WO2002006335A1 - Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide - Google Patents

Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide Download PDF

Info

Publication number
WO2002006335A1
WO2002006335A1 PCT/CN2001/001091 CN0101091W WO0206335A1 WO 2002006335 A1 WO2002006335 A1 WO 2002006335A1 CN 0101091 W CN0101091 W CN 0101091W WO 0206335 A1 WO0206335 A1 WO 0206335A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein kinase
threonine protein
human silk
Prior art date
Application number
PCT/CN2001/001091
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2001295408A priority Critical patent/AU2001295408A1/en
Publication of WO2002006335A1 publication Critical patent/WO2002006335A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases

Definitions

  • the present invention belongs to the field of biotechnology, and specifically, the present invention describes a novel polypeptide, ⁇ ⁇ silk / threonine protein kinase 16.17, and a polynucleotide sequence encoding the polypeptide.
  • the invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • Protein phosphorylation is a basic regulatory mechanism in the regulation of eukaryotic cells, and it is also the most common way of protein modification. For example, cell phosphorylation occurs during cell division, cell metabolism, cell adhesion and cell migration, cell-to-cell communication, and signaling. To accomplish these functions, 2% to 4% of the human coding genes encode about 2000 different kinases (Hunter, 1996).
  • Serine / threonine protein kinases are a class of protein kinases that can phosphorylate serine / threonine residues on substrates that are involved in the process of transmitting signals downstream of serine / threonine protein kinase activation Many serine / threonine residues phosphorylate the cascade, thereby regulating the expression of many genes.
  • serine / threonine protein kinases There are many types of serine / threonine protein kinases. According to existing research, they are similar in structure and can activate MAP kinase kinase (MAPKK). Serine / threonine protein kinases have been shown to interact with MAPKK. The binding domain of MAPKK has been shown to exist on the skeletal / threonine protein kinase. For the specific structure of the serine / threonine protein kinase, please refer to the related literature.
  • MAPKK MAP kinase kinase
  • MAPKK MAP kinase kinase kinase
  • the activated MAPK enters the nucleus, activates them by phosphorylating the silk / threonine residues of other kinases or gene regulatory proteins (transcription factors), transmits signals downstream, and regulates the transcriptional expression of some genes, such as jun and Eik- 1 or some protein kinases and other proteins.
  • serine / threonine protein kinase activated serine / threonine in Ras and PKC Phosphorylation has an important role in the cascade reaction.
  • serine / threonine protein kinases have a non-negligible effect on the signaling process. It can regulate cell growth, division, death, differentiation to form tissues, and various lives. process.
  • MAST205 is a serine / threonine protein kinase that binds to tubulin.
  • MAST205 kinase may be able to couple the cell signaling pathway with the tissue of the sperm microtubule axis [3 ⁇ 4101 Ce ll Bi ol 1993 Dec; 1 3 (12): 7625-35].
  • the IAA561 protein found in 1998 has a 60.5% homology with the aforementioned MAST205 protein kinase, so it may also be a protein kinase that binds to tubulin [DNA Res 5, 31-39 (1998)] .
  • the human silk / threonine protein kinase 16.17 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so identification in the art has been required. More human silk / threonine protein kinase 16.17 proteins involved in these processes, especially the amino acid sequence of this protein was identified. New human silk / threonine protein kinase 16. Isolation of the protein-coding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human silk / threonine protein kinase 16.17.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human silk / threonine protein kinase 16.17.
  • Another object of the present invention is to provide a method for producing human silk / threonine protein kinase 16.17.
  • Another object of the present invention is to provide a human silk / threonine protein kinase directed against the polypeptide of the present invention. 16. 17 antibodies.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human silk / threonine protein kinase 16.17.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to human silk / threonine protein kinase 16. 17 abnormalities. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide sequences of (c) and (a) or (b) have at least 70. Identical polynucleotides.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 106-549 in SEQ ID NO: 1; and (b) a sequence having 1-1973 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human silk / threonine protein kinase 16.17 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human silk / threonine protein kinase 16.17 protein, which comprises detecting the presence of the polypeptide or its encoding polynucleotide sequence in a biological sample Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to polypeptides and / or polynucleotides of the present invention for use in the preparation of a medicament for treating cancer, developmental or immune diseases, or other diseases caused by abnormal expression of human silk / threonine protein kinase 16. 17 use.
  • Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.
  • Figure 1 is a comparison of gene chip expression profiles of human silk / threonine protein kinase 16. ⁇ and KIAA561 of the present invention.
  • the upper graph is a graph of the expression profile of human silk / threonine protein kinase 16. 17 and the lower graph is the graph of the expression profile of KIAA561.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human silk / threonine protein kinase 16.17. 16kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insert refers to a change in the amino acid sequence or nucleotide sequence that results in Compared to the molecule, one or more amino acids or nucleotides are increased.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human silk / threonine protein kinase 16.17, can cause changes in the protein and thereby regulate the activity of the protein.
  • Agonists may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human silk / threonine protein kinase 16.17.
  • Antagonist refers to a biological activity or immunity that can block or regulate human silk / threonine protein kinase 16.17 when combined with human silk / threonine protein kinase 16.17.
  • Chemically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human silk / threonine protein kinase 16.17.
  • Regular refers to a change in the function of human silk / threonine protein kinase 16.17, including an increase or decrease in protein activity, a change in binding characteristics, and any other organism of human silk / threonine protein kinase 16.17 Changes in nature, function, or immunity.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human silk / threonine protein kinase 16.17 using standard protein purification techniques.
  • Substantially pure human silk / threonine protein kinase 16. 17 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human silk / threonine protein kinase 16. 17 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.) lovedMEGALIGN program can compare two or more sequences according to different methods such as Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237 -244) The Clus ter method arranges each set of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in L, (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; have uncharged head groups
  • Amino acids with similar hydrophilicity may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine .
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab,) 2 and Fv, which can specifically bind to the epitope of human silk / threonine protein kinase 16.17.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides coexist in a natural state Separated in other materials, it is isolated and purified.
  • isolated human silk / threonine protein kinase 16. 17 refers to human silk / threonine protein kinase 16. 17 which is substantially free of other proteins, lipids, carbohydrates, or others that are naturally associated with it. substance. Those skilled in the art can purify human silk / threonine protein kinase 16.17 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human silk / threonine protein kinase 16. 17 peptides can be analyzed by amino acid sequence analysis.
  • the present invention provides a novel polypeptide human silk / threonine protein kinase 16.17, which basically consists of the amino acid sequence shown in SEQ ID NO. ⁇ 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, phytoplankton, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of human silk / threonine protein kinase 16.17.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human silk / threonine protein kinase 16.17 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or UI) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (in) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the polypeptide's half-life, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1973 bases, and its open reading frame 106-549 encodes 147 amino acids.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, Due to genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° / »SDS, 60 ° C; or ( 2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human silk / threonine protein kinase 16.17.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human silk / threonine protein kinase 16.17 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These technologies include but It is not limited to: 1) hybridizing a probe to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) antibody screening of the expression library to detect cloned polynucleotide fragments having common structural characteristics.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cD sequences.
  • the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRM plasmid or phage cDNA library.
  • kits are also commercially available (Qiagene).
  • the construction of cDNA library is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human silk / threonine protein kinase 16.17 transcripts (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleosides, preferably at least 30 nucleotides, more preferably at least 50 Nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the human silk / threonine protein kinase 16.17 can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). .
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferred for obtaining the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • the gene of the present invention obtained as described above, or various polynucleotide sequences such as various DM fragments can be used. It is determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be removed using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human silk / threonine protein kinase 16.17 coding sequence, and recombinant technology to produce the present invention Methods of the polypeptide.
  • a polynucleotide sequence encoding human silk / threonine protein kinase 16.17 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human silk / threonine protein kinase 16.17 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Labora tory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, 'usually about 10 to 300 base pairs that act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide for selection
  • selectable marker genes to provide for selection
  • the phenotypic traits of transformed host cells such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
  • GFP green fluorescent protein
  • a polynucleotide encoding human silk / threonine protein kinase 16.17 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (Method 12, using the procedure well known in the art. Alternatively, it is a MgCl 2. If If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human silk / threonine protein kinase 16. 17 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant encoding human silk / threonine protein kinase 16.17 of the present invention, or a suitable host cell is transformed or transduced with a recombinant expression vector containing the polynucleotide ;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Serine / threonine protein kinases are a class of protein kinases that can phosphorylate serine / threonine residues on substrates. They participate in protein phosphorylation in the body and regulate cell growth, division, death, Life processes such as differentiation and formation of tissues. Abnormal expression in the body can cause disorders in protein metabolism and cell proliferation, which can lead to the occurrence of related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human silk / threonine protein kinase protein, and both have similar biological functions.
  • the polypeptide of the present invention participates in protein phosphorylation in vivo and regulates life processes such as cell growth, division, death, differentiation and formation of tissues. Abnormal expression can cause disorders in protein metabolism and cell proliferation, which in turn can lead to embryonic developmental abnormalities, tumors, and disorders of protein metabolism. These diseases include, but are not limited to:
  • Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder lack of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and (toe) malformation, horseshoe varus, etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital agangliomegalo colon, impotence of anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • neural tube defects no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenoma (carcinoma) [ovarian], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], myeloblastoma Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma [skin, mucous membrane], (malignant) hydatidiform mole, chorionic epithelial cancer [uterine], (malignant) supporter cells, stromal cell tumor, (malignant) granulosa cell tumor [ovary, testis], Seminoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .; Diseases related to protein metabolism disorders
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;
  • parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin irritation), peptic ulcer (histamine), hypercholesterolemia (taurine), tumor (polyamine), etc .;
  • the polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as embryonic malformations, tumors, and disorders of protein metabolism.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human silk / threonine protein kinase 16.17.
  • Agonists enhance human silk / threonine protein kinase 16. 17 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or human silk / threonine proteins can be expressed in the presence of drugs
  • Membrane formulations of leukokine 16. 17 are cultured with labeled human silk / threonine protein kinase 16. 17. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human silk / threonine protein kinase 16. 17 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human silk / threonine protein kinase 16.17 can bind to human silk / threonine protein kinase 16.17 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
  • human silk / threonine protein kinase 16.17 When screening compounds as antagonists, human silk / threonine protein kinase 16.17 can be added to the bioanalytical assay, and by measuring the compounds, human silk / threonine protein kinase 16.17 and its receptor interact with each other. Effect to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human silk / threonine protein kinase 16.17 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human silk / threonine protein kinase 16.17 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human silk / threonine protein kinase 16.17 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human silk / threonine protein kinase 16.17 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human silk / threonine protein kinase 16. 17 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human Beta-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human silk / threonine protein kinase 16.II.
  • Antibodies against human silk / threonine protein kinase 16. 17 can be used in immunohistochemical techniques to detect human silk / threonine protein kinase 16. 17 in biopsy specimens.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human silk / threonine protein kinase 16 . 17 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human silk / threonine protein kinase 16.17.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human silk / threonine protein kinase 16.17.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human silk / threonine protein kinase 16.17 levels.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human silk / threonine protein kinase 16. 17 detected in the test can be used to explain the importance of human silk / threonine protein kinase 16. 17 in various diseases and to diagnose human silk / threonine Acid protein kinase 16. 17. Diseases at work.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human silk / threonine protein kinase 16. 17 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human silk / threonine protein kinase 16.17. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human silk / threonine protein kinase 16.17 to inhibit endogenous human silk / threonine protein kinase 16.17 activity.
  • a mutated human silk / threonine protein kinase 16.17 may be a shortened human silk / threonine protein kinase 16.17 that lacks a signaling domain, although it can bind to downstream substrates, However, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human silk / threonine protein kinase 16.17.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, and parvovirus can be used to transfer polynucleotides encoding human silk / threonine protein kinase 16.17 into cells.
  • recombinant viral vectors carrying a polynucleotide encoding human silk / threonine protein kinase 16.17 can be found in the literature (Sambrook, et al.).
  • recombinant polynucleotides encoding human silk / threonine protein kinase 16.17 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides that inhibit human silk / threonine protein kinase 16. 17 raRNA (including antisense RM and DM) And ribozymes are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained by any existing MA or DNA synthesis technology. For example, the technology for the synthesis of oligonucleotides by solid-phase phosphate amide synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the MA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human silk / threonine protein kinase 16. 17 can be used for the diagnosis of diseases related to human silk / threonine protein kinase 16. 17.
  • the polynucleotide encoding human silk / threonine protein kinase 16. 17 can be used to detect the expression of human silk / threonine protein kinase 16. 17 or human silk / threonine protein kinase 16. 17 in a disease state. Abnormal expression.
  • the DNA sequence encoding human silk / threonine protein kinase 16. 17 can be used to hybridize biopsy specimens to determine the expression of human silk / threonine protein kinase 16.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • 17 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human silk / threonine protein kinase 16. 17 transcripts.
  • 17 gene can also be used to diagnose human silk / threonine protein kinase 16. 17-related diseases. Human silk / threonine protein kinase 16. 17 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human silk / threonine protein kinase 16. 17 DNA sequences. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only Heterozygous cells that contain human genes corresponding to the primers produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human silk / threonine protein kinase 16. 17 to effectively treat and / Or prevent the amount of specific indications to be administered.
  • the amount and dose range of human silk / threonine protein kinase 16.17 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM by reverse transcription.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cMA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0640h09 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • Primer2 5'- TGGGGTCTCGCTCTGTCACTAGGC -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 5 Ommo 1 / L KC 1, 1 Orarao 1 / L Tri s-HCl in a reaction volume of 50 ⁇ 1 pH 8.5, 1.5 mraol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1973bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human silk / threonine protein kinase 16.17 gene expression Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0 This method includes acid guanidinium thiocyanate- Chloroform extraction.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA probes were the PCR amplified human silk / threonine protein kinase 16.17 coding region sequence (106bp to 549bp) shown in FIG.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt, s solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation, and purification of recombinant human silk / threonine protein kinase 16. 17 According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, design A pair of specific amplification primers was generated, and the sequence is as follows:
  • Pr imer3 5'-CCCCATATGATGGCACGGACAATGGCTGGCAAT-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTTAGAAACAGCCTTGGTTTACCAG-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the restriction sites of Mel and BamHI correspond to the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using pBS-0640h09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0640h09 plasmid was contained in a total volume of 50 ⁇ 1, and Primer-3 and Primer-4 were lpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60. C 30s, 68. C 2 Rain, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ ⁇ / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced.
  • a positive clone (PET-0640h09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • E. coli BL21 E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • host strain BL21 P ET-0640h09
  • a peptide synthesizer (product of PE company) was used to synthesize the following human silk / threonine protein kinase 16. 17 specific peptides:
  • NH2-Met-Ala-Arg-Thr-Met-Ala-Gly-Asn-Gly-Pro-Lys-Pro-Glu-Thr-I le-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • the titer of antibody in rabbit serum was determined by ELISA using a titer plate coated with 15 ⁇ ⁇ / ⁇ 1 bovine serum albumin polypeptide complex.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a desert-cyanide-activated Seph arOS e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • Immunoprecipitation demonstrated that the purified antibody could specifically bind to human silk / threonine protein kinase 16.17.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • steps 8-13 only when contaminated, can be directly or first step I 4 must be removed.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample film was placed in a plastic bag pre-hybridization solution was added 3 -10mg (10xDenhardt's; 6 xSSC, 0. lmg / ml CT DNA (calf thymus DNA)). After sealing the bag, shake at 68 ° C for 2 hours.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And documents Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Araino-propargyl-2'_deoxyuridine 5 '-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl- 2'- deoxyuridine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
  • fluorescent reagent Cy5dUTP (5-Amino-propargyl- 2'- deoxyuridine 5'-tr iphate coupled to Cy5
  • the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridizat ion Solution (purchased from TeleCheni) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.23 ⁇ 4SDS) at room temperature, and then scanned with ScanArray.
  • 3000 scanner purchased from General Scanning, USA) Scanning
  • the scanned images were processed with Imagene software (Biodiscovery, USA) for data analysis, and the Cy3 / Cy5 ratio of each point was calculated.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). It can be seen from the figure that the expression profiles of human silk / threonine protein kinase 16.17 and KIAA561 according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sérine/thréonine protéine kinase 16.17, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations lors du développement de l'embryon, de tumeurs et de troubles du métabolisme des protéines. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la sérine/thréonine protéine kinase 16.17.
PCT/CN2001/001091 2000-06-30 2001-06-29 Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide WO2002006335A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295408A AU2001295408A1 (en) 2000-06-30 2001-06-29 A novel polypeptide - human serine/threonine protein kinase 16.17 and a polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116948 CN1331321A (zh) 2000-06-30 2000-06-30 一种新的多肽——人丝/苏氨酸蛋白激酶16.17和编码这种多肽的多核苷酸
CN00116948.3 2000-06-30

Publications (1)

Publication Number Publication Date
WO2002006335A1 true WO2002006335A1 (fr) 2002-01-24

Family

ID=4586347

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001091 WO2002006335A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331321A (fr)
AU (1) AU2001295408A1 (fr)
WO (1) WO2002006335A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10258565B2 (en) 2011-04-28 2019-04-16 Abraxis Bioscience, Llc Intravascular delivery of nanoparticle compositions and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J. BIOL. CHEM., vol. 275, no. 10, March 2000 (2000-03-01), pages 7373 - 7377 *
J. HUM. GENET., vol. 44, no. 2, 1999, pages 116 - 120 *
MOL. CELL. BIOL., vol. 13, no. 12, 1993, pages 7625 - 7635 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10258565B2 (en) 2011-04-28 2019-04-16 Abraxis Bioscience, Llc Intravascular delivery of nanoparticle compositions and uses thereof

Also Published As

Publication number Publication date
AU2001295408A1 (en) 2002-01-30
CN1331321A (zh) 2002-01-16

Similar Documents

Publication Publication Date Title
WO2002006477A9 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2002012488A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 8.8, et polynucleotide codant ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2002026793A1 (fr) Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide
WO2001096526A2 (fr) Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide
WO2002020599A1 (fr) Nouveau polypeptide, isomere humain 19.47 du facteur de regulation et de transcription zmf1, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002006472A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.45, et polynucleotide codant ce polypeptide
WO2002040521A1 (fr) Nouveau polypeptide, inhibiteur humain 9.68 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2002012300A1 (fr) Nouveau polypeptide, proteine humaine g29.13 du cycle cellulaire, et polynucleotide codant ce polypeptide
WO2002020780A1 (fr) Nouveau polypeptide, grande proteine humaine 9.13, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

ENP Entry into the national phase

Country of ref document: RU

Kind code of ref document: A

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP