WO2002020582A1 - Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide - Google Patents

Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide Download PDF

Info

Publication number
WO2002020582A1
WO2002020582A1 PCT/CN2001/001051 CN0101051W WO0220582A1 WO 2002020582 A1 WO2002020582 A1 WO 2002020582A1 CN 0101051 W CN0101051 W CN 0101051W WO 0220582 A1 WO0220582 A1 WO 0220582A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein
neurofibroma
human
Prior art date
Application number
PCT/CN2001/001051
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002213739A priority Critical patent/AU2002213739A1/en
Publication of WO2002020582A1 publication Critical patent/WO2002020582A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ neurofibroma amplifying protein 9. 24, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • the transcriptional regulatory proteins encoded by the Myc gene family play a role in many aspects of eukaryotic cell function, such as cell cycle regulation, differentiation, and apoptosis.
  • mutations in c-, N-, and L-myc family members can lead to the development of various tumors. These mutations result in the down-regulation of myc expression, which is normally controlled by both transcription and post-transcriptional regulation [Biochim. Biophys. Acta 1 072, 103 (1991)].
  • the myc family genes are expressed in proliferating cells in embryos and adult tissues.
  • N-myc neurofibromatosis amplifying protein
  • NAG neurofibromatosis amplifying protein
  • human neurofibromatosis 9.24 protein regulates cell division and embryonic development. 24 protein, especially identifying this protein, plays an important role in important functions of the body such as education, and it is believed that a large number of proteins are involved in these regulatory processes. Amino acid sequence of several proteins. New human neurofibroma amplification protein 9. 24 The isolation of the protein-coding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human neurofibroma amplifying protein 9.24.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human neurofibroma amplifying protein 9.24.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human neurofibroma amplification protein 9.24.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human neurofibroma amplifying protein 9.24. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human neurofibroma amplifying protein 9.24 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human neurofibroma amplified protein 9.24 protein, which comprises detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human neurofibroma amplifying protein 9. 24 .
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human neurofibroma amplification protein 9. 24 and human neurofibroma amplification protein according to the present invention.
  • the upper graph is a graph of the expression profile of human neurofibroma amplified protein 9. 24, and the lower graph is the graph of the expression profile of human neurofibroma amplified protein.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human neurofibroma amplifying protein 9.24. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino 'acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human neurofibroma amplifying protein 9.24, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to human neurofibroma amplifying protein 9.24.
  • Antagonist refers to a biological or immunological activity that can block or regulate human neurofibroma amplifying protein 9.24 when combined with human neurofibroma amplifying protein 9.24.
  • Molecule Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human neurofibroma amplifying protein 9.24.
  • Regular refers to a change in the function of human neurofibroma amplification protein 9.24, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human neurofibroma amplification protein 9.24 , Functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Matter. Those skilled in the art can use standard protein purification techniques to purify human neurofibroma amplifying protein.
  • Substantially pure human neurofibroma amplification protein 9.24 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human neurofibroma amplifying protein 9. 24 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the dendrite between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , which can specifically bind to the epitope of human neurofibroma amplifying protein 9.24.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human neurofibroma amplifying protein 9. 24 refers to human neurofibroma amplifying protein 9. 24 that is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can purify human neurofibroma amplifying protein using standard protein purification techniques 9.24. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human neurofibroma amplifying protein 9. 24 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human neurofibroma amplification protein 9. 24, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the present invention also includes fragments, derivatives, and analogs of human neurofibroma amplifying protein 9.24.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human neurofibroma amplifying protein 9.24 of the present invention.
  • Polypeptides of the invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may be It may or may not be encoded by a genetic code; or ( ⁇ ) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) such a type Wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader Sequences or secreted sequences or sequences used to purify this polypeptide). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2843 bases, and its open reading frame 846-1100 encodes 84 amino acids.
  • this peptide has a similar expression profile with human neurofibroma amplification protein, and it can be inferred that the human neurofibroma amplification protein 9. 24 has similar functions to human neurofibroma amplification protein.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not Change the function of the polypeptide it encodes.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human neurofibroma amplifying protein 9. 24.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human neurofibroma amplifying protein 9.24 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the D-sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mR from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRM plasmid or phage cDNA library.
  • kits are also commercially available (Qiagene).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of the transcript of human neurofibroma amplifying protein 9.24 Level; (4) through immunological techniques or determination of health Physical activity to detect protein products expressed by genes. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the human neurofibroma amplified protein 9.24 gene expression protein product can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified D / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human neurofibroma amplification protein 9. 24 coding sequence, and the recombinant technology to produce the Said method of polypeptide.
  • a polynucleotide sequence encoding human neurofibroma amplifying protein 9.24 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequences and expression vectors with appropriate transcriptional / translational regulatory elements include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spin Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs at a later stage from the origin of replication, polyoma enhancers and adenovirus enhancers at the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human neurofibroma amplifying protein 9.24 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the 01 12 method, the steps used are well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human neurofibroma amplification protein 9. 24 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Neurofibroma Amplified Protein Gene is a gene that is co-amplified with N-rayc in neurofibromas.
  • the latter belongs to the Myc proto-oncogene family.
  • the family encodes transcriptional regulatory proteins that play a role in many aspects of eukaryotic cell functions, such as cell cycle regulation> differentiation and apoptosis, etc. Therefore, neurofibromatosis amplifying proteins can be considered to regulate cell cycle regulation, differentiation and cells Apoptosis also has regulatory effects. Its abnormal expression can cause the above-mentioned various aspects of regulatory work disorders, and then lead to the occurrence of related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human neurofibroma amplified protein, and both have similar biological functions.
  • the polypeptide of the present invention regulates cell cycle, cell differentiation, and apoptosis processes in vivo. Abnormal expression of the polypeptide can cause disorders such as cell proliferation, immune regulation, etc., and then cause various embryonic developmental abnormalities, autoimmune diseases, and tumor diseases. Occurs, these diseases include but are not limited to: autoimmune diseases I. Connective tissue disease
  • Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder Absence of a muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger (toe) deformity, horseshoe varus, etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital agangliomegalo colon, impotence of anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • Neural Tube Defects (Anecephalic Malformation, Spina bifida, Spinal Meningocele, Hydrocephalous Meningocele), Tumors in / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], myeloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • apoptosis is a way of metabolism of human cells, which is related to human aging. Therefore, this protein can be used in human anti-aging research.
  • the polypeptide of the present invention and the antagonist I agonist and inhibitor of the polypeptide can be directly used in the treatment of various diseases, such as various embryonic developmental abnormalities, autoimmune diseases, tumor diseases, and the like. In addition, it can be used in human anti-aging research.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human neurofibroma amplifying protein 9.24.
  • Agonists increase human neurofibroma amplifying protein 9. 24 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human neurofibroma amplification protein 9.24 can be cultured with labeled human neurofibroma amplification protein 9.24 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human neurofibroma amplifying protein 9. 24 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human neurofibroma amplification protein 9.24 can bind to human neurofibroma amplification protein 9.24 and eliminate its function, or inhibit the production of the polypeptide, or combine with the active site of the polypeptide to make The polypeptide cannot perform biological functions.
  • human neurofibroma amplifying protein 9.24 When screening compounds that act as antagonists, human neurofibroma amplifying protein 9.24 can be added to the bioanalytical assay, and the interaction between human neurofibroma amplifying protein 9.24 and its receptor can be determined by determining the compound Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human neurofibroma amplification protein 9. 24 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 9.24 molecule of human neurofibroma amplification protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human neurofibroma amplifying protein 9.24 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human neurofibromatosis protein 9.24 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human neurofibroma amplifying protein 9.24 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morr i son et al, PNAS, 1985, 81: 6851).
  • the unique technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human neurofibroma amplifying protein 9.24.
  • Antibodies against human neurofibroma amplification protein 9. 24 can be used in immunohistochemical techniques to detect human neurofibroma amplification protein 9.24 in biopsy specimens.
  • Monoclonal antibodies that bind to human neurofibroma amplification protein 9. 24 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body. Such as human neurofibromatosis protein 9.
  • High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human neurofibroma amplifying protein 9. 24 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human neurofibroma amplifying protein 9. 24. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human neurofibroma amplifying protein 9.24.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human neurofibroma amplifying protein 9.24.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human neurofibroma amplification protein 9.24 detected in the test can be used to explain the importance of human neurofibroma amplification protein 9.24 in various diseases and to diagnose human neurofibroma amplification protein 9. 24 diseases at work.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human neurofibroma amplifying protein 9.24 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human neurofibroma amplifying protein 9.24.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human neurofibroma amplification protein 9.24 to inhibit endogenous human neurofibroma amplification protein 9.24 activity.
  • a variant of human neurofibroma amplifying protein 9.24 may be shortened and lack a signal transduction domain of human neurofibroma amplifying protein 9.24. Although it can bind to downstream substrates, it lacks Signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human neurofibroma amplifying protein 9.24.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. are available for transferring a polynucleotide encoding human neurofibroma amplifying protein 9.24 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human neurofibroma amplifying protein 9.24 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human neurofibroma amplification protein 9.24 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human neurofibroma amplification protein 9. 24 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RM, DNA and ribozymes can be obtained by any RNA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis technology has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DM sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human neurofibroma amplification protein 9.24 can be used for the diagnosis of diseases related to human neurofibroma amplification protein 9.24.
  • Polynucleotide encoding human neurofibroma amplification protein 9.24 can be used to detect the expression of human neurofibroma amplification protein 9.24 or abnormal expression of human neurofibroma amplification protein 9.24 in a disease state .
  • the DNA sequence encoding human neurofibroma amplification protein 9. 24 can be used to hybridize biopsy specimens to determine the expression of human neurofibroma amplification protein 9. 24.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes in tissues and gene diagnosis.
  • Human neurofibroma amplification protein 9. 24 can be detected using RM-polymerase chain reaction (RT-PCR) specific primers for in vitro amplification of human neurofibroma amplification protein 9. 24.
  • RT-PCR RM-polymerase chain reaction
  • Human neurofibromatosis 9.24 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human neurofibromatosis 9.24 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so use Nor thern Blotting and Wes tern blotting can indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these D sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cD sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition contains a safe and effective amount of the polypeptide or antagonist and does not affect Pharmaceutically effective carriers and excipients. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human neurofibroma amplifying protein 9. 24 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human neurofibroma amplifying protein 9.24 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDM cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elraer
  • the determined cDM sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDM sequence of one of the clones 0099e06 was a new DM.
  • a series of primers were synthesized to perform bidirectional determination of the inserted cDM fragments contained in this clone.
  • Example 2 Cloning of a Gene Encoding Human Neurofibroma Amplified Protein 9.24 by RT-PCR CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, PCR was performed using the following primers:
  • Primerl 5, — GGAGGGGTAGTGCAGTATTTCTCT —3, (SEQ ID NO: 3)
  • Primer 2 5'- AATTTTTTTAAGTTTTTAATGCTG -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 mmol / LKCl, 10 mmol / L Tris-HCl ⁇ 8.5, 1.5 1.5 ol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2843bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human neurofibroma amplifying protein 9.24 gene expression.
  • One-step extraction of total RNA [Anal. Biochera 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge.
  • the aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a RM precipitate.
  • the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt, s solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human neurofibroma amplification protein 9.24 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Primer 3 5'-CATCCATGGATGTATGAACAAAGAGGCTCAGAG-3 '(Seq ID No: 5)
  • Priraer4 5'-CATGGATCCCCAAGAGTAAACACCGTATTTTC-3 '(Seq ID No: 6)
  • Ncol and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
  • the PCR reaction was performed using the pBS-0099e06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0099e06 plasmid, primers Primer-3 and Primer-4 were added! Was lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 rain, a total of 25 cycles. Ncol and BamHI were used to double-digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into Escherichia coli DH5 ct using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ 8 / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0099e06) with a correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0099e06) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1mmol / L, and continued Incubate for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was subjected to centrifugation, and chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
  • Bind Quick Cartridge product of Novagen capable of binding to 6 histidines (6His-Tag).
  • a peptide synthesizer (product of PE company) was used to synthesize the following human neurofibroma amplification protein 9. 24 specific peptides:
  • polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (myeloid):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (fiber) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • cold homogenization buffer (0.25 raol / L sucrose; 25 leg ol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 oxol / L MgCl 2 ).
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently researching and developing. It refers to the orderly and high density of a large number of target gene fragments. It is arranged on a carrier such as slope glass and silicon, and then the data is compared and analyzed by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and with high throughput.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed on glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5- Amino-propargy 2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amershara Pharaacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl-2 ' -deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe.
  • Cy3dUTP (5- Amino-propargy 2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amers
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). It can be seen from the figure that the expression profile of human neurofibroma amplification protein 9.24 and human neurofibroma amplification protein according to the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau type de polypeptide-la protéine 9.24 amplifiée par neurofibrome HOMO, et un polynucléotide codant ledit polypeptide ainsi qu'un procédé de production dudit polypeptide par génie génétique. L'invention concerne également la méthode d'application du polypeptide au traitement de divers types de maladies telles que la peroplasie de l'embryon, des maladies auto-immunes, la phymatose, et pour étudier la résistance au gâtisme de l'être humain. L'invention a également trait à un antagoniste ainsi qu'à l'utilisation thérapeutique du polypeptide. De plus, elle concerne l'utilisation du polypeptide codant ladite protéine 9.24 amplifiée par neurofibrome HOMO.
PCT/CN2001/001051 2000-06-28 2001-06-25 Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide WO2002020582A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002213739A AU2002213739A1 (en) 2000-06-28 2001-06-25 A novel polypeptide - homo neurofibroma amplified protein 9.24 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116815 CN1331156A (zh) 2000-06-28 2000-06-28 一种新的多肽——人神经纤维瘤扩增蛋白9.24和编码这种多肽的多核苷酸
CN00116815.0 2000-06-28

Publications (1)

Publication Number Publication Date
WO2002020582A1 true WO2002020582A1 (fr) 2002-03-14

Family

ID=4586215

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001051 WO2002020582A1 (fr) 2000-06-28 2001-06-25 Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide

Country Status (3)

Country Link
CN (1) CN1331156A (fr)
AU (1) AU2002213739A1 (fr)
WO (1) WO2002020582A1 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZHU JINGXIAN ET AL.: "The expression of neurofibroma cancer gene protein", CHIN. J. DERMATOLOGY, vol. 30, no. 3, June 1997 (1997-06-01), pages 191 - 192 *

Also Published As

Publication number Publication date
CN1331156A (zh) 2002-01-16
AU2002213739A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002006475A1 (fr) NOUVEAU POLYPEPTIDE, β1-GLYCOPROTEINE SPECIFIQUE DE LA GROSSESSE 9.02, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002020582A1 (fr) Nouveau polypeptide constitue de la proteine 9.24 amplifiee par neurofibrome homo et polynucleotide codant ledit polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2002011512A1 (fr) Nouveau polypeptide, proteine mitochondriale de liaison du calcium humaine 10.12, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2002004634A1 (fr) Nouveau polypeptide, proteine humaine d'apoptose 9.46, et polynucleotide codant ce polypeptide
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002000834A2 (fr) Nouveau polypeptide, proteine phosphatase humaine 9.68, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2002020576A1 (fr) Nouveau polypeptide, proteine humaine 12.32 de codage de genes de susceptibilite au cancer du sein, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP