WO2001094398A1 - Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001094398A1
WO2001094398A1 PCT/CN2001/000905 CN0100905W WO0194398A1 WO 2001094398 A1 WO2001094398 A1 WO 2001094398A1 CN 0100905 W CN0100905 W CN 0100905W WO 0194398 A1 WO0194398 A1 WO 0194398A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
insulin
growth factor
binding protein
Prior art date
Application number
PCT/CN2001/000905
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU81696/01A priority Critical patent/AU8169601A/en
Publication of WO2001094398A1 publication Critical patent/WO2001094398A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/65—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, an island-like growth factor binding protein 10.45, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • IGF-1 and IGF-I I are mitogenic polypeptides that are structurally and functionally homologous to preproinsulin [Rinderknecht E, Hurabel R. 1978. J Biol Chem 253: 2769-2776] [Froesch ER , Schmid C et al., Rev Phys iol 47: 443-467]. IGF's regulation of GH growth-promoting effectors in cartilage and other tissues is the focus of research by biologists, and IGF may play a very important role in fetal growth and development, especially in the central nervous system.
  • IGF has a very strong affinity for many proteins and rarely exists alone.
  • IGF binds tightly to the membrane-bound receptors of IGF-1 and IGF-I I, and may also bind to other membrane-bound proteins [De Vrode M, Tseng L, Kat soyannis P et a l., 1986 . J Cl in Inves t 77: 602-613] 0 So far, it has been found a molecular weight of 150, 30, 53kDa, and other molecular weight from 24 to 160 kDa specific protein binding. All 30 kDa binding proteins have similar amino acid composition, and the first 10 amino acids at the N-terminus are consistent.
  • IGF-binding protein produced by human HEP G2 hepatocellular carcinoma cells with a molecular weight of 25, 274, was named IGF BP-25.
  • the IGF-BP complete CDM has 1553 bp, including 164 bp 5, non-coding region, an 777 bp open reading frame, and a 612 bp 3 'non-coding region, of which a 612 bp 3' non-coding region has a 3'-poly (A) 12 bp adenylation signal upstream of the tail.
  • the 25 amino acid residues at the N-terminus of the IGF-BP protein contain a typical split signal peptide component: an N-terminal region with positively charged amino acid residues (8), a hydrophobic central region (S amino acids), and A polar C-terminal region.
  • the mature IGF BP-25 has 234 amino acid residues, and the N-terminal 59 amino acid residues constitute a cysteine-rich region. Within this domain, cysteine residues account for 19%, and their spacing is regular. These cysteine residues play a very important role in the structure and function of the binding protein.
  • the insulin-like growth factor binding protein 10.45 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of Insulin-like growth factor-binding protein 10.45 protein, which is mostly involved in these processes, is particularly identified for the amino acid sequence of this protein.
  • the isolation of the new insulin-like growth factor binding protein 10.45 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding an insulin-like growth factor binding protein 10.45.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding an insulin-like growth factor binding protein 10.45.
  • Another object of the present invention is to provide a method for producing insulin-like growth factor binding protein 10.45.
  • Another object of the present invention is to provide an antibody against the polypeptide-insulin-like growth factor binding protein 10.45 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of insulin-like growth factor binding protein 10.45.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 76 to 363 in SEQ ID NO: 1; and (b) a sequence having 1-1455 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit insulin-like growth factor binding protein 10.45 protein activity, which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of insulin-like growth factor binding protein 10.45 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of insulin-like growth factor binding protein 10.45.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of insulin-like growth factor binding protein 10.45 and insulin-like growth factor binding protein of the present invention.
  • the upper graph is a graph of the expression profile of insulin-like growth factor binding protein 10.45, and the lower graph is the graph of the expression profile of insulin-like growth factor binding protein.
  • 1-bladder mucosa 2-PMA + Ecv ⁇ 4 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6- scar into fc Growth factor stimulation, 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer construct cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13 -Fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated insulin-like growth factor binding protein 10.45.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or MA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Biological activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with an insulin-like growth factor binding protein 10.45, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds insulin-like growth factor binding protein 10.45.
  • Antagonist refers to a biological or immunological activity that can block or modulate insulin-like growth factor binding protein 10.45 when combined with insulin-like growth factor binding protein 10.45.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds insulin-like growth factor binding protein 1.045.
  • Regular refers to changes in the function of insulin-like growth factor binding protein 10.45, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties of insulin-like growth factor-binding protein 10.45, Changes in functional or immune properties.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify insulin-like growth factor binding protein 10.45 using standard protein purification techniques.
  • Substantially pure insulin-like growth factor binding protein 10.45 produces a single main band on a non-reducing polyacrylamide gel.
  • Insulin-like growth factor binding protein 10. 45 Purity of peptides Amino acid sequence analysis is available.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madison Wis.). MEGAUGN The program can compare two or more sequences based on different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by
  • the number of residues in the sequence-the number of spacer residues in the sequence-the number of spacer residues X in the sequence ⁇ can also be determined by the Clus ter method or using methods known in the art such as; iotun Hein to determine the percentage identity between nucleic acid sequences (Hein J ., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? , It can specifically bind to the insulin-like growth factor binding protein 10.45 epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides coexist in a natural state Separated in other materials, it is isolated and purified.
  • isolated insulin-like growth factor binding protein 10. 45 refers to insulin-like growth factor-binding protein 10. 45 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify insulin-like growth factor binding proteins 10.45 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Insulin-like growth factor binding protein 10. 45 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, insulin-like growth factor binding protein 10.45, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of insulin-like growth factor binding protein 10.45.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the insulin-like growth factor binding protein 10.45 of the present invention.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the The amino acid may or may not be encoded by a genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or UII) such a Species, wherein the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
  • conservative amino acid residues preferably conservative amino acid residues
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1455 bases in length and its open reading frame 76-363 encodes 95 amino acids. According to the comparison of gene chip expression profiles, this peptide has a similar expression profile to insulin-like growth factor binding protein, and it can be inferred that the insulin-like growth factor binding protein 10.45 has insulin Similar functions to growth factor binding proteins.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42.
  • Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding insulin-like growth factor binding proteins 10.45.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the insulin-like growth factor binding protein 10.45 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
  • the construction of a CDM library is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spooning Harbor Laboratory. New York, 1989).
  • Commercially available cDM libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RM hybridization; U) the presence or absence of marker gene function; (3) determining the level of insulin-like growth factor binding protein 10.45 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the insulin-like growth factor binding protein 10. 45 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method of amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end amplification method
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various MA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using an insulin-like growth factor binding protein 10.45 coding sequence, and to produce the present invention by recombinant technology Said method of polypeptide.
  • a polynucleotide sequence encoding an insulin-like growth factor binding protein 10.45 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct the recombinant epitope vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples to mention These include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding an insulin-like growth factor binding protein 10.45 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be harvested after exponential growth phase, treated with (] 12 method, the steps used in well known in the art. Alternatively, it is a MgCl 2. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant insulin-like growth factor binding protein 10. 45 (Sc ience, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art.
  • These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • IGF Insulin-like growth factor
  • IGF-II Insulin-like growth factor-1 and IGF-II are both mitogenic polypeptides that are structurally and functionally homologous to preproinsulin. They have regulatory effects on GH growth-promoting effectors in cartilage and other tissues and simultaneously Fetal growth and development play a very important role. IGF has a very strong affinity for many proteins and rarely exists alone.
  • IGF insulin-like growth factor binding protein
  • IGF-like growth factor binding protein is an IGF-specific binding protein, and abnormal expression can affect insulin-like growth factor
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human insulin-like growth factor binding protein, and the two have similar biological functions.
  • the polypeptide of the present invention affects insulin-like growth factor in vivo
  • IGF insulin-like growth factor
  • Cleft lip most common, with alveolar cleft and cleft palate
  • cleft palate oblique cleft face
  • cervical pouch most common, with alveolar cleft and cleft palate
  • oblique cleft face cervical pouch, cervical palate, etc.
  • Absent in longitudinal direction Absence of upper limb radius / ulnar side, lower limb tibia / fibula side, etc .;
  • Limb differentiation disorder Absence of a muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger (toe) deformity, horseshoe varus, etc .;
  • -Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital ganglion-free colon, imperforate anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • neural tube defects no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovarian], basal cell carcinoma [head and facial skin ] (Malignant) Polymorphic adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used for the treatment of various diseases, especially embryonic malformations and tumor diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) insulin-like growth factor-like binding proteins 10.45.
  • Agonists increase insulin-like growth factor binding protein 1 0.45 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing insulin-like growth factor binding protein 1 0.45 can be cultured with labeled insulin-like growth factor binding protein 1 0.45 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of insulin-like growth factor binding protein 1 0.45 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of insulin-like growth factor binding protein 10.45 can bind to insulin-like growth factor-binding protein 10.45 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • insulin-like growth factor-binding protein 10.45 can be added to the bioanalytical assay, and the interaction between the insulin-like growth factor-binding protein 10.45 and its receptor can be determined by determining the compound Influence to determine if a compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to insulin-like growth factor binding protein 10.45 can be obtained by selecting a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally respond to insulin-like growth Factor-binding protein 10.45 molecules are labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against an insulin-like growth factor binding protein 10.45 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting insulin-like growth factor binding protein 10.45 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to insulin-like growth factor binding protein 10.45 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U. S. Pat No. 4946778) can also be used to produce single chain antibodies against insulin-like growth factor binding protein
  • Antibodies against insulin-like growth factor binding protein 10.45 can be used in immunohistochemistry to detect insulin-like growth factor binding protein 10.45 in biopsy specimens.
  • Monoclonal antibodies that bind to insulin-like growth factor binding protein 10.45 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the disulfide exchange. This hybrid antibody can be used to kill insulin-like growth factor binding protein cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to insulin-like growth factor binding protein 10.45.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of insulin-like growth factor binding protein 10.45.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of insulin-like growth factor binding protein 10.45.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of insulin-like growth factor binding protein 10.45 detected in the test can be used to explain the importance of insulin-like growth factor-binding protein 10.45 in various diseases and to diagnose diseases in which insulin-like growth factor-binding protein 10.45 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding insulin-like growth factor binding protein 10.45 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of insulin-like growth factor binding protein 10.45.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated insulin-like growth factor binding protein 10.45 to inhibit endogenous insulin-like growth factor binding protein 10.45 activity.
  • a variant insulin-like growth factor-binding protein 10.45 may be shortened and lack an insulin-like growth factor-binding protein 10.45 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling. active.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of insulin-like growth factor binding protein 10.45.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding insulin-like growth factor binding proteins 10.45 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding insulin-like growth factor binding protein 10.45 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding insulin-like growth factor binding protein 10.45 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit insulin-like growth factor binding protein 10.45 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any of the existing RNA or MA synthesis techniques, such as the solid-phase phosphate amide chemical synthesis method for oligonucleotide synthesis.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding the insulin-like growth factor binding protein 10.45 can be used for the diagnosis of diseases related to the insulin-like growth factor binding protein 10.45.
  • the polynucleotide encoding insulin-like growth factor binding protein 10.45 can be used to detect the expression of insulin-like growth factor binding protein 10.45 and No or abnormal expression of insulin-like growth factor binding protein 10. 45 in disease states.
  • a DNA sequence encoding insulin-like growth factor binding protein 10.45 can be used to hybridize biopsy specimens to determine the expression of insulin-like growth factor binding protein 10.45.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
  • Insulin-like growth factor binding protein 10.45 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect insulin-like growth factor binding protein 10.45 transcription products.
  • Detection of mutations in the insulin-like growth factor binding protein 10.45 gene can also be used to diagnose diseases related to the insulin-like growth factor binding protein 10.45.
  • Insulin-like growth factor binding protein 10.45 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type insulin-like growth factor-binding protein 10.45 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found in 1 ⁇ 1013 1 ;, ⁇ 11 (1611 11 Inheritance in Man (available online with Johns Hopkins University Welch Medica l Library). Then linkage analysis can be used to confirm that genes and genes have been mapped to Relationship between diseases on chromosomal regions.
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist and a carrier and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Insulin-like growth factor binding protein 10. 45 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of insulin-like growth factor binding protein 10.45 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik m NA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDM cloning kit purchased from Clontecti was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDM library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • Primerl 5'- ATAGGTGTGAGCCACTGCGCCCGG -3 '(SEQ ID NO: 3)
  • Primer2 5 — TTTCTTTTTTTTTTTTTTTTTGAGATAGGG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2) 200 mol / L dNTP, lOpmol primer, 1U Taq DM polymerization in 50 ⁇ 1 reaction volume Enzyme (Clontech).
  • the reaction was performed on a PE9600 MA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2tnin.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the results of DM sequence analysis showed that the DNA sequence of the PCR product was exactly the same as the l-1455bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of insulin-like growth factor binding protein 10.45 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] rempliThis method includes acid sulfur Guanidinium cyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50 ° /.
  • Carboxamide -25mM KH 2 P0 4 (pH7. 4) -5> ⁇ 33 (-5 ⁇ 061111 & 1 (11,3 solution and 20 ( ⁇ 8/1111 salmon sperm 1) 1 ⁇ .
  • the filter was 1 X SSC-0.1% SDS was washed at 55 Q C for 30 min. Then, analysis and quantification were performed using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant insulin-like growth factor binding protein 10.45 according to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Pr imer3 5'-CCCCATATGATGGCTCAATGTTACCCACCTCCT-3 '(Seq ID No: 5)
  • Pr imer4 5'-CATGGATCCTCAAATCTGAGAGCACAACACTGT-3' (Seq ID No: 6)
  • the two ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BaraHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the pBS-0612G02 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0612G02 plasmid, 3 ⁇ Primer-3 Primer-4; ⁇ ; Sl ⁇ 0 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0612G02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0612G02) was cultured at 37 ° C to the logarithmic growth phase, and IFTG was added to the final concentration lmoiol / L, and continued Incubate for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation, and the supernatant was collected by centrifugation.
  • An affinity chromatography column His Bind Quick capable of binding to 6 histidines (6His-Tag) was used. 45 ⁇ Cartridge (Novagen company) chromatography, the purified protein of interest similar to insulin-like growth factor binding protein 10.45.
  • a peptide synthesizer (product of PE company) was used to synthesize the following insulin-like growth factor binding protein 10. 45 specific peptides:
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps Off.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-lOrag prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After closing the bag, 68. C water bath for 2 hours.
  • Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRi si, L L., Lyer, V. & Brown, PO (1997) Science 278, 680-686. And Helle, RA, Schema, M. ., Chai, A., Shalom, D.,
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
  • the spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips.
  • the specific method steps have been reported in the literature.
  • the post-spotting processing steps of this embodiment are-. 1. Hydration in a humid environment for 4 hours;
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • Fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5> -triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- Propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissues (or stimulated cell lines) mRM, and the probes were prepared after purification.
  • fluorescent reagent Cy5dUTP (5-Amino- Propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye,
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Iraagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation 1013HT, scar into fc not stimulated with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of insulin-like growth factor binding protein 10.45 and insulin-like growth factor binding protein according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Endocrinology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine de liaison 10.45 du facteur de croissance de type insuline, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations de l'embryon et de tumeurs. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine de liaison 10.45 du facteur de croissance de type insuline.
PCT/CN2001/000905 2000-06-07 2001-06-04 Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide WO2001094398A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU81696/01A AU8169601A (en) 2000-06-07 2001-06-04 A novel polypeptide-homo igf conjugated protein 10.45 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116366.3 2000-06-07
CN 00116366 CN1326978A (zh) 2000-06-07 2000-06-07 一种新的多肽——胰岛素类似生长因子结合蛋白10.45和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001094398A1 true WO2001094398A1 (fr) 2001-12-13

Family

ID=4585770

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000905 WO2001094398A1 (fr) 2000-06-07 2001-06-04 Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1326978A (fr)
AU (1) AU8169601A (fr)
WO (1) WO2001094398A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DU QINGYOU ET AL.: "Progress on the studies of insulin like growth factor binding protein", PROG. BIOCHEM. BIOPHYS., vol. 25, no. 1, 1998, pages 104 - 105 AND 158 *
HUA YIMING ET AL.: "Structure and fuction of IGFBP", UNIVERSITY OF ELECTRIC POWER (NATURAL SCIENCE), vol. 12, no. 2, May 1997 (1997-05-01), pages 219 - 222 *
MIU ZHONGRUI ET AL.: "Effect of insulin-like growth factors(IGFs) and IGF-binding proteins on motility of sperm in vitro", vol. 19, no. 6, 1999, pages 342 - 347 *
SHAO ZHIMIN ET AL.: "GFBP-3 gene expression and estrogen receptor status in human breast carcinoma cell lines and patients specimens", ACTA ACADEMIAE MEDICINAE SHANGHAI, vol. 23, no. 6, November 1996 (1996-11-01), pages 403 - 407 *

Also Published As

Publication number Publication date
AU8169601A (en) 2001-12-17
CN1326978A (zh) 2001-12-19

Similar Documents

Publication Publication Date Title
WO2002006477A9 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2001094398A1 (fr) Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002020777A1 (fr) Nouveau polypeptide, proteine myd24.09 de transmission de signaux cellulaires, et polynucleotide codant ce polypeptide
WO2002012318A1 (fr) Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide
WO2002012320A1 (fr) Nouveau polypeptide, proteine humaine 12 liee a tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2002012301A1 (fr) Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide
WO2002026793A1 (fr) Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide
WO2001064744A1 (fr) Nouveau polypeptide, facteur de croissance du fibroblaste 14, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002000834A2 (fr) Nouveau polypeptide, proteine phosphatase humaine 9.68, et polynucleotide codant ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001096526A2 (fr) Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide
WO2002012315A1 (fr) Nouveau polypeptide, proteine mid1 10.56 du gene de type « ring finger », et polynucleotide codant ce polypeptide
WO2002012313A1 (fr) Nouveau polypeptide, proteine phosphatase humaine 12.43, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP