WO2002026793A1 - Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002026793A1
WO2002026793A1 PCT/CN2001/001121 CN0101121W WO0226793A1 WO 2002026793 A1 WO2002026793 A1 WO 2002026793A1 CN 0101121 W CN0101121 W CN 0101121W WO 0226793 A1 WO0226793 A1 WO 0226793A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
large protein
human large
protein
Prior art date
Application number
PCT/CN2001/001121
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2002223369A priority Critical patent/AU2002223369A1/en
Publication of WO2002026793A1 publication Critical patent/WO2002026793A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human large protein 62, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique
  • genes are expressed in 10 human tissues, 8 brain regions (tonsils, corpus callosum, cerebellum, caudate nucleus, hippocampus, thalamic nucleus, thalamus, substantia nigra), spinal cord, fetal brain, and fetal liver [Takahi ro Nagas e, Ken-ichi I shikawa et a l., 1999, DNA Res earch., 6, 63-70].
  • ⁇ 0138 protein As mentioned above, the function of ⁇ 0138 protein is related to cell signaling / communication, cell structure / movement, and nucleic acid control. It is expressed in 10 human tissues and 8 brain regions, spinal cord, fetal brain, and fetal liver.
  • human large protein 62 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human large protein 62 proteins involved in these processes, especially to identify this. Amino acid sequence of several proteins. Isolation of the new human large protein 62 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing human large protein 62.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human large protein 62.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed against the polypeptide of the present invention-human large protein 62.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human large protein 62.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human large protein 62 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to a compound obtained by the method.
  • the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human large protein 62 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting the The amount or biological activity of the polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human large protein 62.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic MA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • Antagonist refers to a protein that, when bound to human large protein 62, causes a change in the protein to regulate Molecules that are active in this protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human large protein 62.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human large protein 62 when combined with human large protein 62.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human large protein 62.
  • Regular refers to a change in the function of human large protein 62, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human large protein 62.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human large protein 62 using standard protein purification techniques.
  • Substantially pure human protein 62 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human large protein 62 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. (Hein J., (1990) Methods in emzumo ogy 183: 625-645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (&1>') 2 and? ⁇ It can specifically bind to the epitope of human large protein 62.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human large protein 62 means that human large protein 62 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can use standard eggs White matter purification technology purified human large protein 62. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human large protein 62 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human large protein 62, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human large protein 62.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human large protein 62 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2544 bases in length and its open reading frame 521-5687 encodes 568 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 54% homology with human large protein, and it can be deduced that the human large protein 62 has a similar structure and function to human large protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DM forms include cDNA, genomic MA or synthetic DNA. DM can be single-stranded or double-stranded. DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SBQ ID NO: 1 or a degenerate variant.
  • degenerate variant refers to a nucleic acid sequence that encodes a protein or polypeptide having SEQ ID NO: 2 but is different from the coding region sequence shown in SEQ ID NO: 1 in the present invention. .
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /. (V / v) formamide, 0.1% calf serum / 0.1 ° /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human large protein 62.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human large protein 62 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or Phage CDM Library.
  • the construction of cDNA libraries is also a common method (Sambrook, et ah, Molecular Cloning, A Laboratory Manua, Coll Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DM-MA hybridization; (2) the appearance or loss of marker gene function; 0) determination of the level of human large protein 62 transcripts; (4) through immunology Technology or measurement of biological activity to detect protein products expressed by genes. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of a pin is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human large protein 62 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human large protein 62 coding sequence, and a method for producing a polypeptide according to the present invention by recombinant technology.
  • a polynucleotide sequence encoding human large protein 62 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to a bacterial plasmid, Bacterial body, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus or other vectors.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequences encoding human large protein 62 and appropriate transcriptional / translational regulatory elements can be used to construct expression vectors containing DM sequences encoding human large protein 62 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, cold Spring Harbor Laboratory. New York, 1989).
  • the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide fflRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human large protein 62 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector incorporating the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl ⁇ . The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human large protein 62 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of amino acid sequence homology between human large protein 62 and human large protein of the present invention.
  • the upper sequence is human large protein 62, and the lower sequence is human large protein.
  • Identical amino acids are represented by a single character amino acid between the two sequences, and similar amino acids are represented by.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of isolated human large protein 62.
  • 62kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elraer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDM sequence of one of the clones 0276dll was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDNA was synthesized using fetal brain cell total MA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- GTAGCATCTGTTCCTTTTGTGAAA -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- GTGCAAACCTGGTTTATTACGTTC -3, (SEQ ID NO: 4) Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pi-imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of ol / L KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 ⁇ l / L MgCl 2 , 200 ⁇ mol / L dNTP in a reaction volume of 50 ⁇ 1 lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and Template blank is negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2544bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human large protein 62 gene expression:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, Analysis and quantification using Phosphor Imager.
  • Example 5 In vitro expression, analysis and purification of recombinant human large protein 62
  • Primer 3 5,-CATCCATGGATGTTGGTGATCAACTTCAAAGAA -3, (Seq ID No: 5)
  • Primer 4 5,-CATGGATCCCCGCTCATCATGTCGAGACTGCA -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively , followeded by the coding sequences of the 5 'end and 3 ' end of the gene of interest, respectively.
  • the restriction sites of Mel and EcoRI correspond to those on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865 .3). Selective endonuclease site.
  • PBS- The 0276dll plasmid was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1, a plasmid containing 10 pg of pBS-O ll, primers Pr imer-3 and pr imer-4 points; j is lOpmol Advantage polymerase Mix
  • a peptide synthesizer (product of PE company) was used to synthesize the following human large protein 62-specific peptides:
  • NH 2 -Met-Leu-Val-I le-Asn-Phe-Lys-Glu-Pro-Gln-Arg-Arg-Gln-Thr-Ser- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Im ochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human large protein 62.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Group Whether the expression in weaving cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the probes from the hybridization are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 301 ⁇ 2-70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1: 5 '-TGTTGGTGATCAACTTCAAACAACCTCAAAGAAGACAGACA-3' (SEQ ID NO: 9)
  • SEQ ID NO: 9 For other common reagents and their preparation methods not listed in the following specific experimental procedures, please refer to the literature: DM PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used manuals of molecular cloning experiments such as "Molecular Cloning Experiment Guide” (Second Edition 1998) [US] Sambrook et al., Science Press.
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software, in order to achieve the purpose of analyzing biological information quickly, efficiently and with high throughput.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi s i, J. L., Lyer, V. feBrown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR (as described in Example 1), and the amplified product was purified to a concentration of about 500ng / ul, and a Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA) was used. The point is on the glass medium, and the distance between the points is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips.
  • the specific method steps have been variously reported in the literature, and the specific method steps have been variously reported in the literature.
  • the sample post-processing steps of this embodiment are:
  • Total mRM was extracted from normal liver and liver cancer in one step, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargyl-2'- deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amershani Phamacia Biotech company) labeled mRNA of normal liver tissue, using Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA), and scan the scanned images using Imagene software (Biodiscovery, USA) for data Analyze and process to calculate the Cy3 / Cy5 ratio of each point, and the point whose ratio is less than 0.5 and greater than 2 is considered as a gene with different expression.
  • polypeptide of the present invention as well as its antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Human KIAA protein is related to cell signaling / communication, cell structure / movement, and nucleic acid control in the human body. Abnormal expression of human KIAA protein can cause human cell signaling pathway disturbances, disturbances in gene expression, and disturbances in protein metabolism, which can lead to related diseases. occur.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human KIAA protein, and both have similar biological functions.
  • the polypeptide of the present invention is related to cell signal transduction / communication, cell structure / movement, and nucleic acid control in vivo. Abnormal expression of the polypeptide can cause human cell signal pathway transmission disorder, disorder of gene expression, and disorder of protein metabolism, etc., and then cause embryo developmental abnormalities. , Protein metabolism disorders, tumor diseases, disorders of the immune system, etc. These diseases include but are not limited to:
  • Cleft lip most common, with alveolar cleft and cleft palate
  • cleft palate cleft palate
  • oblique cleft palate cervix
  • cervical fistula etc.
  • Absent in longitudinal direction Absence of upper limb radius / ulnar side, lower limb tibia / fibula side, etc .;
  • Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multiple finger (toe) deformity, and finger (toe) deformity, horse tellurium varus etc .;
  • neural tube defects no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovarian], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .; 2.
  • Mesenchymal tissue :
  • Fibrous (sarcoma) [limbs], (Malignant) fibrohistiocytoma [limbs], lipo (sarcoma) [subcutaneous tissue, lower limbs, retroperitoneum], leiomyosarcoma (uterus and gastrointestinal), striated muscle (Sarcoma) [head and neck, genitourinary tract, limbs], hemangioma (sarcoma), lymphangioma (sarcoma) [skin, subcutaneous tissue, tongue, lips], bone (sarcoma) [cranium, long bone], (malignant Giant cell tumor [femoral / tibia / upper humerus], cartilage (sarcoma) [hand and foot short bone, pelvis / rib / femoral / humerus / scapula], synovial (sarcoma) tumor
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [head, neck, limbs and other nerves], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum] (Malignant) Meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, improper antidiuretic hormone secretion syndrome, abnormal lactation, etc. 3) Parathyroid hormone: hyperparathyroidism, hypoparathyroidism, etc .;
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • Intracellular parasitic infections typhoid, paratyphoid (typhoid), tuberculosis (tuberculosis), leprosy (leprosy), wave thermal conductivity (brutella), etc .;
  • measles virus measles, measles bronchitis, pneumonia, otitis media, subacute sclerosis panencephalitis
  • herpes virus herpes zoster, chicken pox
  • others other, some Some fungi (Candida albicans) infections;
  • poliovirus poliomyelitis
  • hepatitis virus A, B, C, D, E, H, G
  • Malignant tumors leukemia, lymphatic tumors, etc .;
  • Autoimmune diseases systemic lupus erythematosus, rheumatoid arthritis, malignant anemia, etc.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of various diseases, such as embryonic developmental malformations, protein metabolism disorders, tumor diseases, immune system disorders and the like.
  • the invention also provides screening compounds to identify increasing (agonist) or repressing (antagonist) human large proteins.
  • Agonists enhance human large protein 62 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human large protein 62 can be cultured with labeled human large protein 62 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human large protein 62 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human large protein 62 can bind to human large protein 62 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human large protein 62 can be added to a bioanalytical assay, and whether the compound is an antagonist can be determined by measuring the effect of the compound on the interaction between human large protein 62 and its receptor.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human large protein 62 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally respond to human large protein 62 Molecules are labeled.
  • the present invention provides a method for producing a polypeptide using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human large protein 62 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human large protein 62 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies against human large protein 62 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using known techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the unique technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human large protein 62.
  • Anti-human large protein 62 antibodies can be used in immunohistochemical techniques to detect human large protein 62 in biopsy specimens.
  • Monoclonal antibodies that bind to human large protein 62 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • the high affinity monoclonal antibody of human large protein 62 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
  • SPDP thiol cross-linking agent
  • This hybrid antibody can be used to kill human large protein 62 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human large protein 62.
  • Administration of an appropriate amount of antibody can stimulate or block the production or activity of human large protein 62.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human large protein.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human large protein 62 detected in the test can be used to explain the importance of human large protein 62 in various diseases and to diagnose diseases in which human large protein 62 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzyme, and can be analyzed by one-dimensional or two-dimensional or three-dimensional gel electrophoresis, and more preferably by mass spectrometry coding.
  • the polynucleotide of human large protein 62 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used Treatment of abnormal cell proliferation, development, or metabolism due to non-expression or abnormal / inactive expression of human large protein 62.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human large protein 62 to inhibit endogenous human large protein 62 activity.
  • a mutated human large protein 61 may be a shortened human large protein 62 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human large protein 62.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human large protein 62 into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense MA and DNA
  • ribozymes that inhibit human large protein 62 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like MA molecule that can specifically decompose a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA to perform endonucleation.
  • Antisense RNA and DNA and ribozymes can be obtained by any of the existing RNA or MA synthesis techniques, such as the solid-phase phosphate amide chemical synthesis technique for the synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DM sequence is integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human large protein 62 can be used for the diagnosis of diseases related to human large protein 62.
  • the polynucleotide encoding human big protein 62 can be used to detect the expression of human big protein 62 or the abnormal expression of human big protein 62 in a disease state.
  • the DNA sequence encoding human large protein 62 can be used to hybridize biopsy specimens to determine the expression of human large protein 62.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human big protein 62 specific primers can also be used to detect human big protein 62 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Detection of mutations in the human large protein 62 gene can also be used to diagnose human large protein 62-related diseases.
  • Human large protein 62 mutant forms include point mutations, Bits, deletions, reorganizations, and any other abnormalities. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the cDNA or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Use in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human large protein 62 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and dose range of human large protein 62 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une grande protéine humaine 62, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations apparaissant lors du développement de l'embryon, de troubles du métabolisme des protéines, de maladies tumorales et de troubles du système immunitaire. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la grande protéine humaine 62.
PCT/CN2001/001121 2000-07-07 2001-07-02 Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide WO2002026793A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002223369A AU2002223369A1 (en) 2000-07-07 2001-07-02 A novel polypeptide-homo macro-protein 62 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00117024 CN1333244A (zh) 2000-07-07 2000-07-07 一种新的多肽——人大蛋白62和编码这种多肽的多核苷酸
CN00117024.4 2000-07-07

Publications (1)

Publication Number Publication Date
WO2002026793A1 true WO2002026793A1 (fr) 2002-04-04

Family

ID=4586422

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001121 WO2002026793A1 (fr) 2000-07-07 2001-07-02 Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1333244A (fr)
AU (1) AU2002223369A1 (fr)
WO (1) WO2002026793A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108794396A (zh) * 2018-07-06 2018-11-13 浙江工业大学 4-氧代-2,3-二氢喹啉类化合物的氧化方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 16 June 1999 (1999-06-16), OHARA O. ET AL., retrieved from GI:3882211 accession no. NCBI Database accession no. (AB018288) *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108794396A (zh) * 2018-07-06 2018-11-13 浙江工业大学 4-氧代-2,3-二氢喹啉类化合物的氧化方法
CN108794396B (zh) * 2018-07-06 2020-06-02 浙江工业大学 4-氧代-2,3-二氢喹啉类化合物的氧化方法

Also Published As

Publication number Publication date
CN1333244A (zh) 2002-01-30
AU2002223369A1 (en) 2002-04-08

Similar Documents

Publication Publication Date Title
WO2002006477A1 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002026793A1 (fr) Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2002006475A1 (fr) NOUVEAU POLYPEPTIDE, β1-GLYCOPROTEINE SPECIFIQUE DE LA GROSSESSE 9.02, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2002020586A1 (fr) Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002020780A1 (fr) Nouveau polypeptide, grande proteine humaine 9.13, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2001083687A2 (fr) Nouveau polypeptide, proteine pax humaine 23, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002032949A1 (fr) Nouveau polypeptide, grande proteine humaine 81, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP