WO2002004507A1 - Nouveau polypeptide, proteine de type histidyl-arnt synthetase 13.2, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine de type histidyl-arnt synthetase 13.2, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002004507A1
WO2002004507A1 PCT/CN2001/000999 CN0100999W WO0204507A1 WO 2002004507 A1 WO2002004507 A1 WO 2002004507A1 CN 0100999 W CN0100999 W CN 0100999W WO 0204507 A1 WO0204507 A1 WO 0204507A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
histidine
trna synthetase
Prior art date
Application number
PCT/CN2001/000999
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU93630/01A priority Critical patent/AU9363001A/en
Publication of WO2002004507A1 publication Critical patent/WO2002004507A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y601/00—Ligases forming carbon-oxygen bonds (6.1)
    • C12Y601/01—Ligases forming aminoacyl-tRNA and related compounds (6.1.1)
    • C12Y601/01021—Histidine-tRNA ligase (6.1.1.21)

Definitions

  • a new peptide a group of aminoacyl-tRNA synthetase-like proteins 13. 2
  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a group of aminoacyl-tRNA synthetase-like proteins 13.2, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • tRM functions to map the codons of the mRNA to the corresponding amino acids. There is no structural correlation between the anti-codon on the tRNA molecule and its corresponding amino acid, and tRM itself cannot catalyze the load of the corresponding amino acid.
  • the reaction that combines tRNA with the corresponding amino acid is the aminoacyl-tRNA synthetase Catalytic.
  • aminoacyl tRNA synthetase synthesizes aminoacyl-tRM in two steps: the amino acid is first activated to aminoacyladenylate, and then aminoacyladenylate and tRNA generate aminoacyl-tRNA.
  • Aminoacyl-tRNA synthetase recognizes different tRNAs through "codons" on the tRNA molecule in order to bind the correct amino acid to the tRNA.
  • Each amino acid corresponds to an aminoacyl-tRNA synthetase, so there are 20 different aminoacyl-tRNA synthetases for 20 amino acids. But these 20 aminoacyl-tRNA synthetases are related to each other. Depending on the structure and sequence, the 20 aminoacyl-tRM synthetases can be divided into two classes, class I and class ⁇ .
  • the catalytic part of Class I enzymes contains a backbone composed of Rossmann folds, which is a type of nucleic acid binding region; the backbone of Class I enzymes consists of a new anti-parallel fold.
  • aminoacyl-tRNA synthetase N-terminal sequences are quite conserved, especially the tetrapeptide sequence H s- l ie- Gly- Hi s C HIGH. This sequence is in arginine, tryptophan, glutamic acid, isoleucine
  • aminoacyl-tRNA synthetases such as lysine, methionine, and tyrosine are found. They are all class I synthetases.
  • Aminoacyl-tRNA synthetases provide usable aminoacyl-tRNA for protein synthesis. If a certain aminoacyl-tRNA synthetase is deleted, the corresponding aminoacyl-tRNA will not be formed properly, resulting in the premature termination of the protein synthesis process and the formation of a non-functional protein. If a certain aminoacyl-tRM synthetase is mutated to recognize another amino acid, the resulting protein contains an incorrect amino acid sequence. If the mutation occurs at an amino acid site that is critical to the function of the protein, then The formed protein will not fold properly without function, or the function is weakened or enhanced, or the functioning substrate is changed to change its function. This functional change often leads to disease.
  • Ras protein is found, and 61 out of 12 Ras
  • the point mutation of the residue, and the replacement of valine by glycine inhibit the activity of Ras itself and GTP enzyme stimulated by GAP, so Ras-GTP cannot be converted into Ras-GDP, resulting in Ras in a long-term active state, without stopping downstream Send out signals, cause abnormal proliferation of cells, and lead to the occurrence of cancer.
  • Mutations in aminoacyl-tRNA synthetase may also cause protein sorting and secretion disorders and dysfunction of membrane receptors, which can cause various endocrine diseases, immune system diseases, and neuromuscular system diseases.
  • histidine-tRNA synthetase-like protein 13.2 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of Many histidine-tRNA synthetases involved in these processes are similar to the protein 13.2 protein, especially the amino acid sequence of this protein is identified.
  • the isolation of the new histidine-tRNA synthetase-like protein 13.2 gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a histidine-tRNA synthetase-like protein 13.2.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a histidine-tRNA synthetase-like protein 13.2.
  • Another object of the present invention is to provide a method for producing a histidine-tRNA synthetase-like protein 13.2.
  • Another object of the present invention is to provide antibodies against a group of aminoacyl-tRM synthetase-like proteins 13.2 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a group of aminoacyl-tRNA synthetase-like proteins 13.2 mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in histidine-tRM synthase-like protein 13.2.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 605-967 in SEQ ID NO: 1; and (b) a sequence having positions 1-1642 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening a compound that mimics, activates, antagonizes or inhibits histidine-tRNA synthetase-like protein 13.2 protein activity, which comprises using the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a histidine-tRNA synthetase-like protein 13.2 protein, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of histidine-tRNA synthetase-like protein 13. 2 the use of.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with a histidine-tRNA synthetase-like protein 13.2, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind a histidine-tRNA synthetase-like protein 1 3.2.
  • Antagonist refers to an organism that blocks or regulates histidine-tRM synthetase-like protein 13.2. When combined with histidine-tRNA synthetase-like protein 13.2 Molecularly active or immunologically active molecule. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind a histidine-tRNA synthetase-like protein 1 3.2.
  • Regular refers to changes in the function of histidine-tMA synthetase-like protein 1 3.2, including an increase or decrease in protein activity, changes in binding characteristics, and histidine-tRNA synthetase-like protein 1 3.2 Of any other biological, functional or immune properties.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify histidine-tRNA synthetase-like proteins using standard protein purification techniques
  • Substantially pure histidine-tRNA synthetase-like protein 1 3.2 in a non-reducing polyacrylamide gel Can produce a single main band. Histidine-tRNA synthetase-like protein 13.2
  • the purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higginis, DG and PM Sharp (1988) Gene 73: 237-244).
  • the C luster method checks all pairs The sequences of each group are arranged into clusters. The clusters are then allocated in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Between sequence A and sequence B The number of matching residues X 100 The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by Cluster method or by methods known in the art such as Jotun He in Percent identity between sequences (He in J., (1990) Methods in emzumo l ogy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the "sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of histidine-t RNA synthetase-like protein 13.2.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated histidine-tRNA synthetase-like protein 1 3.2 means that histidine-tRNA synthetase-like protein 1 3.2 is substantially free of other proteins, lipids, Sugars or other substances.
  • Those skilled in the art can purify histidine-tRNA synthetase-like proteins 13.2 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The histidine-tRNA synthetase-like protein 13.2 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a group of aminoacyl-tRNA synthetase-like proteins 13.2, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives, and analogs of histidine-tRNA synthetase-like protein 13.2.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the histidine-tRNA synthetase-like protein 13.2 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1642 bases, and its open reading frames 605-967 encode 120 amino acids.
  • this peptide has a similar expression profile to the histidine-tRM synthase homologous protein, and it can be inferred that the histidine-tRNA synthetase-like protein 13.2 has histidine-tRNA synthesis Enzyme homologous proteins have similar functions.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • degenerate variant refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID: 2 in the present invention, but differing from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants Body, deletion variant, and insertion variant.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 icoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% It is more preferable that hybridization occurs only when 97% or more. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding histidine-tRNA synthetase-like protein 13.2.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the histidine-tRNA synthetase-like protein 13.2 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene;).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but not (Limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the transcript of histidine-tRNA synthetase-like protein 13.2; (4) by Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunohistochemical techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of histidine-tRNA synthetase-like protein 13.2 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PMS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a histidine-tRM synthetase-like protein 13.2 coding sequence, and the present invention is produced by recombinant technology Methods of the polypeptide.
  • a polynucleotide sequence encoding a histidine-tRNA synthetase-like protein 13.2 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987,
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a histidine-tRM synthetase-like protein 13.2. And appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, etal. Mo l ecul ar Cloning, a Labora tory Manua l, co ld Spr ng Harbor Labora tory. New York, 1989) .
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a histidine-tRNA synthetase-like protein 13.2 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a polynucleotide containing the polynucleotide or the recombinant vector.
  • Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • Competent cells of DNA uptake can be harvested after exponential growth phase, treated with (Method 12, using the procedure well known in the art.
  • 2 method if desired, can be transformed by electroporation of MgCl
  • the following DM transfection methods can be selected: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant histidine-tRM synthetase-like protein 1 3.2 (Scence, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums depending on the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of gene chip expression profiles of histidine-tRM synthetase-like protein 13.2 and histidine-tRNA synthetase homologous protein of the present invention.
  • the upper graph is a histidine-tRNA synthetase-like protein 13. 2 expression profile histogram
  • the lower graph is a histidine-tRNA synthetase-like protein expression profile histogram.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated histidine-tRNA synthetase-like protein 13.2. 13kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit purchased from Clontech was used to insert the 00 ⁇ fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0039a05 was new DNA.
  • a series of primers were synthesized to perform bidirectional determination of the inserted cDM fragments contained in this clone.
  • CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Q i a gene kit, the following primers were used for PCR amplification:
  • Pr imer2 5'- AGACAAAGTCTCACTCTGTCACCC -3, (SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions A reaction volume of 50 ⁇ 1 contains 50 ol / L KC1, 10 ol / L Tr is— CI, (pH 8.5), 1.5mraol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -act in was set as positive during RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1642bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of histidine-tRNA synthetase-like protein 13.2 gene expression: Total RNA was extracted in one step [Anal. Biochem 1987, 162,156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • A- 32 P dATP with 32 ⁇ prepared by random priming Method - labeled DNA probe.
  • the DNA probe used was the PCR amplified histidine-tRNA synthetase-like protein 13.2 coding region sequence (605 to 967 ⁇ ) shown in FIG.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raMKH 2 P0 4 ( ⁇ 4) - 5 xSSC- 5xDenhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant histidine-tRNA synthetase-like protein 13.2
  • Priraer3 5'-CCCCATATGATGAGACTAAGGAATGGACAGCTA-3 '(Seq ID No: 5)
  • Primer4 5 '-CATGGATCCTTAACATAGGGCACAATATAGTCT- 3' (Seq ID No: 6)
  • the 5 ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5, 5 and 3 'ends of the target gene, respectively.
  • the Ndel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • the PCR reaction was performed using the pBS-0039a0 5 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1, 10 pg of plasmid pBS-0039a05, primer Primer-3, and? 1 1: -4 points and other!
  • a peptide synthesizer (product of PE company) was used to synthesize the following histidine-tRNA synthetase-like proteins 13.2 specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ffll bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sephar 0 S e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • Immunoprecipitation demonstrated that the purified antibody could specifically bind to histone-tRNA synthetase-like protein 13.2.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie SBQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free y-dATP) is prepared.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And He l le, RA. Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5- Amino- propargyl- 2'- deoxyuridine 5'- tripliate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5— Amino- propargyl- 2'— deoxyuridine 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP 5- Amino- propargyl- 2'- deoxyuridine 5'- tripliate coupled to Cy3 fluorescent dye (purchased from Amers
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibrobl as t, growth factor stimulation, 1 024NT, Scar into fc growth factor stimulation, 1013HT, Scar into fc without growth factor stimulation, 101 3HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum Adenocarcinoma and cardia cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the histidine-tRNA synthetase-like protein 13.2 and histidine-tRNA synthetase homologous protein expression profiles according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • tRM plays a role in mapping the codons of the mRNA to the corresponding amino acids.
  • the reaction that binds tRNA to the corresponding amino acid is catalyzed by aminoacyl-tRNA synthetase.
  • Aminoacyl-tRNA synthetase provides usable aminoacyl-tRNA for protein synthesis, a process necessary for protein synthesis. Abnormal expression of aminoacyl-tRNA synthetase in vivo can affect protein synthesis, which can lead to the occurrence of related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human histidine-tRM synthetase histidine-tRNA synthetase homologous protein, both of which have similar biological functions.
  • the polypeptide of the present invention provides a usable aminoacyl-tRNA for protein synthesis in the body. This process is necessary for protein synthesis. Abnormal expression can affect the protein synthesis and produce various non-functional or / and abnormal proteins. Causes the occurrence of diseases related to protein metabolism disorders and tumor diseases, including but not limited to: Protein metabolism disorders can affect the following major physiological functions of proteins, which in turn leads to the occurrence of related diseases-.
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .
  • Hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;
  • parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine,
  • Y-aminobutyric acid serotonin, glutamine
  • motion sickness I-type allergic diseases (urticaria, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), high Cholesterolemia (taurine), tumors (polyamines), etc .;
  • Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenoma (carcinoma) [ovarian], basal cell carcinoma [head and face Skin], (malignant) polymorphic adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .; 2.
  • Mesenchymal tissue :
  • Lymphoid hematopoietic tissue ' Malignant lymphoma [neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / costal / cranium and long bone], etc .;
  • Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum]
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) histidine-tRNA synthetase-like protein 1 3.2.
  • Agonists increase histidine-tRM synthetase-like proteins 13.2. They stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing a histidine-tRNA synthetase-like protein 1 3.2 can be cultured together with a labeled histidine-tRNA synthetase-like protein 1 3.2 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of histidine-tRNA synthetase-like proteins 13.2 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of histidine-tRM synthetase-like protein 1 3.2 can bind to histidine-tRNA synthetase-like protein 1 3.2 and eliminate its function. Function, or inhibit the production of the polypeptide, or The active site binding of the polypeptide prevents the polypeptide from performing a biological function.
  • histidine-tRM synthetase-like protein 1 3.2 can be added to the bioanalytical assay, and the histidine-tRNA synthetase-like protein 13.2.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to histidine-tRNA synthetase-like protein 13.2 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. Histidine-tRM synthase Protein-like 13.2 molecules are labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the histidine-tRNA synthetase-like protein 13.2 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting histidine-tRNA synthetase-like protein 13.2 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies against histidine-tRNA synthetase-like protein 13.2 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975,
  • Antibodies against histidine-tRM synthetase-like protein 13.2 can be used in immunohistochemistry to detect histidine-tRNA synthetase-like protein 13.2 in biopsy specimens.
  • Monoclonal antibodies that bind to histidine-tRNA synthetase-like protein 13.2 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • histidine-tRNA synthetase-like protein 13.2 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill histidine-tRNA synthetase-like proteins 13.2 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to histidine-tRNA synthetase-like protein 13.2. Administration of appropriate doses of antibodies can stimulate or block histidine-tRNA synthetase-like proteins
  • the invention also relates to a diagnostic test method for the quantitative and localization of 13.2 levels of histidine-tRNA synthetase-like protein.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • 13.2 levels of histidine-tRNA synthetase-like protein detected in the test which can be used to explain histidine
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzyme, and can be analyzed by one-dimensional or two-dimensional or three-dimensional gel electrophoresis, and more preferably by mass spectrometry encoding A histidine-tRNA synthetase-like polynucleotide of protein 13. 2 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of histidine-tRM synthetase-like protein 13.2.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant histidine-tRNA synthetase-like protein 13.2 to inhibit endogenous histidine-tRNA synthetase-like protein 13.2 activity .
  • a variant histidine-tRNA synthetase-like protein 1 3.2 may be a shortened histidine-tRNA synthetase-like protein 13.2. Substrate binding, but lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of histone-tRNA synthetase-like protein 13.2.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a histidine-tRNA synthetase-like protein 13.2 to a cell Inside.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a histidine-tRNA synthetase-like protein 13.2. can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding a histidine-tRNA synthetase-like protein 13.2 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides for making histidine-tRNA synthetase-like proteins 13.2 mRNA and ribozymes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA and DNA and ribozymes can be obtained by any RNA or DNA synthesis technology. For example, solid-phase phosphate amide chemical synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding histidine-tRNA synthetase-like protein 13.2 can be used for diagnosis of diseases related to histidine-tRNA synthetase-like protein 13.2.
  • Polynucleotides encoding histidine-tRNA synthetase-like protein 13.2 can be used to detect the expression of histidine-tRNA synthetase-like protein 1 3.2 or the disease The abnormal expression of histidine-tRNA synthetase-like protein 13.2.
  • Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, etc. These technologies are publicly available and mature technologies, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Histidine-tRNA synthetase-like protein 13.2 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect histidine-tRNA synthetase-like protein 13. 2 transcription products .
  • Histanoyl-tRNA synthetase-like protein 13.2 mutant forms include point mutations, translocations, deletions, recombinations, and others compared to normal wild-type histidine-tRNA synthetase-like protein 13.2 DNA sequences Any exceptions etc. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR to select somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to locate DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found in, for example, V. Mckus i ck, Mendel i an
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Histidine-tRNA synthetase-like protein 13.2 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of histidine-tRNA synthetase-like protein 13.2 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine de type histidyl-ARNt synthétase 13.2, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies associées aux troubles du métabolisme protéique et de maladies tumorales. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine de type histidyl-ARNt synthétase 13.2.
PCT/CN2001/000999 2000-06-19 2001-06-18 Nouveau polypeptide, proteine de type histidyl-arnt synthetase 13.2, et polynucleotide codant ce polypeptide WO2002004507A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU93630/01A AU9363001A (en) 2000-06-19 2001-06-18 A novel polypeptide - histidyl-trna synthetase-like protein 13.2 and a polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116584.4 2000-06-19
CN 00116584 CN1329141A (zh) 2000-06-19 2000-06-19 一种新的多肽——组氨酰－tRNA合成酶类似蛋白13.2和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002004507A1 true WO2002004507A1 (fr) 2002-01-17

Family

ID=4585988

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000999 WO2002004507A1 (fr) 2000-06-19 2001-06-18 Nouveau polypeptide, proteine de type histidyl-arnt synthetase 13.2, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329141A (fr)
AU (1) AU9363001A (fr)
WO (1) WO2002004507A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014059196A2 (fr) * 2012-10-10 2014-04-17 The Trustees Of Columbia University In The City Of New York Diagnostic et traitement d'un déficit en sma et smn

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BIOL. CHEM., vol. 380, no. 6, 1999, pages 623 - 646 *
NUCLEIC ACIDS RES., vol. 20, no. 5, 1992, pages 1075 - 1081 *
SOMAT. CELL. MOL. GENET., vol. 12, no. 5, 1986, pages 513 - 517 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014059196A2 (fr) * 2012-10-10 2014-04-17 The Trustees Of Columbia University In The City Of New York Diagnostic et traitement d'un déficit en sma et smn
WO2014059196A3 (fr) * 2012-10-10 2014-06-12 The Trustees Of Columbia University In The City Of New York Diagnostic et traitement d'un déficit en sma et smn

Also Published As

Publication number Publication date
CN1329141A (zh) 2002-01-02
AU9363001A (en) 2002-01-21

Similar Documents

Publication Publication Date Title
WO2001094568A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10 de type ii, et polynucleotide codant ce polypeptide
WO2002006334A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.01, et polynucleotide codant ce polypeptide
WO2002004507A1 (fr) Nouveau polypeptide, proteine de type histidyl-arnt synthetase 13.2, et polynucleotide codant ce polypeptide
WO2002006475A1 (fr) NOUVEAU POLYPEPTIDE, β1-GLYCOPROTEINE SPECIFIQUE DE LA GROSSESSE 9.02, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2002004504A1 (fr) Nouveau polypeptide, sous-unite humaine 9.46 de proteine g, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2002048355A1 (fr) Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide
WO2001096526A2 (fr) Nouveau polypeptide, facteur humain 11.77 d'inhibition tumorale, et polynucleotide codant ce polypeptide
WO2002012302A1 (fr) Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2002040523A1 (fr) Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide
WO2002032948A1 (fr) Nouveau polypeptide, proteine humaine de grande taille 10.12, et polynucleotide codant ce polypeptide
WO2002020593A1 (fr) Nouveau polypeptide, antigene stromal de nucleoproteine 115.29, et polynucleotide codant ce polypeptide
WO2002040522A1 (fr) NOUVEAU POLYPEPTIDE, PROTEINE HUMAINE D'ACTIVATION 14.08 DU FACTEUR β DE REGULATION DE LA CROISSANCE ET DE TRANSCRIPTION, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001068877A1 (fr) Nouveau polypeptide, proteine humaine de transport 10 d'acides amines excitateurs, et polynucleotide codant pour ce polypeptide
WO2002002768A1 (fr) Nouveau polypeptide, recepteur peptidique natriuretique humain 9, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP