WO2002004634A1 - Nouveau polypeptide, proteine humaine d'apoptose 9.46, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine d'apoptose 9.46, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002004634A1
WO2002004634A1 PCT/CN2001/000987 CN0100987W WO0204634A1 WO 2002004634 A1 WO2002004634 A1 WO 2002004634A1 CN 0100987 W CN0100987 W CN 0100987W WO 0204634 A1 WO0204634 A1 WO 0204634A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human apoptosis
protein
sequence
Prior art date
Application number
PCT/CN2001/000987
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU93623/01A priority Critical patent/AU9362301A/en
Publication of WO2002004634A1 publication Critical patent/WO2002004634A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human apoptosis-related protein 9.46, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • lymphocytes causes the disappearance of inter-finger (toe) tissues and separates the fingers (toes) from each other;
  • the programmed death of lymphocytes is an important part to ensure that the immune system recognizes itself and foreign components; in spinal animals, more than 70% of potential neuroblasts Death at specific stages of nervous system development, etc.
  • Recent studies have also shown that the inability of some cells in the organism to enter programmed death will lead to the occurrence of malignant diseases such as tumors and cancers in related tissues. Therefore, the programmed cell death plays an important role in the growth and development of various tissues and organs, and it is an important way for the body's own metabolic regulation.
  • RNA recognition domains proteins containing RNA recognition domains (NA recognition motifs, RRMs) are involved in many aspects of RNA metabolism, some of which are essential for normal development.
  • Neuroblas toma apoptos is-related RNA binding protein (NAPOR) is an ELAV-type RNA-binding protein with three characteristic RNP2 / RNP1 RRMs. Genes that are induced during cell tumor apoptosis.
  • mNapor is a type of mouse mNapor protein found in NAP0R in mice. Its open reading frame has 98.5% identity with NAP0R, and also has 80.1% identity with 3, -untranslated regions. The mNapor of the mouse is located at the A2-A3 position of chromosome 2 and combines with the human NAP0R position. The analysis of in situ hybridization experiments showed that the expression profile of mNapor and the occurrence of apoptosis were consistent in space and time. It shows its role in the development of the central nervous system. [Gene 1999 Sep 3; 237 (1): 135- 42]
  • the human apoptosis-related protein 9.46 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human apoptosis-associated protein 9.46 protein involved in these processes, especially the amino acid sequence of this protein is identified.
  • New human apoptosis-related protein 9. 46 The isolation of the protein-coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for the disease, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human apoptosis-related protein 9.46.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human apoptosis-associated protein 9.46.
  • Another object of the present invention is to provide a method for producing a human apoptosis-related protein 9.46.
  • Another object of the present invention is to provide a human apoptosis-related protein directed against the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the human apoptosis-related protein 9.46 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human apoptosis-related protein 9.46.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 268-528 in SEQ ID NO: 1; and (b) a sequence having 1- in SEQ ID NO: 1 21 30-bit sequences.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human apoptosis-associated protein 9.46 protein activity, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of a human apoptosis-related protein 9.46 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human apoptosis-related protein 9.46.
  • Acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include amino acid sequences or nucleotides A deletion, insertion, or substitution of an amino acid or nucleotide in a sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human apoptosis-associated protein 9.46, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to a human apoptosis-related protein 9.46.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human apoptosis-related protein 9.46 when combined with human apoptosis-related protein 9.46 .
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds to human cell death-related proteins 9.46.
  • Regular refers to a change in the function of human apoptosis-related protein 9.46, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human apoptosis-related protein 9.46 Or changes in immune properties.
  • substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances naturally associated with it.
  • Those skilled in the art can use standard protein purification techniques to purify human apoptosis-related proteins 9.46
  • the substantially pure human apoptosis-associated protein 9. 46 can generate a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human apoptosis-associated protein 9. 46 can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Sou thern India Traces or Northern blots). Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method arranges groups of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Cluster method or using methods known in the art such as Jotun He in.
  • the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules. '
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human apoptosis-related protein 9.46.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, the presence of a naturally occurring polynucleotide or polypeptide in a living animal is It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in natural systems.
  • Such a polynucleotide may be part of a vector, or it may be such a polynucleotide Acids or polypeptides are part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human apoptosis-related protein 9. 46 refers to human apoptosis-related protein 9. 46 and is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human apoptosis-related proteins 9.46 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human apoptosis-related protein 9. 46 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human apoptosis-related protein 9.46, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of the human apoptosis-related protein 9.46.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human apoptosis-related protein 9.46 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence or protein used to purify this polypeptide SEQUENCES)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 21 to 30 bases in length, and its open reading frame 268-528 encodes 86 amino acids.
  • this peptide has a similar expression profile with that of mouse mNapor protein, and it can be deduced that the human apoptosis-associated protein 9.46 has similar functions to mouse mNapor protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 701 ⁇ 2 identity, between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences
  • the hybridization occurs only when the identity between them is at least 953 ⁇ 4, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide is identical to the mature polypeptide shown in SEQ ID NO: 2 Biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human apoptosis-associated protein 9.46.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding 9.46 of human apoptosis-related protein of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript level of human apoptosis-related protein 9.46; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product for detecting the expression of the human apoptosis-related protein 9.46 gene may be Immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) are used.
  • Immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) are used.
  • ELISA enzyme-linked immunosorbent assay
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human apoptosis-associated protein 9.46 coding sequence, and a recombinant technology to produce the polypeptide of the present invention method.
  • a polynucleotide sequence encoding a human apoptosis-related protein 9.46 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding human apoptosis-related protein 9.46 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbox Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs late to the origin of replication, polyoma enhancers and adenovirus enhancers to the late side of the replication origin.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human apoptosis-related protein 9.46 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human apoptosis-related proteins 9. 46 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums depending on the host cells used. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
  • the appropriate promoter such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human apoptosis-related protein 9.46 and mouse mNapor protein of the present invention.
  • the upper graph is a graph of the expression profile of human apoptosis-related protein 9. 46, and the lower graph is the graph of the expression profile of mouse mNapor protein.
  • Figure 2 is a polyacrylamide gel electrophoresis image of isolated human apoptosis-related protein 9. 46 (SDS-1)
  • Example 1 Cloning of human apoptosis-related protein 9.46
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0381h05 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the results show that the full-length cDNA contained in the 0381h05 clone is 2130bp (as shown in Seq ID NO: l), and there is a 260bp open reading frame (0RF) from 268bp to 528bp, which encodes a new protein (such as Seq ID NO : Shown in 2). 46.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- GATCCTGGAATTCCAGCCTCAGAA -3 '(SEQ ID NO: 3)
  • Pr imer 2 5'- TCTTGACTAAATCCCTCATGTAAT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting at the lbp at the 5 'end of SEQ ID NO: 1;
  • Pr imer 2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5.5), 1.5 mraol / L MgCl 2 , 200 ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0
  • ⁇ -act in was set as positive during RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2130bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human apoptosis-related protein 9.46 gene expression:
  • RNA extraction in one step [Anal. Biochem. 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was applied on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2 M formaldehyde Line electrophoresis. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR-encoded human apoptosis-related protein 9.46 coding region sequence (268bp to 528bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5xSSC-5xDenhardt, s solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filters were placed in 1 X SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human apoptosis-related protein 9.46
  • Primer3 5'-CCCCATATGATGGAGTTTCGCTCTGTCACCCAG-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCACTCCTGTAATCCCAGCACTTT-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • PCR was performed using the pBS-0381h05 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0381h05 plasmid, primers Primer-3 and Primer_4, and j is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced.
  • the correct positive clone (pET-0381h05) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • Anti-human apoptosis related protein Antibodies produced 09.46 A peptide specific to human apoptosis-related protein 9.46 was synthesized using a peptide synthesizer (product of PE):
  • NH2-Met-Glu-Phe-Arg-Ser-Val-Thr-Gln-Ala-Arg-Val-Gln-Ser-Cys-Asn-COOH SEQ ID NO: 7
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin for methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human apoptosis-associated protein 9.46.
  • Example 6 Use of a polynucleotide fragment of the present invention as a hybrid probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. I. Selection of probes
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the literature DeR isi, JL, Lyer, V.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • the fluorescent reagent Cy 3dUTP (5-Am i no-pr opa r gy 1 -2 ⁇ -deoxyu ridi ne 5 'tr iphate coupled to Cy3 f luorescent dye, purchased from Araersham Phamacia Biotech) was used to label the mRNA of human mixed tissue
  • Cy5dUTP (5—Amino— propargyl— 2'—deoxyur idine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamac ia Biotech) was used to label the mRNA of specific tissues (or stimulated cell lines) in the body
  • Probes were prepared after purification. For specific steps and methods, see:
  • Solut ion (purchased from TeleChem) was used for hybridization for 16 hours. After washing at room temperature with a washing solution (lx SSC, 0.2% SDS), scanning was performed with a ScanArray 3000 scanner (purchased by General Scannin, USA). The image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, and PMA +
  • Ecv304 cell line LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer construct
  • Cell EJ bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunum adenocarcinoma, cardiac cancer.
  • Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) The figure shows the expression of human apoptosis-related protein 9.46 and mouse mNapor protein according to the present invention.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Mouse mNapor protein is a small neuron tumor cell apoptosis-associated RNA binding protein (NAP0R).
  • Murine mNapor protein The former is a gene that is induced to be expressed during the apoptosis of neuroblastoma.
  • the study found that the expression profile of mNa por and the occurrence of apoptosis are consistent in space and time, which indicates its correlation with apoptosis.
  • Abnormal expression of mNapor protein in vivo can affect the process of cell apoptosis, and then lead to the occurrence of related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the mNapor protein, and both have similar biological functions.
  • the polypeptide of the present invention is closely related to cell apoptosis in vivo, and its abnormal expression can affect the process of cell apoptosis. It is well known that cell apoptosis has important biological significance in balancing cell proliferation and regulating the number of cells in the body. The continuous aging, abrasion, aberration, excess, or function that has been completed or turned into harmful cells inside the organism is generally eliminated by cell death; on the other hand, it can be supplemented by cell appreciation. During limb development, embryonic limb buds can develop into normally separated fingers or toes only when certain excess cells die. Autoreactive T, B lymphocytes, or cancerous cells can be eliminated by apoptosis, so cell death is a self-protection mechanism of the body.
  • Disturbances in cell apoptosis can cause various embryonic developmental abnormalities, autoimmune diseases, and tumor diseases. These diseases include, but are not limited to:
  • Cleft lip most common, with alveolar clefts and cleft palate
  • cleft palate most common, with alveolar clefts and cleft palate
  • facial oblique cleft cervical pouch
  • neck Fistula etc.
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder Absence of a muscle or muscle group, poor joint development, bone deformity, bone fusion, multi-finger (toe), and multi-finger (toe) deformity, horse tellurium, etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital agangliomegalo colon, impotence of anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • Neural Tube Defects (Anecephalic Malformation, Spina bifida, Spinal Meningocele, Hydrocephalous Meningocele), Intra- / External Hydrocephalus, etc. Tumors in various tissues
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .; 2.
  • Mesenchymal tissue :
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [vertebrae / thorax / ribs / skull and long bones], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • cell apoptosis is a way of metabolism of human cells, which is related to the aging of the human body, so the protein can be used for human anti-aging research.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cell apoptosis-associated protein 9.46.
  • Agonists increase human apoptosis-related proteins 9. 46 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a human apoptosis-related protein 9.46 can be cultured with a labeled human apoptosis-related protein 9.46 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the human apoptosis-related protein 9.46 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human apoptosis-associated protein 9. 46 can bind to human apoptosis-associated protein 9. 46 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide. The polypeptide cannot perform biological functions.
  • human apoptosis-related protein 9.46 can be added to the organism In the analytical assay, it is determined whether the compound is an antagonist by measuring the effect of the compound on the interaction between human apoptosis-related protein 9.46 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human apoptosis-related protein 9.46 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9.46 molecules of human apoptosis-related protein should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the 9.46 epitope of human apoptosis-related protein. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by directly injecting human apoptosis-related protein 9.46 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies to human apoptosis-related protein 9.46 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human apoptosis-related protein 9.46.
  • Antibodies against human apoptosis-related protein 9. 46 can be used in immunohistochemistry to detect human apoptosis-related protein 9. 46 in biopsy specimens.
  • Monoclonal antibodies that bind to human apoptosis-associated protein 9. 46 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • 46 A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human apoptosis-related proteins 9. 46 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human apoptosis-related protein 9.46.
  • the proper dose of antibody can stimulate or block the production or activity of human apoptosis-related protein 9.46.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human apoptosis-related protein 9.46. Law. These tests are well known in the art and include FI SH assays and radioimmunoassays. 46 The level of human apoptosis-related protein 9.46 detected in the test can be used to explain the importance of human apoptosis-related protein 9. 46 in various diseases and to diagnose human apoptosis-related protein 9. 46 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human apoptosis-related protein 9.46 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human apoptosis-related protein 9.46.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human apoptosis-related proteins 9.46 to inhibit endogenous human apoptosis-related proteins 9.46 activity.
  • a variant of human apoptosis-associated protein 9.46 can be a shortened human apoptosis-associated protein 9.46 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling. active. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of apoptosis-related proteins 9.46.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human apoptosis-related protein 9.46 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human apoptosis-associated protein 9.46 can be found in the literature (Safflbrook, et al.).
  • the polynucleotide encoding human apoptosis-related protein 9.46 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides (including antisense RNA and DNA) that inhibit human apoptosis-related proteins 9.46 raRNA and ribozymes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human apoptosis-associated protein 9. 46 can be used for the diagnosis of diseases related to human apoptosis-associated protein 9. 46.
  • Polynucleotide encoding human apoptosis-related protein 9. 46 can be used for detection Measure the expression of human apoptosis-related protein 9. 46 or the abnormal expression of human apoptosis-related protein 9. 46 in a disease state.
  • the DNA sequence encoding human apoptosis-related protein 9. 46 can be used to hybridize biopsy specimens to determine the expression of human apoptosis-related protein 9. 46.
  • Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mi croar ray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and gene diagnosis .
  • the transcription product of human apoptosis-associated protein 9. 46 can also be detected using RNA-polymerase chain reaction (RT-PCR) in vitro amplification of human apoptosis-associated protein 9.46 specific primers.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of human apoptosis-related proteins 9. 46 gene mutations can also be used to diagnose human apoptosis-related proteins 9. 46-related diseases. Human apoptosis-related protein 9. 46 mutations include point mutations, translocations, deletions, recombination, and any other abnormalities compared to the normal wild-type human apoptosis-related protein 9. 46 DM sequence. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of gene clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include original bait hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human Apoptosis Related Protein 9. 46 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human apoptosis-related protein 9.46 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine d'apoptose 9.46, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations survenant lors du développement de l'embryon, de maladies auto-immunes et de maladies tumorales. Ce polypeptide est également utilisé dans les études menées pour lutter contre la sénilité affectant les personnes âgées. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine d'apoptose 9.46.
PCT/CN2001/000987 2000-06-19 2001-06-18 Nouveau polypeptide, proteine humaine d'apoptose 9.46, et polynucleotide codant ce polypeptide WO2002004634A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU93623/01A AU9362301A (en) 2000-06-19 2001-06-18 A novel polypeptide, a human apoptosis relative protein 9.46 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116590.9 2000-06-19
CN 00116590 CN1329054A (zh) 2000-06-19 2000-06-19 一种新的多肽——人细胞凋亡相关蛋白9.46和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002004634A1 true WO2002004634A1 (fr) 2002-01-17

Family

ID=4585994

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000987 WO2002004634A1 (fr) 2000-06-19 2001-06-18 Nouveau polypeptide, proteine humaine d'apoptose 9.46, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329054A (fr)
AU (1) AU9362301A (fr)
WO (1) WO2002004634A1 (fr)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 16 September 1998 (1998-09-16), Database accession no. AC002468 *
DATABASE GENBANK [online] 18 April 2000 (2000-04-18), Database accession no. AC008521 *
DATABASE GENBANK [online] 22 June 1995 (1995-06-22), Database accession no. M98511.1 *
DATABASE GENBANK [online] 9 October 1999 (1999-10-09), Database accession no. AC007917 *
DATABASE UNKNOWN [online] 17 April 2000 (2000-04-17), retrieved from CNS01DUJ accession no. EMBL Database accession no. AL133246.2 *

Also Published As

Publication number Publication date
CN1329054A (zh) 2002-01-02
AU9362301A (en) 2002-01-21

Similar Documents

Publication Publication Date Title
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002004634A1 (fr) Nouveau polypeptide, proteine humaine d'apoptose 9.46, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2002004504A1 (fr) Nouveau polypeptide, sous-unite humaine 9.46 de proteine g, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002040525A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2002011512A1 (fr) Nouveau polypeptide, proteine mitochondriale de liaison du calcium humaine 10.12, et polynucleotide codant ce polypeptide
WO2002000834A2 (fr) Nouveau polypeptide, proteine phosphatase humaine 9.68, et polynucleotide codant ce polypeptide
WO2002020582A1 (fr) Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2002020576A1 (fr) Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide
WO2002020599A1 (fr) Nouveau polypeptide, isomere humain 19.47 du facteur de regulation et de transcription zmf1, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002012300A1 (fr) Nouveau polypeptide, proteine humaine g29.13 du cycle cellulaire, et polynucleotide codant ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP