WO2002006334A1 - Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002006334A1
WO2002006334A1 PCT/CN2001/001089 CN0101089W WO0206334A1 WO 2002006334 A1 WO2002006334 A1 WO 2002006334A1 CN 0101089 W CN0101089 W CN 0101089W WO 0206334 A1 WO0206334 A1 WO 0206334A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
large protein
human large
protein
Prior art date
Application number
PCT/CN2001/001089
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002210326A priority Critical patent/AU2002210326A1/en
Publication of WO2002006334A1 publication Critical patent/WO2002006334A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, "" large protein 10. 01, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • genes are expressed in 10 human tissues, 8 brain regions (tonsils, corpus callosum, cerebellum, caudate nucleus, hippocampus, thalamic nucleus, thalamus, substantia nigra), spinal cord, fetal brain, and fetal liver [Takahiro Nagase , Ken-ichi Ishikawa et al., 1999, DNA Research., 6, 63-70.
  • KIAA1002 protein is related to cell signalling / communication, cell structure / movement, and nucleic acid control. It is expressed in 10 human tissues and 8 brain regions, spinal cord, fetal brain, and fetal liver.
  • the human large protein 10.01 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • Human large protein 10. 01 protein especially the amino acid sequence of this protein is identified.
  • the isolation of the new human large protein 10.01 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human large protein 10. 01.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human large protein 10.01.
  • Another object of the present invention is to provide a method for producing human large protein 10.01.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human large protein 10.01.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human large protein 10.01.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human large protein 10.01.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide complementary to polynucleotide (a);
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1177-1452 in SEQ ID NO: 1; and (b) having a sequence of 1-1743 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human large protein 10.01 protein, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human large protein 10.01 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the amount or biological activity of a polypeptide of the invention comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human large protein 10. 01.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human large protein 10.01 and KIAA of the present invention.
  • the upper graph is a graph of the expression spectrum of Renmin 10.01
  • the lower graph is the graph of the expression spectrum of KIAA.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of isolated human large protein 10.01. 10kDa Is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human large protein 10.01, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human large protein 10.01.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human large protein 10.01 when combined with human large protein 10.01.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human large protein 10.01.
  • “Regulation” refers to a change in the function of human large protein 10.01, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human large protein 10.01.
  • “Substantially pure” means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. 01 ⁇ Those skilled in the art can use standard protein purification techniques to purify human large protein 10. 01. Basically pure human large protein 10.01 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human large protein 10.01 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (Higgins, D. G. and
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun He in (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand means A nucleic acid strand complementary to a “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? 01, It can specifically bind to the epitope of human large protein 10. 01.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it exists in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human large protein 10. 01 means human large protein 10. 01 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it.
  • Those skilled in the art can purify human large protein 10.01 using standard protein purification techniques.
  • Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human large protein 10.01 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a human large protein 10.01, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human large protein 10.01.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human large protein 10.01 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non-conserved amino acid residues (preferred) (Conservative amino acid residues are chosen), and the substituted amino acids may or may not be encoded by the genetic codon; or ( ⁇ ) is one in which a group on one or more amino acid residues is replaced by another Group substitutions include substituents; or (II) such that the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such that additional The polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protease sequence) resulting from the fusion of the amino acid sequence into a mature polypeptide.
  • the polypeptide sequence such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1743 bases in length and its open reading frames 1177-1452 encode 91 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to KIAA, and it can be deduced that the human large protein 10.01 has similar functions to KIAA.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and each additional coding sequence; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to the present invention under strict conditions.
  • the polynucleotide is a polynucleotide that can hybridize.
  • strict conditions means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) L% Ficol l, 42 ⁇ 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 were added during hybridization.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human large protein 10.01.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human large protein 10.01 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic MA is the least commonly used. Direct chemical synthesis of D-sequences is often the method of choice. The more commonly used method is the separation of cMA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene). And the construction of cDNA library is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of transcript of human large protein 10.01; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • probes are typically 2000 nucleotides in length Within 1,000 nucleotides is preferred.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • MA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the human large protein 10.01 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RM is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human large protein 10.01 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding human large protein 10.01 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mMA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human large protein 10.01 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human large protein 10. 01 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • step (3) Isolate and purify protein from culture medium or cells.
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases, etc. .
  • Human KIAA protein is related to cell signalling / communication, cell structure / movement, and nucleic acid control in the human body. Abnormal expression of human KIAA protein can lead to impaired cell signaling pathways, disorder of gene expression, and disorder of protein metabolism in humans, leading to related diseases. occur.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human ⁇ AA protein, and both have similar biological functions.
  • the polypeptide of the present invention is related to cell signal transduction / communication, cell structure / movement, and nucleic acid control in vivo. Abnormal expression of the polypeptide can cause human cell signal pathway transmission disorder, disorder of gene expression, and disorder of protein metabolism, etc., and then cause embryo developmental abnormalities. , Protein metabolism disorders, tumor diseases, disorders of the immune system, etc. These diseases include but are not limited to:
  • Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder Absence of a muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, finger (toe) deformity, horseshoe varus, etc .; Common malformations of the digestive system:
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital agangliomegalo colon, impotence of anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • neural tube defects no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovarian], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [head, Nerves of the neck, limbs, etc.], (Malignant) Gliomas [Brain], Myeloblastoma [Cerebellum], (Malignant) Meningiomas [Menion], Ganglioblastoma / Neuroblastoma [Mediastinum and Retroperitoneum] / Adrenal medulla] etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;
  • parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • Intracellular parasitic infections typhoid, paratyphoid (typhoid), tuberculosis (tuberculosis), leprosy (leprosy), wave thermal conductivity (brutella), etc .;
  • measles virus measles, measles bronchitis, pneumonia, otitis media, subacute sclerosing panencephalitis
  • herpes virus herpes zoster, chicken pox
  • poliovirus poliomyelitis
  • hepatitis virus A, B, C, D, E, H, G
  • Malignant tumors leukemia, lymphatic tumors, etc .;
  • Autoimmune diseases systemic lupus erythematosus, rheumatoid arthritis, malignant anemia, etc.
  • the polypeptide of the present invention and its antagonists, agonists and inhibitors can be directly used in the treatment of various diseases For example, embryo developmental abnormalities, protein metabolism disorders, tumor diseases, disorders of the immune system, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human large protein 10.01.
  • Agonists enhance human large protein 10. 01 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human large protein 10.01 can be cultured with labeled human large protein 10.01 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human large protein 10. 01 include antibodies, compounds, receptor deletions, and analogs that have been screened.
  • the antagonist of human large protein 10.01 can bind to human large protein 10.01 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human large protein 10. 01 When adding compounds as antagonists, human large protein 10. 01 can be added to the bioassay In determining whether a compound is an antagonist, the effect of the compound on the interaction between human large protein 10.01 and its receptor is determined. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human large protein 10.01 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally, the human protein 10.01 molecule should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a human large protein 10.01 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human large protein 10.01 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. .
  • Techniques for preparing monoclonal antibodies to human large protein 10. 01 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morr ison et al, PMS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human large protein 10.01.
  • Antibodies to human large protein 10. 01 can be used in immunohistochemical techniques to detect human large protein 10. 01 in biopsy specimens.
  • Monoclonal antibodies that bind to human large protein 10. 01 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human large protein 10. 01 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human large protein 10. 01 positive cells.
  • a thiol cross-linking agent such as SPDP
  • the antibodies of the present invention can be used to treat or prevent diseases related to human large protein 10. 01. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human large protein 10.01.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human large protein at a level of 10.01. These tests are well known in the art and include FISH assays and radioimmunoassays. 01. The level of human large protein 10.01 detected in the test can be used to explain the importance of human large protein 10.01 in various diseases and 01 for diseases where human large protein 10.01 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • human large protein 10.01 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human large protein 10.01.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human large protein 10.01 to inhibit endogenous human large protein 10.01 activity.
  • a variant human large protein 10.01 may be a shortened human large protein 10.01, which lacks the signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human large protein 10. 01.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human large protein 10.01 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human large protein 10. 01 can be found in the existing literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding human large protein 10. 01 can be packaged into liposomes and transferred into cells a
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit human large protein 10.01 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DM sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human large protein 10.01 can be used for the diagnosis of diseases related to human large protein 10.01.
  • the polynucleotide encoding human large protein 10. 01 can be used to detect the expression of human large protein 10. 01 or the abnormal expression of human large protein 10. 01 in a disease state.
  • the DNA sequence encoding human large protein 10. 01 can be used to hybridize biopsy specimens to determine the expression of human large protein 10. 01.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part of a polynucleotide of the invention or All can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also known as a "gene chip") for analysis of differential expression analysis of genes and genetic diagnosis in tissues.
  • 01's transcription product can also be detected using RNA-polymerase chain reaction (RT-PCR) in vitro amplification of human protein 10.01 specific primers.
  • RT-PCR RNA-polymerase chain reaction
  • Detecting mutations in the human protein 10.01 gene can also be used to diagnose human protein 10.01-related diseases.
  • Human protein 10. 01 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild type human protein 10. 01 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is not observed in any normal individual, The mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cD accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human large protein 10. 01 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human large protein 10.01 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multi-cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • CDNA The sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0046B03 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5,-ACTCAAGATTTTGGCATGTTTATC -3, (SEQ ID NO: 3)
  • Primer 2 5'- GACGGGCTCACTCTGTCAGCCACG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KCl, 10 mmol / L Tris-HCl pH 8.50, 1.5 mmol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U in 50 ⁇ 1 reaction volume Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72.
  • ⁇ -act in was used as a positive control and template blank was used as a negative control at the same time during RT-PCR.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1 to 1743bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human large protein 10.01 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • Primer 3 5,-CCCCATATGATGTTAGCCAGGCTGGTCTTGCAA-3 '(Seq ID No: 5)
  • Priraer4 5' -CATGGATCCTCAGTTTTTTCTCCACCTTGAGGC-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BaraHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using pBS-0046B03 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0046B03 plasmid, primers? ]: ⁇ 6]: -3 and? ] ⁇ ]: -4 are 10 11101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 ot by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0046B03) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-0046B03) was 37 in LB liquid medium containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1). C.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human large protein 10. 01 specific peptides:
  • NH2-Met-Leu-Ala-Arg-Leu-Val-Leu-Gln-Leu-Leu-Thr-Ser-Ser-Asp-Pro-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. See also: Avrameas, et al. Immunocheraistry, 1969; 6: 43 undertakenImmunize rabbits with 1 ⁇ 2 g of the above hemocyanin peptide complex plus complete Freund's adjuvant, and then 15 days later with hemocyanin peptide complex plus incomplete Freund's Adjuvant boosts the immunity once.
  • the titer of the antibody in rabbit serum was determined by ELISA using a 15 ⁇ A ⁇ 1 bovine serum albumin peptide complex-coated titer plate. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum. 01 ⁇ Example 6 The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human large protein 10. 01.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered-.
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • Probes 1 3 ⁇ 1 Probe (0.1OD / ⁇ ), add 2 ⁇ 1 Kinase buffer, 8-10 uCi ⁇ - 32 P-dATP + 2U Kinase, to make up to a final volume of 20 ⁇ 1.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (OxDenhardt's; 6xSSC, 0.1 mg / inl CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution OxDenhardt's; 6xSSC, 0.1 mg / inl CT DNA (calf thymus DNA)
  • Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target D for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
  • the spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy 3dUTP (5-Am i no-pr opa r gy 1 -2 ⁇ -deoxy uridi ne 5> -triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue.
  • Probes were prepared after purification. For specific steps and methods, see:
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC; Fibroblast, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn (Figure 1). It can be seen from the figure that the expression profiles of human large protein 10.01 and KIAA according to the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de grande taille 10.01, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations survenant lors du développement de l'embryon, de troubles du métabolisme des protéines, de maladies tumorales et de troubles du système immunitaire. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine de grande taille 10.01.
PCT/CN2001/001089 2000-06-30 2001-06-29 Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide WO2002006334A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002210326A AU2002210326A1 (en) 2000-06-30 2001-06-29 A novel polypeptide - human large protein 10.01 and a polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116927.0 2000-06-30
CN 00116927 CN1331213A (zh) 2000-06-30 2000-06-30 一种新的多肽——人大蛋白10.01和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002006334A1 true WO2002006334A1 (fr) 2002-01-24

Family

ID=4586326

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001089 WO2002006334A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331213A (fr)
AU (1) AU2002210326A1 (fr)
WO (1) WO2002006334A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8637454B2 (en) 2009-01-06 2014-01-28 Dyax Corp. Treatment of mucositis with kallikrein inhibitors
US8663629B2 (en) 1994-01-11 2014-03-04 Dyax Corp. Kallikrein-binding “kunitz domain” proteins and analogues thereof
US8716225B2 (en) 2004-09-27 2014-05-06 Dyax Corp. Kallikrein inhibitors and anti-thrombolytic agents and uses thereof
US8822653B2 (en) 2010-01-06 2014-09-02 Dyax Corp. Plasma kallikrein binding proteins
US9114144B2 (en) 2002-06-07 2015-08-25 Dyax Corp. Kallikrein-inhibitor therapies
US9266964B2 (en) 2011-01-06 2016-02-23 Dyax Corp. Method of treating hereditary angioedema using plasma kallikrein binding antibodies
US9480733B2 (en) 2002-06-07 2016-11-01 Dyax Corp. Prevention and reduction of blood loss
US11286307B2 (en) 2015-12-11 2022-03-29 Takeda Pharmaceutical Company Limited Plasma kallikrein inhibitors and uses thereof for treating hereditary angioedema attack

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DNA RES., vol. 4, no. 1, 1997, pages 53 - 59 *
DNA RES., vol. 4, no. 2, 1997, pages 141 - 150 *
DNA RES., vol. 4, no. 5, 1997, pages 307 - 313 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8663629B2 (en) 1994-01-11 2014-03-04 Dyax Corp. Kallikrein-binding “kunitz domain” proteins and analogues thereof
US10245307B2 (en) 2002-06-07 2019-04-02 Dyax Corp. Prevention and reduction of blood loss
US9114144B2 (en) 2002-06-07 2015-08-25 Dyax Corp. Kallikrein-inhibitor therapies
US11344610B2 (en) 2002-06-07 2022-05-31 Takeda Pharmaceutical Company Limited Prevention and reduction of blood loss
US9480733B2 (en) 2002-06-07 2016-11-01 Dyax Corp. Prevention and reduction of blood loss
US8716225B2 (en) 2004-09-27 2014-05-06 Dyax Corp. Kallikrein inhibitors and anti-thrombolytic agents and uses thereof
US9757437B2 (en) 2004-09-27 2017-09-12 Dyax Corp. Kallikrein inhibitors and anti-thrombolytic agents and uses thereof
US8637454B2 (en) 2009-01-06 2014-01-28 Dyax Corp. Treatment of mucositis with kallikrein inhibitors
US8822653B2 (en) 2010-01-06 2014-09-02 Dyax Corp. Plasma kallikrein binding proteins
US10336832B2 (en) 2010-01-06 2019-07-02 Dyax Corp. Methods of inhibiting plasma kallikrein in edema patient
US11505620B2 (en) 2010-01-06 2022-11-22 Takeda Pharmaceutical Company Limited Methods of detecting plasma kallikrein
US10370453B2 (en) 2011-01-06 2019-08-06 Dyax Corp. Plasma kallikrein binding proteins
US9266964B2 (en) 2011-01-06 2016-02-23 Dyax Corp. Method of treating hereditary angioedema using plasma kallikrein binding antibodies
US11401346B2 (en) 2011-01-06 2022-08-02 Takeda Pharmaceutical Company Limited Nucleic acids encoding plasma kallikrein binding proteins
US11286307B2 (en) 2015-12-11 2022-03-29 Takeda Pharmaceutical Company Limited Plasma kallikrein inhibitors and uses thereof for treating hereditary angioedema attack

Also Published As

Publication number Publication date
AU2002210326A1 (en) 2002-01-30
CN1331213A (zh) 2002-01-16

Similar Documents

Publication Publication Date Title
WO2002006477A1 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002006475A1 (fr) NOUVEAU POLYPEPTIDE, β1-GLYCOPROTEINE SPECIFIQUE DE LA GROSSESSE 9.02, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002004504A1 (fr) Nouveau polypeptide, sous-unite humaine 9.46 de proteine g, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2002026793A1 (fr) Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2002020586A1 (fr) Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002020780A1 (fr) Nouveau polypeptide, grande proteine humaine 9.13, et polynucleotide codant ce polypeptide
WO2002004507A1 (fr) Nouveau polypeptide, proteine de type histidyl-arnt synthetase 13.2, et polynucleotide codant ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001096526A2 (fr) Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide
WO2002020599A1 (fr) Nouveau polypeptide, isomere humain 19.47 du facteur de regulation et de transcription zmf1, et polynucleotide codant ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2002006472A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.45, et polynucleotide codant ce polypeptide
WO2002012488A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 8.8, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP