WO2002020584A1 - Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020584A1
WO2002020584A1 PCT/CN2001/001057 CN0101057W WO0220584A1 WO 2002020584 A1 WO2002020584 A1 WO 2002020584A1 CN 0101057 W CN0101057 W CN 0101057W WO 0220584 A1 WO0220584 A1 WO 0220584A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
repair protein
human
sequence
Prior art date
Application number
PCT/CN2001/001057
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002214909A priority Critical patent/AU2002214909A1/en
Publication of WO2002020584A1 publication Critical patent/WO2002020584A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ DM repair protein 10.23, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • NER nucleotide excision repair
  • UV ultraviolet
  • Rad_18 gene has some unusual features: (1) it is the only DM repair gene in the DNA repair gene that is closely related to the SMC family; (2) removes its repair role in DM damage, and has other important functions That is, the function involved in DM replication; (3) The rad-18 mutant is sensitive to UV and Y radiation.
  • Rad-18 protein belongs to the SMC family because it has all the main characteristics of the family: the amino acid length is between 1100 and 1500, and it has a Wa lker A nucleotide binding site at about 40 amino acids or 120 amino acids , Has two coiled coil domains, the first region has 240 to 350 amino acids, the second region has 280 to 380 amino acids, the middle is separated by a 160 to 210 amino acid spacer, and there is a highly conserved near C-terminus Region is the 3 ⁇ 4 11 ⁇ 1 type B site involved in binding nucleotides. Other members of the SMC superfamily are involved in the construction of chromosomes, but the rad-18 protein has nothing to do with the concentration and separation of chromosomes.
  • Rad-18 protein also has two nuclear localization signals (NLSs) at amino acids 22 to 25 and amino acids 41 to 44. There is a 16 amino acid gap between these two nuclear localization signals, which is longer than the 10 bases between the usual bipartite nuclear localization signals. About 10 amino acids upstream of the first sequence, there is a casein kinase II site (SLEE) that is often found in NLSs.
  • SLEE casein kinase II site
  • the KIAA0594 protein discovered in 1998 is homologous to the above-mentioned RAD18 protein, so it may also be a DM repair protein [DNA Res 5, 31-39 (1988)].
  • Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibrobl as t, growth factor stimulation, 1024NT, scar-forming fc growth factor stimulation, 101 3HT, Scar into fc without stimulation with growth factor, 101 3HC, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer, the present invention
  • the expression profile of the peptide is very similar to that of KIAA0594, so the functions of the two may also be similar.
  • the invention is named human DNA repair protein 10.23.
  • the human DM repair protein 10.23 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these Process of the human DM repair protein 10.23 protein, especially the amino acid sequence of this protein is identified.
  • Newcomer DM repair protein 10.23 The isolation of the protein-coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human DNA repair protein 10.23.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human DNA repair protein 10.23.
  • Another object of the present invention is to provide a method for producing human DNA repair protein 10.23.
  • Another object of the present invention is to provide an antibody against the polypeptide-human DNA repair protein 10.23 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-human DNA repair protein 10.23 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human DM repair protein 10.23. Summary of invention
  • the invention relates to an isolated polypeptide, which is of human origin, and which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 690-971 in SEQ ID NO: 1; and (b) a sequence having 1-1131 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human DNA repair protein 10.23 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human DNA repair protein 10.23 protein in vitro, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human DM repair protein 10.23.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of the inventor's DM repair protein 10.23 and KIAA0594.
  • the upper graph is a graph of the expression profile of human DM repair protein 10.23, and the lower graph is the graph of the expression profile of KIAA0594.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human D repair protein 10.23.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human DM repair protein 10.23, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human DNA repair protein 10.23.
  • An "antagonist” or “inhibitor” refers to a molecule that can block or regulate the biological or immunological activity of human DM repair protein 10.23 when combined with human DM repair protein 10.23.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human DM repair protein 10.23.
  • Regular refers to a change in the function of human DM repair protein 10.23, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human DNA repair protein 10.23 change.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human DNA repair proteins using standard protein purification techniques 10.23.
  • Substantially pure human DM repair protein 10.23 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human DM repair protein 10.23 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (Higgins, D. G. and
  • Nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein Percentage of identity between them (He in J., (1990) Methods in enzymology 183: 625-645). "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human DNA repair protein 10.23.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human DM repair protein 10.23 refers to human DNA repair protein 10.23 and is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human DM repair protein using standard protein purification techniques 10.23. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human DM repair protein 10.23 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human DNA repair protein 10.23, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic Polypeptide, preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human DNA repair protein 10.23.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human DNA repair protein 10.23 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1131 bases, and its open reading frame 690-971 encodes 93 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to KIAA0594, and it can be deduced that the human DM repair protein 10.23 has similar functions to KIAA0594.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 »/.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human DM repair protein 10.23.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human DM repair protein 10.23 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of MA sequences is often the method of choice. The more commonly used method is the separation of cD sequences.
  • the standard method for isolating the CDM of interest is to isolate raRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human DNA repair protein 10.23 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect human D repair protein 10.23 gene expression protein products.
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human DNA repair protein 10.23 coding sequence, and a recombinant technology to produce a polypeptide of the present invention. method.
  • a polynucleotide sequence encoding the human DNA repair protein 10.23 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; A pMSXND expression vector (Lee and Nathans, J Bio Chem.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human DM repair protein 10.23 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DM technology, earning synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Collspring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human DM repair protein 10.23 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • Competent cells that absorb DNA can be harvested after the exponential growth phase and treated with the 01 2 method.
  • the steps used are well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human DNA repair protein 10.23 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • KIAA0594 protein is a RAD18 protein, KIAA0594, which is involved in DNA repair pathways that remove UV-induced DNA damage and ionizing radiation damage. Abnormal expression of KIAA0594 protein in the body can cause the body to lose the damaged DNA repair mechanism, and then cause related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human KIAA0594 protein, and both have similar biological functions.
  • the polypeptide of the present invention is involved in the DNA repair pathway to remove UV-induced DM damage and ionizing radiation damage in vivo. Abnormal expression of the polypeptide can cause the body to lose the damaged DM repair mechanism, and then cause embryonic developmental malformations and various tumor diseases These diseases include but are not limited to: Common embryonic malformations: 1. Common deformities of face, neck and limbs:
  • Cleft lip most common, with alveolar cleft and cleft palate
  • cleft palate oblique cleft face
  • cervical pouch most common, with alveolar cleft and cleft palate
  • oblique cleft face cervical pouch, cervical palate, etc.
  • Absent in longitudinal direction Absence of upper limb radius / ulnar side, lower limb tibia / fibula side, etc .;
  • Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, finger (toe) deformity, horseshoe varus, etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital agangliomegalo colon, impotence of anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • neural tube defects no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .; Mesenchymal organization:
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as embryonic malformation and various tumor diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human DNA repair protein 10.23.
  • Agonists enhance human DNA repair proteins 10.23 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human DNA repair protein 10.23 and labeled human DNA repair protein 10.23 can be cultured in the presence of drugs. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human DNA repair protein 10.23 include selected antibodies, compounds, receptor deletions, and the like.
  • the antagonist of human DNA repair protein 10.23 can bind to human DM repair protein 10.23 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human DNA repair protein 10.23 can be added to a bioanalytical assay to determine whether a compound is a compound by measuring the effect of the compound on the interaction between human DNA repair protein 10.23 and its receptor.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human DNA repair protein 10.23 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 10.23 molecules of human DM repair protein should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human DM repair protein 10.23 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human DM repair protein 10.23 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human DNA repair protein 10.23 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cell hybridoma technology , EBV-hybridoma technology, etc.
  • Antibodies against human DNA repair protein 10.23 can be used in immunohistochemical techniques to detect human D repair protein 10.23 in biopsy specimens.
  • Monoclonal antibodies that bind to human DM repair protein 10.23 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human DNA repair protein 10.23 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human DM repair protein 10.23.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human DM repair protein 10.23.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human DNA repair protein 10.23. Law. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human DM repair protein 10.23 detected in the test can be used to explain the importance of human DM repair protein 10.23 in various diseases and to diagnose diseases in which human DNA repair protein 10.23 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human DNA repair proteins 10.23 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human DNA repair protein 10.23.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human DNA repair protein 10.23 to inhibit endogenous human DNA repair protein 10.23 activity.
  • a mutated human DM repair protein 10.23 may be a shortened human DM repair protein 10.23, which lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human DNA repair protein 10.23.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding human DM repair protein 10.23 into cells.
  • Methods for constructing recombinant viral vectors carrying polynucleotides encoding human DM repair protein 10.23 can be found in existing literature (Sambrook, et al.).
  • recombinant polynucleotides encoding human DNA repair protein 10.23 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human DNA repair protein 10.23 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA and DM and ribozymes can be obtained by any RNA or DM synthesis technology. For example, solid-phase phosphoramidite chemical synthesis technology has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This D sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human DNA repair protein 10.23 can be used for diagnosis of diseases related to human DNA repair protein 10.23.
  • Polynucleotide encoding human DNA repair protein 10.23 can be used to detect human DM repair The expression of complex protein 10.23 or abnormal expression of human DM repair protein 10.23 in a disease state.
  • a DNA sequence encoding human DNA repair protein 10.23 can be used to hybridize biopsy specimens to determine the expression status of human DNA repair protein 10.23.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • the transcription product of human DNA repair protein 10.23 can also be detected by RNA-polymerase chain reaction (RT-PCR) in vitro amplification using human DNA repair protein 10.23 specific primers.
  • Human DNA repair protein 10.23 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human DM repair protein 10.23 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cD libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human DNA repair protein 10. 23 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of human DNA repair protein 10.23 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik mRNA Isolat ion Ki t Product of Qiegene
  • Isolate poly A
  • m NA Q 2ug poly A
  • mRNA from total RNA and form cDNA by reverse transcription.
  • Smart cDNA cloning kit purchased from Clontech
  • the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elraer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the CDM sequence of one of the clones, 0042b07, was a new DM.
  • a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
  • CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5,-TCCTAATATGCAGGCCTCCAGATC-3, (SEQ ID NO: 3)
  • Primer 2 5'- GAGGTGGGGTTTCACCATGTTGCC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1/1 dNTP, 1 Opraol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -act in was set as positive during RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DM sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1 to 1131 bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human DNA repair protein 10.23 gene expression
  • Total RM extraction in one step [Anal. Biochem 1987, 162, 156-159] rempliThis method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M Sodium acetate (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol ( 0.8 volume) and centrifuge the mixture to obtain RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • 32P-labeled probes (approximately 2 x 10 6 cpm / ral) were hybridized with RM-transferred nitrocellulose membrane at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human DNA repair protein 10.23
  • Pr imer3 5 '-CCCCATATGATGGTCAGGCTTTTAAGCAACCTC-3' (Seq ID No: 5)
  • Pr imer4 5'-CATGGATCCTTACTCAAATATTTCTTCTTTCCT-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using the pBS-0042b07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing pBS-0042b07 plasmid 1 Opg, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BaraHI were used to double-digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
  • the host bacteria BL21 (pET-0042b07) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1 mmol / L, and the culture was continued. 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was collected by centrifugation and chromatographed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). 23 ⁇
  • the purified target protein DNA repair protein 10.23 was obtained.
  • a peptide synthesizer (product of PE company) was used to synthesize the following polypeptide specific for human DM repair protein 10.23: NH2-Met-Val-Arg-Leu-Leu-Ser-Asn-Leu-Ile-Phe-Leu-Leu- Val-Ser-Val-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 853 ⁇ 4 or there are more than 15 consecutive bases, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 PP r0 (the second peak is free ⁇ - 32P-dATP) to be prepared.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1rag / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, sown at 68 ° C for 2 hours.
  • prehybridization solution lOxDenhardt's; 6xSSC, 0.1rag / ml CT DM (calf thymus DNA)
  • Gene microarray or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs were used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2 — — Deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Araersham Phamacia Biotech Company, labeled mRM of specific tissues (or stimulated cell lines) of the body, and the probes were prepared after purification.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy3 f l
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn (Figure 1). It can be seen from the figure that the expression profiles of human DNA repair proteins 10.23 and 1 (14 people 0594) according to the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de réparation de l'ADN 10.23, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations survenant lors du développement de l'embryon et de diverses maladies tumorales. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine de réparation de l'ADN 10.23.
PCT/CN2001/001057 2000-06-28 2001-06-25 Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide WO2002020584A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002214909A AU2002214909A1 (en) 2000-06-28 2001-06-25 A novel polypeptide-homo dna repair protein 10.23 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116857.6 2000-06-28
CN 00116857 CN1331183A (zh) 2000-06-28 2000-06-28 一种新的多肽——人dna修复蛋白10.23和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002020584A1 true WO2002020584A1 (fr) 2002-03-14

Family

ID=4586256

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001057 WO2002020584A1 (fr) 2000-06-28 2001-06-25 Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331183A (fr)
AU (1) AU2002214909A1 (fr)
WO (1) WO2002020584A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6720319B2 (en) 2000-09-08 2004-04-13 Boehringer Ingelheim Pharmaceuticals, Inc. Compounds useful as reversible inhibitors of cysteine proteases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ZHU YINGBAO ET AL.: "Hr24L, a functional human homologue of S. cerevisiae RAD24L gene, is involved in cell cycle checkpoint control", JOURNAL OF BEIJING MEDICAL UNIVERSITY, vol. 31, no. 3, June 1999 (1999-06-01), pages 269 - 273 *
ZHU YINGBAO ET AL.: "Molecular cloning and sequencing of DNA repair gene RAD24", CHINESE BIOCHEMICAL JOURNAL, vol. 11, no. 5, October 1995 (1995-10-01), pages 541 - 550 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6720319B2 (en) 2000-09-08 2004-04-13 Boehringer Ingelheim Pharmaceuticals, Inc. Compounds useful as reversible inhibitors of cysteine proteases

Also Published As

Publication number Publication date
CN1331183A (zh) 2002-01-16
AU2002214909A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
WO2002006477A9 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2001096526A2 (fr) Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002026793A1 (fr) Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2002011512A1 (fr) Nouveau polypeptide, proteine mitochondriale de liaison du calcium humaine 10.12, et polynucleotide codant ce polypeptide
WO2001094578A1 (fr) Nouveau polypeptide, proteine ubch5 11.44, et polynucleotide codant ce polypeptide
WO2002012313A1 (fr) Nouveau polypeptide, proteine phosphatase humaine 12.43, et polynucleotide codant ce polypeptide
WO2002006472A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.45, et polynucleotide codant ce polypeptide
WO2002020582A1 (fr) Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide
WO2002026811A1 (fr) Nouveau polypeptide, symplekine 8.91, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2001094398A1 (fr) Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide
WO2002020599A1 (fr) Nouveau polypeptide, isomere humain 19.47 du facteur de regulation et de transcription zmf1, et polynucleotide codant ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2002020576A1 (fr) Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP