WO2002006477A1 - Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002006477A1
WO2002006477A1 PCT/CN2001/001100 CN0101100W WO0206477A1 WO 2002006477 A1 WO2002006477 A1 WO 2002006477A1 CN 0101100 W CN0101100 W CN 0101100W WO 0206477 A1 WO0206477 A1 WO 0206477A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human topoisomerase
topoisomerase
sequence
Prior art date
Application number
PCT/CN2001/001100
Other languages
English (en)
Chinese (zh)
Other versions
WO2002006477A9 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2001295412A priority Critical patent/AU2001295412A1/en
Publication of WO2002006477A1 publication Critical patent/WO2002006477A1/fr
Publication of WO2002006477A9 publication Critical patent/WO2002006477A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human topoisomerase 12.1, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • DNA usually exists in the form of supercoil in the body.
  • Supercoil is divided into positive supercoil and negative supercoil. All DM supercoils are catalyzed by DNA topoisomerase, and various topoisomerases are found in many eukaryotes.
  • DNA topoisomerases can be divided into two categories: one is called topoisomerase I and the other is called topoisomerase ⁇ .
  • Topoisomerase I is mainly responsible for catalyzing the cleavage and reconnection of the DM chain. It only acts on one chain at a time, that is, it catalyzes the transient single-chain break and connection. It does not require the co-action of energy cofactors such as ATP or NAD.
  • the topoisomerase I I can simultaneously break and connect the double-stranded DM chain, which usually requires the synergy of the energy cofactor ATP.
  • Organisms make DNA negative supercoil reach a stable state through the opposite action of topoisomerase I and topoisomerase ⁇ , and catalyze the normal progress of DNA replication. Studies have found that an increase in DNA supercoil will lead to a decrease in cell viability, which in turn affects the normal growth and development of the body. It can be seen that these two proteases play an extremely important role in the stabilization and action of the genetic material of the organism.
  • Topoisomerase I and topoisomerase ⁇ molecules have been studied from many different eukaryotes, and the structure and function of these proteins have been studied in detail.
  • Peter and others cloned a new topoisomerase I protein from humans. This protein is similar to topoisomerase I in yeast and other organisms, and works in concert with topoisomerase II in vivo to catalyze the negative supercoiled form of DNA in vivo and the transcription and expression of genetic material.
  • mutations or abnormal expression of the protein will directly affect the existence of genetic material in the body, the recombination and the viability of related cells, and then cause various related diseases [Peter D'Arpa, Paula S. Machl in et a. , 1988, Proc Nat l Acad Sc i USA, 85: 2543-2547] 0
  • the human topoisomerase 12,1 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field
  • These processes are human topoisomerase 12.1 proteins, and in particular the amino acid sequence of this protein is identified.
  • Newcomer topoisomerase 12.1 The isolation of protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human topoisomerase 12.1.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human topoisomerase 12.1.
  • Another object of the present invention is to provide a method for producing human topoisomerase 12.1.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human topoisomerase 12.1.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human topoisomerase 12.1.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human topoisomerase 12.1. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human topoisomerase 12.1 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of a human topoisomerase 12.1 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human topoisomerase 12.1.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor topoisomerase 12.1 and human topoisomerase.
  • the upper graph is a graph of the expression profile of human topoisomerase 12.1
  • the lower graph is the graph of the expression profile of human topoisomerase 12.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human topoisomerase 12.1.
  • 12. lkDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human topoisomerase 12.1, causes a change in the protein and thereby regulates the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human topoisomerase 12.1.
  • Antagonist refers to a molecule that, when combined with human topoisomerase 12.1, can block or regulate the biological or immunological activity of human topoisomerase 12.1.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human topoisomerase 12.1.
  • Regulation refers to a change in the function of human topoisomerase 12.1, including an increase in protein activity Or reduction, changes in binding properties, and any other biological, functional or immune properties of human topoisomerase 12.1.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human topoisomerase using standard protein purification techniques 12.1. Basically pure human topoisomerase 12.1 produces a single main band on a non-reducing polyacrylamide gel. Human topoisomerase 12.1 The purity of a polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine Acids and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human topoisomerase 12.1.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human topoisomerase 12.1 means human topoisomerase 12.1 is essentially free of other proteins, lipids, carbohydrates or other substances that are naturally associated with it. Those skilled in the art can purify human topoisomerase 12.1 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human topoisomerase 12.1 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human topoisomerase 12.1, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human topoisomerase 12.1.
  • fragment As used herein, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially retains the same biological function or activity of the human topoisomerase 12.1 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) is one in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 815 bases, and its open reading frames 292-624 encode 110 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to human topoisomerase, and it can be deduced that the human topoisomerase 12.1 has similar functions to human topoisomerase.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a polynucleotide A replacement form, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes.
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50% between the two sequences, preferably having a sequence identity of 70%).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° / »Fi col l, 42 ° C, etc .; or (3) only in two sequences Crosses occur only when the identity between them is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human topoisomerase 12.1.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human topoisomerase 12.1 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mMA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of the human topoisomerase 12.1 transcript; (4) through immunological techniques or determination of biological activity, To detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human topoisomerase 12.1 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (EL ISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (EL ISA).
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferred for obtaining the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human topoisomerase 12.1 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding a human topoisomerase 12.1 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Ros enberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding human topoisomerase 12.1 and appropriate transcription / translation regulatory elements.
  • DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human topoisomerase 12.1 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after exponential growth and used.
  • treatment Step 12 the used well known in the art that alternative 2, if desired, the conversion may be performed by electroporation method MgCl
  • the host is a eukaryote
  • the following optional DNA... Transfection method calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
  • the polynucleotide sequence of the invention can be used for expression or production Recombinant human topoisomerase 12.1 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • DNA generally exists in the form of supercoils in living organisms. Supercoils are divided into positive supercoils and negative supercoils. All DM supercoils are catalyzed by DNA topoisomerase, and various topoisomerases are found in many eukaryotes. DNA topoisomerases can be divided into two categories: one is called topoisomerase I and the other is called topoisomerase ⁇ . Topoisomerase I is mainly responsible for catalyzing the breakage and reconnection of DNA strands. It only acts on one strand at a time, that is, it catalyzes the transient single-strand breakage and connection, and does not require the cooperative action of energy cofactors such as ATP or MD.
  • Topoisomerase I is mainly responsible for catalyzing the breakage and reconnection of DNA strands. It only acts on one strand at a time, that is, it catalyzes the transient single-strand breakage and connection, and does not require the cooperative action
  • Topoisomerase II can simultaneously break and connect double-stranded DNA strands, which usually requires the synergistic effect of the energy cofactor ATP.
  • Organisms make DNA negative supercoil reach a stable state through the opposite action of topoisomerase I and topoisomerase ⁇ , and catalyze the normal progress of MA replication. Studies have found that an increase in DNA supercoil will lead to a decrease in cell viability, which in turn affects the normal growth and development of the body. It can be seen that these two proteases play an extremely important role in the stabilization and action of the genetic material of the organism.
  • Human topoisomerase I is a new topoisomerase I protein that works in concert with topoisomerase II in vivo to catalyze the negative supercoiled form of DNA in vivo and the transcription and expression of genetic material. Studies have found that mutations or abnormal expression of this protein will directly affect the existence of genetic material in the body, the recombination and the living capacity of related cells, and then cause various embryonic developmental abnormalities, The occurrence of tumor diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human topoisomerase I protein, and both have similar biological functions.
  • the polypeptide of the present invention cooperates with in vivo topoisomerase II to catalyze the negative supercoiled form of DM in vivo and the transcription and expression of genetic material, and its abnormal expression can affect the existing form of genetic material in vivo, recombination and the living capacity of related cells , which in turn causes the development of various embryonic malformations and tumor diseases, including but not limited to:
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous thyroid adenoma (carcinoma) [ovarian], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger (toe) deformity, horseshoe varus, etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical diaphragm, congenital umbilical hernia, congenital non-gangliomegaly, imperforate anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc .;
  • neural tube defects no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus in / outside the brain, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human topoisomerase 12.1.
  • Agonists enhance human topoisomerase 12.1 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human topoisomerase 12.1 and labeled human topoisomerase 12.1 can be cultured together in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human topoisomerase 12.1 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human topoisomerase 12.1 can bind to human topoisomerase 12.1 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to render the polypeptide incapable Play biological functions.
  • human topoisomerase 12.1 When screening compounds as antagonists, human topoisomerase 12.1 can be added to the bioanalytical assay, and the compounds can be determined by measuring the effect of the compound on the interaction between human topoisomerase 12.1 and its receptor Whether it is an antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human topoisomerase 12.1 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human topoisomerase 12.1 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human topoisomerase 12.1 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab 'fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced using human topoisomerase 12.1 by direct injection in immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human topoisomerase 12.1 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human topoisomerase 12.1.
  • Antibodies against human topoisomerase 12.1 can be used in immunohistochemistry to detect human topoisomerase 12.1 in biopsy specimens.
  • Monoclonal antibodies that bind to human topoisomerase 12.1 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human topoisomerase 12.1 High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill human topoisomerase 12. Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human topoisomerase 12.1.
  • An appropriate dose of the antibody can stimulate or block the production or activity of human topoisomerase 12.1.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human topoisomerase 12.1 levels. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human topoisomerase 12.1 detected in the test can be used to explain the importance of human topoisomerase 12.1 in various diseases and to diagnose the role of human topoisomerase 12.1 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human topoisomerase 12.1 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human topoisomerase 12.1. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human topoisomerase 12.1 to inhibit endogenous human topoisomerase 12.1 activity.
  • a mutated human topoisomerase 12.1 can be a shortened human topology isomerase 12.1 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human topoisomerase 12.1.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human topoisomerase 12.1 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human topoisomerase 12.1 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human topoisomerase 12.1 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human topoisomerase 12.1 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DM synthesis techniques, such as the solid-phase phosphoramidite synthesis method for oligonucleotide synthesis.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
  • This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • Polynucleotide encoding human topoisomerase 12.1 can be used for diseases related to human topoisomerase 12.1 Diagnosis of the disease.
  • a polynucleotide encoding human topoisomerase 12.1 can be used to detect the expression of human topoisomerase 12.1 or the abnormal expression of human topoisomerase 12.1 in a disease state.
  • a DNA sequence encoding human topoisomerase 12.1 can be used to hybridize biopsy specimens to determine the expression of human topoisomerase 12.1.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • a DM chip also known as a "gene chip”
  • Human topoisomerase 12.1 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human topoisomerase 12.1 transcription products.
  • Detection of mutations in the human topoisomerase 12.1 gene can also be used to diagnose human topoisomerase 12.1 related diseases.
  • Human topoisomerase 12.1 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human topoisomerase 12.1 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with mid-phase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human topoisomerase 12.1 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human topoisomerase 12.1 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) msa was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech
  • Clontech was used to insert the cDNA fragments into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDM was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers:
  • Primer 1 5
  • SEQ ID NO: 3 one GGATGGCGGAGCTGTATGTGAAGC-3, (SEQ ID NO: 3)
  • Pr imer2 5'- CGCAGAGATGTTTTTATTGAAATG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l of reaction volume in 50 ⁇ l containing 50 ol / L KC1, 10ramol / L Tri s-HCl pH 8. 5, 1. 5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer , 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min 0 Simultaneously set ⁇ -act in as a positive control and template blank as a negative control during RT-PCR.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-815bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human topoisomerase 12.1 gene expression
  • Total RM was extracted in one step [Anal. Biochera 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M Sodium acetate (pH4. 0) The tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • 32P-labeled probes (approximately 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DM. After hybridization, the filter was washed in i x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human topoisomerase 12.1
  • Primer3 5'-CCCCATATGATGGATCCCCCAGAGCAGGTATGT-3 '(Seq ID No: 5)
  • Primer4 5'-CCCGAATTCTTATGAAGCCTGCTGGAAGCCTGG-3' (Seq ID No: 6)
  • These two primers contain Ndel and EcoRI restriction sites at the 5 'end, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively, and the Ndel and EcoRI restriction sites correspond to those on the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865. 3). Selective endonuclease site.
  • the PCR reaction was performed using the pBS-0155e08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0155e08 plasmid, primers Primer-3 and Primer-4 were 10 pmol, and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
  • coli DH5a by the calcium chloride method. After being cultured on LB plates containing kanamycin (final concentration 30 ⁇ £ / ⁇ 1) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0155e08) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration 30 g / ml) of LB liquid medium, host strain BL21 (P ET-0155e08) at 37. C.
  • the following human topoisomerase 12.1 specific peptide was synthesized using a peptide synthesizer (product of PE company): NH2-Met-Asp-Pro-Pro-Glu-Gln-Val-Cys-Asp-Asp-I le-Ser -Arg-Arg-Leu-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Imm, Chemis try, 1969; 6: 43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding sites of the sample on the filter are saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC total amount is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (bond) of the gene fragment of SEQ ID NO: 1 or its complementary fragment :
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC film nitrocellulose
  • the sample membrane was placed in a plastic bag, and 3-lOing pre-hybridization solution (lOxDen ardt-s; 6xSSC, 0.1 ling / ml CT DM (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • 3-lOing pre-hybridization solution (lOxDen ardt-s; 6xSSC, 0.1 ling / ml CT DM (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500ng / ul. Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA) was spotted on the glass medium, between the spots. The distance is 280 ⁇ ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified by Ol igotex mRM Midi Kit (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Araersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyur idine
  • the probes from the above two types of tissues were hybridized with the chip in UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • UniHyb TM Hybridization Solution purchasedd from TeleChem
  • lx SSC 0.2% SDS
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1G13HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of human topoisomerase 12.1 and human topoisomerase according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une topologie isomérase humaine 12.1, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la topologie isomérase humaine 12.1.
PCT/CN2001/001100 2000-06-30 2001-06-29 Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide WO2002006477A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295412A AU2001295412A1 (en) 2000-06-30 2001-06-29 A novel polypeptide, a human cytokine receptor 10.67 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116881.9 2000-06-30
CN 00116881 CN1331340A (zh) 2000-06-30 2000-06-30 一种新的多肽——人拓扑异构酶12.1和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2002006477A1 true WO2002006477A1 (fr) 2002-01-24
WO2002006477A9 WO2002006477A9 (fr) 2002-05-30

Family

ID=4586280

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001100 WO2002006477A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331340A (fr)
AU (1) AU2001295412A1 (fr)
WO (1) WO2002006477A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9062055B2 (en) 2010-06-21 2015-06-23 Incyte Corporation Fused pyrrole derivatives as PI3K inhibitors
US9707233B2 (en) 2011-09-02 2017-07-18 Incyte Holdings Corporation Heterocyclylamines as PI3K inhibitors
US9732097B2 (en) 2015-05-11 2017-08-15 Incyte Corporation Process for the synthesis of a phosphoinositide 3-kinase inhibitor
US9815839B2 (en) 2010-12-20 2017-11-14 Incyte Corporation N-(1-(substituted-phenyl)ethyl)-9H-purin-6-amines as PI3K inhibitors
US9944646B2 (en) 2012-04-02 2018-04-17 Incyte Holdings Corporation Bicyclic azaheterocyclobenzylamines as PI3K inhibitors
US9975907B2 (en) 2009-06-29 2018-05-22 Incyte Holdings Corporation Pyrimidinones as PI3K inhibitors
US9988401B2 (en) 2015-05-11 2018-06-05 Incyte Corporation Crystalline forms of a PI3K inhibitor
US10077277B2 (en) 2014-06-11 2018-09-18 Incyte Corporation Bicyclic heteroarylaminoalkyl phenyl derivatives as PI3K inhibitors
US10336759B2 (en) 2015-02-27 2019-07-02 Incyte Corporation Salts and processes of preparing a PI3K inhibitor

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011075643A1 (fr) 2009-12-18 2011-06-23 Incyte Corporation Dérivés condensés d'hétéroaryles substitués à titre d'inhibiteurs de pi3k
EP2558463A1 (fr) 2010-04-14 2013-02-20 Incyte Corporation Dérivés condensés en tant qu'inhibiteurs de i3
US9108984B2 (en) 2011-03-14 2015-08-18 Incyte Corporation Substituted diamino-pyrimidine and diamino-pyridine derivatives as PI3K inhibitors
US9126948B2 (en) 2011-03-25 2015-09-08 Incyte Holdings Corporation Pyrimidine-4,6-diamine derivatives as PI3K inhibitors

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHUANZHONG Y.E. ET AL: "Immunohistochemical study of topoisomerase expression in transitional cell carcinoma of bladder", CHIN. J. UROL., vol. 20, no. 1, January 1999 (1999-01-01), pages 25 - 26 *
DATABASE GENBANK [online] 20 April 1999 (1999-04-20), R.B. LANZ ET AL, XP002994896, Database accession no. (AF092038) *

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9975907B2 (en) 2009-06-29 2018-05-22 Incyte Holdings Corporation Pyrimidinones as PI3K inhibitors
US11401280B2 (en) 2009-06-29 2022-08-02 Incyte Holdings Corporation Pyrimidinones as PI3K inhibitors
US10829502B2 (en) 2009-06-29 2020-11-10 Incyte Corporation Pyrimidinones as PI3K inhibitors
US10428087B2 (en) 2009-06-29 2019-10-01 Incyte Corporation Pyrimidinones as PI3K inhibitors
US9062055B2 (en) 2010-06-21 2015-06-23 Incyte Corporation Fused pyrrole derivatives as PI3K inhibitors
US9815839B2 (en) 2010-12-20 2017-11-14 Incyte Corporation N-(1-(substituted-phenyl)ethyl)-9H-purin-6-amines as PI3K inhibitors
US10646492B2 (en) 2011-09-02 2020-05-12 Incyte Corporation Heterocyclylamines as PI3K inhibitors
US11819505B2 (en) 2011-09-02 2023-11-21 Incyte Corporation Heterocyclylamines as PI3K inhibitors
US9707233B2 (en) 2011-09-02 2017-07-18 Incyte Holdings Corporation Heterocyclylamines as PI3K inhibitors
US10092570B2 (en) 2011-09-02 2018-10-09 Incyte Holdings Corporation Heterocyclylamines as PI3K inhibitors
US11433071B2 (en) 2011-09-02 2022-09-06 Incyte Corporation Heterocyclylamines as PI3K inhibitors
US10376513B2 (en) 2011-09-02 2019-08-13 Incyte Holdings Corporation Heterocyclylamines as PI3K inhibitors
US9730939B2 (en) 2011-09-02 2017-08-15 Incyte Holdings Corporation Heterocyclylamines as PI3K inhibitors
US10259818B2 (en) 2012-04-02 2019-04-16 Incyte Corporation Bicyclic azaheterocyclobenzylamines as PI3K inhibitors
US9944646B2 (en) 2012-04-02 2018-04-17 Incyte Holdings Corporation Bicyclic azaheterocyclobenzylamines as PI3K inhibitors
US11130767B2 (en) 2014-06-11 2021-09-28 Incyte Corporation Bicyclic heteroarylaminoalkyl phenyl derivatives as PI3K inhibitors
US10479803B2 (en) 2014-06-11 2019-11-19 Incyte Corporation Bicyclic heteroarylaminoalkyl phenyl derivatives as PI3K inhibitors
US11999751B2 (en) 2014-06-11 2024-06-04 Incyte Corporation Bicyclic heteroarylaminoalkyl phenyl derivatives as PI3K inhibitors
US10077277B2 (en) 2014-06-11 2018-09-18 Incyte Corporation Bicyclic heteroarylaminoalkyl phenyl derivatives as PI3K inhibitors
US10336759B2 (en) 2015-02-27 2019-07-02 Incyte Corporation Salts and processes of preparing a PI3K inhibitor
US11084822B2 (en) 2015-02-27 2021-08-10 Incyte Corporation Salts and processes of preparing a PI3K inhibitor
US12024522B2 (en) 2015-02-27 2024-07-02 Incyte Corporation Salts and processes of preparing a PI3K inhibitor
US10125150B2 (en) 2015-05-11 2018-11-13 Incyte Corporation Crystalline forms of a PI3K inhibitor
US9988401B2 (en) 2015-05-11 2018-06-05 Incyte Corporation Crystalline forms of a PI3K inhibitor
US9732097B2 (en) 2015-05-11 2017-08-15 Incyte Corporation Process for the synthesis of a phosphoinositide 3-kinase inhibitor

Also Published As

Publication number Publication date
CN1331340A (zh) 2002-01-16
WO2002006477A9 (fr) 2002-05-30
AU2001295412A1 (en) 2002-01-30

Similar Documents

Publication Publication Date Title
WO2002006477A1 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001094578A1 (fr) Nouveau polypeptide, proteine ubch5 11.44, et polynucleotide codant ce polypeptide
WO2002012313A1 (fr) Nouveau polypeptide, proteine phosphatase humaine 12.43, et polynucleotide codant ce polypeptide
WO2002020780A1 (fr) Nouveau polypeptide, grande proteine humaine 9.13, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002020586A1 (fr) Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001087959A1 (fr) Nouveau polypeptide, proteine pax humaine 11.9, et polynucleotide codant pour ce polypeptide
WO2002020577A1 (fr) Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2002012300A1 (fr) Nouveau polypeptide, proteine humaine g29.13 du cycle cellulaire, et polynucleotide codant ce polypeptide
WO2001047994A1 (fr) Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide
WO2002000834A2 (fr) Nouveau polypeptide, proteine phosphatase humaine 9.68, et polynucleotide codant ce polypeptide
WO2001072805A1 (fr) Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: C2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PUBLISHED INTERNATIONAL SEARCH REPORT (2 PAGES) REPLACED BY CORRECT INTERNATIONAL SEARCH REPORT (2 PAGES) (WITH AN UPDATED VERISON OF THE PAMPHLET FRONT PAGE)

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP