WO2002020586A1 - Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020586A1
WO2002020586A1 PCT/CN2001/001123 CN0101123W WO0220586A1 WO 2002020586 A1 WO2002020586 A1 WO 2002020586A1 CN 0101123 W CN0101123 W CN 0101123W WO 0220586 A1 WO0220586 A1 WO 0220586A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
large protein
human large
sequence
Prior art date
Application number
PCT/CN2001/001123
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2002223370A priority Critical patent/AU2002223370A1/en
Publication of WO2002020586A1 publication Critical patent/WO2002020586A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human large protein 10.23, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the function of KIAA0072 protein is related to cell signalling / communication, cell structure / movement, and nucleic acid control. It is expressed in 10 human tissues and 8 brain regions, spinal cord, fetal brain, and fetal liver. Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-fc growth factor stimulation, ⁇ scars to fc Not stimulated with growth factors, expression of the polypeptide of the present invention in 1013HC, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunum adenocarcinoma, and cardia cancer The profile is very similar to the expression profile of KIAA0072, so the functions of the two may be similar.
  • the invention is named human large protein 10.23.
  • the human large protein 10.23 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • the human large protein 10.23 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human large protein 10.23 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human large protein 10.23.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human large protein 10.23.
  • Another object of the present invention is to provide a method for producing human large protein 10.23.
  • Another object of the present invention is to provide an antibody against the polypeptide-human large protein 10.23 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human large protein 10.23.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in human large protein 10.23.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1054 to 1335 in SEQ ID NO: 1; and (b) a sequence having 1-2719 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
  • the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human large protein 10.23 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human large protein 10.23 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating ⁇ cancer, developmental disease or immune disease ⁇ or other diseases caused by abnormal expression of human large protein 10.23.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term “immunologically active” refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human large protein 10.23, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human large protein 10.23.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human large protein 10.23 when combined with human large protein 10.23.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human large protein 10.23.
  • Regular refers to a 'change in the function of human large protein 10.23, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human large protein 10.23.
  • Substantially pure 1 'means essentially free of other proteins, lipids, carbohydrates or other substances naturally associated with it.
  • Those skilled in the art can purify human large protein 10.23 using standard protein purification techniques. Human large protein 10.23 can produce a single main band on a non-reducing polyacrylamide gel. Human large protein 10.23 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergenes of tware package, DNASTAR, Inc., Mad is on Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method checks all pairs The distances of each group are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jo tun He in Percentage (He in J., (1990) Me thods in emzumo ogy 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human large protein 10.23.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human large protein 10.23 means human large protein 10.23 is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can purify human large protein 10.23 using standard protein purification techniques. Non-reducing polyacryl A single main band can be produced on the amine gel. The purity of human large protein 10.23 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human large protein 10.23, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human large protein 10.23.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human large protein 10.23 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2719 bases in length and its open reading frame 1 054-1 335 encodes 93 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile as ⁇ AA0072, and it can be inferred that the human large protein 10.23 has similar functions to KIAA0072.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: ⁇ or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optionally the additional Plus coding sequences) and non-coding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-3 G nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human large protein 10.23.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human large protein 10.23 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available. Way to get (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of transcript of human large protein 10.23; (4) through immunization Technology or measurement of biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human large protein 10.23 gene expression.
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human large protein 10.23 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding human large protein 10.23 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, which are well known in the art. Or other carriers.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human large protein 10.23 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells such as fly S2 or S
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • the host cell can be transformed with the DM sequence of the present invention or a recombinant vector containing the DNA sequence. This is done using conventional techniques well known to those skilled in the art.
  • competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human large protein 10.23 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatments, protein precipitant treatments (salting out methods), centrifugation, osmotic disruption, ultrasonic treatments, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatments protein precipitant treatments (salting out methods), centrifugation, osmotic disruption, ultrasonic treatments, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HP
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human large protein 10.23 and human-human 0072 of the present invention.
  • the upper graph is a graph of the expression profile of human protein 10.23, and the lower graph is the graph of the expression profile of KIAA0072.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imer l 5, —TCTCTGAACTTCATTCTCCCCATA— 3, (SEQ ID NO: 3)
  • Pr imer2 5,-AGAGACAGGACCTCACCCTGCAGC- 3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting at the lbp at the 5 'end of SEQ ID NO: 1;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was identical to the 1-2727bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human large protein 10.23 gene expression:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human large protein 10.23
  • Primer3 5,-CCCCATATGATGCTTTTGCAGTCATGCAGCAAG -3, (Seq ID No: 5)
  • Priraer4 5'- CCCGAATTCTTAATAAAATTTGGAGAAAAATGT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using the pBS-0063c06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0063c06 plasmid, ⁇
  • the ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method. After the LB plate (final concentration 30 g / ml) was cultured overnight, positive clones were selected by colony PCR method and sequenced. Selected positive clones with the correct sequence (P ET-0063c06) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Novagen Co.).
  • the host strain BL21 (pET-0063c06) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. , Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation, and the supernatant was collected by centrifugation. An affinity chromatography column His s. Bind Quick Car tr idge capable of binding to 6 histidines (6His-Tag) was used.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human large protein 10. 23 specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting Trace method, Nor thern blot method, and copy method, etc., all are used to fix the polynucleotide sample to be tested on the filter membrane and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Example 7 DNA Mi croarray
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; finding and screening new tissue-specific new genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs as target DNA, including the present invention Polynucleotide. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
  • the spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips.
  • the specific method steps have been variously reported in the literature.
  • the post-spot processing steps of this embodiment are:
  • Total raRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription.
  • Cy3dUTP (5-Amino-propargy 1-2'-deoxyur idine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 -Amino- propargyl- 2'- deoxyur idine 5'-triphate cou led to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech, to label mRNA of specific tissues (or stimulated cell lines) of the body, and prepare probes after purification .
  • Cy3dUTP (5-Amino-propargy 1-2'-deoxyur idine 5'-triphate coupled to Cy
  • the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, and PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblast 1 024NC, Fi broblas t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 101 3HC, bladder Cancer cell line EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a chart based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human large protein 10.23 and KIAA0072 according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Human K IAA protein is related to cell signalling / communication, cell structure / movement, and nucleic acid control in the human body. Abnormal expression of human K IAA protein can cause human cell signal pathway transmission disorders, disorder of gene expression, and disorder of protein metabolism, etc., and then cause related diseases. happened.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human KIAA protein, and both have similar biological functions.
  • the polypeptide of the present invention is related to cell signal transduction / communication, cell structure / movement, and nucleic acid control in vivo. Abnormal expression of the polypeptide can cause human cell signal pathway transmission disorder, disorder of gene expression, and disorder of protein metabolism, etc., and then cause embryo developmental abnormalities , Protein metabolism disorders, tumor diseases, disorders of the immune system, etc. These diseases include but are not limited to: Common embryonic developmental abnormalities
  • Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.
  • Absent in longitudinal direction Absence of upper limb scratch / ulnar side, lower limb tibia / fibula side, etc .;
  • Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multiple finger (toe) deformity, and finger (toe) deformity, horse tellurium varus etc .;
  • Thyroglossal cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital No ganglionous giant colon, impervious anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc. 3.
  • Common malformations of the respiratory system laryngotracheal stenosis / occlusion, tracheoesophageal fistula, hyaline membrane disease, unilateral lung failure Occurrence, ectopic lung lobe, congenital lung cyst, pulmonary insufficiency, etc .;
  • neural tube defects no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polymorphic adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .; 2.
  • Mesenchymal tissue :
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [head, neck, limbs and other nerves], (malignant) glioblastoma [brain], myeloblastoma Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / kidney Adrenal medulla] and so on;
  • malignant melanoma [skin, mucous membrane], (malignant) hydatidiform mole, chorionic epithelial cancer [uterine], (malignant) supporter cells, stromal cell tumor, (malignant) granulosa cell tumor [ovarian, testicular], fine Protocytoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum, and sacral tail], etc .; disorders related to protein metabolism disorders
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;
  • parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • Intracellular parasitic infections typhoid, paratyphoid (typhoid), tuberculosis (tuberculosis), leprosy (leprosy), wave thermal conductivity (brutella), etc .;
  • measles virus measles, measles bronchitis, pneumonia, otitis media, subacute sclerosing panencephalitis
  • herpes virus herpes zoster, chicken pox
  • polio virus poliomyelitis
  • hepatitis virus A, B, C, D, E, H, G
  • etc . Various viral infections: polio virus (poliomyelitis), hepatitis virus (A, B, C, D, E, H, G), etc .;
  • Malignant tumors leukemia, lymphatic tumors, etc .;
  • Autoimmune diseases systemic lupus erythematosus, rheumatoid arthritis, malignant anemia, etc.
  • the polypeptide of the present invention and its antagonists, agonists and inhibitors can be directly used in the treatment of various diseases, For example, embryo developmental abnormalities, protein metabolism disorders, tumor diseases, disorders of the immune system, etc.
  • the invention also provides screening compounds to identify increasing (agonist) or repressing (antagonist) human large proteins.
  • Agonists enhance human large protein 10.23 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
  • mammalian cells or membrane preparations expressing human large protein 10.23 can be cultured together with labeled human large protein 10.23 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human large protein 10.23 include screened antibodies, compounds, receptor deletions and analogs. Antagonists of human large protein 10.23 can bind to human large protein 10.23 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human large protein 10.23 When screening compounds as antagonists, human large protein 10.23 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human large protein 10.23 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human large protein 10.23 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 10.23 molecules of human large protein should be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human deprotein 10.23 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human large protein 10.23 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies against human large protein 10.23 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridoma technology. Wait. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the unique technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human large protein 10.23.
  • Anti-Human Large Protein 10.23 antibody can be used in immunohistochemistry to detect human Large Protein 10.23 in biopsy specimens.
  • Monoclonal antibodies that bind to human large protein 10.23 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human large protein 10.23 High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human large protein 10.23 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human large protein 10.23. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human large protein 10.23.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human large protein at 10.23.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human large protein 10.23 detected in the test can be used to explain the importance of human large protein 10.23 in various diseases and to diagnose diseases where human large protein 10.23 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human large protein 10.23 can also be used for a variety of therapeutic purposes. Gene therapy technology can It is used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human large protein 10.23.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human large protein 10.23 to inhibit endogenous human large protein 10.23 activity.
  • a mutated human large protein 10.23 may be a shortened human large protein 10.23 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human large protein 10.23.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human large protein 10.23 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human large protein 10.23 can be found in existing literature (Sanibrook, et al.).
  • a recombinant polynucleotide encoding human large protein 10.23 can be packaged into liposomes and transferred into cells. ⁇
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit 10.23 mRM of human large proteins are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the solid-phase phosphate amide chemical synthesis method to synthesize oligonucleotides has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human large protein 10.23 can be used for the diagnosis of diseases related to human large protein 10.23.
  • the polynucleotide encoding human large protein 10.23 can be used to detect the expression of human large protein 10.23 or the abnormal expression of human large protein 10.23 in a disease state.
  • the DM sequence encoding human large protein 10.23 can be used to hybridize biopsy specimens to determine the expression of human large protein 10.23.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly known and mature, and related kits are commercially available.
  • Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human-protein 10.23 specific primers can be used to detect RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human-protein 10.23 transcripts.
  • Mutation detection NPC 10.2 3 gene protein may also be used to diagnose a disease associated 10.23 NPC proteins.
  • Human protein 10.23 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild type human protein 10.23 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopk ins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human large protein 1 0. 2 3 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human large protein 10.2 3 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une grande protéine humaine 10.23, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations apparaissant lors du développement de l'embryon, de troubles du métabolisme des protéines, de maladies tumorales et de maladies liées aux troubles du système immunitaire. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la grande protéine humaine 10.23.
PCT/CN2001/001123 2000-07-07 2001-07-02 Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide WO2002020586A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002223370A AU2002223370A1 (en) 2000-07-07 2001-07-02 A novel polypeptide-human large protein 10.23 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00117058.9 2000-07-07
CN00117058A CN1333261A (zh) 2000-07-07 2000-07-07 一种新的多肽——人大蛋白10.23和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002020586A1 true WO2002020586A1 (fr) 2002-03-14

Family

ID=4586455

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001123 WO2002020586A1 (fr) 2000-07-07 2001-07-02 Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1333261A (fr)
AU (1) AU2002223370A1 (fr)
WO (1) WO2002020586A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH04197179A (ja) * 1990-11-29 1992-07-16 Fujikura Kasei Co Ltd ヒトパラインフルエンザ２型ウイルスラージプロテイン遺伝子及び該遺伝子を含む物質
WO1997020468A1 (fr) * 1995-12-08 1997-06-12 St. Louis University VACCINS VIVANTS ATTENUES COMPORTANT LA SOUCHE cp45 D'HPIV-3 ET PROCEDE GARANTISSANT L'ATTENUATION DE CES VACCINS

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH04197179A (ja) * 1990-11-29 1992-07-16 Fujikura Kasei Co Ltd ヒトパラインフルエンザ２型ウイルスラージプロテイン遺伝子及び該遺伝子を含む物質
WO1997020468A1 (fr) * 1995-12-08 1997-06-12 St. Louis University VACCINS VIVANTS ATTENUES COMPORTANT LA SOUCHE cp45 D'HPIV-3 ET PROCEDE GARANTISSANT L'ATTENUATION DE CES VACCINS

Also Published As

Publication number Publication date
AU2002223370A1 (en) 2002-03-22
CN1333261A (zh) 2002-01-30

Similar Documents

Publication Publication Date Title
WO2002006477A1 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002006475A1 (fr) NOUVEAU POLYPEPTIDE, β1-GLYCOPROTEINE SPECIFIQUE DE LA GROSSESSE 9.02, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002020586A1 (fr) Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide
WO2002026793A1 (fr) Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide
WO2002004504A1 (fr) Nouveau polypeptide, sous-unite humaine 9.46 de proteine g, et polynucleotide codant ce polypeptide
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002012318A1 (fr) Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide
WO2002020780A1 (fr) Nouveau polypeptide, grande proteine humaine 9.13, et polynucleotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2001096526A2 (fr) Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide
WO2002004507A1 (fr) Nouveau polypeptide, proteine de type histidyl-arnt synthetase 13.2, et polynucleotide codant ce polypeptide
WO2002012488A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 8.8, et polynucleotide codant ce polypeptide
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP