WO2001096526A2 - Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001096526A2 WO2001096526A2 PCT/CN2001/000906 CN0100906W WO0196526A2 WO 2001096526 A2 WO2001096526 A2 WO 2001096526A2 CN 0100906 W CN0100906 W CN 0100906W WO 0196526 A2 WO0196526 A2 WO 0196526A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- tumor suppressor
- human tumor
- suppressor gene
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, ⁇ tumor suppressor gene 11.77, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- Von Hippel-Lindau is a familial cancer syndrome.
- the cause is a mutation in the VHL tumor suppressor gene.
- the mutation caused the continuous stabilization of hypoxia-inducible factors 1 ⁇ and 2 ⁇ in the transcription factor tissue. 1 ⁇ and 2 ⁇ are combined with enhancer elements of specific vascular endothelial growth factor (VEGF) genes to stimulate angiogenesis.
- VEGF vascular endothelial growth factor
- Critical target organs such as the heart, brain, kidneys, and eyeballs, etc.
- This angiogenesis under normal oxygen supply conditions will lead to a high degree of morbidity and shortened life [Oncologist 2000; 5 Suppl 1: 32-6].
- VHL protein is a protein complex containing elongin B, elongin C and cullin-2 proteins. These proteins all play a role in transcription extension and generalization [Science 284: 602-604, 1999].
- the human tumor suppressor gene 11.77 protein plays a role in regulating cell division and embryonic development. Plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more human tumor suppressor 11.77 proteins involved in these processes, especially to identify the amino acid sequence of this protein .
- the isolation of the novel tumor suppressor gene 11.77 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human tumor suppressor gene 11.77.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human tumor suppressor gene 11.77.
- Another object of the present invention is to provide a method for producing a human tumor suppressor gene 11.77.
- Another object of the present invention is to provide antibodies against the human tumor suppressor gene 11. 77 of the polypeptide of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human tumor suppressor gene 11.77.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human tumor suppressor gene 11.77. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 539-862; and (b) a sequence of positions 1-2714 in SEQ ID NO: 1.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human tumor suppressor gene 11.
- 77 protein which comprises using the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of a human tumor suppressor gene 11.77 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human tumor suppressor gene 11.77.
- Fig. 1 is a comparison diagram of gene chip expression profiles of the human tumor suppressor gene 11.77 and human VHL protein of the present invention.
- the upper graph is a graph of the expression profile of the human tumor suppressor gene 11. 77
- the lower graph is the graph of the expression profile of the human VHL protein.
- 1-bladder mucosa 2-PMA + Ecv3 (M cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6- scar into fc Growth factor stimulation, 1013HT, 7-scar into fc without growth factor stimulation, 1013HC, 8-bladder cancer construct cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13 -Fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human tumor suppressor gene 11.77.
- 12kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with the human tumor suppressor gene 11. 77, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds a human tumor suppressor gene 11.77.
- Antagonist refers to a molecule that, when combined with human tumor suppressor gene 11. 77, can block or regulate the biological or immunological activity of human tumor suppressor gene 11. 77.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human tumor suppressor genes 11.77.
- Regular refers to a change in the function of human tumor suppressor gene 11.77, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human tumor suppressor gene 11.77. change.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality.
- Those skilled in the art can purify human tumor suppressor gene 11.77 using standard protein purification techniques.
- the substantially pure human tumor suppressor gene 11.77 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the human tumor suppressor gene 11. 77 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGAUGN program can compare two or more sequences based on different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? ⁇ It can specifically bind to the epitope of human tumor suppressor gene 11. 77.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human tumor suppressor gene 11. 77 means human tumor suppressor gene 11. 77 is substantially free of other proteins, lipids, sugars or other substances naturally associated with it. Those skilled in the art can purify human tumor suppressor genes 11.77 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. Human tumor suppressor gene 11. 77 The purity of the peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human tumor suppressor gene 11. 77, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the human tumor suppressor gene 11.77.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human tumor suppressor gene 11.77 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non- A conservative amino acid residue (preferably a conservative amino acid residue) substitution, and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more of the amino acid residues Each group is substituted by another group to include a substituent; or (II) a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such A type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence).
- an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2,714 bases in length, and its open reading frames 539-862 encode 107 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human VHL protein, and it can be deduced that the human tumor suppressor gene 11. 77 has similar functions to human VHL protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- the D form includes cDM, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human tumor suppressor genes 11. 77.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human tumor suppressor gene 11.77 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genome D; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genome D is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- raRNA extraction There are many mature techniques for raRNA extraction, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Moleculer Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) measuring the level of the human tumor suppressor gene 11.77 transcript; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 Nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the human tumor suppressor 11.77 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / MA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human tumor suppressor gene 11. 77 coding sequence, and a recombinant technology to produce a polypeptide of the present invention. method.
- a polynucleotide sequence encoding the human tumor suppressor gene 11. 77 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human tumor suppressor gene 11.77 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be harvested after exponential growth phase, 0 & (12 treated with method steps used are well known in the art. Alternatively, it is by M g Cl 2.
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Plastid packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human tumor suppressor genes 11. 77 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- VHL syndrome is a familial cancer syndrome. Male patients with this syndrome may suffer from hypercalcemia associated with epididymal mastoid cystadenoma, retinal cell carcinoma, pheochromocytoma, and pancreatic, colon, and adenocarcinomas.
- the cause of von Hippel Lindau's syndrome is a mutation in the VHL tumor suppressor gene.
- VHL protein is a protein complex containing elongin B, elongin C and cul l in-2 protein. These proteins all play a role in transcription extension and generalization.
- abnormal expression of VHL protein can cause tumor disease.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human VHL protein, and both have similar biological functions.
- the abnormal expression of the polypeptide of the present invention in vivo can cause various tumor diseases, including but not limited to:
- Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;
- Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
- Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
- malignant melanoma skin, mucous membrane
- (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
- (malignant) supporter cells stromal cell tumor
- (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
- malignant melanoma skin, mucous membrane
- hydatidiform mole chorionic epithelial cancer [uterine]
- (malignant) supporter cells stromal cell tumor
- (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
- asexual cell tumor ovary
- embryonal cancer testis, ovary
- (malignant) teratoma
- polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used in the treatment of various diseases, especially various tumor diseases and the like.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human tumor suppressor genes 11.77.
- Agonists increase human tumor suppressor genes.
- 77 77 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- 77 can be cultured together with a labeled human tumor suppressor gene 11. 77 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
- Antagonists of the human tumor suppressor gene ⁇ . 77 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human tumor suppressor gene 11. 77 can bind to human tumor suppressor gene 11. 77 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human tumor suppressor genes 11, 77 can be added to the bioanalytical assay, and the interaction between the human tumor suppressor gene 11. 77 and its receptor can be determined by measuring the compound Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to the human tumor suppressor gene 11.77 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In the screening, 11.77 molecules of human tumor suppressor gene should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human tumor suppressor gene 11. 77 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human tumor suppressor gene 11.77 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human tumor suppressor gene 11. 77 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Embedding antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human tumor suppressor gene 11. 77
- Antibodies against human tumor suppressor gene 11. 77 can be used in immunohistochemistry to detect human tumor suppressor gene 11. 77 in biopsy specimens.
- Monoclonal antibodies that bind to the human tumor suppressor gene 11. 77 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill the human tumor suppressor gene 11. 77 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to the human tumor suppressor gene 11.77.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human tumor suppressor gene 11.77.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human tumor suppressor gene 11.77.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human tumor suppressor gene 11.77 detected in the test can be used to explain the human tumor suppressor gene 11.77 ⁇ Significance in various diseases and diseases for which the human tumor suppressor gene 11.77 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding the human tumor suppressor gene 11. 77 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human tumor suppressor gene 11. 77.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human tumor suppressor genes 11. 77 to suppress endogenous human tumor suppressor genes 11. 77 activity.
- a mutated human tumor suppressor gene 11. 77 may be a shortened human tumor suppressor gene 11. 77 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human tumor suppressor gene 11. 77.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding human tumor suppressor gene 11. 77 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human tumor suppressor gene 11. 77 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding the human tumor suppressor gene 11.77 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- RNA oligonucleotides including antisense RNA and MA
- ribozymes are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DNA sequence is integrated downstream of the R polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding the human tumor suppressor gene 11.77 can be used for the diagnosis of diseases related to the human tumor suppressor gene 11.77.
- the polynucleotide encoding the human tumor suppressor gene 11. 77 can be used to detect the expression of the human tumor suppressor gene 11. 77 or the abnormal expression of the human tumor suppressor gene 11. 77 in a disease state.
- the DNA sequence encoding human tumor suppressor gene 11. 77 can be used to hybridize biopsy specimens to determine human Expression of tumor suppressor gene 11. 77.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human tumor suppressor gene 11.77 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human tumor suppressor gene 11.77 transcription product.
- Detection of mutations in the human tumor suppressor 11.77 gene can also be used to diagnose human tumor suppressor 11.77-related diseases.
- Human tumor suppressor 11.77 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human tumor suppressor 11.77 D sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human tumor suppressor genes 11. 77 are administered in amounts effective to treat and / or prevent specific indications. The amount and dose range of human tumor suppressor gene ⁇ . 77 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Directional insertion of cDNA fragments into pBSK using Smart cDNA Cloning Kit (purchased from Clontech) (+) At the multiple cloning site of the vector (Clontech), DH5 ⁇ was transformed, and the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- cDNA sequence of one of the clones 0562B11
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0562B11 clone contains a full-length CDM of 2714bp (as shown in Seq ID N0: l), a 323bp open reading frame (0RF) from 539bp to 862bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- This clone pBS-0562B11 and the encoded protein was named human tumor suppressor gene 11.77.
- Example 2 Cloning of a gene encoding human tumor suppressor gene 11.77 by RT-PCR
- CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Q i agene's kit, the following primers were used for PCR amplification:
- Pr imerl 5'- CTCAAAGTTAGGGTCTGTATCTAC -3 '(SEQ ID NO: 3)
- Primer2 5 — ACGGAGTCTTGCTCTGTCGCCCAG -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Conditions for the amplification reaction 50 ⁇ l of 01 / L KC1, 1 Ommo 1 / L Tri s-HCl pH 8.5, 1.5 ol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1 ⁇ Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
- the amplification products were purified using QIAGEN kits, and TA cloning kits were connected to pCR vectors. Unvi trogen products ).
- DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2714bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human tumor suppressor gene 11.77 gene expression Total MA was extracted in one step [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate-chloroform extraction.
- the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing.
- the aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate.
- the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- 20 ⁇ 8 RNA containing 20mM 3- (N- morpholino) propanesulfonic acid (pH7 0.) -5mM sodium acetate -.
- L EDTA-2 2M formaldehyde 1.2% agarose gel motivated Line electrophoresis. It was then transferred to a nitrocellulose membrane.
- A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers.
- the DNA probe used was a PCR amplified human tumor suppressor gene 11.77 coding region sequence (539bp to 862bp) shown in FIG.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / iiil) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.
- Pr imer3 5'-CATGCTAGCATGCCTGTAATCCCAGCACTTTGG-3 '(Seq ID No: 5)
- Primer4 5' -CATGGATCCTTACAGATTAGAAAACAGAGGCAC-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Nhel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR was performed using the PBS-0562B11 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ containing pBS - 0562B11 plasmid 10pg, primer Primer-3 and Primer-4, respectively l Opraol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60. C 30s, 68. C 2 rain, a total of 25 cycles.
- Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH5 cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive colonies were screened by colony PCR method and sequenced. Positive sequence correct clone (PET-0562B11) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- Polypeptide synthesizer (product of PE Company) was used to synthesize the following human tumor suppressor gene 11. 77-specific peptides: -Gly-Gly-Ser-C00H (SEQ ID NO: 7). The peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avraraeas, et al. Immunochemi stry, 1969; 6: 43 »Use 1 ⁇ 2 g of the above hemocyanin peptide complex with complete Freund's adjuvant. Rabbits were immunized, and 15 days later they were boosted with hemocyanin polypeptide complex and incomplete Freund's adjuvant.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to human tumor suppressor gene 11. 77.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30% -70%, if it exceeds, non-specific hybridization increases
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genome sequences and their complement The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (view):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Two NC membranes are needed for each probe, so as to be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Pr 0 be (the second peak is free ⁇ - 32 P- dATP) to be prepared.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeRis i, JL, Lyer, V. & Brown, PO (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema, M Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen), and the fluorescent reagents were separately reverse-transcribed.
- Cy3dUTP (5_Amino-propar gy 2'-deoxyur idine 5'-triphate cou led to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) labeled mRM of human mixed tissues, using the fluorescent reagent Cy5dUTP (5 — Amino-propargyl-2 ' -deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRM of specific tissues (or stimulated cell lines) of the body, and the probes were prepared after purification.
- Cy3dUTP 5_Amino-propar gy 2'-deoxyur idine 5'-triphate cou led to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech
- Cy5dUTP 5 — Amino-propargyl-2 ' -deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham
- the probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridizat ion Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profile of human tumor suppressor gene 11. 77 and human VHL protein according to the present invention are very similar.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89515/01A AU8951501A (en) | 2000-06-07 | 2001-06-04 | A novel polypeptide, a human tumor suppressor factor 11.77 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00116365 CN1326977A (zh) | 2000-06-07 | 2000-06-07 | 一种新的多肽——人肿瘤抑制基因11.77和编码这种多肽的多核苷酸 |
CN00116365.5 | 2000-06-07 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001096526A2 true WO2001096526A2 (fr) | 2001-12-20 |
WO2001096526A3 WO2001096526A3 (fr) | 2002-05-10 |
Family
ID=4585769
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000906 WO2001096526A2 (fr) | 2000-06-07 | 2001-06-04 | Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1326977A (fr) |
AU (1) | AU8951501A (fr) |
WO (1) | WO2001096526A2 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8750328B2 (en) | 1998-12-04 | 2014-06-10 | Tekelec Global, Inc. | Methods and systems for communicating signaling system 7 (SS7) user part messages among SS7 signaling points (SPs) and internet protocol (IP) nodes using signal transfer points (STPs) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6013436A (en) * | 1994-07-08 | 2000-01-11 | Visible Genetics, Inc. | Compositions and methods for diagnosis of mutation in the von Hippel-Lindau tumor suppressor gene |
-
2000
- 2000-06-07 CN CN 00116365 patent/CN1326977A/zh active Pending
-
2001
- 2001-06-04 AU AU89515/01A patent/AU8951501A/en not_active Abandoned
- 2001-06-04 WO PCT/CN2001/000906 patent/WO2001096526A2/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6013436A (en) * | 1994-07-08 | 2000-01-11 | Visible Genetics, Inc. | Compositions and methods for diagnosis of mutation in the von Hippel-Lindau tumor suppressor gene |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8750328B2 (en) | 1998-12-04 | 2014-06-10 | Tekelec Global, Inc. | Methods and systems for communicating signaling system 7 (SS7) user part messages among SS7 signaling points (SPs) and internet protocol (IP) nodes using signal transfer points (STPs) |
Also Published As
Publication number | Publication date |
---|---|
CN1326977A (zh) | 2001-12-19 |
AU8951501A (en) | 2001-12-24 |
WO2001096526A3 (fr) | 2002-05-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002006477A9 (fr) | Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide | |
WO2002006334A1 (fr) | Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide | |
WO2002006475A1 (fr) | NOUVEAU POLYPEPTIDE, β1-GLYCOPROTEINE SPECIFIQUE DE LA GROSSESSE 9.02, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE | |
WO2001096526A2 (fr) | Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide | |
WO2002026796A1 (fr) | Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide | |
WO2001092319A1 (fr) | NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE | |
WO2002020584A1 (fr) | Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide | |
WO2002006471A1 (fr) | Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2001090133A1 (fr) | Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2002006335A1 (fr) | Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide | |
WO2002040525A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2001092329A1 (fr) | Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2001092518A1 (fr) | Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2002000823A2 (fr) | Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide | |
WO2002026811A1 (fr) | Nouveau polypeptide, symplekine 8.91, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001090379A1 (fr) | Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide | |
WO2002012486A1 (fr) | Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2002012313A1 (fr) | Nouveau polypeptide, proteine phosphatase humaine 12.43, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |