antibodies against interferon ⁇ la, such as AvonexTM or Rebif®, or lb, such as Betaseron®, wherein a variant of the present invention which has reduced reaction or no reaction with such circulation antibodies (e.g. the reaction is reduced by at least 25%, such as by at least 50%, and preferably by at least 75%) such as about 100% (i.e. no reaction) is formulated into an injectable or otherwise suitable formulation as further described above.
  • the term "circulating antibodies” is intended to indicate antibodies, in particular neutralizing antibodies, formed in a mammal in response to having been treated with any of the commercially available IFNB preparations (Rebif, Betaseron, Avonex).
  • the invention relates to a method of treating a patient in need of treatment with a pharmaceutical composition with at least some of the therapeutically beneficial properties of IFNB (e.g. a patient suffering from any of the diseases mentioned herein which is treatable by IFNB) comprising administering a composition comprising a variant of the invention, said treatment having reduced or removed adverse psychological effects as compared to treatment with current commercial IFNB products.
  • IFNB therapeutically beneficial properties of IFNB
  • the invention relates to a pharmaceutical composition useful for such treatment. Also contemplated is use of a nucleotide sequence encoding a polypeptide variant of the invention in gene therapy applications.
  • nucleotide sequence encoding a polypeptide as described in the section above entitled "Variants with increased glycosylation” or “Variants with specific amino acid substitutions” or “Variants which aer fusion proteins”.
  • the glycosylation of the polypeptides is thus achieved during the course of the gene therapy, i.e. after expression of the nucleotide sequence in the human body.
  • Gene therapy applications contemplated include treatment of those diseases in which the polypeptide is expected to provide an effective therapy due to its antiviral activity, e.g., viral diseases, including hepatitis such as hepatitis C, and particularly HPV, or other infectious diseases that are responsive to IFNB or infectious agents sensitive to IFNB.
  • conjugate or polypeptide of the invention may be used in the treatment of chronic inflammatory demyelinating polyradiculoneuropathy, and of severe necrotising cutaneous lesions.
  • gene therapy in connection with the treatment of any MS type is contemplated.
  • this invention contemplates gene therapy applications for immunomodulation, as well as in the treatment of those diseases in which IFNB is expected to provide an effective therapy due to its antiproliferative activity, e.g., tumors and cancers, or other conditions characterized by undesired cell proliferation, such as restenosis.
  • IFNB antiproliferative activity
  • e.g., tumors and cancers, or other conditions characterized by undesired cell proliferation, such as restenosis is provided in WO 95/25170.
  • Local delivery of IFNB using gene therapy may provide the therapeutic agent to the target area while avoiding potential toxicity problems associated with non-specific administration.
  • Direct gene transfer e.g., as disclosed by Wolff et al., "Direct Gene transfer Into Mouse Muscle In vivo", Science 247, pp. 1465-68 (1990);
  • Liposome-mediated DNA transfer e.g., as disclosed by Caplen et al., "Liposome- mediated CFTR Gene Transfer to the Nasal Epithelium Of Patients With Cystic Fibrosis" Nature Med., 3, pp. 39-46 (1995); Crystal, "The Gene As A Drug", Nature Med., 1, pp.- 15-17 (1995); Gao and Huang, "A Novel Cationic Liposome Reagent For Efficient Transfection of Mammalian Cells", Biochem.Bio ⁇ hys Res. Comm., 179, pp. 280-85 (1991);
  • Retrovirus-mediated DNA transfer e.g., as disclosed by Kay et al., "In vivo Gene Therapy of Hemophilia B: Sustained Partial Correction In Factor IX-Deficient Dogs", Science, 262, pp. 117-19 (1993); Anderson, “Human Gene Therapy", Science, 256, pp.808-13(1992);
  • DNA viruses include adenoviruses (preferably Ad-2 or Ad-5 based vectors), herpes viruses (preferably herpes simplex virus based vectors), and parvoviruses (preferably "defective" or non-autonomous parvovirus based vectors, more preferably adeno-associated virus based vectors, most preferably AAV-2 based vectors).
  • adenoviruses preferably Ad-2 or Ad-5 based vectors
  • herpes viruses preferably herpes simplex virus based vectors
  • parvoviruses preferably "defective" or non-autonomous parvovirus based vectors, more preferably adeno-associated virus based vectors, most preferably AAV-2 based vectors.
  • the present section is relevant for the parts of the disclosure relating to PCT/DKOO/00471 as well as the disclosure relating to the present invention.
  • HeLa cells - available from American Type Culture Collection (ATCC) ISRE-Luc (Stratagene, La Jolla USA) pCDNA 3.1/hygro (Invitrogen, Carlsbad USA) pGL3 basic vector (Promega)
  • DMEM medium Dulbecco's Modified Eagle Media (DMEM), 10% fetal bovine serum (available from Life Technologies A S, Copenhagen, Denmark)
  • ISRE Interferon Stimulated Response Element
  • HeLa cells are co-transfected with ISRE-Luc and pCDNA 3.1/hygro and foci (cell clones) are created by selection in DMEM media containing Hygromycin B. Cell clones are screened for luciferase activity in the presence or absence of IFNB. Those clones showing the highest ratio of stimulated to unstimulated luciferase activity are used in further assays.
  • muteins To screen muteins, 15,000 cells/well are seeded in 96 well culture plates and incubated overnight in DMEM media. The next day muteins as well as a known standard are added to the cells in various concentrations. The plates are incubated for 6 hours at 37°C in a 5% CO 2 air atmosphere LucLite substrate (Packard Bioscience, Groningen The Netherlands ) is subsequently added to each well. Plates are sealed and luminescence measured on a TopCount luminometer (Packard) in SPC (single photon counting) mode. Each individual plate contains wells incubated with IFNB as a stimulated control and other wells containing normal media as an unstimulated control. The ratio between stimulated and unstimulated luciferase activity serves as an internal standard for both mutein activity and experiment-to-experiment variation.
  • IFNB TopCount luminometer
  • the ⁇ -Rl gene is activated by IFNB but not by other interferons.
  • the transciption of ⁇ - Rl thus serves as a second marker of IFNB activation and is used to ensure that muteins retain IFNB activity.
  • a 300 bp promoter fragment of ⁇ -Rl shown to drive interferon sensitive transcription (Rani. M.R. et al (1996) JBC 211 22878-22884 ) was isolated by PCR from human genomic DNA and inserted into the pGL3 basic vector (Promega).
  • the resulting ⁇ - Rl :luciferase gene is used in assays similar to the primary assay described above. In astrocytoma cells, the resulting ⁇ -Rl :luciferase gene has been described to show 250 fold higher sensitivity to IFNB than to interferon ⁇ (Rani et al. op cit).
  • the concentration of IFNB is quantitated by use of a commercial sandwich immunoassay (PBL Biomedical Laboratories, New Brunswick, NJ, USA).
  • the kit is based on an ELISA with monoclonal mouse anti-IFN- ⁇ antibodies for catching and detection of IFN- ⁇ in test samples.
  • the detecting antibody is conjugated to biotin.
  • Tests samples and recornbinant human IFN- ⁇ standard are added in 0.1 mL in concentrations from 10-0.25 ng/mL to microtiter plates, precoated with catching antibody. The plates are incubated at RT for 1 hr. Samples and standard are diluted in kit dilution buffer. The plates are washed in the kit buffer and incubated with the biotinylated detecting antibody in 0.1 mL for 1 hr at RT. After another wash the streptavidin-horseradishperoxidase conjugate is added in 0.1 mL and incubated for 1 hr at RT.
  • TMB Tetramethylbenzidine
  • the receptor binding capability of a polypeptide or conjugate of the invention can be determined using the assay described in WO 95/25170 entitled "Analysis Of IFN- ⁇ (Phe 101 ) For Receptor Binding"(which is based on Daudi or A549 cells). Soluble domains of IFNARl and
  • IFNAR2 can be obtained essentially as described by Arduini et al, Protein Science, 1999, vol. 8,
  • the receptor binding capability is determined using a crosslinking agent such as disuccinimidyl suberate (DSS) available from Pierce, Rockford, IL, USA as follows: The polypeptide or conjugate is incubated with soluble IFNAR-2 receptor in the presence or absence of DSS in accordance with the manufacturer's instructions. Samples are separated by SDS-PAGE, and a western blot using anti-IFNB or anti-IFNAR2 antibodies is performed. The presence of a functional IFNB polypeptide/conjugate: receptor interaction is apparent by an increase in the molecular size of receptor and IFNB in the presence of DSS.
  • DSS disuccinimidyl suberate
  • Reduced immunogenicity of a conjugate or polypeptide of the invention is determined by use of an ELISA method measuring the immunoreactivity of the conjugate or polypeptide relative to a reference molecule or preparation.
  • the reference molecule or preparation is normally a recombinant human IFNB preparation such as Avonex, Rebif or Betaseron, or another recombinant human IFNB preparation produced by a method equivalent to the way these products are made.
  • the ELISA method is based on antibodies from patients treated with one of these recombinant IFNB preparations.
  • the immunogenicity is considered to be reduced when the conjugate or polypeptide of the invention has a statistically significant lower response in the assay than the reference molecule or preparation.
  • Another method of determining immunogenicity is by use of sera from patients treated with IFNB (i.e. any commercial IFNB product) in an analogous manner to that described by Ross et al. J. Clin Invest. 95, 1974-78, 1995.
  • IFNB i.e. any commercial IFNB product
  • reduced immunogenicity results in reduced inhibition of a conjugate of the invention by patient sera compared to a wt IFNB reference molecule.
  • a less immunogenic conjugate is expected to bind to patient IgG to a lesser extent than reference IFNB molecules.
  • the reference and conjugate molecules are added in a concentration that produces approximately 80% virus protection in the antiviral neutralisation bioassay.
  • the IFNB proteins are mixed with patient sera in various dilutions (starting at 1 :20).
  • the antiviral bioassay is performed using A549 cells (CCL 185, American tissue culture collection) and Encephalomyocarditis (EMC) virus (VR-129B, American tissue culture collection).
  • the cells are seeded in 96 well tissue culture plates at a concentration of 10,000 cells/well and incubated at 37°C in a 5% CO 2 air atmosphere.
  • a polypeptide or conjugate of the invention is added in concentrations from 100-0.0001 IU/mL in a total of lOO ⁇ l DMEM medium containing fetal calf serum and antibiotics. After 24 hours the medium is removed and 0.1 mL fresh medium containing EMC virus is added to each well.
  • the EMC virus is added in a concentration that causes 100% cell death in IFN- ⁇ free cell cultures after 24 hours.
  • the antiviral effect of the polypeptide or conjugate is measured using the WST-1 assay.
  • 0.01 mL WST-1 WST-1 cell proliferation agent, Roche Diagnostics GmbH, Mannheim, Germany
  • the cleavage of the tetrazolium salt WST-1 by mitochondria! dehydrogenases in viable cells results in the formation of formazan that is quantified by measuring the absorbance at 450 nm.
  • ISRE Interferon Stimulated Response Element
  • the IFNB neutralising effect of anti-IFNB sera are analysed using the ISRE-Luciferase activity assay.
  • Sera from IFNB treated patients or from immunised animals are used. Sera are added either in a fixed concentration (dilution 1 :20-l :500 (pt sera) or 20-600 ng/mL (animal sera)) or in five-fold serial dilutions of sera starting at 1/20 (pt sera) or 600 ng/mL (animal sera).
  • IFNB is added either in five fold-dilutions starting at 25.000 IU/mL or in a fixed concentration (0.1-10 IU/mL) in a total volume of 80 ⁇ l DMEM medium + 10% FCS. The sera are incubated for 1 hr. at 37°C with IFN- ⁇ .
  • Biological half-life measurement of a PEG — IFNB conjugate or glycosylated IFNB variants Measurement of biological half-life can be carried out in a number of ways described in the literature.
  • One method is described by Munafo et al (European Journal of Neurology 1998, vol 5 No2 p 187-193), who used an ELISA method to detect serum levels of IFNB after subcutaneous and intramuscular administration of IFNB.
  • the rapid decrease of IFNB serum concentrations after i.v. administration has made it important to evaluate biological responses to IFNB treatment.
  • the conjugates of the present invention will have prolonged serum half lifes also after i.v. administration making it possible to measure by e.g.
  • IFNB biological effects of IFNB
  • Assays to assess the biological effects of IFNB such as antiviral, antiproliferative and immunomodulatory effects (as described in e.g. Annals of Neurology 1995 vol 37 No 1 p 7-15) can be used together with the primary and secondary screening assays described herein to evaluate the biological efficacy of the conjugate in comparison to wild type IFNB.
  • EAE experimental autoimmune encephalomyelitis
  • TMEN Theiler's murine encephalomyelitis virus
  • ASA Accessible Surface Area
  • the computer program Access (B. Lee and F.M.Richards, J. Mol.Biol. 55: 379-400 (1971)) version 2 (Copyright (c) 1983 Yale University) are used to compute the accessible surface area (ASA) of the individual atoms in the structure.
  • This method typically uses a probe- size of 1.4A and defines the Accessible Surface Area (ASA) as the area formed by the centre of the probe. Prior to this calculation all water molecules and all hydrogen atoms are removed from the coordinate set, as are other atoms not directly related to the protein.
  • Alternative programs are available for computing ASA, e.g. the program Whatlf G.Nriend, J. Mol. Graph.
  • the fractional ASA of the side chain atoms is computed by division of the sum of the ASA of the atoms in the side chain with a value representing the ASA of the side chain atoms of that residue type in an extended ALA-x-ALA tripeptide. See Hubbard, Campbell & Thornton
  • GenBank accession number M28622 shown in SEQ ID NO 1
  • SEQ ID NO 1 The DNA sequence, GenBank accession number M28622 (shown in SEQ ID NO 1), encompassing a full length cDNA encoding human IFNB with its native signal peptide, was modified in order to facilitate high expression in mammalian cells.
  • the primers were assembled to the synthetic gene by one step PCR using Platinum Pfx- polymerase kit (Life Technologies) and standard three step PCR cycling parameters.
  • the assembled gene was amplified by PCR using the same conditions.
  • a cDNA encoding a N-terminal extended form of human IFNB was synthesised using the same PCR conditions as described above but with the primers CBProFprl and —14 substituted with the primers: CBProFpr7
  • Codons for individual amino acids were changed by amplifying relevant regions of the coding region by PCR in such a way that the PCR introduced changes in the sequence can be introduced in the expression plasmids by classical cloning techniques.
  • Lys45arg-5 'primer ( ⁇ arl/KasI):
  • Lys45mut-3 'primer (BsiWI): 5 CTCCACGCGTACGATGGTCCAGGCGCAGTGGCTG-3', were used to introduce a K45R substitution in the PCR-fragment spanning the region from position 1055 to 1243 in pCBProFl. Both the PCR fragment and pCBProFl was cut with ⁇ arl and BsiWI which are both unique. The PCR fragment and the vector backbone of pCBProFl are purified and ligated resulting in substitution of the Lys45 codon AAG with the Arg codon
  • the central (nonsense) primer and the N-terminal (sense) primer were used to amplify the N-terminal part of the INF ⁇ coding region in one of the primary PCRs and equivalently for the C-terminal part.
  • the N- and C-terminal parts are assembled into the full-length product in a secondary PCR and cloned into a modified version of pCDNA3.1/Hygro as described above.
  • the following primers were used to introduce the mutations for the substitutions Fl 1 IN and Rl 13T: CBProFprimer9(S ense) :
  • the PCR product was subsequently cloned using the restriction endo-nuclease sites BsiWi. and BsfBl.
  • the synthetic gene (hinf- ⁇ ) encoding hINF- ⁇ was altered by site-directed PCR mutagenesis.
  • BIO-X-ACT Bioline, UK
  • pcDNA3.1 (-)Hygro/Intron a derivative of pcDNA3.1 (-)Hygro (Invitrogen, US A) in which a chimeric intron obtained from pCI-neo (Promega, USA) had been inserted between the BamHI and Nhel sites in the MCS of the vector] as template
  • two PCR reactions were performed with two overlapping primer-sets [CB41 (5'- TTTAAACTGGATCCAGCCACCATGACCAACAAG-3')
  • ICB55 5'-CGGCCATAGT
  • PF085 was fransfected into the CHO Kl cell line (ATCC #CCL-61 ) by use of Lipofectamine 2000 (Life Technologies, USA) as transfection agent. 24 hours later the culture medium was harvested and assayed for LNF- ⁇ activity/concentration:
  • CAGCTGCAGAACTTCACCAAGGAGGACGCC-3' resulting in two fragments of 228 and 369 base pairs, respectively. These two fragments were assembled in a third PCR with the flanking primers PBR7 and PBR8.
  • the resulting gene was inserted into the mammalian expression vector pcDNA3.1(-)Hygro/Intron and confirmed by DNA sequencing to have the correct base changes leading to [Q49N,Q51 T]hINF- ⁇ (plasmid designated PF 104) .
  • PF104 was fransfected into the CHO Kl cell line by use of Lipofectamine 2000 (Life Technologies, USA) as transfection agent. 24 hours later the culture medium was harvested and assayed for INF- ⁇ activity/concentration: Activity: 17639 IU/ml [primary assay]
  • the [Q49N+Q51T]hINF- ⁇ variant has a high specific activity. This may be due to poor recognition by one of the monoclonal antibodies used in the ELISA.
  • PBR78 and PBR8/PBR77 resulting in two fragments of 228 and 369 base pairs, respectively. These two fragments were assembled in a third PCR with the flanking primers PBR89 and PBR8.
  • the resulting gene was inserted into the mammalian expression vector pcDNA3.1(- )Hygro/Intron and confirmed by sequencing to have the correct base changes leading to [Q49N, Q51T, Fl 1 IN, Rl 13T] hINF- ⁇ (plasmid designated PF123).
  • PF123 was fransfected into CHO Kl cells by use of Fugene 6 (Roche) as transfection agent. 24 hours later the culture medium was harvested and assayed for LNF- ⁇ activity/concentration:
  • the variant was found to have receptor binding activity in the receptor binding assay described in the Materials and Methods section, which is based on the use of the crosslinking agent DSS.
  • plasmid DNA [K19R, K45R, K123R]INF- ⁇ / ⁇ cDNA3.1(-)Hygro; PF #161) was aliquoted into another 14 ml polypropylene tube. After 5 min incubation the Fugene 6 mix was added directly to the DNA solution and incubated for 15 min at RT. After incubation about 700 ⁇ l was added drop wise to each of the three cell media.
  • the transfection medium was substituted with 35 ml serum-free production medium.
  • the serum-free medium is based on DMEM medium (Life Technologies; Cat. # 31053-028) supplemented with Glutamine, Sodium Pyruvate, penicillin/streptomycin, 1% ITS A (Life Technologies; Cat. # 51300-044), and 0.2% Ex-Cyte (Serologicals Proteins; Cat. # 81- 129). Before the production medium was added the cell layers were washed two times in the DMEM medium without additives.
  • the broth was batch adsorbed to 1 ml SP 550 cation exchange resin (TosoHaas) preequilibrated with buffer A (20 mM phosphate, 100 mM NaCl, pH 7). After 2 h rotation end over end, the resin was allowed to sediment and transferred to a column. The resin was washed with 5 column volumes buffer A and eluted with 2 ml buffer B (20 mM phosphate, 800 mM NaCl, pH 7). The eluate was concentrated to 500 ul on VivaSpin (cutoff 10 kDa) after addition of 5 % ethyleneglycol.
  • buffer A 20 mM phosphate, 100 mM NaCl, pH 7
  • buffer B 20 mM phosphate, 800 mM NaCl, pH 7
  • the eluate was concentrated to 500 ul on VivaSpin (cutoff 10 kDa) after addition of 5 % ethyleneglycol.
  • the concentrate was adjusted to 50 mM phosphate, 0.3 M NaCl, 20 % ethyleneglycol, pH 8 in a final volume of 2 ml and further concentrated to 0.5 ml.
  • the final concentrate was PEGylated as follows: to 100 ul of the final concentrate, 25 ul of activated mPEG-SPA (5000 kDa, Shearwater, Alabama) freshly prepared in phosphate buffer, pH 8 were added to make final concentrations of activated PEG of 0, 5, 10, 25 or 50 mg/ml.
  • the reaction was allowed to proceed for 30 min at room temperature and then quenched by addition of 50 mM glycine buffer. Samples were frozen immediately at -80°C and bioactivity was measured as described (Primary Assay). Western blots of each sample were performed in order to evaluate the amount of unreacted IFNB variant present in the PEGylated sample.
  • Results demonstrate that at 25 mg activated PEG/ml, nonPEGylated IFNB variant was absent as judged by western blot and the variant retained 50 % of its bioactivity compared to the control sample (treated identically, but with 0 mg ml activated PEG).
  • Variants having increased carbohydrate attachment at position 49 The inserted N-linked glycosylation site at position 49 in the INFB variant [Q49N, Q5 IT] described in Example 6 of PCT/DKOO/00471 is used only about 60%.
  • glutamine residue at position 48 was exchanged with phenylalanine (Q48F), valine (Q48V), and tryptophan (Q48W) by site-directed PCR mutagenesis.
  • PCR reactions were performed with overlapping primer-sets:
  • O5 IT PBR89 (5'CGCGGATCCAGCCACCATGACCAACAAGTGCCTG)/PBR148 (5'GTCCTCCTTGGTGAAGTTGAACAGCTGCTT) and PBR8 ((5'- ATATATCCCAAGCTTTTATCAGTTGCGCAGGTAGCCGGT-3 '))/ PBR147 (5 ' AAGCAGCTGTTCAACTTCACCAAGGAGGAC) O48V.
  • PBR89 5'CGCGGATCCAGCCACCATGACCAACAAGTGCCTG
  • PBR150 5'GTCCTCCTTGGTGAAGTTCACCAGCTGCTT
  • PBR8 /PBR149 5 ' AAGCAGCTGGTGAACTTCACCAAGGAGGAC
  • PBR89 5'CGCGGATCCAGCCACCATGACCAACAAGTGCCTG
  • PBR152 5'GTCCTCCTTGGTGAAGTTCCACAGCTGCTT
  • PBR8 /PBR151 5'AAGCAGCTGTGGAACTTCACCAAG GAGGAC
  • the fragments were assembled in PCR reactions with the flanking primers PBR89 and PBR8.
  • PF305, PF306, PF307, and PF185 were fransfected into CHO
  • N-linked glycosylation site at position 111 in the INFB variant [Fl 1 IN, Rl 13T] described in Example 5 of PCT/DKOO/00471 is used only about 50%).
  • the aspartic acid residue at position 110 was exchanged with phenylalanine (Dl 10F) and valine (Dl 10V) by site-directed PCR mutagenesis.
  • BIO-X- ACT Bioline, UK
  • PF085 described in Example 5 of PCT/DKOO/00471
  • PBR89 5'CGCGGATCCAGCCACCATGACCAACAAGTGCCTG
  • PBR154 5'CAGCTTGCCGGTGGTGTTGAACTCCTTCTC
  • PBR8 /PBR153 GAGAAGGAGTTCAACACCACCGGCAAG CTG
  • PBR89 5'CGCGGATCCAGCCACCATGACCAACAAGTGCCTG
  • PBR156 5'CAGCTTGCCGGTGGTGTTCACCTCCTTCTC
  • PBR 8 /PBR 155 5'GAGAAGGAGGTGAACACCACCGGCAAGCTG
  • the fragments were assembled in PCR reactions with the flanking primers PBR89 and PBR8.
  • the resulting genes were inserted into the mammalian expression vector pcDNA3.1 (- )Hygro/Infron and confirmed by sequencing to have the correct base changes leading to [Dl 10F, Fl 1 IN, Rl 13T]hINF- ⁇ (plasmid designated PF308) and [Dl 10V, Fl 1 IN, Rl 13T]hINF- ⁇ (plasmid designated PF309), respectively.
  • PF308, PF309 and PF085 (encoding [Fl 1 IN, Rl 13T,]hINF- ⁇ ) were fransfected into CHO Kl cells by use of Fugene 6 (Roche) as transfection agent. 24 hours later the culture medium was harvested and assayed for INF- ⁇ activity: PF085 58615 IU/ml PF308 50900 IU/ml
  • PF309 15063 IU/ml In order to evaluate the amount of attached carbohydrate in the two new glycosylation variants a Western blot was performed with equal amount of activity in each lane (Fig. 1; lanes 7, 8, 9). As seen in the figure the amino acid exchanges (Dl 10F and Dl 10V) in front of the introduced glycosylation site (Fl 1 IN, Rl 13T) both leads to a significantly increased amount of fully glycosylated material.
  • Hydroxyapatite chromatography is an efficient means for separation of IFNB glycoforms and e.g. obtain glycoforms with fully utilized glycosylation sites. This is illustrated in the present example.
  • the IFNB variant [Q49N+ Q51T+F11 IN+Rl 13T] produced as described in Example 8 of PCT/DOO/00471 was purified in a three-step procedure:
  • the harvested media from roller bottles was centrifuged and filtered through a 0.22 um filter (PVDF).
  • the filfrated media was diafilfrated on a Vivaflow 200 system equipped with a polyethersulfon membrane with cut off 10000 and applied to a S-Sepharose column (Pharmacia) equilibrated with 50 mM sodium acetate, 50 mM sodium chloride, pH 5.5.
  • the interferon variant bound to the column was eluted with 50 mM sodium acetate, 0.5 M sodium chloride, pH 5.5.
  • the concentration of sodium chloride in the eluate from the S-Sepharose column was adjusted to 1.0 M and the sample was applied on a Phenyl-Sepharose High Performance column (Pharmacia) equilibrated with 50 mM sodium acetate, 1.0 M sodium chloride, pH 5.5. Following application the column was washed with Milli Q water. The IFNB variant was eluted with a gradient from Milli Q water to 60% ethylene glycol, 50 mM sodium acetate, pH 5.5 in 30 column volumes. Fractions containing fully glycosylated IFNB variant were collected and the buffer in the eluate was changed to 15 mM sodium phosphate buffer, pH 7.2.
  • the sample was applied on a hydroxyapatite column (CHT II , Ceramic hydroxyapatite, Type II, Biorad) equilibrated with 15 mM sodium phosphate.
  • CHT II Ceramic hydroxyapatite, Type II, Biorad
  • the fully glycosylated form passed through the column where as the underglycosylated form with one extra site used bound to the column and was eluted with a linear sodium phosphate gradient from 15 mM to 200 mM in 20 column volumes.
  • SCM-PEG succinimidyl ester of carboxymethylated PEG from Shearwater, Alabama, 5 kD or 12 kD
  • Pegylated material was separated from unpegylated material and surplus of PEG using either size-exclusion chromatography or cation exchange chromatography or a combination of both.
  • Size-exclusion chromatography was performed with a Superose 12 or Superdex 75 column from Pharmacia equilibrated with PBS buffer, pH 7.2.
  • Cation exchange chromatography was performed on SP-Sepharose HP (Pharmacia) equilibrated with 20 mM citrate, pH 2.7. Elution from the SP-Sepharose HP column was performed either by increasing the concentration of salt (e.g. sodium chloride) or by increasing the pH of the buffer (e.g. sodium acetate or sodium phosphate).
  • salt e.g. sodium chloride
  • pH of the buffer e.g. sodium acetate or sodium phosphate
  • Hyper-glycosylated INF- ⁇ variant is stabilised by substitution of the cysteine in position 17 with serine
  • CHOK1 cells were fransfected with plasmids encoding two hyper-glycosylated INF- ⁇ variants: [S2N, N4T, Q5 IN, E53T]INF- ⁇ (PF276) and [S2N, N4T, Cl 7S, Q5 IN, E53T]LNF- ⁇ (PF279).
  • Confluent stable primary transfection pools were expanded into four T-175 flasks each.
  • the flasks were shifted from serum containing medium to a serum-free medium based on DMEM/F-12 medium (Lifetecnologies #21045-025) supplemented with 1/100 ITS A (Life Technologies #51300-044) and 1/1000 Ex-Cyte (Serologicals Corp. #81- 129). Every day, in 15 days, 120 ml of each variant was harvested and frozen at -80 °C.
  • the supernatants from the daily harvest were collected and filtered through 0.22 urn filter (PVDF based).
  • the supernatant was concentrated approximately 15 times on a Vivaflow 200 system equipped with a polyethersulfon membrane with cut-off 10000 and the concentrated sample was applied on a S-Sepharose column equilibrated with 50 mM sodium acetate, 50 mM NaCl, pH 5.5
  • the IFNB variant eluted in a step with 50 mM sodium acetate, 0.5 M NaCl, pH 5.5.
  • the concentration of sodium chloride in the eluate from the S-Sepharose column was adjusted to 1.0 M and the sample was applied on a Phenyl-Sepharose column equilibrated with 50 mM sodium acetate, 1.0 M sodium chloride, pH 5.5. Extensive washing with the equilibration buffer was carried out before the IFNB variant was eluted with 60% ethylene glycol in 50 mM sodium acetate, pH 5.5.
  • Rl 13T]IFNB glycosylation variant was seeded into 6 roller bottles, each with an expanded surface of 1700 cm 2 (Corning, USA), in 200 ml DMEM/F-12 medium (LifeTechnologies; Cat. # 31330) supplemented with 10% FBS and penicillin/streptomycin (P/S). After 2 days the medium was exchanged. After another 2 days the two roller bottles were nearly 100% confluent and the medium was shifted to 300 ml serum-free UlfraCHO medium (BioWhittaker; Cat. # 12- 724) supplemented with 1/500 EX-CYTE (Serologicals Proteins; Cat. # 81129N) and P/S.
  • the S-Sepharose column was equilibrated with 50 mM sodium acetate, 50 mM sodium chloride, pH 5.5 and the interferon variant was eluted with 50 mM sodium acetate, 0.5 M sodium chloride, pH 5.5.
  • the concentration of sodium chloride in the eluate was adjusted to 1.0 M.
  • the eluate from the S-Sepharose column was applied on a Phenyl-Sepharose High Performance column (Pharmacia) equilibrated with 50 mM sodium acetate, 1.0 M sodium chloride, pH 5.5. Following application the column was washed with 50 mM sodium acetate, 50 mM sodium chloride, pH 5.5.
  • the IFNB variant was eluted with a gradient from 50 mM sodium acetate, 50 mM sodium chloride, pH 5.5 to 60% ethylene glycol, 50 mM sodium acetate, pH 5.5 in 30 column volumes. Fractions containing fully glycosylated IFNB variant were collected and pooled.
  • the ethylene glycol in the eluate from the Phenyl-Sepharose was removed by passing the eluate through a S-Sepharose column equilibrated with 50 mM sodium acetate, 50 mM sodium chloride, pH 5.5.
  • the ethylene glycol was in the flow through where as the interferon variant bound to the column.
  • the column was washed with 20 mM sodium acetate, pH 5.5 and the interferon variant was eluted with 100 mM sodium phosphate, pH 7.5.
  • the phosphate concentration in the eluate was adjusted to 15 mM sodium phosphate buffer, pH 7.2. and applied on a hydroxyapatite column (CHT I , Ceramic hydroxyapatite, Type I, Biorad) equilibrated with 15 mM sodium phosphate, pH 7.2.
  • CHT I Ceramic hydroxyapatite, Type I, Biorad
  • the fully glycosylated form passed through the column where as the undergfycosylated form with one extra site used bound to the column and was eluted with a linear sodium phosphate gradient from 15 mM to 200 mM sodium phosphate, pH 6.8 in 20 column volumes.
  • the purity of the fully glycosylated variant [C17S+Q49N+ Q51T+D110F+ Fl 11N+
  • Rl 13T]IFNB was judged to be higher than 95% based on SDS-PAGE.
  • the reaction mixture contained a mixture of mono-, di- and un-pegylated material.
  • Mono-pegylated material was separated from other species using either cation exchange chromatography or size-exclusion chromatography or a combination of both.
  • pH in the PEGylation solution was adjusted to pH 2.7 and the sample was applied on a SP-Sepharose HR (Pharmacia) column equilibrated with 20 mM sodium citrate, pH 2.7.
  • the pegylated protein was eluted from the column with 50 mM sodium acetate containing 1 M sodium chloride and applied on a size-exclusion column, Sephacryl S-100, ((16/60) Pharmacia) equilibrated with 100 mM sodium acetate, 200 mM sodium chloride, pH 5.5. Fractions containing mono-pegylated material were pooled and characterized further.
  • PEGylation sites i.e. lysines and N-terminus. After incubation for 30 min at room termperature, the reaction was quenched by addition of a surplus of 20 mM glycine, pH 8.0. The reaction mixture contained a mixture of mono-, di-, tri-pegylated material together with underivatized material. The pegylated material was separated from the unmodified protein using either cation exchange chromatography or size-exclusion chromatography or a combination of both. pH in the PEGylation solution was adjusted to pH 2.7 and the sample was applied on a SP-Sepharose HR (Pharmacia) column equilibrated with 20 mM sodium citrate, pH 2.7.
  • the pegylated protein was eluted from the column with 50 mM sodium acetate containing 1 M sodium chloride and applied on a size-exclusion column, Sephacryl S-100, ((16/60) Pharmacia) equilibrated with 100 mM sodium acetate, 200 mM sodium chloride, pH 5.5. Fractions containing the mixture of mono-, di- and tri-pegylated protein were pooled and characterized further.
  • a CHOK1 sub-clone (5/G-10) producing [C17S+K19R+ K33R+K45R+Q49N+ Q51T+D110F+ Fl 11N+ Rl 13T]IFNB glycosylation variant was produced in 6 roller bottles as described in example 12 and purified according to the protocol used in example 12. The purity of the fully glycosylated variant [C17S+K19R+ K33R+K45R+Q49N+ Q51T+D110F+ Fl 11N+ Rl 13T]IFNB was judged to be higher than 95% based on SDS-PAGE.
  • a protein solution of 0.1 mg/ml in 20 mM sodium phosphate, pH 7.0 was PEGylated with SCM-PEG, 20K, with 3 times molar surplus of PEG to possible PEGylation sites, i.e. lysines and N-terminus. After incubation for 30 min at room termperature, the reaction was quenched by addition of a surplus of 20 mM glycine, pH 8.0. The reaction mixture contained a mixture of mono-, di- and un-pegylated material. Mono-pegylated material was separated from other species using either cation exchange chromatography or size-exclusion chromatography or a combination of both.
  • pH in the PEGylation solution was adjusted to pH 2.7 and the sample was applied on a SP-Sepharose HR (Pharmacia) column equilibrated with 20 mM sodium citrate, pH 2.7.
  • the pegylated protein was eluted from the column with 50 mM sodium acetate containing 1 M sodium chloride and applied on a size-exclusion column, Sephacryl S-100, ((16/60) Pharmacia) equilibrated with 100 mM sodium acetate, 200 mM sodium chloride, pH 5.5. Fractions containing mono-pegylated material was pooled and characterized further In another experiment a protein solution of 0.1 mg/ml in 20 mM sodium phosphate, pH
  • 7.0 was PEGylated with (10 mg/ml) SCM-PEG, 12K, with 5 times molar surplus of PEG to possible PEGylation sites, i.e. lysines and N-terminus. After incubation for 30 min at room termperature, the reaction was quenched by addition of a surplus of 20 mM glycine, pH 8.0.
  • the reaction mixture contained a mixture of mono-, di-, tri-pegylated material together with underivatized material. The pegylated material was separated from the unmodified protein using either cation exchange chromatography or size-exclusion chromatography or a combination of both.
  • pH in the PEGylation solution was adjusted to pH 2.7 and the sample was applied on a SP-Sepharose HR (Pharmacia) column equilibrated with 20 mM sodium citrate, pH 2.7.
  • the pegylated protein was eluted from the column with 50 mM sodium acetate containing 1 M sodium chloride and applied on a size-exclusion column, Sephacryl S-100, ((16/60) Pharmacia) equilibrated with 100 mM sodium acetate, 200 mM sodium chloride, pH 5.5. Fractions containing the mixture of mono-, di- and tri-pegylated protein were pooled and characterized further.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Dermatology (AREA)
  • Cardiology (AREA)
  • Zoology (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Inorganic Chemistry (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
PCT/DK2002/000128 2001-02-27 2002-02-26 New interferon beta-like molecules Ceased WO2002074806A2 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
SK1188-2003A SK11882003A3 (sk) 2001-02-27 2002-02-26 Variant štandardného ľudského interferónu ß, nukleotidová sekvencia kódujúca tento variant, expresný vektor a hostiteľská bunka s jej obsahom, farmaceutický prostriedok s obsahom uvedeného variantu a jeho použitie
EP02702228A EP1366075B1 (en) 2001-02-27 2002-02-26 New interferon beta-like molecules
IL15605902A IL156059A0 (en) 2001-02-27 2002-02-26 NEW INTERFERON beta-LIKE MOLECULES
JP2002573813A JP2004534523A (ja) 2001-02-27 2002-02-26 新規なインターフェロンβ様分子
AT02702228T ATE432288T1 (de) 2001-02-27 2002-02-26 Neue interferon-beta-ähnliche moleküle
MXPA03007619A MXPA03007619A (es) 2001-02-27 2002-02-26 Nuevas moleculas similares a interferon beta.
HU0303251A HUP0303251A2 (hu) 2001-02-27 2002-02-26 Béta-interferon-szerű molekulák
BR0207576-8A BR0207576A (pt) 2001-02-27 2002-02-26 Variante glicosilada de um polipeptìdeo de interferon beta precursor (ifnb), processos de aumentar a glicosilação in vivo de uma molécula de ifnb precursora, de produzir uma molécula de ifnb glicosilada, para preparar uma variante conjugada e de tratar um mamìfero com esclerose múltiplam composição farmacêutica, molécula de ifnb variante, sequência de nucleotìdeo, vetor de expressão, célula hospedeira de glicosilação conjugado, e, uso de um conjugado
CA002469846A CA2469846A1 (en) 2001-02-27 2002-02-26 New interferon beta-like molecules
DE60232434T DE60232434D1 (de) 2001-02-27 2002-02-26 Neue interferon-beta-ähnliche moleküle
RU2003128955/13A RU2003128955A (ru) 2001-02-27 2002-02-26 Новые интерферон бета-подобные молекулы
IS6927A IS6927A (is) 2001-02-27 2003-08-26 Nýjar sameindir skyldar interferon-beta
NO20033781A NO20033781L (no) 2001-02-27 2003-08-26 Nye interferon beta-lignede molekyler

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
DKPA200100323 2001-02-27
DKPA200100323 2001-02-27
DKPA200100333 2001-03-01
DKPA200100333 2001-03-01
DKPA200101040 2001-06-29
DKPA200101040 2001-06-29
DKPA200101277 2001-08-30
DKPA200101277 2001-08-30
DKPA200101954 2001-12-21
DKPA200101954 2001-12-21
DKPA200200257 2002-02-19
DKPA200200257 2002-02-19

Publications (2)

Publication Number Publication Date
WO2002074806A2 true WO2002074806A2 (en) 2002-09-26
WO2002074806A3 WO2002074806A3 (en) 2003-05-01

Family

ID=27545246

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2002/000128 Ceased WO2002074806A2 (en) 2001-02-27 2002-02-26 New interferon beta-like molecules

Country Status (17)

Country Link
EP (2) EP1366075B1 (cg-RX-API-DMAC7.html)
JP (1) JP2004534523A (cg-RX-API-DMAC7.html)
AT (1) ATE432288T1 (cg-RX-API-DMAC7.html)
BR (1) BR0207576A (cg-RX-API-DMAC7.html)
CA (1) CA2469846A1 (cg-RX-API-DMAC7.html)
CZ (1) CZ20032526A3 (cg-RX-API-DMAC7.html)
DE (1) DE60232434D1 (cg-RX-API-DMAC7.html)
HU (1) HUP0303251A2 (cg-RX-API-DMAC7.html)
IL (1) IL156059A0 (cg-RX-API-DMAC7.html)
IS (1) IS6927A (cg-RX-API-DMAC7.html)
MX (1) MXPA03007619A (cg-RX-API-DMAC7.html)
NO (1) NO20033781L (cg-RX-API-DMAC7.html)
PL (1) PL367154A1 (cg-RX-API-DMAC7.html)
RU (1) RU2003128955A (cg-RX-API-DMAC7.html)
SK (1) SK11882003A3 (cg-RX-API-DMAC7.html)
WO (1) WO2002074806A2 (cg-RX-API-DMAC7.html)
YU (1) YU48703A (cg-RX-API-DMAC7.html)

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004020468A3 (en) * 2002-08-28 2004-06-10 Maxygen Aps Interferon beta-like molecules for treatment of cancer
US7125843B2 (en) 2001-10-19 2006-10-24 Neose Technologies, Inc. Glycoconjugates including more than one peptide
US7138371B2 (en) 2001-10-10 2006-11-21 Neose Technologies, Inc Remodeling and glycoconjugation of peptides
US7157277B2 (en) 2001-11-28 2007-01-02 Neose Technologies, Inc. Factor VIII remodeling and glycoconjugation of Factor VIII
US7173003B2 (en) 2001-10-10 2007-02-06 Neose Technologies, Inc. Granulocyte colony stimulating factor: remodeling and glycoconjugation of G-CSF
US7179617B2 (en) 2001-10-10 2007-02-20 Neose Technologies, Inc. Factor IX: remolding and glycoconjugation of Factor IX
US7214660B2 (en) 2001-10-10 2007-05-08 Neose Technologies, Inc. Erythropoietin: remodeling and glycoconjugation of erythropoietin
WO2006135930A3 (en) * 2005-06-13 2007-05-31 Nastech Pharm Co Transmucosal delivery of peptide derivatives
US7226903B2 (en) 2001-10-10 2007-06-05 Neose Technologies, Inc. Interferon beta: remodeling and glycoconjugation of interferon beta
JP2007518724A (ja) * 2003-12-31 2007-07-12 オーソロジック コーポレイション トロンビンペプチド誘導体のための医薬組成物
US7265085B2 (en) 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycoconjugation methods and proteins/peptides produced by the methods
US7265084B2 (en) 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycopegylation methods and proteins/peptides produced by the methods
US7297511B2 (en) 2001-10-10 2007-11-20 Neose Technologies, Inc. Interferon alpha: remodeling and glycoconjugation of interferon alpha
EP1575531A4 (en) * 2002-09-27 2008-01-23 Biogen Idec Inc INFLAMMATORY DEMYELINIZATION POLYNEUROPATIC CHRONIC THERAPIES USING INTERFERON-BETA
WO2008020968A3 (en) * 2006-08-08 2008-05-29 Novartis Vaccines & Diagnostic Recombinant interferon-beta with enhanced biological activity
US7399613B2 (en) 2001-10-10 2008-07-15 Neose Technologies, Inc. Sialic acid nucleotide sugars
US7405198B2 (en) 2003-11-24 2008-07-29 Neose Technologies, Inc. Glycopegylated erythropoietin
US7439043B2 (en) 2001-10-10 2008-10-21 Neose Technologies, Inc. Galactosyl nucleotide sugars
US7473680B2 (en) 2001-11-28 2009-01-06 Neose Technologies, Inc. Remodeling and glycoconjugation of peptides
US7625555B2 (en) 2007-06-18 2009-12-01 Novagen Holding Corporation Recombinant human interferon-like proteins
US7691603B2 (en) 2003-04-09 2010-04-06 Novo Nordisk A/S Intracellular formation of peptide conjugates
US7696163B2 (en) 2001-10-10 2010-04-13 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7795210B2 (en) 2001-10-10 2010-09-14 Novo Nordisk A/S Protein remodeling methods and proteins/peptides produced by the methods
US7803777B2 (en) 2003-03-14 2010-09-28 Biogenerix Ag Branched water-soluble polymers and their conjugates
US7842661B2 (en) 2003-11-24 2010-11-30 Novo Nordisk A/S Glycopegylated erythropoietin formulations
US7932364B2 (en) 2003-05-09 2011-04-26 Novo Nordisk A/S Compositions and methods for the preparation of human growth hormone glycosylation mutants
US7956032B2 (en) 2003-12-03 2011-06-07 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US8008252B2 (en) 2001-10-10 2011-08-30 Novo Nordisk A/S Factor VII: remodeling and glycoconjugation of Factor VII
US8017733B2 (en) 2002-01-18 2011-09-13 Biogen Idec Ma Inc. Polyalkylene polymer compounds and uses thereof
US8063015B2 (en) 2003-04-09 2011-11-22 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
EP1667708B1 (en) * 2002-12-26 2012-06-06 Mountain View Pharmaceuticals, Inc. POLYETHYLENE GLYCOL CONJUGATES OF INTERFERON-BETA-1b WITH ENHANCED IN VITRO BIOLOGICAL POTENCY
US8207112B2 (en) 2007-08-29 2012-06-26 Biogenerix Ag Liquid formulation of G-CSF conjugate
US8268967B2 (en) 2004-09-10 2012-09-18 Novo Nordisk A/S Glycopegylated interferon α
US8361961B2 (en) 2004-01-08 2013-01-29 Biogenerix Ag O-linked glycosylation of peptides
US8404809B2 (en) 2005-05-25 2013-03-26 Novo Nordisk A/S Glycopegylated factor IX
US8632770B2 (en) 2003-12-03 2014-01-21 Novo Nordisk A/S Glycopegylated factor IX
US8633157B2 (en) 2003-11-24 2014-01-21 Novo Nordisk A/S Glycopegylated erythropoietin
WO2014049588A1 (en) * 2012-09-27 2014-04-03 University College Dublin, National University Of Ireland, Dublin A method for treatment of pulmonary fibrosis and diagnosis or prognosis of an aggressive pulmonary fibrosis phenotype
US8791070B2 (en) 2003-04-09 2014-07-29 Novo Nordisk A/S Glycopegylated factor IX
US8791066B2 (en) 2004-07-13 2014-07-29 Novo Nordisk A/S Branched PEG remodeling and glycosylation of glucagon-like peptide-1 [GLP-1]
US8841439B2 (en) 2005-11-03 2014-09-23 Novo Nordisk A/S Nucleotide sugar purification using membranes
WO2014157107A1 (ja) 2013-03-29 2014-10-02 株式会社糖鎖工学研究所 シアリル化糖鎖が付加されたポリペプチド
US8911967B2 (en) 2005-08-19 2014-12-16 Novo Nordisk A/S One pot desialylation and glycopegylation of therapeutic peptides
US8916360B2 (en) 2003-11-24 2014-12-23 Novo Nordisk A/S Glycopegylated erythropoietin
US8969532B2 (en) 2006-10-03 2015-03-03 Novo Nordisk A/S Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography
US9005625B2 (en) 2003-07-25 2015-04-14 Novo Nordisk A/S Antibody toxin conjugates
US9023992B2 (en) 2004-05-04 2015-05-05 Novo Nordisk Healthcare Ag Hydrophobic interaction chromatography purification of factor VII polypeptides
US9029331B2 (en) 2005-01-10 2015-05-12 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
US9150848B2 (en) 2008-02-27 2015-10-06 Novo Nordisk A/S Conjugated factor VIII molecules
US9187546B2 (en) 2005-04-08 2015-11-17 Novo Nordisk A/S Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
US9187532B2 (en) 2006-07-21 2015-11-17 Novo Nordisk A/S Glycosylation of peptides via O-linked glycosylation sequences
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography
US10358470B2 (en) 2011-10-01 2019-07-23 Glytech, Inc. Glycosylated polypeptide and pharmaceutical composition containing same

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007022799A1 (en) * 2005-08-26 2007-03-01 Ares Trading S.A. Process for the preparation of glycosylated interferon beta
US9579628B2 (en) 2015-04-15 2017-02-28 Air Products And Chemicals, Inc. Perforated adsorbent particles

Family Cites Families (118)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
FR2351665A1 (fr) 1976-05-21 1977-12-16 Elf Aquitaine Procede de purification de preparations possedant notamment une activite interferon, preparations purifiees ainsi obtenues et leur application en tant que medicament
JPS5564799A (en) 1978-11-07 1980-05-15 Toray Ind Inc Multi-stage concentration and purification of interferon originated from human fibroblast
US4289689A (en) 1980-03-14 1981-09-15 Hoffmann-La Roche Inc. Preparation of homogeneous human fibroblast interferon
NL7907791A (nl) 1979-10-23 1981-04-27 Stichting Rega V Z W Werkwijze voor het zuiveren van interferon.
EP0041313B1 (en) 1980-04-03 1990-09-12 Biogen, Inc. Dna sequences, recombinant dna molecules and processes for producing human fibroblast interferon
JPS58110600A (ja) 1981-12-25 1983-07-01 Kyowa Hakko Kogyo Co Ltd ヒトβ型インタ−フエロン遺伝子を含む組みかえ体プラスミド
JPS58201794A (ja) 1982-05-17 1983-11-24 Toray Ind Inc ヒトインターフェロンβの濃縮精製法
US4470461A (en) 1982-09-30 1984-09-11 Phillips Petroleum Company Organic nitro compounds as cosurfactants in enhanced oil recovery processes
US4588585A (en) 1982-10-19 1986-05-13 Cetus Corporation Human recombinant cysteine depleted interferon-β muteins
US4966843A (en) 1982-11-01 1990-10-30 Cetus Corporation Expression of interferon genes in Chinese hamster ovary cells
US4485017A (en) 1982-12-22 1984-11-27 Cetus Corporation Isolation of human interferon by immunosorbent and high performance liquid chromatography
CA1231306A (en) 1983-03-03 1988-01-12 Erich Hochuli Purification of interferon
GB8317880D0 (en) 1983-07-01 1983-08-03 Searle & Co Structure and synthesis of interferons
US4870008A (en) 1983-08-12 1989-09-26 Chiron Corporation Secretory expression in eukaryotes
DE3572982D1 (en) 1984-03-06 1989-10-19 Takeda Chemical Industries Ltd Chemically modified lymphokine and production thereof
GB8412564D0 (en) 1984-05-17 1984-06-20 Searle & Co Structure and properties
US4931373A (en) 1984-05-25 1990-06-05 Zymogenetics, Inc. Stable DNA constructs for expression of α-1 antitrypsin
GB8430252D0 (en) 1984-11-30 1985-01-09 Beecham Group Plc Compounds
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
JP2524586B2 (ja) 1985-06-26 1996-08-14 シタス コーポレイション ポリマ−接合を利用する医薬組成物用蛋白質の可溶化
US4917888A (en) 1985-06-26 1990-04-17 Cetus Corporation Solubilization of immunotoxins for pharmaceutical compositions using polymer conjugation
US5679543A (en) 1985-08-29 1997-10-21 Genencor International, Inc. DNA sequences, vectors and fusion polypeptides to increase secretion of desired polypeptides from filamentous fungi
UA41863C2 (uk) 1985-10-25 2001-10-15 Займодженетікс Інк. Спосіб одержання гетерологічного поліпептиду в еукаріотичних мікроорганізмах
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
GB8601597D0 (en) 1986-01-23 1986-02-26 Wilson R H Nucleotide sequences
WO1987005330A1 (en) 1986-03-07 1987-09-11 Michel Louis Eugene Bergh Method for enhancing glycoprotein stability
DK122686D0 (da) 1986-03-17 1986-03-17 Novo Industri As Fremstilling af proteiner
EP0260350B1 (en) 1986-09-05 1992-02-12 Cetus Oncology Corporation Oxidation-resistant interferon-beta muteins and their production; formulations containing such muteins
US5183746A (en) 1986-10-27 1993-02-02 Schering Aktiengesellschaft Formulation processes for pharmaceutical compositions of recombinant β-
DE3712564A1 (de) 1987-04-14 1988-11-24 Bioferon Biochem Substanz Verfahren zur konstruktion einer animalen zellinie fuer die herstellung von humanem interferon-beta
US4904584A (en) 1987-12-23 1990-02-27 Genetics Institute, Inc. Site-specific homogeneous modification of polypeptides
US4847325A (en) 1988-01-20 1989-07-11 Cetus Corporation Conjugation of polymer to colony stimulating factor-1
GB8809129D0 (en) 1988-04-18 1988-05-18 Celltech Ltd Recombinant dna methods vectors and host cells
US5218092A (en) 1988-09-29 1993-06-08 Kyowa Hakko Kogyo Co., Ltd. Modified granulocyte-colony stimulating factor polypeptide with added carbohydrate chains
GB8824591D0 (en) 1988-10-20 1988-11-23 Royal Free Hosp School Med Fractionation process
US5349052A (en) 1988-10-20 1994-09-20 Royal Free Hospital School Of Medicine Process for fractionating polyethylene glycol (PEG)-protein adducts and an adduct for PEG and granulocyte-macrophage colony stimulating factor
AU4647889A (en) 1988-11-18 1990-06-12 Cetus Corporation Insect signal peptide mediated secretion of recombinant proteins
US5041376A (en) 1988-12-09 1991-08-20 The Board Of Regents Of The University Of Texas System Method for identifying or shielding functional sites or epitopes of proteins that enter the exocytotic pathway of eukaryotic cells, the mutant proteins so produced and genes encoding said mutant proteins
US5047335A (en) 1988-12-21 1991-09-10 The Regents Of The University Of Calif. Process for controlling intracellular glycosylation of proteins
WO1990006952A1 (fr) 1988-12-22 1990-06-28 Kirin-Amgen, Inc. Facteur de stimulation de colonies de granulocytes modifies chimiquement
US4902502A (en) 1989-01-23 1990-02-20 Cetus Corporation Preparation of a polymer/interleukin-2 conjugate
US5122614A (en) 1989-04-19 1992-06-16 Enzon, Inc. Active carbonates of polyalkylene oxides for modification of polypeptides
ES2136595T5 (es) 1989-04-19 2004-04-01 Enzon, Inc. Carbonatos activos de oxidos de polialquileno para la modificacion de polipeptidos.
DK0400472T3 (da) 1989-05-27 1996-05-13 Sumitomo Pharma Fremgangsmåde til fremstilling af polyethylenglycolderivater og modificeret protein
US5077214A (en) 1989-07-07 1991-12-31 The Texas A&M University System Use of baculovirus early promoters for expression of foreign genes in stably transformed insect cells
FR2650598B1 (fr) 1989-08-03 1994-06-03 Rhone Poulenc Sante Derives de l'albumine a fonction therapeutique
US5023328A (en) 1989-08-04 1991-06-11 The Texas A&M University System Lepidopteran AKH signal sequence
US5219564A (en) 1990-07-06 1993-06-15 Enzon, Inc. Poly(alkylene oxide) amino acid copolymers and drug carriers and charged copolymers based thereon
EP0513332A4 (en) 1990-11-14 1993-03-17 Cargill, Incorporated Conjugates of poly(vinylsaccharide) with proteins for the stabilization of proteins
US5404871A (en) 1991-03-05 1995-04-11 Aradigm Delivery of aerosol medications for inspiration
US6565841B1 (en) 1991-03-15 2003-05-20 Amgen, Inc. Pulmonary administration of granulocyte colony stimulating factor
JPH06506217A (ja) 1991-03-18 1994-07-14 エンゾン,インコーポレーテッド ポリペプチドまたはグリコポリペプチドとポリマーとのヒドラジン含有結合体
US5595732A (en) 1991-03-25 1997-01-21 Hoffmann-La Roche Inc. Polyethylene-protein conjugates
US5281698A (en) 1991-07-23 1994-01-25 Cetus Oncology Corporation Preparation of an activated polymer ester for protein conjugation
DE4128319A1 (de) 1991-08-27 1993-03-04 Bioferon Biochem Substanz Neues rekombinantes human-ifn-beta, verfahren zu dessen herstellung und dieses enthaltende pharmazeutische zubereitungen
EP0551535A1 (en) 1992-01-13 1993-07-21 SCLAVO S.p.A. Process for the purification of recombinant human beta interferon, beta interferon thus purified, and pharmaceutical compositions which contain them
FR2686899B1 (fr) 1992-01-31 1995-09-01 Rhone Poulenc Rorer Sa Nouveaux polypeptides biologiquement actifs, leur preparation et compositions pharmaceutiques les contenant.
FR2686901A1 (fr) 1992-01-31 1993-08-06 Rhone Poulenc Rorer Sa Nouveaux polypeptides antithrombotiques, leur preparation et compositions pharmaceutiques les contenant.
ZA933926B (en) 1992-06-17 1994-01-03 Amgen Inc Polyoxymethylene-oxyethylene copolymers in conjuction with blomolecules
US5785049A (en) 1994-09-21 1998-07-28 Inhale Therapeutic Systems Method and apparatus for dispersion of dry powder medicaments
AU5006993A (en) 1992-08-21 1994-03-15 Enzon, Inc. Novel attachment of polyalkylene oxides to bio-effecting substances
US5382657A (en) 1992-08-26 1995-01-17 Hoffmann-La Roche Inc. Peg-interferon conjugates
NZ250375A (en) 1992-12-09 1995-07-26 Ortho Pharma Corp Peg hydrazone and peg oxime linkage forming reagents and protein derivatives
US5298643A (en) 1992-12-22 1994-03-29 Enzon, Inc. Aryl imidate activated polyalkylene oxides
US5349001A (en) 1993-01-19 1994-09-20 Enzon, Inc. Cyclic imide thione activated polyalkylene oxides
US5934272A (en) 1993-01-29 1999-08-10 Aradigm Corporation Device and method of creating aerosolized mist of respiratory drug
US5558085A (en) 1993-01-29 1996-09-24 Aradigm Corporation Intrapulmonary delivery of peptide drugs
US5915378A (en) 1993-01-29 1999-06-29 Aradigm Corporation Creating an aerosolized formulation of insulin
US5321095A (en) 1993-02-02 1994-06-14 Enzon, Inc. Azlactone activated polyalkylene oxides
IL104734A0 (en) 1993-02-15 1993-06-10 Univ Bar Ilan Bioactive conjugates of cellulose with amino compounds
WO1994028024A1 (en) 1993-06-01 1994-12-08 Enzon, Inc. Carbohydrate-modified polymer conjugates with erythropoietic activity
AU7113594A (en) 1993-06-21 1995-01-17 Enzon, Inc. Site specific synthesis of conjugated peptides
GB9317618D0 (en) 1993-08-24 1993-10-06 Royal Free Hosp School Med Polymer modifications
US5919455A (en) 1993-10-27 1999-07-06 Enzon, Inc. Non-antigenic branched polymer conjugates
US5643575A (en) 1993-10-27 1997-07-01 Enzon, Inc. Non-antigenic branched polymer conjugates
US5951974A (en) 1993-11-10 1999-09-14 Enzon, Inc. Interferon polymer conjugates
ATE214940T1 (de) 1993-11-10 2002-04-15 Enzon Inc Verbesserte interferon-polymerkonjugate
US5446090A (en) 1993-11-12 1995-08-29 Shearwater Polymers, Inc. Isolatable, water soluble, and hydrolytically stable active sulfones of poly(ethylene glycol) and related polymers for modification of surfaces and molecules
ATE416755T1 (de) 1994-03-07 2008-12-15 Nektar Therapeutics Verfahren und zusammensetzung für die pulmonale darreichung von insulin
US5545723A (en) 1994-03-15 1996-08-13 Biogen Inc. Muteins of IFN-β
US5473034A (en) 1994-03-18 1995-12-05 Hyogo Prefectural Government Method for producing protein-synthetic polymer conjugate and said conjugate produced thereby
US5629384A (en) 1994-05-17 1997-05-13 Consiglio Nazionale Delle Ricerche Polymers of N-acryloylmorpholine activated at one end and conjugates with bioactive materials and surfaces
MX9605717A (es) 1994-05-18 1998-05-31 Inhale Therapeutic Syst Metodos y composiciones para la formulacion de polvo seco de interferones.
AU2826495A (en) 1994-06-02 1996-01-04 Enzon, Inc. Method of solubilizing substantially water insoluble materials
US5730990A (en) 1994-06-24 1998-03-24 Enzon, Inc. Non-antigenic amine derived polymers and polymer conjugates
CN101659926A (zh) 1994-06-30 2010-03-03 诺沃奇梅兹有限公司 非毒性、非产毒性、非致病性镰孢属表达系统及所用启动子和终止子
CA2155762C (en) 1994-08-23 2000-04-25 Haruya Sato Protein modification method
US5650234A (en) 1994-09-09 1997-07-22 Surface Engineering Technologies, Division Of Innerdyne, Inc. Electrophilic polyethylene oxides for the modification of polysaccharides, polypeptides (proteins) and surfaces
US5522385A (en) 1994-09-27 1996-06-04 Aradigm Corporation Dynamic particle size control for aerosolized drug delivery
US5824784A (en) 1994-10-12 1998-10-20 Amgen Inc. N-terminally chemically modified protein compositions and methods
DE4437604A1 (de) 1994-10-21 1996-04-25 Basf Ag Konjugate aus einem Poly- oder Oligopeptid und einer niedermolekularen lipophilen Verbindung
CA2204726A1 (en) 1994-11-09 1996-12-27 Robin E. Offord Functionalized polymers for site-specific attachment
US5738846A (en) 1994-11-10 1998-04-14 Enzon, Inc. Interferon polymer conjugates and process for preparing the same
US5932462A (en) 1995-01-10 1999-08-03 Shearwater Polymers, Inc. Multiarmed, monofunctional, polymer for coupling to molecules and surfaces
US5780014A (en) 1995-04-14 1998-07-14 Inhale Therapeutic Systems Method and apparatus for pulmonary administration of dry powder alpha 1-antitrypsin
WO1996040791A1 (en) 1995-06-07 1996-12-19 Novo Nordisk A/S Modification of polypeptides
US5654007A (en) 1995-06-07 1997-08-05 Inhale Therapeutic Systems Methods and system for processing dispersible fine powders
US5672662A (en) 1995-07-07 1997-09-30 Shearwater Polymers, Inc. Poly(ethylene glycol) and related polymers monosubstituted with propionic or butanoic acids and functional derivatives thereof for biotechnical applications
GB9526733D0 (en) 1995-12-30 1996-02-28 Delta Biotechnology Ltd Fusion proteins
US5747639A (en) 1996-03-06 1998-05-05 Amgen Boulder Inc. Use of hydrophobic interaction chromatography to purify polyethylene glycols
TW517067B (en) 1996-05-31 2003-01-11 Hoffmann La Roche Interferon conjugates
EP0964702B1 (en) 1996-08-02 2006-10-04 Ortho-McNeil Pharmaceutical, Inc. Polypeptides having a single covalently bound n-terminal water-soluble polymer
AU5719798A (en) 1996-12-31 1998-07-31 Inhale Therapeutic Systems, Inc. Processes for spray drying aqueous suspensions of hydrophobic drugs with hydrophilic excipients and compositions prepared by such processes
WO1998032466A1 (en) 1997-01-29 1998-07-30 Polymasc Pharmaceuticals Plc Pegylation process
DE19717864C2 (de) * 1997-04-23 2001-05-17 Fraunhofer Ges Forschung Humanes rekombinantes Interferon-beta, Verfahren zu seiner Herstellung und seine Verwendung
EP0979102A4 (en) 1997-04-30 2005-11-23 Enzon Inc DETAILED POLYPEPTIDE MODIFIED BY POLYALKYLENE OXIDE
JP4011124B2 (ja) 1997-06-06 2007-11-21 協和醗酵工業株式会社 化学修飾ポリペプチド
ES2297889T3 (es) * 1997-07-14 2008-05-01 Bolder Biotechnology, Inc. Derivados de hormona de crecimiento y proteinas relacionadas.
US5855564A (en) 1997-08-20 1999-01-05 Aradigm Corporation Aerosol extrusion mechanism
US5981709A (en) 1997-12-19 1999-11-09 Enzon, Inc. α-interferon-polymer-conjugates having enhanced biological activity and methods of preparing the same
US5985263A (en) 1997-12-19 1999-11-16 Enzon, Inc. Substantially pure histidine-linked protein polymer conjugates
EE05214B1 (et) 1998-04-28 2009-10-15 Applied Research Systems ARS Holding N.V. Polool-IFN- β konjugaat, selle valmistamismeetod ja farmatseutiline kompositsioon
US6451986B1 (en) 1998-06-22 2002-09-17 Immunex Corporation Site specific protein modification
HU229888B1 (en) 1998-10-16 2014-11-28 Biogen Idec Ma Inc Cambridge Polymer conjugates of interferon betha-1a and uses
BR9915548A (pt) 1998-10-16 2001-08-14 Biogen Inc Proteìnas de fusão de interferon-beta e usos
ATE365210T1 (de) 1998-10-30 2007-07-15 Novozymes As Glykosylierte proteine mit reduzierter allergenität
AU6687000A (en) * 1999-08-27 2001-03-26 Maxygen Aps New interferon beta-like molecules

Cited By (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7226903B2 (en) 2001-10-10 2007-06-05 Neose Technologies, Inc. Interferon beta: remodeling and glycoconjugation of interferon beta
US7265085B2 (en) 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycoconjugation methods and proteins/peptides produced by the methods
US7138371B2 (en) 2001-10-10 2006-11-21 Neose Technologies, Inc Remodeling and glycoconjugation of peptides
US8076292B2 (en) 2001-10-10 2011-12-13 Novo Nordisk A/S Factor VIII: remodeling and glycoconjugation of factor VIII
US7173003B2 (en) 2001-10-10 2007-02-06 Neose Technologies, Inc. Granulocyte colony stimulating factor: remodeling and glycoconjugation of G-CSF
US7179617B2 (en) 2001-10-10 2007-02-20 Neose Technologies, Inc. Factor IX: remolding and glycoconjugation of Factor IX
US7214660B2 (en) 2001-10-10 2007-05-08 Neose Technologies, Inc. Erythropoietin: remodeling and glycoconjugation of erythropoietin
US8716240B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7416858B2 (en) 2001-10-10 2008-08-26 Neose Technologies, Inc. Pharmaceutical compositions of glycoconjugates
US7439043B2 (en) 2001-10-10 2008-10-21 Neose Technologies, Inc. Galactosyl nucleotide sugars
US8716239B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Granulocyte colony stimulating factor: remodeling and glycoconjugation G-CSF
US7265084B2 (en) 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycopegylation methods and proteins/peptides produced by the methods
US7276475B2 (en) 2001-10-10 2007-10-02 Neose Technologies, Inc. Remodeling and glycoconjugation of peptides
US7297511B2 (en) 2001-10-10 2007-11-20 Neose Technologies, Inc. Interferon alpha: remodeling and glycoconjugation of interferon alpha
US8008252B2 (en) 2001-10-10 2011-08-30 Novo Nordisk A/S Factor VII: remodeling and glycoconjugation of Factor VII
US7795210B2 (en) 2001-10-10 2010-09-14 Novo Nordisk A/S Protein remodeling methods and proteins/peptides produced by the methods
US7399613B2 (en) 2001-10-10 2008-07-15 Neose Technologies, Inc. Sialic acid nucleotide sugars
US7696163B2 (en) 2001-10-10 2010-04-13 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7125843B2 (en) 2001-10-19 2006-10-24 Neose Technologies, Inc. Glycoconjugates including more than one peptide
US7473680B2 (en) 2001-11-28 2009-01-06 Neose Technologies, Inc. Remodeling and glycoconjugation of peptides
US7157277B2 (en) 2001-11-28 2007-01-02 Neose Technologies, Inc. Factor VIII remodeling and glycoconjugation of Factor VIII
US8524660B2 (en) 2002-01-18 2013-09-03 Biogen Idec Ma Inc. Polyalkylene polymer compounds and uses thereof
US8017733B2 (en) 2002-01-18 2011-09-13 Biogen Idec Ma Inc. Polyalkylene polymer compounds and uses thereof
WO2004020468A3 (en) * 2002-08-28 2004-06-10 Maxygen Aps Interferon beta-like molecules for treatment of cancer
EP1575531A4 (en) * 2002-09-27 2008-01-23 Biogen Idec Inc INFLAMMATORY DEMYELINIZATION POLYNEUROPATIC CHRONIC THERAPIES USING INTERFERON-BETA
US9125880B2 (en) 2002-12-26 2015-09-08 Mountain View Pharmaceuticals, Inc. Polymer conjugates of interferon-beta with enhanced biological potency
EP1667708B1 (en) * 2002-12-26 2012-06-06 Mountain View Pharmaceuticals, Inc. POLYETHYLENE GLYCOL CONJUGATES OF INTERFERON-BETA-1b WITH ENHANCED IN VITRO BIOLOGICAL POTENCY
US7803777B2 (en) 2003-03-14 2010-09-28 Biogenerix Ag Branched water-soluble polymers and their conjugates
US8247381B2 (en) 2003-03-14 2012-08-21 Biogenerix Ag Branched water-soluble polymers and their conjugates
US8853161B2 (en) 2003-04-09 2014-10-07 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
US8791070B2 (en) 2003-04-09 2014-07-29 Novo Nordisk A/S Glycopegylated factor IX
US8063015B2 (en) 2003-04-09 2011-11-22 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
US7691603B2 (en) 2003-04-09 2010-04-06 Novo Nordisk A/S Intracellular formation of peptide conjugates
US7932364B2 (en) 2003-05-09 2011-04-26 Novo Nordisk A/S Compositions and methods for the preparation of human growth hormone glycosylation mutants
US9005625B2 (en) 2003-07-25 2015-04-14 Novo Nordisk A/S Antibody toxin conjugates
US7842661B2 (en) 2003-11-24 2010-11-30 Novo Nordisk A/S Glycopegylated erythropoietin formulations
US7405198B2 (en) 2003-11-24 2008-07-29 Neose Technologies, Inc. Glycopegylated erythropoietin
US8916360B2 (en) 2003-11-24 2014-12-23 Novo Nordisk A/S Glycopegylated erythropoietin
US8633157B2 (en) 2003-11-24 2014-01-21 Novo Nordisk A/S Glycopegylated erythropoietin
US7956032B2 (en) 2003-12-03 2011-06-07 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US8632770B2 (en) 2003-12-03 2014-01-21 Novo Nordisk A/S Glycopegylated factor IX
JP2007518724A (ja) * 2003-12-31 2007-07-12 オーソロジック コーポレイション トロンビンペプチド誘導体のための医薬組成物
US8361961B2 (en) 2004-01-08 2013-01-29 Biogenerix Ag O-linked glycosylation of peptides
US10844110B2 (en) 2004-05-04 2020-11-24 Novo Nordisk Healthcare Ag O-linked glycoforms of polypeptides and method to manufacture them
US9023992B2 (en) 2004-05-04 2015-05-05 Novo Nordisk Healthcare Ag Hydrophobic interaction chromatography purification of factor VII polypeptides
US8791066B2 (en) 2004-07-13 2014-07-29 Novo Nordisk A/S Branched PEG remodeling and glycosylation of glucagon-like peptide-1 [GLP-1]
US8268967B2 (en) 2004-09-10 2012-09-18 Novo Nordisk A/S Glycopegylated interferon α
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
US10874714B2 (en) 2004-10-29 2020-12-29 89Bio Ltd. Method of treating fibroblast growth factor 21 (FGF-21) deficiency
US9029331B2 (en) 2005-01-10 2015-05-12 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US9187546B2 (en) 2005-04-08 2015-11-17 Novo Nordisk A/S Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
US8404809B2 (en) 2005-05-25 2013-03-26 Novo Nordisk A/S Glycopegylated factor IX
WO2006135930A3 (en) * 2005-06-13 2007-05-31 Nastech Pharm Co Transmucosal delivery of peptide derivatives
US8911967B2 (en) 2005-08-19 2014-12-16 Novo Nordisk A/S One pot desialylation and glycopegylation of therapeutic peptides
US8841439B2 (en) 2005-11-03 2014-09-23 Novo Nordisk A/S Nucleotide sugar purification using membranes
US9187532B2 (en) 2006-07-21 2015-11-17 Novo Nordisk A/S Glycosylation of peptides via O-linked glycosylation sequences
WO2008020968A3 (en) * 2006-08-08 2008-05-29 Novartis Vaccines & Diagnostic Recombinant interferon-beta with enhanced biological activity
US8969532B2 (en) 2006-10-03 2015-03-03 Novo Nordisk A/S Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography
US9234022B2 (en) 2007-06-18 2016-01-12 Novagen Holding Corporation Recombinant human interferon-like proteins and method of treatment using them
US7625555B2 (en) 2007-06-18 2009-12-01 Novagen Holding Corporation Recombinant human interferon-like proteins
US7867482B2 (en) 2007-06-18 2011-01-11 Novagen Holding Corporation Recombinant human interferon-like proteins
US8425895B2 (en) 2007-06-18 2013-04-23 Novagen Holding Corporation Recombinant human interferon-like proteins
US10538565B2 (en) 2007-06-18 2020-01-21 Novagen Holding Corporation Method of treating diseases with recombinant human interferon-like proteins
US7868151B2 (en) 2007-06-18 2011-01-11 Novagen Holding Corporation Recombinant human interferon-like proteins
US9982028B2 (en) 2007-06-18 2018-05-29 Novagen Holding Corporation Recombinant human interferon-like proteins
US8207112B2 (en) 2007-08-29 2012-06-26 Biogenerix Ag Liquid formulation of G-CSF conjugate
US9150848B2 (en) 2008-02-27 2015-10-06 Novo Nordisk A/S Conjugated factor VIII molecules
US10358470B2 (en) 2011-10-01 2019-07-23 Glytech, Inc. Glycosylated polypeptide and pharmaceutical composition containing same
WO2014049588A1 (en) * 2012-09-27 2014-04-03 University College Dublin, National University Of Ireland, Dublin A method for treatment of pulmonary fibrosis and diagnosis or prognosis of an aggressive pulmonary fibrosis phenotype
WO2014157107A1 (ja) 2013-03-29 2014-10-02 株式会社糖鎖工学研究所 シアリル化糖鎖が付加されたポリペプチド
US10053499B2 (en) 2013-03-29 2018-08-21 Glytech, Inc. Polypeptide having sialylated sugar chains attached thereto
CN104334574B (zh) * 2013-03-29 2020-01-14 株式会社糖锁工学研究所 附加唾液酸化糖链的多肽
EP2982686A4 (en) * 2013-03-29 2016-10-26 Glytech Inc POLYPEPTIDE WITH SIALYLATED SUGAR CHAINS FIXED THEREIN
KR20150139411A (ko) * 2013-03-29 2015-12-11 가부시키가이샤 도우사 고가쿠 겐큐쇼 시알릴화 당쇄가 부가된 폴리펩티드
CN104334574A (zh) * 2013-03-29 2015-02-04 株式会社糖锁工学研究所 附加唾液酸化糖链的多肽

Also Published As

Publication number Publication date
JP2004534523A (ja) 2004-11-18
WO2002074806A3 (en) 2003-05-01
HUP0303251A2 (hu) 2003-12-29
BR0207576A (pt) 2004-04-27
EP2080771A3 (en) 2010-01-06
EP1366075A2 (en) 2003-12-03
ATE432288T1 (de) 2009-06-15
IS6927A (is) 2003-08-26
MXPA03007619A (es) 2003-12-04
CZ20032526A3 (cs) 2003-12-17
EP1366075B1 (en) 2009-05-27
DE60232434D1 (de) 2009-07-09
IL156059A0 (en) 2003-12-23
CA2469846A1 (en) 2002-09-26
SK11882003A3 (sk) 2004-03-02
NO20033781D0 (no) 2003-08-26
YU48703A (sh) 2006-05-25
NO20033781L (no) 2003-08-26
PL367154A1 (en) 2005-02-21
RU2003128955A (ru) 2005-04-10
EP2080771A2 (en) 2009-07-22

Similar Documents

Publication Publication Date Title
EP1366075B1 (en) New interferon beta-like molecules
US7338788B2 (en) Interferon-β variants and conjugates
US7504237B2 (en) Polynucleotides encoding interferon gamma polypeptides
US7144574B2 (en) Interferon β variants and conjugates
US20090030183A1 (en) Interferon Beta-Like Molecules
WO2001015736A2 (en) Interferon-beta conjugates
US7230081B1 (en) Interferon gamma conjugates
US20020169290A1 (en) New multimeric interferon beta polypeptides
US7524931B2 (en) Full-length interferon gamma polypeptide variants
US7390638B2 (en) S99T C-11 Truncated polynucleotides encoding interferon gamma polypeptide variants
WO2002036628A2 (en) New multimeric interferon beta polypeptides
AU2002235727A1 (en) New interferon beta-like molecules
ZA200303964B (en) New interferon beta-like molecules.
AU782635B2 (en) Interferon gamma conjugates
ZA200200337B (en) New interferon beta-like molecules.

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: P-487/03

Country of ref document: YU

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2002235727

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2002702228

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2003/03964

Country of ref document: ZA

Ref document number: 156059

Country of ref document: IL

Ref document number: 200303964

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 526151

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2469846

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PA/a/2003/007619

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2002573813

Country of ref document: JP

Ref document number: 1346/CHENP/2003

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 028056051

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: P20030745A

Country of ref document: HR

WWE Wipo information: entry into national phase

Ref document number: PV2003-2526

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 11882003

Country of ref document: SK

WWP Wipo information: published in national office

Ref document number: 2002702228

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: PV2003-2526

Country of ref document: CZ

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWR Wipo information: refused in national office

Ref document number: PV2003-2526

Country of ref document: CZ