WO2002040524A1 - Nouveau polypeptide, facteur humain 10.78 associe au facteur de croissance des cellules embryonnaires fibreuses de type acide, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, facteur humain 10.78 associe au facteur de croissance des cellules embryonnaires fibreuses de type acide, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002040524A1
WO2002040524A1 PCT/CN2001/001102 CN0101102W WO0240524A1 WO 2002040524 A1 WO2002040524 A1 WO 2002040524A1 CN 0101102 W CN0101102 W CN 0101102W WO 0240524 A1 WO0240524 A1 WO 0240524A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
fibroblast growth
growth factor
acidic fibroblast
Prior art date
Application number
PCT/CN2001/001102
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2001295414A priority Critical patent/AU2001295414A1/en
Publication of WO2002040524A1 publication Critical patent/WO2002040524A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide—human acidic fibroblast growth factor binding factor 10.78, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • FIBP Human acidic fibroblast growth factor
  • aFGF Human acidic fibroblast growth factor plays a role in stimulating cell division and inducing cell shape change and differentiation in a variety of cells. It functions by binding to receptors.
  • FIBP aFGF intracellular binding protein
  • FIBP is a binding factor for aFGF.
  • FIBP is mainly expressed in the nucleus, and is also present in mitochondria and other membrane structures, such as the endoplasmic reticulum, but in smaller quantities. In cell-free systems, this protein binds to microsomes. Even when microsomes were added to the system after FIBP synthesis, FIBP was able to bind to microsomes, indicating that the protein has affinity with microsomes. In cell-free systems, FIBP bound to microsomes can easily bind to aFGF. .-
  • FIBP FIBP is widely expressed in the human body, but the amount of expression in different tissues varies considerably. It is most abundantly expressed in muscle, brain and pancreas. FIBP is found in the membrane structure of both the cytoplasm and the nucleus, suggesting that it may circulate between these two membrane structures. aFGF may enter the nucleus by combining with FIBP to initiate the synthesis of DM [Biochem 1998], 336, 213-222.
  • the human acidic fibroblast growth factor binding factor 10.78 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art Identification of more human acidic fibroblast growth factor binding factor 10.78 proteins involved in these processes, and in particular the identification of the amino acid sequence of this protein. Isolation of the new acidic fibroblast growth factor binding factor 10.78 protein encoding gene was also identified for the study White's role in health and disease states provides the basis. This protein may constitute a diagnostic and
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human acidic fibroblast growth factor binding factor 10.78.
  • Another object of the present invention is to provide a method for producing human acidic fibroblast growth factor binding factor 10.78.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human acidic fibroblast growth factor binding factor 10.78.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human acidic fibroblast growth factor binding factor 10.78.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human acidic fibroblast growth factor binding factor 10.78. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 584-880 in SEQ ID NO: 1; and (b) a sequence having 1-1966 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention;
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human acidic fibroblast growth factor binding factor 10.78 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human acidic fibroblast growth factor binding factor 10.78 protein in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptide and / or polynucleotide of the invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human acidic fibroblast growth factor binding factor 10.78. the use of.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human acidic fibroblast growth factor binding factor 10.78 and human FIBP protein of the present invention.
  • the upper graph is a graph of the expression profile of human acidic fibroblast growth factor binding factor 10.78
  • the lower graph is the graph of the expression profile of human FIBP protein.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of an isolated human acidic fibroblast growth factor binding factor 10.78.
  • l lkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human acidic fibroblast growth factor binding factor 10.78, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human acidic fibroblast growth factor binding factor 10.78.
  • Antagonist refers to a biological activity that can block or regulate human acidic fibroblast growth factor binding factor 10.78 when combined with human acidic fibroblast growth factor binding factor 10.78 Or immunologically active molecules.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human acidic fibroblast growth factor binding factor 10.78.
  • “Regulation” refers to a change in the function of human acidic fibroblast growth factor binding factor 10.78, including any increase or decrease in protein activity, changes in binding characteristics, and any of human acidic fibroblast growth factor binding factor 10.78. Changes in other biological, functional or immune properties. "Substantially pure” means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. 78. Those skilled in the art can purify human acidic fibroblast growth factor binding factor 10.78 using standard protein purification techniques. Essentially pure human acidic fibroblast growth factor binding factor 10.78 produces a single main band on a non-reducing polyacrylamide gel. The purity of human acidic fibroblast growth factor binding factor 10.78 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the "sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human acidic fibroblast growth factor binding factor 10.78.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human acidic fibroblast growth factor binding factor 10.78 refers to human acidic fibroblast growth factor binding factor 10.78, which is substantially free of other proteins, lipids, and sugars naturally associated with it. Class or other substances. Those skilled in the art can purify human acidic fibroblast growth factor binding factor 1 0.78 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human acidic fibroblast growth factor binding factor 10. 78 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human acidic fibroblast growth factor binding factor 10.78, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, quince, and mammalian cells).
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human acidic fibroblast growth factor binding factor 10.78. As used herein, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of the human acidic fibroblast growth factor binding factor 10.78 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ⁇ ) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1966 bases, and its open reading frames 584-880 encode 98 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with human FIBP protein, and it can be deduced that the human acidic fibroblast growth factor binding factor 10. 78 has similar functions to human FIBP protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • the DM can be a coding chain or a non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be days Naturally occurring allelic or non-naturally occurring variants.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or ( 2 ) Add a denaturant such as 50 when hybridizing. /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human acidic fibroblast growth factor binding factor 10.78.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human acidic fibroblast growth factor binding factor 10.78 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the genome D; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua 1, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries such as different cDNAs from Clontech library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene function; (3) determination of human acidic fibroblast growth factor binding factor 10.78 transcription (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the human acidic fibroblast growth factor binding factor 10.78 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA )Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA )Wait.
  • a method for amplification of DM / RM using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). '' Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human acidic fibroblast growth factor binding factor 10.78, and the present invention is produced by recombinant technology A method of inventing the polypeptide.
  • a polynucleotide sequence encoding a human acidic fibroblast growth factor binding factor 10.78 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Suitable carriers in the present invention include, but are not limited to: T7 promoter-based expression vector expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human acidic fibroblast growth factor binding factor 10.78 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology (Sambroook, et al. Mo lecul ar Cl oning, a Labora tory Manua l, cold Spring Harbor Laboratory. New York, 1989). DM.
  • the sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: E.
  • Expression vectors also include ribosome binding sites and transcription terminators for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are expressed by DM A cis-acting factor, usually about 10 to 300 base pairs, acts on a promoter to enhance gene transcription. Examples include 100-270 bases on the late side of the starting point of the SV40 enhancer, a griefful point late in the replication starting polyoma enhancers, and adenovirus enhancers like.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a gene containing the polynucleotide or the recombinant vector.
  • Engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human acidic fibroblast growth factor binding factor 10. 78 (Science, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant
  • encoding the human acidic fibroblast growth factor binding factor 10.78 of the present invention, or a suitable host cell is transformed or transduced with a recombinant expression vector containing the polynucleotide ;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Human acidic fibroblast growth factor plays a role in stimulating cell division and inducing cell shape changes and differentiation in a variety of human cells. It functions by binding to receptors.
  • Human FIBP protein FGF intracellular binding protein
  • FIBP protein FGF intracellular binding protein
  • Abnormal expression in vivo can cause human aFGF dysfunction, which in turn leads to the occurrence of related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human FIBP protein, both of which have similar biological functions.
  • the polypeptide of the present invention is a human aFGF binding factor in vivo, and its abnormal expression can cause the human aFGF to malfunction, which can lead to the development of embryonic malformations and tumor diseases. These diseases include, but are not limited to:
  • Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.
  • Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
  • Limb differentiation disorder lack of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and (toe) deformity, horseshoe varus, etc .;
  • Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital agangliomegalo colon, impotence of anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc
  • neural tube defects no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
  • hydrocephalus inside / outside the brain, etc.
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, nail [Gonad], Mucinous / serous thyroid adenoma (carcinoma) [Ovary], Basal cell carcinoma [Head and facial skin], (Malignant) Polymorphic adenoma [Extended gland 1, Papilloma, Transitional epithelial cancer [Bladder, Renal pelvis ⁇ Wait;
  • Fibrous (sarcoma) [limbs], (Malignant) fibrohistiocytoma [limbs], lipo (sarcoma) [subcutaneous tissue, lower limbs, retroperitoneum], leiomyosarcoma (uterus and gastrointestinal), striated muscle (Sarcoma) [head and neck, genitourinary tract, limbs], hemangioma (sarcoma), lymphangioma (sarcoma) [skin, subcutaneous tissue, tongue, lips], bone (sarcoma).
  • Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges 1, ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
  • malignant melanoma skin, mucous membrane
  • (malignant) hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .
  • malignant melanoma skin, mucous membrane
  • hydatidiform mole chorionic epithelial cancer [uterine]
  • (malignant) supporter cells stromal cell tumor
  • (malignant) granulosa cell tumor ovarian, testicular] fine Blastoma [testis]
  • asexual cell tumor ovary
  • embryonal cancer testis, ovary
  • (malignant) teratoma
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as embryonic developmental malformations, tumor diseases, and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human acidic fibroblast growth factor binding factor 10.78.
  • Agonists increase human acidic fibroblast growth factor binding factor 10. 78 stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human acidic fibroblast growth factor binding factor 10.78 can be cultured together with labeled human acidic fibroblast growth factor binding factor 10.78 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human acidic fibroblast growth factor binding factor 10.78 include selected antibodies, Compounds, receptor deletions, and the like. Antagonist of human acidic fibroblast growth factor binding factor 10.78 can bind to human acidic fibroblast growth factor binding factor 10.78 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.
  • human acidic fibroblast growth factor binding factor 10.78 can be added to the bioanalytical assay, by measuring the compounds against human acidic fibroblast growth factor binding factor 10.78 and its receptors The effect of this interaction is used to determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human acidic fibroblast growth factor binding factor 10. 78 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human acidic fibroblast growth factor binding factor 10.78 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human acidic fibroblast growth factor binding factor 10.78 epitope. These antibodies include (but are not limited to; polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human acidic fibroblast growth factor binding factor 10.78 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like.
  • Preparation of human acidic fibroblast growth factor binding factor monoclonal antibody 10.78 art including but not limited to the hybridoma technique (Kohler and Mi ls tein Na ture , 1975, 256:. 495-497) 5 three hybridoma technique, the human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • the chimeric human antibody constant region and the variable region of non-human origin may be used in combination Pat some production techniques (Morr i son et al, PNAS , 1985, 81: 6851) 0 only some technical production of single chain antibodies ( ⁇ S. Pat No. 4946778) can also be used to produce single chain antibodies against human acidic fibroblast growth factor binding factor 10.78.
  • Antibodies against human acidic fibroblast growth factor binding factor 10. 78 can be used in immunohistochemical techniques to detect human acidic fibroblast growth factor binding factor 10. 78 in biopsy specimens.
  • Monoclonal antibodies that bind to human acidic fibroblast growth factor binding factor 10. 78 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human acidic fibroblast growth factor binding factor 10. 78. High affinity monoclonal antibodies can interact with bacterial or plant toxins (such as white Laryngeal toxin, ricin, ormosine, etc.) are covalently bound. A common method is to use a thiol crosslinking agent such as
  • SPDP which attacks the amino group of an antibody, binds the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human acidic fibroblast growth factor binding factor 10. 78 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human acidic fibroblast growth factor binding factor 10.78.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human acidic fibroblast growth factor binding factor 10.78.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human acidic fibroblast growth factor binding factor 10.78.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human acidic fibroblast growth factor binding factor 10.78 detected in the test can be used to explain the importance of human acidic fibroblast growth factor binding factor 10.78 in various diseases and to diagnose human acidity A disease where fibroblast growth factor binding factor 10.78 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human acidic fibroblast growth factor binding factor 10.78.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human acidic fibroblast growth factor binding factor 10.78, to inhibit endogenous human acidic fibroblast growth factor binding factor 10.78 activity .
  • a mutated human acidic fibroblast growth factor binding factor 10.78 may be a shortened human acidic fibroblast growth factor binding factor 10.78, although it may be related to the downstream base Binding, but lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human acidic fibroblast growth factor binding factor 10.78.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78 into cells .
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78 can be found in the literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human acidic fibroblast growth factor binding factor 10.78 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA.
  • Antisense RNA and D and ribozymes can be obtained by any RNA or DNA synthesis technology.
  • solid-phase phosphate amide chemical synthesis technology has been widely used in oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DM sequence has been integrated downstream of the MA polymerase promoter of the vector.
  • nucleic acid molecule In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78 can be used for the diagnosis of diseases related to human acidic fibroblast growth factor binding factor 10.78.
  • a polynucleotide encoding human acidic fibroblast growth factor binding factor 10.78 can be used to detect the expression of human acidic fibroblast growth factor binding factor 10.78 or the binding of human acidic fibroblast growth factor in a disease state Abnormal expression of factor 1 0. 78.
  • a DNA sequence encoding human acidic fibroblast growth factor binding factor 10.78 can be used to hybridize biopsy specimens to determine the expression of human acidic fibroblast growth factor binding factor 10.78.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • Human acidic fibroblast growth factor binding factor 10.78 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of human acidic fibroblast growth factor binding factor 10.78.
  • Detection of mutations in the human acidic fibroblast growth factor binding factor 10.78 gene can also be used to diagnose human acidic fibroblast growth factor binding factor 10. 78-related diseases.
  • Human acidic fibroblast growth factor binding factor 1 0.78 mutant forms include point mutations, translocations, deletions, recombination, and any other mutations compared to normal wild-type human acidic fibroblast growth factor binding factor 10.78 DNA sequences Exception, etc. Mutations can be detected using existing techniques such as Southern blotting, MA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human acidic fibroblast growth factor binding factor 10. 78 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human acidic fibroblast growth factor binding factor 10.78 administered to a patient will depend on many factors in the cattle, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik m NA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smar t cDNA cloning kit (purchased from C 1 on t ech) was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 a. The bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 028 Of 05 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDNA was synthesized by reverse transcription reaction using fetal brain cell total R as a template and ol igo-dT as a primer. After purification with Qia gene kit, PCR was performed using the following primers: Primerl: 5,-ACGTAAAAGAGTATTTTAATTCTT -3, (SEQ ID NO: 3)
  • Primer2 5'- ACTGCTAAGTTTCTTTGAAAGTGT -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KCl, I Ckmol / L Tri s-HCl pH 8.5, 1.5 legs ol / L MgCl 2 , 200 ⁇ 1 / dNTP, lOpmol primers, 1 U in a reaction volume of 50 ⁇ 1 Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as 1-1966bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human acidic fibroblast growth factor binding factor 10.78 gene expression
  • RNA containing 20mM 3- (N - morpholino) propanesulfonic acid (P H7 0.) - 5raM sodium acetate -.
  • ImM EDTA-2 2M subjected to electrophoresis on a 1.2% formaldehyde agarose gel . It was then transferred to a nitrocellulose membrane.
  • the 32 P-labeled DM probe was prepared by cc- 32 P dATP by random primer method.
  • the DNA probe used was the PCR amplified human acidic fibroblast growth factor binding factor 10.78 coding region sequence (58 to 880 ⁇ ) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was placed in 1 X SSC-0.1 ° /. SDS at 55 ° C. Wash for 30min. Then, use Phosphor Imager for analysis and quantification.
  • Example 4 Recombinant human acidic fibroblast growth factor binding factor 10.78 in vitro expression, isolation and purification
  • the PCR reaction was performed using the pBS-0280f 05 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0280f05 plasmid, Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Nhel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5 ct using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive colonies were screened by colony PCR and sequenced.
  • a positive clone (pET-0280f 05) with the correct sequence was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method.
  • kanamycin final concentration 3 ( ⁇ g / ml)
  • the host strain BL21 pET-0280f 05
  • IPTG was added to a final concentration of 1 leg ol / L
  • the cells were collected by centrifugation and broken by ultrasound.
  • the supernatant was collected by centrifugation, and the purified target protein was obtained by chromatography using an affinity chromatography column His s.
  • Bind Quick Cartr idge product of Novagen capable of binding to 6 histidines (6His-Tag). Human acidic fibroblast growth factor binding factor 10.78.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 301 ⁇ 2-70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used; 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its alternate fragment (41Nt): '
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene microarrays or DNA microarrays are currently used in many national laboratories and pharmaceutical companies.
  • the companies are starting to develop and develop a new technology. It refers to arranging a large number of target gene fragments in an orderly and high density on a carrier such as glass and silicon, and then using fluorescence detection and computer software to compare and analyze the data.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases, such as genetic diseases .
  • the specific method steps have been reported in the literature.
  • ⁇ ⁇ Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
  • Fluorescent test Cy3dUTP (5-Amino-propargy 1-2'-deoxyur i dine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 -Amino- propargyl-2'-deoxyur idine 5--tr iphate cou led to Cy5 f luorescent dye, purchased from Araersham Phamacia Biotech Company, labeled specific tissues (or stimulated cell lines) m A of the body, prepared after purification Probe.
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and then washed with a washing solution (lx SSC, 0.2 SDS) at room temperature before use.
  • ScanArray 3000 scanner purchased from General Scanning Company, USA was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodicovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Bcv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn (Figure 1). It can be seen from the figure that the expression profile of human acidic fibroblast growth factor binding factor 10.78 and human FIBP protein according to the present invention is very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur humain 10.78 associé au facteur de croissance des cellules embryonnaires fibreuses de type acide, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de malformations apparaissant lors du développement de l'embryon et de maladies tumorales. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant le facteur humain 10.78 associé au facteur de croissance des cellules embryonnaires fibreuses de type acide.
PCT/CN2001/001102 2000-06-30 2001-06-29 Nouveau polypeptide, facteur humain 10.78 associe au facteur de croissance des cellules embryonnaires fibreuses de type acide, et polynucleotide codant ce polypeptide WO2002040524A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295414A AU2001295414A1 (en) 2000-06-30 2001-06-29 A novel polypeptide-homo afgf conjugated factor 10.78 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116924.6 2000-06-30
CN 00116924 CN1331210A (zh) 2000-06-30 2000-06-30 一种新的多肽——人酸性纤维原细胞生长因子结合因子10.78和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002040524A1 true WO2002040524A1 (fr) 2002-05-23

Family

ID=4586323

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001102 WO2002040524A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, facteur humain 10.78 associe au facteur de croissance des cellules embryonnaires fibreuses de type acide, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331210A (fr)
AU (1) AU2001295414A1 (fr)
WO (1) WO2002040524A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), DU H. ET AL., retrieved from GI:4153864 Database accession no. (AC004979) *
DATABASE GENBANK [online] 5 May 1999 (1999-05-05), QUENTIN Y. ET AL., retrieved from GI:113671 Database accession no. (P23964) *

Also Published As

Publication number Publication date
AU2001295414A1 (en) 2002-05-27
CN1331210A (zh) 2002-01-16

Similar Documents

Publication Publication Date Title
WO2002006477A9 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002026812A1 (fr) Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002040524A1 (fr) Nouveau polypeptide, facteur humain 10.78 associe au facteur de croissance des cellules embryonnaires fibreuses de type acide, et polynucleotide codant ce polypeptide
WO2002004504A1 (fr) Nouveau polypeptide, sous-unite humaine 9.46 de proteine g, et polynucleotide codant ce polypeptide
WO2002006335A1 (fr) Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide
WO2002020584A1 (fr) Nouveau polypeptide, proteine humaine de reparation de l'adn 10.23, et polynucleotide codant ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2002026793A1 (fr) Nouveau polypeptide, grande proteine humaine 62, et polynucleotide codant ce polypeptide
WO2002006488A1 (fr) NOUVEAU POLYPEPTIDE, ADN POLYMERASE δ HUMAINE 12.65, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002012488A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 8.8, et polynucleotide codant ce polypeptide
WO2002026792A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 9.24, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2002020599A1 (fr) Nouveau polypeptide, isomere humain 19.47 du facteur de regulation et de transcription zmf1, et polynucleotide codant ce polypeptide
WO2001096526A2 (fr) Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002026969A1 (fr) Nouveau polypeptide, inhibiteur humain 9.13 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide
WO2001094578A1 (fr) Nouveau polypeptide, proteine ubch5 11.44, et polynucleotide codant ce polypeptide
WO2002020780A1 (fr) Nouveau polypeptide, grande proteine humaine 9.13, et polynucleotide codant ce polypeptide
WO2002006472A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.45, et polynucleotide codant ce polypeptide
WO2002020777A1 (fr) Nouveau polypeptide, proteine myd24.09 de transmission de signaux cellulaires, et polynucleotide codant ce polypeptide
WO2002040521A1 (fr) Nouveau polypeptide, inhibiteur humain 9.68 de la sous-unite ac40 d'arn-polymerase adn-dependante, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP