WO2002020576A1 - Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020576A1
WO2002020576A1 PCT/CN2001/001005 CN0101005W WO0220576A1 WO 2002020576 A1 WO2002020576 A1 WO 2002020576A1 CN 0101005 W CN0101005 W CN 0101005W WO 0220576 A1 WO0220576 A1 WO 0220576A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein
encoded
human breast
Prior art date
Application number
PCT/CN2001/001005
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001295392A priority Critical patent/AU2001295392A1/en
Publication of WO2002020576A1 publication Critical patent/WO2002020576A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide—a protein encoded by a human breast susceptibility gene 12.32, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • BRCA1 encodes a multifunctional protein. Mutations in these proteins make the body prone to breast cancer.
  • the functions of BRCA1 include: 1. Maintain the stability of the genome. BRCA1 is involved in homologous recombination and plays a role in transcription-coupled double-strand break repair. BRAC1 is missing under the repair function of the mouse, and the cell cycle checkpoint is also missing; 2. BRCA1 is necessary in the explosive cell proliferation in the early stage of embryo development. During puberty, during pregnancy, and during lactation, expression can be upregulated with the proliferation of mammary epithelial cells. '' In adult breast or ovarian epithelial cells, the absence of BRCA1 can cause tumors; 3.
  • BRCA1 plays a role in transcriptional regulation. BRCA1 forms a complex with RNA polymerase II. And BRCA1 can interact with transcriptional regulatory proteins. [Trends in Genetics 2000, 16: 69-74]
  • BRCA1 is a nuclear protein. Its nuclear distribution domain can interact with iraportin-cc, a nuclear transport signal receptor. There are also indications that BRCA1 is a secreted protein, and in sporadic, severe (third degree) breast ductal tumors, BRCA1 protein expression is reduced or disappeared. BRCA1 tends to be expressed early in the G1 phase and S phase of the cell cycle. BRCA1 function can be regulated by phosphorylation. It is hyperphosphorylated in the late G1 and S phases by an endogenous kinase activity and dephosphorylated in the M phase. During the G1 to S phase transition, BRCA1 may bind to hypophosphorylated eye oncoproteins and prevent the cell cycle from continuing. [Proc. Natl. Acad. Sci. U. S. A., 96: 11866- 11871]
  • BRCA1 may regulate G2-M checkpoints. It controls the assembly of the mitotic spindle and correctly separates the chromosomes into two daughter cells. BRCA1 exon 11-deficient mouse embryonic fibroblasts had problems at the G2-M checkpoint: centrosomes were duplicated, and chromosomes were abnormally distributed, resulting in the appearance of aneuploid cells. Proteins that regulate the G2-M phase, such as p53, RB are located near the centriole. BRCA1 is also located near the centrosome during mitosis, and it is related to the microtubules (the components of the centrosome). Interaction. Mutated BRCA1 may lead to aberrant regulation of telomere replication, leading to instability of the cell genome. [Mol. Cell. Biol., 16: 7133-7143]
  • the 12.32 protein encoded by the human breast susceptibility gene plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the 12.32 protein encoded by the human breast susceptibility gene involved in these processes, especially the amino acid sequence of this protein is identified.
  • Protein encoded by new human breast susceptibility genes 12.32 The isolation of the protein-encoded genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a protein 12.32 encoded by a human breast susceptibility gene.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a protein 12.32 encoded by a human breast susceptibility gene.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the protein 12.32 encoded by the human breast susceptibility gene of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of the protein 12.32 encoded by the human breast susceptibility gene.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 590-928 in SEQ ID NO: 1; and (b) a sequence having 1-936 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of protein 12.32 protein encoded by the human breast susceptibility gene, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to a protein encoded by a human breast susceptibility gene 12.32 protein, which comprises detecting a polypeptide in a biological sample or a coding polynucleotide sequence thereof. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental or immune disease or other diseases caused by abnormal expression of protein 12.32 encoded by human breast susceptibility gene. use.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
  • polypeptide or “protein” is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with the protein 12.32 encoded by the human breast susceptibility gene, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to protein 12.32 encoded by a human breast susceptibility gene.
  • Antagonist refers to a biological activity or immunity that can block or regulate protein 12.32 encoded by the human breast susceptibility gene when combined with protein 12.32 encoded by the human breast susceptibility gene.
  • Chemically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the protein 12.32 encoded by the human breast susceptibility gene.
  • Regular refers to a change in the function of protein 12.32 encoded by the human breast susceptibility gene, including an increase or decrease in protein activity, a change in binding characteristics, and any other organism of protein 12.32 encoded by the human breast susceptibility gene. Changes in nature, function, or immunity.
  • substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify proteins encoded by human breast susceptibility genes12 32.
  • a protein encoded by a substantially pure human breast susceptibility gene 12. 32 can produce a single main band on a non-reducing polyacrylamide gel.
  • a protein encoded by a human breast susceptibility gene 12. 32 The purity of the polypeptide is available Amino acid sequence analysis.
  • Complementary refers to a polynucleotide that naturally binds by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-GA” can be combined with the complementary sequence "G-AC-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Cluster's method or using methods known in the art such as Jotun He in.
  • the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625- 645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (£ ⁇ ') 2 and? It can specifically bind to the 12.32 epitope of human breast susceptibility gene.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • protein 12.32 encoded by an isolated human mammary susceptibility gene refers to protein 12.32 encoded by a human mammary susceptibility gene that is substantially free of other proteins, lipids, sugars, or other proteins that are naturally associated with it. substance. Those skilled in the art can purify the protein encoded by the human breast susceptibility gene using standard protein purification techniques. 12.32. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The protein encoded by the human breast susceptibility gene 12. 32 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide-protein 12.32 encoded by a human breast susceptibility gene, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of the protein 12.32 encoded by the human breast susceptibility gene.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of protein 12.32 encoded by the human breast susceptibility gene of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type, One of the one or more amino acid residues is substituted with another group to include a substituent; or
  • polypeptide sequences (such as leader sequences or secretory sequences or sequences used to purify this polypeptide or protein sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence that is 936 bases in length and its open reading frame 590-928 encodes 112 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human BRCA1 protein, and it can be deduced that the protein encoded by the human breast susceptibility gene 12.32 has similar functions to human BRCA1 protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) in the lower Hybridization and elution at ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60%; or (2) adding denaturants such as 50% (v / v) formamide, 0.1% calf serum / 0.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the protein 12.32 encoded by the human breast susceptibility gene.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the protein 12.32 encoded by the human breast susceptibility gene of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of the transcript of protein 12.32 encoded by the human breast susceptibility gene (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleosides Acid, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein encoded by the human mammary gland susceptibility gene 12.32 gene expression protein product can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or a protein encoded by the human mammary gland susceptibility gene 12.32, and to produce the present invention by recombinant technology Polypeptide method.
  • a polynucleotide sequence encoding the protein 12.32 encoded by the human breast susceptibility gene can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • an expression vector containing a DNA sequence encoding a protein encoded by the human breast susceptibility gene 12.32 and suitable transcription / translation regulatory elements can be used to construct an expression vector containing a DNA sequence encoding a protein encoded by the human breast susceptibility gene 12.32 and suitable transcription / translation regulatory elements. These methods include body External recombination DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, etal. Molecluar Clinging, a Labora tory Manua l, cold Spring Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a protein encoded by the human breast susceptibility gene 12.32 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl, the steps used are well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce the protein encoded by the recombinant human breast susceptibility gene 12.32 (Sc ience, 1984; 224: 1431). Average There are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of gene chip expression profiles of protein 12.32 and human BRCA1 protein encoded by the human breast susceptibility gene of the present invention.
  • the upper graph is a graph of the expression profile of protein 12.32 encoded by the human breast susceptibility gene
  • the lower graph is the graph of the expression profile of human BRCA1 protein.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the protein encoded by the isolated human breast susceptibility gene 12.32. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Example 1 Cloning of protein 12.32 encoded by human breast susceptibility gene
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones Ol fO 4 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the results show that the full-length cDNA contained in the 0145f04 clone is 936bp (as shown by Seq ID NO: l), and there is a 338bp open reading frame (0RF) from Obp to WSbp, which encodes a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0145f 04 was named protein 12.32 encoded by the human breast susceptibility gene.
  • Example 2 Cloning of a gene encoding protein 12.32 encoded by a human breast susceptibility gene by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5 — CTTAAGATGAAAAGATTTTGTTTT -3, (SEQ ID NO: 3)
  • Pr iraer2 5'- ACAGAGTCTCATTCTGTTACCCAG -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 leg ol / L KC1, 10mraol / L Tri s-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP in a reaction volume of 50 ⁇ 1 , l Opmol primer, 1U Taq DM polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0
  • ⁇ -act in was set as positive during RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as 1-936bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human breast susceptibility gene 12.32 gene expression: Total RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate-chloroform extraction. I.e.
  • RNA precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA was prepared using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DM probe used is the 12.32 coding region sequence (590bp to 928bp) of the protein encoded by the human breast susceptibility gene amplified by PCR shown in FIG.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and a nitrocellulose membrane to which RNA was transferred were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 X SSC-5 X Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of protein 12.32 encoded by recombinant human breast susceptibility gene
  • Primer3 5'-CATGCTAGCATGAGAGAGGTAAGTGCGTGTAAT-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCATTCTGTTACCCAGGCTGGAGT-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using pBS-0145f04 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing pBS- 0145f 04 plasmid 10pg, 3
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68. C 2 rain, a total of 25 cycles.
  • Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 ⁇ g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0145f04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE ; 3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-0145f04) was at 37 in LB liquid medium containing kanamycin (final concentration 30 ⁇ g / ml). C.
  • Polypeptide encoded by the following human mammary gland susceptibility gene was synthesized with a peptide synthesizer (product of PE company) 12. 32 specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ral bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sephar 0S e 4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. 32 ⁇
  • the immunoprecipitation method proved that the purified antibody could specifically bind to the protein 12.32 encoded by the human breast susceptibility gene.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes, and Incubation hybridizes the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-lOmg pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the bag, 68 Q C water Shake for 2 hours.
  • 3-lOmg pre-hybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides are hydrated, dried, and placed in purple Crosslink in Diplomatic Instrument. After elution, the DNA is fixed on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified by Ol igotex mRNA Midi Ki t (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino-propargy 1-2 ⁇ -deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl- 2'- deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Amino-propargy 1-2 ⁇ -deoxyur idine 5'-
  • the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed using a ScaiiArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, Fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardiac cancer. Draw a chart based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . As can be seen from the figure, the protein 12.32 and human BRCA1 protein expression profile encoded by the human breast susceptibility gene according to the present invention are very similar. Industrial applicability
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immune diseases.
  • the breast cancer susceptibility gene (BRCA1) is required for explosive cell proliferation in the early stages of embryonic development. It has the effect of maintaining the stability of the genome.
  • BRCA1 may regulate G2-M checkpoints. It controls the assembly of the mitotic spindle and the correct separation of chromosomes into two daughter cells.
  • the protein encoded by the human breast susceptibility gene has a regulatory effect on cell proliferation in vivo, and its abnormal expression can affect the stability of the human cell genome, leading to the occurrence of gene mutations and then related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human breast cancer susceptibility gene (BRCA1) protein, and both have similar biological functions.
  • BRCA1 human breast cancer susceptibility gene
  • the abnormal expression of the polypeptide of the present invention can affect the regulation of cell proliferation.
  • the abnormal expression of the polypeptide can affect the stability of the human cell genome, lead to the occurrence of gene mutations, and then lead to the development of embryo malformations and tumor diseases. These diseases Including but not limited to: Common embryonic malformations
  • Cleft lip most common, with alveolar clefts and cleft palate
  • cleft palate facial oblique cleft
  • cervical pouch cervical fistula
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger (toe) malformation, horse tellurium varus, etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital apathy, sigmoid colon, impervious anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • neural tube defects no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningocele), hydrocephalus in / outside the brain, etc .
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovarian], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum]
  • malignant melanoma [skin, mucous membrane], (malignant) hydatidiform mole, chorionic epithelial cancer [uterine], (malignant) supporter cells, stromal cell tumor, (malignant) granulosa cell tumor [ovarian, testicular], fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant fetal tumor [ovary, testis, mediastinum and palate tail], etc .;
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as embryonic developmental malformations, tumor diseases, and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the protein encoded by the human breast susceptibility gene 12.32.
  • Agonists increase proteins encoded by human breast susceptibility genes. 12. 32 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a protein encoded by the human breast susceptibility gene 12.32 can be cultured together with a protein encoded by the labeled human breast susceptibility gene 12.32 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the proteins encoded by the human breast susceptibility gene 12.32 include screened antibodies, compounds, receptor deletions, and the like. Antagonist of protein 12.32 encoded by human breast susceptibility gene can bind to protein 12.32 encoded by human breast susceptibility gene and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
  • the protein encoded by the human breast susceptibility gene 12.32 can be added to the bioanalytical assay, and the protein encoded by the compound against the human breast susceptibility gene 12.32 and its receptors can interact with each other. Effect to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to proteins encoded by the human breast susceptibility gene 12.32 can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. When screening, the 12.32 molecules encoded by the human breast susceptibility gene should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the protein 12.32 epitope encoded by the human breast susceptibility gene. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of the protein encoded by the human mammary gland susceptible gene 12.32.
  • Immunized animals such as rabbits, mice, rats, etc.
  • adjuvants including but not Limited to Freund's adjuvant and the like.
  • Preparation of monoclonal antibody against protein 12.32 encoded by human breast susceptibility gene Technologies include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against protein 12.32 encoded by the human breast susceptibility gene.
  • Antibodies against protein 12.32 encoded by human breast susceptibility genes can be used in immunohistochemical techniques to detect protein 12.32 encoded by human breast susceptibility genes in biopsy specimens.
  • Monoclonal antibodies that bind to protein 12.32 encoded by the human breast susceptibility gene can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • the human mammary gland susceptibility gene encodes a protein 12.32.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the protein encoded by the human breast susceptibility gene 12.32 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the protein 12.32 encoded by the human breast susceptibility gene.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of the protein 12.32 encoded by the human breast susceptibility gene.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the 12.32 level of the protein encoded by the human breast susceptibility gene.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of 12.32 protein encoded by the human breast susceptibility gene detected in the test can be used to explain the importance of protein 12.32 encoded by the human breast susceptibility gene in various diseases and to diagnose the protein encoded by the human breast susceptibility gene 12.32. A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding the protein 12.32 encoded by the human breast susceptibility gene can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of protein 12.32 encoded by the human breast susceptibility gene.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express the 12.32 protein encoded by the mutated human breast susceptibility gene to inhibit the activity of the protein 12.32 encoded by the endogenous human breast susceptibility gene.
  • a mutated human breast susceptibility gene encoding protein 12.32 can be a shortened human breast susceptibility group lacking a signaling domain.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of protein 12.32 encoded by the human breast susceptibility gene.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding a protein 12.32 encoded by a human breast susceptibility gene into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a protein 12.32 encoded by a human breast susceptibility gene can be found in the literature (Sambrook, etal.).
  • a recombinant polynucleotide encoding a protein encoded by the human breast susceptibility gene 12.32 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit proteins 12.32 mRNA encoded by human breast susceptibility genes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA and DNA and ribozymes can be obtained by any RNA or DNA synthesis technology. For example, solid-phase phosphate amide chemical synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding the protein 12.32 encoded by the human breast susceptibility gene can be used for diagnosis of diseases related to the protein 12.32 encoded by the human breast susceptibility gene.
  • the polynucleotide encoding the protein 12.32 encoded by the human breast susceptibility gene can be used to detect the expression of the protein 12.32 encoded by the human breast susceptibility gene or the protein encoded by the human breast susceptibility gene 12.32 in a disease state. Abnormal expression.
  • a DNA sequence encoding the protein 12.32 encoded by the human breast susceptibility gene can be used to hybridize biopsy specimens to determine the expression status of the protein II.32 encoded by the human breast susceptibility gene.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip"), and used to analyze differential expression analysis of genes and genetic diagnosis in tissues. .
  • Human breast susceptibility gene 12.32-specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription product of protein 12.32 encoded by human breast susceptibility gene.
  • Detecting mutations in the 12.32 gene encoded by the human breast susceptibility gene can also be used to diagnose the 12.32-related diseases encoded by the human breast susceptibility gene.
  • the human breast susceptibility gene encodes a protein 12.32 mutation that includes point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the 12.32 DM sequence encoded by the normal wild-type human breast susceptibility gene. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l an an inher tance in Man (available online with Johns Hopkins Univer s Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The CDM of the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with 'suitable pharmaceutical carriers.
  • These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the protein encoded by the human breast susceptibility gene 12. 32 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of the protein encoded by the human breast susceptibility gene administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 12.32 de codage de gènes de susceptibilité au cancer du sein, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment malformations apparaissant lors du développement de l'embryon et de maladies tumorales. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine 12.32 de codage de gènes de susceptibilité au cancer du sein.
PCT/CN2001/001005 2000-06-21 2001-06-19 Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide WO2002020576A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295392A AU2001295392A1 (en) 2000-06-21 2001-06-19 A novel polypeptide - homo glandulae mammaria susceptibility gene encoding protein 12.32 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116681.6 2000-06-21
CN 00116681 CN1329089A (zh) 2000-06-21 2000-06-21 一种新的多肽——人乳腺易感基因编码的蛋白12.32和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002020576A1 true WO2002020576A1 (fr) 2002-03-14

Family

ID=4586083

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001005 WO2002020576A1 (fr) 2000-06-21 2001-06-19 Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329089A (fr)
AU (1) AU2001295392A1 (fr)
WO (1) WO2002020576A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DENG WEI ET AL.: "The progress of studying on breast cancer susceptibility genes", THE EVOLUTION OF BIOENGINEERING, vol. 19, no. 1, 1999, pages 13 - 18 *
LAN HAI ET AL.: "The progress of studying on breast cancer susceptibility genes", FOREIGN MEDICINE ONCOLOGY FASCICULE, vol. 26, no. 4, August 1999 (1999-08-01), pages 216 - 218 *
LV YOUYONG ET AL.: "Tumour susceptibility and digestive system tumour susceptibility genes", BASIC MEDICAL SCIENCES AND CLINICS, vol. 19, no. 5, 1999, pages 10 - 16 *

Also Published As

Publication number Publication date
AU2001295392A1 (en) 2002-03-22
CN1329089A (zh) 2002-01-02

Similar Documents

Publication Publication Date Title
WO2002006477A9 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2002020576A1 (fr) Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide
WO2002004504A1 (fr) Nouveau polypeptide, sous-unite humaine 9.46 de proteine g, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002020777A1 (fr) Nouveau polypeptide, proteine myd24.09 de transmission de signaux cellulaires, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002011512A1 (fr) Nouveau polypeptide, proteine mitochondriale de liaison du calcium humaine 10.12, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002012488A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 8.8, et polynucleotide codant ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2002000834A2 (fr) Nouveau polypeptide, proteine phosphatase humaine 9.68, et polynucleotide codant ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2002040524A1 (fr) Nouveau polypeptide, facteur humain 10.78 associe au facteur de croissance des cellules embryonnaires fibreuses de type acide, et polynucleotide codant ce polypeptide
WO2002004634A1 (fr) Nouveau polypeptide, proteine humaine d'apoptose 9.46, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002020582A1 (fr) Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide
WO2002012301A1 (fr) Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide
WO2002012300A1 (fr) Nouveau polypeptide, proteine humaine g29.13 du cycle cellulaire, et polynucleotide codant ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP