WO2002012301A1 - Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002012301A1
WO2002012301A1 PCT/CN2001/000947 CN0100947W WO0212301A1 WO 2002012301 A1 WO2002012301 A1 WO 2002012301A1 CN 0100947 W CN0100947 W CN 0100947W WO 0212301 A1 WO0212301 A1 WO 0212301A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
insulin
growth factor
binding protein
Prior art date
Application number
PCT/CN2001/000947
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU93612/01A priority Critical patent/AU9361201A/en
Publication of WO2002012301A1 publication Critical patent/WO2002012301A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4743—Insulin-like growth factor binding protein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, an insulin-like growth factor binding protein 16.17, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • IGF-II are both mitogenic polypeptides that are structurally and functionally homologous to preproinsulin
  • IGF IGF's regulation of GH growth-promoting effectors in cartilage and other tissues is the focus of biologists' research, and IGF may play a very important role in fetal growth and development at the same time, especially in the central nervous system.
  • IGF has a very strong affinity for many proteins and rarely exists alone. On the cell surface, IGF binds tightly to membrane-bound receptors of IGF-1 and IGF-II, and may also bind to other membrane-bound proteins [De Vrode M, Tseng L, atsoyannis P et al., 1986. J Clin Invest 77: 602-613]. So far, maggots have found specific binding proteins with molecular weights of 150, 30, 53 kDa and other molecular weights from 24 to 160 kDa. All 30 kDa binding proteins have similar amino acid composition, and the first 10 amino acids at the N-terminus are consistent.
  • the IGF-binding protein produced by human HEP G2 hepatocellular carcinoma cells has a molecular weight of 25, 274, and is named IGF BP-25.
  • the IGF-BP complete cDNA has 1553 bp, including 164 bp 5, non-coding region, an 777 bp open reading frame, and a 612 bp 3 'non-coding region, of which 612 bp 3, and the non-coding region has a 3,-poLy (A) A 12 bp adenylation signal upstream of the tail.
  • the 25 amino acid residues at the N-terminus of the IGF-BP protein contain typical split signal peptide components: a N-terminal region with positively charged amino acid residues (S), a hydrophobic central region (8 amino acids), and a C-terminal region of polarity.
  • S positively charged amino acid residues
  • hydrophobic central region 8 amino acids
  • C-terminal region of polarity The mature IGF BP-25 has 234 amino acid residues, and the 59 amino acid residues at the N-terminus form a cysteine-rich region. In this domain, cysteine residues account for 19%, and they The spacing is regular. These cysteine residues play a very important role in the structure and function of the binding protein.
  • the insulin-like growth factor binding protein 16.17 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these
  • the process of insulin is similar to the growth factor binding protein 16.17 protein, especially the amino acid sequence of this protein is identified.
  • New insulin-like growth factor binding protein 16.17 The isolation of the protein-coding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding an insulin-like growth factor binding protein 16.17.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding an insulin-like growth factor binding protein 16.17.
  • Another object of the present invention is to provide a method for producing insulin-like growth factor binding protein 16.17.
  • Another object of the present invention is to provide antibodies against the polypeptide-insulin-like growth factor binding protein 16.17 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-insulin-like growth factor binding protein 16.17 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of insulin-like growth factor binding protein 16.17.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 363 to 806 in SEQ ID NO: 1; and (b) a sequence having 1 to 835 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of insulin-like growth factor binding protein 16.17 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of insulin-like growth factor binding protein 16.17 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the use of the polypeptides and / or polynucleotides of the invention for the manufacture of a medicament for the treatment of cancer, developmental or immune disease or other diseases caused by abnormal expression of insulin-like growth factor binding protein 16.17.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan. '
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides. .
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with insulin-like growth factor binding protein 16.17, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds insulin-like growth factor binding proteins 16.17.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of insulin-like growth factor binding protein 16.17 when combined with insulin-like growth factor binding protein 16.17.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds insulin-like growth factor binding proteins 16.17.
  • Regular refers to a change in the function of insulin-like growth factor binding protein 16.17, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of insulin-like growth factor-binding protein 16.17. Or changes in immune properties.
  • Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify insulin-like growth factor binding proteins
  • Substantially pure insulin-like growth factor binding protein 16. 17 produces a single main band on non-reducing polyacrylamide gels. Insulin-like growth factor binding protein 16.17 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to a polynucleotide that naturally binds by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-CT
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • Homology refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid.
  • the inhibition of such hybridization can be detected by performing hybridization (S 0 uthern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGAL I GN program (La s e r gene sof tware package, DNASTAR, Inc., Madis on Wi s.).
  • the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244).
  • the Clus ter method arranges groups of groups into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X X 1 00 The number of residues in sequence A-the interval residues in sequence A The number of spacer residues in sequence B can also be determined by Clus ter method or by methods known in the art such as: Fotun He in. The percentage identity between nucleic acid sequences (Hein J., (1990) Methods in emzumo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the insulin-like growth factor binding protein 16.17 epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated insulin-like growth factor binding protein 16. 17 refers to insulin-like growth factor-like binding protein 16. 17 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify insulin-like growth factor binding proteins 16.17 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Insulin-like growth factor binding protein 16.17 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide-insulin-like growth factor binding protein 16.17, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the starting methionine residue.
  • the invention also includes fragments, derivatives and analogs of insulin-like growth factor binding protein 16.17.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the insulin-like growth factor binding protein 16.17 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (II I) Such a type in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a type in which the additional amino acid sequence is fused Polypeptide sequences (such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) formed from mature polypeptides are described herein. Such fragments, derivatives and analogs are considered to be within the skill of those skilled in the art. Within knowledge.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 835 bases, and its open reading frames 363-806 encode 147 amino acids.
  • this polypeptide has a similar expression profile to insulin-like growth factor binding protein, and it can be inferred that the insulin-like growth factor-binding protein 1 6. 17 has similar functions to insulin-like growth factor-binding protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be a coding chain or a non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 503 ⁇ 4 (v / v) amide, 0.1% calf serum / 0.1% Fi co ll, 42.
  • hybridized polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-3 G nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding insulin-like growth factor binding protein 16.17.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the insulin-like growth factor binding protein 16.17 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of insulin-like growth factor binding protein transcript 16.17; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • detecting the expression of the insulin-like growth factor binding protein 16.17 gene White products can be used immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Selected and synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cMA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using an insulin-like growth factor binding protein 16.17 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding an insulin-like growth factor binding protein 16.17 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding insulin-like growth factor binding protein 16.17 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce a recombinant insulin-like growth factor binding protein 16.17 (Scence, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of insulin-like growth factor binding protein 16.17 and insulin-like growth factor binding protein of the present invention.
  • the upper graph is a graph of the expression profile of insulin-like growth factor binding protein 16.17
  • the lower graph is the graph of the expression profile of insulin-like growth factor binding protein.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5- Fibrob las t, growth factor stimulation, 1024NT, 6- scar growth into fc Factor stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13- Placenta, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer. .
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated insulin-like growth factor binding protein 16.17. 16kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mMA was isolated from total RNA using Quik mRNA Iso lat ion Kit (product of Qi egene). 2ug po ly (A) mRNA was reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye termina te cycle react ion sequencing kit Perkin-Elmer Hekou ⁇ ⁇ 377
  • An automatic sequencer Perkin-Elmer determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0 843 D (M was new DNA. A series of primers were synthesized to insert the cloned cDNA into the clone. The fragments were measured in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primer 1 5'- CTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGA -3 '(SEQ ID NO: 3)
  • Primer2 5'- ATCCCTTCTGAGCCATCCACCAAG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 leg ol / L KC1, 10 leg ol / L Tris-Cl, (pH8.5), 1.5 ol / L MgCl 2) 200 ⁇ in a reaction volume of 50 ⁇ 1 L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-835bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of the expression of insulin-like growth factor binding protein 16.17 gene: Total UNA was extracted in one step [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidine thiocyanate-chloroform extraction mention.
  • the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained MA precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA was prepared by a random primer method using ⁇ - 32 P dATP.
  • the DNA probe used was the 16.17 coding region sequence (363bp to 806bp) of the PCR-amplified insulin-like growth factor binding protein shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and nitrocellulose
  • the vitamin membrane was hybridized overnight at 42 ° C in a solution containing 50% formamide-25 mM K PO 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 3 Gmin. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant insulin-like growth factor binding protein 16.17
  • Primer 3 5 '-CCCCATATGATGCTCTATTGTAACTGTATGTTT-3' (Seq ID No: 5)
  • Primer4 5 '-CATGGATCCTCAGTGAGTTAGCAACACTATGGA-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively , followeded by the 5 'end of the target gene and
  • the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was performed using the pBS-0843D04 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ containing pBS- 0843D04 plasmid 10 pg, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 m i n, a total of 25 cycles.
  • Nde I and BamH I were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were screened by colony PCR method and sequenced. Positive clone with correct sequence (PET-0843D04)
  • the recombinant plasmid was transformed into E.
  • coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • LB liquid containing kanamycin final concentration 30 ⁇ g / ml
  • IPTG was added to a final concentration of lrmol / L, and the culture was continued for 5 hours.
  • the bacteria were collected by centrifugation, and the bacteria were collected by centrifugation and ultrasonication Chromatography was performed using an His.
  • NH2- et-Leu-Tyr-Cys-Asn-Cys-Met-Phe-Thr-Leu-Leu-Phe-Pro-Gln-Tyr-C00 H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a compound, respectively. See: Avrameas, et al. Immunochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the polypeptide bound to cyanogen bromide-activated S e ph a r0 S e4B column, by affinity chromatography from total IgG isolated anti-polypeptide antibody. Immunoprecipitation showed that the purified antibody could specifically bind to insulin-like growth @ ⁇ Binding protein 16.17.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissues or pathological tissues from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions
  • SEQ ID NO: 1 source sequence region
  • other known genomic sequences and their complementary regions For homology comparison, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • RNA enzyme A was added to the DNA solution to a final concentration of 100ug / ml, 37 D C for 30 minutes.
  • NC membrane nitrocellulose membrane
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or gene microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, please refer to the literature DeRi Si, J. L., Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method steps are widely reported in the literature. The post-spot processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5- Amino- propargyl-2'-deoxyur idine 5'- tr i phate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl -2'-deoxyur idine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare the probe.
  • fluorescent reagent Cy5dUTP (5-Amino-propargyl -2'-deoxyur idine 5'-trip
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion So lut i on (purchased from Te LeChem) hybridization solution for 16 hours, and the washing solution (1 ⁇ SSC, 0.2 was used at room temperature). % SDS) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are processed by Imagene software (Biodicovery, USA) for data analysis, and the Cy3 / Cy5 ratio of each point is calculated.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1 024NT, scar-like fc growth Factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer .
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • IGF Insulin-like growth factor
  • IGF-II are mitogenic polypeptides that are structurally and functionally homologous to preproinsulin, and they have a regulatory effect on GH growth-promoting effectors in cartilage and other tissues. Fetal growth and development play a very important role. IGF has a strong affinity for many proteins and rarely exists alone.
  • IGF insulin-like growth factor binding protein
  • IGF insulin-like growth factor
  • the polypeptide of the present invention affects the physiological function of insulin-like growth factor (UGF) in vivo, and its abnormal expression can affect the regulation of insulin-like growth factor (IGF) on cell proliferation, which in turn leads to embryonic developmental malformations and tumor diseases. Occurs, these diseases include but are not limited to: Common embryonic malformations
  • Cleft lip most common, with alveolar clefts and cleft palate, cleft palate, facial oblique cleft, cervix, cervical fistula, etc .;
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger (toe) malformation, horse tellurium varus etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical diaphragm, congenital umbilical hernia, congenital agangliomegalo colon, impotence of anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • neural tube defects no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polymorphic adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .; 2.
  • Mesenchymal tissue :
  • Lymphoid hematopoietic tissue '
  • Malignant lymphoma [Neck, mediastinum, mesentery, and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / costal / cranium and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used for the treatment of various diseases, especially embryonic malformations and tumor diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) insulin-like growth factor-like binding proteins 16.17.
  • Agonists increase insulin-like growth factor binding protein 16.17 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing insulin-like growth factor binding protein 16.17 can be cultured with labeled insulin-like growth factor binding protein 16.17 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of insulin-like growth factor binding protein 16.17 include selected antibodies, compounds, Receptor deletions and analogs. Antagonists of insulin-like growth factor binding protein 16.17 can bind to insulin-like growth factor-binding protein 16.17 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • insulin-like growth factor binding protein 16.17 can be added to bioanalytical assays to determine whether a compound is Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to insulin-like growth factor binding protein 16.17 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the insulin-like growth factor binding protein 16.17 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the insulin-like growth factor binding protein 16.17 epitope.
  • These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting insulin-like growth factor binding protein 16.17 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing insulin-like growth factor binding protein 16.17 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • the chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Morrison et al, PNAS, 1985 , 81: 6851) 0 Ersi some technical production of single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against insulin-like growth factor binding protein 16.17.
  • Antibodies against insulin-like growth factor binding protein 16.17 can be used in immunohistochemistry to detect insulin-like growth factor binding protein 16.17 in biopsy specimens.
  • Monoclonal antibodies that bind to insulin-like growth factor binding protein 16.17 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • insulin-like growth factor binding protein 16.17 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill insulin-like growth factor binding protein 16.17 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to insulin-like growth factor binding protein 16.17.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of insulin-like growth factor binding protein 16.17.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting insulin-like growth factor binding protein levels of 16.1. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of insulin-like growth factor binding protein 1 6. 1 7 detected in the test can be used to explain the importance of insulin-like growth factor-binding protein 16. 17 in various diseases and to diagnose insulin-like growth factor-binding protein 16 17 diseases at work.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • Polynucleotides encoding insulin-like growth factor binding proteins 16.17 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of insulin-like growth factor binding protein 16.17.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated insulin-like growth factor binding protein 1 6. 1 7 to inhibit endogenous insulin-like growth factor binding protein 16. 17 activity.
  • a variant insulin-like growth factor-binding protein 16. 1 may be a shortened insulin-like growth factor-binding protein 16.17 lacking a signaling domain, although it can bind to downstream substrates, but lacks a signal Conductive activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of insulin-like growth factor binding protein 16.17.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding insulin-like growth factor binding proteins 16.17 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding an insulin-like growth factor binding protein 16.17 can be found in the existing literature (Sanibrook, et al.).
  • recombinant polynucleotides encoding insulin-like growth factor binding protein 16.II can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit insulin-like growth factor binding protein 16.17 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis, which is widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated into the vector Downstream of the RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding insulin-like growth factor binding protein 16.17 can be used for the diagnosis of diseases related to insulin-like growth factor-binding protein 16.17.
  • the polynucleotide encoding insulin-like growth factor binding protein 16. 17 can be used to detect the expression of insulin-like growth factor-binding protein 16.17 or the abnormal expression of insulin-like growth factor-binding protein 16. 17 in a disease state.
  • the DNA sequence encoding insulin-like growth factor-binding protein 16.17 can be used to hybridize biopsy specimens to determine the expression of insulin-like growth factor-binding protein 16.17.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array (Mi croar ray) or a DM chip (also known as a "gene chip"), and used for analyzing differential expression analysis of genes and genetic diagnosis in tissue .
  • Insulin-like growth factor-binding protein 16.17-specific primers can also be used to detect the transcription products of insulin-like growth factor-binding protein 1 6. 17 using RM-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Detecting insulin-like growth factor-binding protein 16.17 mutations can also be used to diagnose insulin-like growth factor-binding protein 16.17-related diseases.
  • Insulin-like growth factor binding protein 1 6. 17 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type insulin-like growth factor-binding protein 16. 17 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Insulin-like growth factor binding protein 16.17 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of amylin-like growth factor binding protein 16.17 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Toxicology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine de liaison 16.17 du facteur de croissance de type insuline, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations lors du développement de l'embryon et de maladies tumorales. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine de liaison 16.17 du facteur de croissance de type insuline.
PCT/CN2001/000947 2000-06-14 2001-06-11 Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide WO2002012301A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU93612/01A AU9361201A (en) 2000-06-14 2001-06-11 A novel polypeptide-insulin-like growth factor binding protein 16.17 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116509.7 2000-06-14
CN00116509A CN1328055A (zh) 2000-06-14 2000-06-14 一种新的多肽——胰岛素类似生长因子结合蛋白16.17和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002012301A1 true WO2002012301A1 (fr) 2002-02-14

Family

ID=4585913

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000947 WO2002012301A1 (fr) 2000-06-14 2001-06-11 Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1328055A (fr)
AU (1) AU9361201A (fr)
WO (1) WO2002012301A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995004076A1 (fr) * 1993-08-02 1995-02-09 Celtrix Pharmaceuticals, Inc. Expression de polypeptides de fusion transportes hors du cytoplasme sans sequence de tete
WO1999032620A1 (fr) * 1997-12-22 1999-07-01 Forssmann Wolf Georg Fragments de proteine liant le facteur de croissance de substances apparentees a l'insuline et leur utilisation
WO2000023469A2 (fr) * 1998-10-16 2000-04-27 Musc Foundation For Research Development Fragments du facteur de croissance proche de l'insuline et de la proteine de fixation du facteur de croissance proche de l'insuline, et utilisations de ces fragments

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995004076A1 (fr) * 1993-08-02 1995-02-09 Celtrix Pharmaceuticals, Inc. Expression de polypeptides de fusion transportes hors du cytoplasme sans sequence de tete
WO1999032620A1 (fr) * 1997-12-22 1999-07-01 Forssmann Wolf Georg Fragments de proteine liant le facteur de croissance de substances apparentees a l'insuline et leur utilisation
WO2000023469A2 (fr) * 1998-10-16 2000-04-27 Musc Foundation For Research Development Fragments du facteur de croissance proche de l'insuline et de la proteine de fixation du facteur de croissance proche de l'insuline, et utilisations de ces fragments

Also Published As

Publication number Publication date
AU9361201A (en) 2002-02-18
CN1328055A (zh) 2001-12-26

Similar Documents

Publication Publication Date Title
WO2002006477A1 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002012301A1 (fr) Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2002012318A1 (fr) Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002012488A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 8.8, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002000823A2 (fr) Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide
WO2002012320A1 (fr) Nouveau polypeptide, proteine humaine 12 liee a tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2002012493A1 (fr) Nouveau polypeptide, proteine de liaison 11.88 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide
WO2001094398A1 (fr) Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide
WO2001094532A2 (fr) Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2002000834A2 (fr) Nouveau polypeptide, proteine phosphatase humaine 9.68, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2002012300A1 (fr) Nouveau polypeptide, proteine humaine g29.13 du cycle cellulaire, et polynucleotide codant ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP