WO2001094568A1 - Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10 de type ii, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10 de type ii, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001094568A1
WO2001094568A1 PCT/CN2001/000697 CN0100697W WO0194568A1 WO 2001094568 A1 WO2001094568 A1 WO 2001094568A1 CN 0100697 W CN0100697 W CN 0100697W WO 0194568 A1 WO0194568 A1 WO 0194568A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
aminoacyl
trna synthetase
human
Prior art date
Application number
PCT/CN2001/000697
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU70444/01A priority Critical patent/AU7044401A/en
Publication of WO2001094568A1 publication Critical patent/WO2001094568A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human class I I aminoacyl-tRNA synthetase 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • tRM plays a role in mapping the codons of the mRNA to the corresponding amino acids. There is no structural correlation between the anti-codon on the tRNA molecule and its corresponding amino acid, and tRM itself cannot catalyze the load of the corresponding amino acid.
  • the reaction that combines tRM with the corresponding amino acid is the aminoacyl-tRM synthetase Catalytic.
  • aminoacyl tRNA synthetase to synthesize aminoacyl-tRM is divided into two steps: the amino acid is first activated to aminoacyl adenylate, and then aminoacyl adenylate and tRNA generate aminoacyl-tRM.
  • Aminoacyl-tRNA synthetase recognizes different tRNAs through "codons" on the tRM molecule, in order to combine the correct amino acid with tRM.
  • Each amino acid corresponds to an aminoacyl-tRNA synthetase, so there are 20 different aminoacyl-tRNA synthetases for 20 amino acids. But these 20 aminoacyl-tRM synthetases are related to each other. Depending on the structure and sequence, the 20 aminoacyl-tRNA synthetases can be divided into two classes, class I and class I I.
  • the catalytic part of Class I enzymes contains a backbone composed of Rossmann folds, which is a type of nucleic acid binding region; the backbone of Class I enzymes consists of a new antiparallel fold.
  • Aminoacyl-tRNA synthetases provide usable aminoacyl-tRM for protein synthesis. If a certain aminoacyl-tRNA synthetase is deleted, the corresponding aminoacyl-tRM will not be formed correctly, resulting in the premature termination of the protein synthesis process and the formation of non-functional proteins. If a certain aminoacyl-tRNA synthetase is mutated to recognize another amino acid, the resulting protein contains an incorrect amino acid sequence. If the mutation occurs at an amino acid site that is critical to the function of the protein, then The formed protein will not fold properly without function, or the function is weakened or enhanced, or the functioning substrate is changed to change its function. This functional change often leads to disease.
  • Ras protein For example, in 25% -30% of human tumors, abnormal Ras protein is found, and a point mutation of residue 61 at position 12 of Ras is obtained.
  • glycine replaces valine, which inhibits Ras itself and GAP-stimulated GTP. Enzyme activity, therefore, cannot be Ras-GTP into Ras-GDP.
  • Ras is in an active state for a long period of time, sending signals to the downstream without stopping, causing abnormal proliferation of cells, leading to the occurrence of cancer.
  • Mutations in aminoacyl-tRNA synthetase may also cause protein sorting and secretion disorders, and membrane receptor dysfunction, etc., causing various endocrine diseases, immune system diseases, neuromuscular system diseases, and the like.
  • the human class II aminoacyl-tRNA synthetase 10 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, the identification of Many human aminoacyl-tRNA synthetase 10 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new class I class I aminoacyl-tRNA synthetase 10 protein also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its code for DM. Object of the invention
  • An object of the present invention is to provide an isolated novel polypeptide, human class I, aminoacyl-tRNA synthetase 10, and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human class II aminoacyl-tRNA synthetase 10.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, a human class I, aminoacyl-tRNA synthetase 10.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human class II aminoacyl-tRNA synthetase 10. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 28-285 in SEQ ID NO: 1; and (b) a sequence having 1-1177 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human class II aminoacyl-tRNA synthetase 10 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human class II aminoacyl-tRNA synthetase 10 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human class II aminoacyl-tRNA synthetase 10 .
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor's class II aminoacyl-tRNA synthetase 10 and human class II aminoacyl-tRNA synthetase 9.
  • the upper graph is a graph of the expression profile of human class II aminoacyl-t A synthetase 10
  • the lower graph is the graph of the expression profile of human class II aminoacyl-t A synthetase 9.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 represents ECV304 PMA +
  • 11 represents fetal liver
  • 12 represents normal liver
  • 13 represents thyroid
  • 14 represents skin
  • 15 represents fetal lung
  • 16 represents lung
  • 17 represents lung cancer
  • 18 represents fetal spleen
  • 19 represents spleen
  • 20 is the prostate
  • 21 is the fetal heart
  • 22 is the heart
  • 23 is the muscle
  • 24 is the testis
  • 25 is the fetal thymus
  • 26 is the thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human class I and aminoacyl-tRM synthetase 10.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bio activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human class II aminoacyl-tRM synthetase 10, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human class II aminoacyl-tRM synthetase 10.
  • Antagonist refers to a biological or immunological activity that can block or modulate human class II aminoacyl-tRNA synthetase 10 when combined with human class II aminoacyl-tRNA synthetase 10 Molecule.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human class II aminoacyl-tRNA synthetase 10.
  • Regular refers to a change in the function of human class II aminoacyl-tRNA synthetase 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human class II aminoacyl-tRM synthetase 10 , Functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human class II aminoacyl-tRNA synthetase 10 using standard protein purification techniques. Essentially pure human class I I aminoacyl-tRNA synthetase 10 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human class I aminoacyl-tRM synthetase 10 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. Two amino acid sequences such as The percent identity between sequence A and sequence B is calculated by:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as; Totun He in (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? It can specifically bind to the epitope of human class II aminoacyl-tRNA synthetase 10.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human II aminoacyl-tRNA synthetase 10 refers to human class II aminoacyl-tRNA synthetase 10 that is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human class II aminoacyl-tRM complexes using standard protein purification techniques. ⁇ ⁇ 10 ⁇ The enzyme 10. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ⁇ aminoacyl-tRNA synthetase 10 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human class II aminoacyl-tRNA synthetase 10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human class II aminoacyl-tRNA synthetase 10.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human class II aminoacyl-tRNA synthetase 10 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1177 bases, and its open reading frames 28-285 encode 85 amino acids.
  • this polypeptide has a similar expression profile to human class II aminoacyl-tRNA synthetase 9, and it can be inferred that the human class II aminoacyl-tRNA synthetase 10 has human class II aminoacyl-tRM synthesis Enzyme 9 has similar functions.
  • the polynucleotide of the present invention may be in the form of MA or RM.
  • DNA forms include cDNA, genomic DNA or artificially synthesized DNA.
  • DM can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • degenerate variants in the present invention It refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant such as 50 »/ during hybridization.
  • polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human class I, aminoacyl-tRNA synthetase 10.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human II aminoacyl-tRNA synthetase 10 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DM from genomic DNA Sequence; 2) chemically synthesize a DM sequence to obtain double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • fflRM a plasmid or phage cDNA library.
  • kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; ( 2 ) the presence or loss of marker gene function; G) determination of the level of human II aminoacyl-tRNA synthetase 10 transcripts (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by human class I and aminoacyl-tRNA synthetase 10 genes.
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones before they can be spliced. Long CDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human II aminoacyl-tRNA synthetase 10 coding sequence, and to produce the present invention by recombinant technology Said method of polypeptide.
  • Synthetase 10 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human class II aminoacyl-tRNA synthetase 10 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spin Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human II aminoacyl-tRNA synthetase 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human class I aminoacyl-tRNA synthetase 10 (Science, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases Therapy, for example, can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Aminoacyl-tRNA synthetases are essential for proper protein synthesis. Aminoacyl-tRNA synthetase can be used to treat and prevent diseases caused by dysfunction of the endocrine system, immune system and nervous system. It can also be used to treat and prevent cancer.
  • the polypeptide of the present invention or a fragment thereof can be used to treat or prevent diseases caused by abnormal endocrine system, including but not limited to: diabetes insipidus, precocious puberty, diabetes, hypothyroidism, adrenal cortex Incomplete functionality.
  • the polypeptide live fragments of the present invention can be used to treat or prevent diseases caused by disorders of the immune system, including but not limited to: rheumatoid arthritis, chronic active hepatitis, primary dryness syndrome, acute Stammitis, Hemochromatosis, systemic lupus erythematosus, scleroderma, polymyositis, myasthenia gravis, autoimmune hemolytic anemia, immune thrombocytopenic purpura, autoimmune interstitial nephritis, autoimmune heart disease, etc. .
  • diseases caused by disorders of the immune system including but not limited to: rheumatoid arthritis, chronic active hepatitis, primary dryness syndrome, acute Stammitis, Hemochromatosis, systemic lupus erythematosus, scleroderma, polymyositis, myasthenia gravis, autoimmune hemolytic anemia, immune thrombocytopenic purpura, autoimmune inter
  • polypeptides or fragments thereof of the present invention can also be used to treat or prevent diseases caused by nervous system dysfunction, including but not limited to: myasthenia gravis, spinal muscular atrophy, myo-pseudohypertrophy, ankylosal muscular dystrophy, Dystonia, retarded movement, etc.
  • polypeptides or fragments thereof of the present invention can also be used to treat or prevent various cancers. Including but not limited to: Nasal and Sinus Stomach Tumors, Nasopharyngeal Cancer, Laryngeal Cancer, Tracheal Cancer, Lung Cancer, Pleural Mesothelioma;
  • Digestive system tumors salivary gland tumors, esophageal cancer, esophageal leiomyosarcoma, primary esophageal small cell carcinoma, gastric cancer, gastric malignant lymphoma, gastric carcinoid, colorectal cancer, colon cancer, intestinal malignant lymphoma, primary liver cancer, Hepatoblastoma, primary cholangiocarcinoma, pancreatic cancer
  • lymphatic tumors acute leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, malignant lymphoma (such as lymphatic reticulum, malignant lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, etc.), malignant Histiocytosis
  • Nervous system tumors astrocytoma, ependymal tumor, medulloblastoma, meningiomas, glioblastoma, acoustic neuroma, angiogenic tumor, pituitary adenoma, craniopharyngioma
  • tumors osteoid osteoma, osteochondroma, chondroma, osteoblastoma, chondroblastoma, etc.
  • malignant epiphyseal tumors such as giant cell tumor of bone, osteosarcoma, chondrosarcoma, Ewing's sarcoma, myeloma
  • Tumors of the genitourinary system benign tumors such as renal tubular adenoma, eosinophilic adenoma, juxtaglomerular cell tumor, polycystic kidney tumor, seminoma, teratoma, testicular stromal cell tumor, intrauterine Mesenchymal tumor, hydatidiform mole, ovarian tumor, breast fibroma
  • malignant tumors such as renal cell carcinoma, renal sarcomatoid carcinoma, papillary renal cell carcinoma, nephroblastoma, prostate cancer, testicular tumor chorionic carcinoma, epididymal cancer, Cervical cancer
  • Soft tissue tumors fibroma, fibrosarcoma, fibromatosis, lipoma, liposarcoma, leiomyoma, leiomyosarcoma, rhabdomyosarcoma, rhabdomyosarcoma, synovial tissue tumor, hemangioma, intramuscular hemangioma, blood vessels Globuloma, hemangioendothelial sarcoma, lymphangioma, lymphangiomyoma, lymphatic endothelial sarcoma, histiocytoma, malignant fibrous histiocytoma, soft tissue acinar sarcoma, clear cell sarcoma, myxoma, extraosseous Ewing's sarcoma, Soft tissue osteosarcoma, soft tissue chondrosarcoma, mesothelioma, epithelioid sarcoma, schwannomas, neurofibromas, malignant
  • Skin malignancies dermal Mike cell tumor, Kaposi sarcoma, melanoma
  • the invention also provides methods for selecting compounds to identify agents that increase (agonist) or suppress (antagonist) human class II aminoacyl-tRNA synthetase 10.
  • Agonists enhance human II aminoacyl-tRNA synthetase 10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human class II aminoacyl-tRNA synthetase 10 can be cultured with a labeled human class II aminoacyl-tRNA synthetase 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human class II aminoacyl-tRM synthetase 10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human II aminoacyl-tRNA synthetase 10 can bind to human class II aminoacyl-tRNA synthetase 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that The polypeptide cannot perform biological functions.
  • human II aminoacyl-tRNA synthetase 10 When screening compounds that act as antagonists, human II aminoacyl-tRNA synthetase 10 can be added to a bioanalytical assay. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human class II aminoacyl-tRNA synthetase 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 10 molecules of human class I and I aminoacyl-tRNA synthetase should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human class II aminoacyl-tRNA synthetase 10 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and Fab expression Library-generated fragments.
  • Polyclonal antibodies can be produced by injecting human II aminoacyl-tRNA synthetase 10 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • Various adjuvants can be used to enhance the immune response, including but not limited Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human ⁇ aminoacyl-tR synthetase 10 include, but are not limited to, hybridoma technology (Kohler and. Milstein. Nature, 1975, 256: 495- 497), triple tumor technology, human B- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human class II aminoacyl-tRNA synthetase 10.
  • Antibodies against human II aminoacyl-tRNA synthetase 10 can be used in immunohistochemical techniques to detect human II aminoacyl-tRNA synthetase 10 in biopsy specimens.
  • Monoclonal antibodies that bind to human II aminoacyl-tRNA synthetase 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human II aminoacyl-tRM synthase 10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human class II aminoacyl-tRM synthetases 10 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human class II aminoacyl-tRNA synthetase 10.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human class II aminoacyl-tRNA synthetase 10.
  • the present invention also relates to a diagnostic test method for quantitative and localized detection of human class II aminoacyl-tRNA synthetase 10 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human class II aminoacyl-tRNA synthetase 10 detected in the test can be used to explain the importance of human class II aminoacyl-tRNA synthetase 10 in various diseases and to diagnose human class II aminoacyl-tRNA Diseases where Synthetase 10 works.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human II aminoacyl-tRM synthetase 10 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat non-expression or abnormality due to human class II aminoacyl-tRNA synthetase / Cell proliferation, development, or metabolic abnormalities caused by inactive expression.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human II aminoacyl-tRNA synthetase 10 to inhibit endogenous human II aminoacyl-tRNA synthetase 10 activity.
  • a variant human type II aminoacyl-tRM synthetase 10 may be a shortened human type II aminoacyl-tRNA synthetase 10 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks Signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human class II aminoacyl-tRNA synthetase 10.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human class II aminoacyl-tR synthetase 10 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human II aminoacyl-tRNA synthetase 10 can be found in the existing literature (Sarabrook, et al.).
  • a recombinant polynucleotide encoding human class II aminoacyl-tRNA synthetase 10 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human class II aminoacyl-tRM synthetase 10 mRNA and ribozymes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA for endonucleation.
  • Antisense RM, DM and ribozymes can be obtained by any existing RM or DM synthesis technology, such as solid-phase phosphoramidite synthesis of oligonucleotides. Widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human class II aminoacyl-tRNA synthetase 10 can be used for the diagnosis of diseases related to human class II aminoacyl-tRNA synthetase 10.
  • the polynucleotide encoding human class II aminoacyl-tRNA synthetase 10 can be used to detect the expression of human class II aminoacyl-tRM synthetase 10 or the abnormal expression of human class II aminoacyl-tRM synthetase 10 in a disease state .
  • the DM sequence encoding human class II aminoacyl-tRM synthetase 10 can be used to hybridize biopsy specimens to determine the expression status of human class II aminoacyl-tRM synthetase 10.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene analysis of genes in tissues. Due to diagnosis. Human II aminoacyl-tR synthetase 10 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human class II aminoacyl-tRNA synthetase 10 transcription products.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the human class II aminoacyl-tRNA synthetase 10 gene can also be used to diagnose human class I aminoacyl-tRM synthetase 10-related diseases.
  • Forms of human class II aminoacyl-tRNA synthetase 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human class II aminoacyl-tRNA synthetase 10 DNA sequences. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to locate D to a specific chromosome.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cD sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human class II aminoacyl-tRNA synthetase 10 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of human class II aminoacyl-tRNA synthetase 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech
  • DH5 ⁇ was transformed, and the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • CDM The sequence was compared with the existing public DNA sequence database (Genebank), and the cDNA sequence of one of the clones 0304a08 was found to be a new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • RNA of fetal brain cells was used as a template, and ol-igo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA.
  • a Qiagene kit was used. After purification, PCR amplification was performed with the following primers:
  • Pr imer 1 5'- CATTAACACACAGGTACTTTGAAC -3 '(SEQ ID NO: 3)
  • Primer2 5'- AGATATATATCCACTAGTCCCAAC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume containing 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8. 5, 1. 5 mmol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerization Enzyme (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the result of MA sequence analysis showed that the DNA sequence of the PCR product was exactly the same as l-1177bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human class II aminoacyl-tRNA synthetase 10 gene expression Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing.
  • the aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a MA precipitate.
  • the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.
  • 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and The nitrocellulose membrane was hybridized overnight at 42 ° C in a solution containing 50% amidamide-25mM KH 2 P0 4 ( ⁇ 7 ⁇ 4) -5 x SSC- 5 x Denhardt, s solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0. 1% SDS at 55 ° C for 30 min. Then, analysis and quantification were performed using a Phosphor Imager.
  • Example 4 Recombinant human class II aminoacyl-tMA In vitro expression, isolation and purification of Synthetase 10 According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Primer3 5'-CATGCTAGCATGTCTGCAGGTCTGTGTCATTTT-3 '(Seq ID No: 5)
  • Primer4 5' -CATGGATCCTTAGGGATTACTACACCAGGTCCC-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Sex endonuclease site.
  • PCR was performed using the PBS-0304a08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0301 ⁇ 208 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 rain, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 ⁇ ) ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0304a08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human class I and I aminoacyl-tRNA synthetase 10-specific peptides:
  • NH2-Met-Ser-Ala-Gly-Leu-Cys-Hi s-Phe-Ala-I le-Ser-Leu-Gly-Asn-Hi s-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Imraunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human class II aminoacyl-tRNA synthetase 10.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered: 1.
  • the preferred range of probe size is 18-50 nucleotides;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genome sequences and their complement For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (fiber):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • Step ⁇ 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Lysis with cold cells Resuspend pelleted cells in liquid (lx10 8 cells / ml) with a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 7 cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After the sealed bag, 6 8 ° C shaking water bath for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5 '-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl- 2 '-deoxyur idine 5'-tripha te coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech Company, labeled mRM of specific tissues (or stimulated cell lines) of the body, and the probes were prepared after purification.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5 '-tr iphate coupled to Cy3 fluorescent dye
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une aminoacyl-ARNt synthétase humaine 10 de type II, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'aminoacyl-ARNt synthétase humaine 10 de type II.
PCT/CN2001/000697 2000-05-09 2001-05-08 Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10 de type ii, et polynucleotide codant ce polypeptide WO2001094568A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU70444/01A AU7044401A (en) 2000-05-09 2001-05-08 A new polypeptide- human ii class aminoacyl-trna synthetase 10 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115632.2 2000-05-09
CN00115632A CN1322818A (zh) 2000-05-09 2000-05-09 一种新的多肽——人II类氨酰基-tRNA合成酶10和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001094568A1 true WO2001094568A1 (fr) 2001-12-13

Family

ID=4585078

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000697 WO2001094568A1 (fr) 2000-05-09 2001-05-08 Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10 de type ii, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1322818A (fr)
AU (1) AU7044401A (fr)
WO (1) WO2001094568A1 (fr)

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011072265A1 (fr) * 2009-12-11 2011-06-16 Atyr Pharma, Inc. AMINOACYL-ARNt SYNTHÉTASES DESTINÉES À MODULER UNE INFLAMMATION
US8404471B2 (en) 2008-06-26 2013-03-26 Atyr Pharma, Inc. Compositions and methods comprising glycyl-tRNA synthetases having non-canonical biological activities
US8404242B2 (en) 2009-03-16 2013-03-26 Atyr Pharma, Inc. Compositions and methods comprising histidyl-tRNA synthetase splice variants having non-canonical biological activities
US8828395B2 (en) 2009-12-11 2014-09-09 Atyr Pharma, Inc. Antibodies that bind tyrosyl-tRNA synthetases
US8835387B2 (en) 2012-02-16 2014-09-16 Atyr Pharma, Inc. Histidyl-tRNA synthetases for treating autoimmune and inflammatory diseases
US8945541B2 (en) 2010-05-14 2015-02-03 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-tRNA synthetases
US8946157B2 (en) 2010-05-03 2015-02-03 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of seryl-tRNA synthetases
US8961960B2 (en) 2010-04-27 2015-02-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of isoleucyl tRNA synthetases
US8962560B2 (en) 2010-06-01 2015-02-24 Atyr Pharma Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Lysyl-tRNA synthetases
US8961961B2 (en) 2010-05-03 2015-02-24 a Tyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of arginyl-tRNA synthetases
US8969301B2 (en) 2010-07-12 2015-03-03 Atyr Pharma Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of aspartyl-tRNA synthetases
US8981045B2 (en) 2010-05-03 2015-03-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of methionyl-tRNA synthetases
US8980253B2 (en) 2010-04-26 2015-03-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of cysteinyl-tRNA synthetase
US8986680B2 (en) 2010-04-29 2015-03-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Asparaginyl tRNA synthetases
US8986681B2 (en) 2010-04-27 2015-03-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of threonyl-tRNA synthetases
US8993723B2 (en) 2010-04-28 2015-03-31 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of alanyl-tRNA synthetases
US8999321B2 (en) 2010-07-12 2015-04-07 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases
US9029506B2 (en) 2010-08-25 2015-05-12 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of tyrosyl-tRNA synthetases
US9034321B2 (en) 2010-05-03 2015-05-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-alpha-tRNA synthetases
US9034598B2 (en) 2010-05-17 2015-05-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of leucyl-tRNA synthetases
US9034320B2 (en) 2010-04-29 2015-05-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Valyl-tRNA synthetases
US9062302B2 (en) 2010-05-04 2015-06-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of p38 multi-tRNA synthetase complex
US9062301B2 (en) 2010-05-04 2015-06-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutamyl-prolyl-tRNA synthetases
US9068177B2 (en) 2010-04-29 2015-06-30 Atyr Pharma, Inc Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutaminyl-tRNA synthetases
US9422539B2 (en) 2010-07-12 2016-08-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US9453214B2 (en) 2009-02-27 2016-09-27 Atyr Pharma, Inc. Polypeptide structural motifs associated with cell signaling activity
US9499810B2 (en) 2008-06-11 2016-11-22 Atyr Pharma, Inc. Thrombopoietic activity of tyrosyl-tRNA synthetase polypeptides
US9688978B2 (en) 2011-12-29 2017-06-27 Atyr Pharma, Inc. Aspartyl-tRNA synthetase-Fc conjugates
US9714419B2 (en) 2011-08-09 2017-07-25 Atyr Pharma, Inc. PEGylated tyrosyl-tRNA synthetase polypeptides
US9796972B2 (en) 2010-07-12 2017-10-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases
US9816084B2 (en) 2011-12-06 2017-11-14 Atyr Pharma, Inc. Aspartyl-tRNA synthetases
US9822353B2 (en) 2011-12-06 2017-11-21 Atyr Pharma, Inc. PEGylated aspartyl-tRNA synthetase polypeptides
US9896680B2 (en) 2009-03-31 2018-02-20 Atyr Pharma, Inc. Compositions and methods comprising aspartyl-tRNA synthetases having non-canonical biological activities
US10093915B2 (en) 2013-03-15 2018-10-09 Atyr Pharma Inc. Histidyl-tRNA synthetase-Fc conjugates
US10563191B2 (en) 2010-10-06 2020-02-18 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of tryptophanyl tRNA synthetases
US11767520B2 (en) 2017-04-20 2023-09-26 Atyr Pharma, Inc. Compositions and methods for treating lung inflammation

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5798240A (en) * 1994-09-13 1998-08-25 Cubist Pharmaceuticals, Inc. Recombinant mycobacterial methionyl-tRNA synthetase genes and methods of use therefore
US5912140A (en) * 1995-04-03 1999-06-15 Cubist Pharmaceuticals, Inc. Recombinant pneumocystis carinii aminoacyl tRNA synthetase genes, tester strains and assays

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5798240A (en) * 1994-09-13 1998-08-25 Cubist Pharmaceuticals, Inc. Recombinant mycobacterial methionyl-tRNA synthetase genes and methods of use therefore
US5912140A (en) * 1995-04-03 1999-06-15 Cubist Pharmaceuticals, Inc. Recombinant pneumocystis carinii aminoacyl tRNA synthetase genes, tester strains and assays

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CRUZEN M.E. AND ARFIN S.M.: "Nucleotide and deduced amino acid sequence of human threonyl-tRNA synthetase reveals extensive homology to the escherichia coli and yeast enzymes", J. BIOL. CHEM., vol. 266, no. 15, 1991, pages 9919 - 9923 *
SULSTON J.E. AND WATERSTON R.: "Toward a complete human genome sequence", GENOME RES., vol. 8, no. 1, 1998, pages 1097 - 1108 *
VINCENT C., TARBOURIECH N. AND HARTLEIN M.: "Genomic organization, cDNA sequence, bacterial expression and purification of human seryl-tRNA synthase", EUR. J. BIOCHEM., vol. 250, no. 1, 1997, pages 77 - 84 *

Cited By (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9499810B2 (en) 2008-06-11 2016-11-22 Atyr Pharma, Inc. Thrombopoietic activity of tyrosyl-tRNA synthetase polypeptides
US9585946B2 (en) 2008-06-26 2017-03-07 Atyr Pharma, Inc. Compositions and methods comprising glycyl-tRNA synthetases having non-canonical biological activities
US8404471B2 (en) 2008-06-26 2013-03-26 Atyr Pharma, Inc. Compositions and methods comprising glycyl-tRNA synthetases having non-canonical biological activities
US9157076B2 (en) 2008-06-26 2015-10-13 Atyr Pharma, Inc. Compositions and methods comprising glycyl-tRNA synthetases having non-canonical biological activities
US8747840B2 (en) 2008-06-26 2014-06-10 Atyr Pharma, Inc. Compositions and methods comprising glycyl-tRNA synthetases having non-canonical biological activities
US9453214B2 (en) 2009-02-27 2016-09-27 Atyr Pharma, Inc. Polypeptide structural motifs associated with cell signaling activity
US9605265B2 (en) 2009-03-16 2017-03-28 Atyr Pharma, Inc. Compositions and methods comprising histidyl-tRNA synthetase splice variants having non-canonical biological activities
US11078299B2 (en) 2009-03-16 2021-08-03 Atyr Pharma, Inc. Compositions and methods comprising histidyl-tRNA synthetase splice variants having non-canonical biological activities
US10526419B2 (en) 2009-03-16 2020-01-07 Atyr Pharma, Inc. Compositions and methods comprising histidyl-tRNA synthetase splice variants having non-canonical biological activities
US8404242B2 (en) 2009-03-16 2013-03-26 Atyr Pharma, Inc. Compositions and methods comprising histidyl-tRNA synthetase splice variants having non-canonical biological activities
US10941214B2 (en) 2009-03-16 2021-03-09 Atyr Pharma, Inc. Compositions and methods comprising histidyl-tRNA synthetase splice variants having non-canonical biological activities
US10017582B2 (en) 2009-03-16 2018-07-10 Atyr Pharma, Inc. Compositions and methods comprising histidyl-trna synthetase splice variants having non-canonical biological activities
US9896680B2 (en) 2009-03-31 2018-02-20 Atyr Pharma, Inc. Compositions and methods comprising aspartyl-tRNA synthetases having non-canonical biological activities
US9943577B2 (en) 2009-12-11 2018-04-17 Atyr Pharma, Inc. Aminoacyl tRNA synthetases for modulating inflammation
US9127268B2 (en) 2009-12-11 2015-09-08 Atyr Pharma, Inc. Aminoacyl tRNA synthetases for modulating inflammation
AU2014210626B2 (en) * 2009-12-11 2017-02-16 Atyr Pharma, Inc Aminoacyl trna synthetases for modulating inflammation
US9540628B2 (en) 2009-12-11 2017-01-10 Atyr Pharma, Inc. Aminoacyl tRNA synthetases for modulating inflammation
US8828395B2 (en) 2009-12-11 2014-09-09 Atyr Pharma, Inc. Antibodies that bind tyrosyl-tRNA synthetases
US9328340B2 (en) 2009-12-11 2016-05-03 Atyr Pharma, Inc. Amino acyl tRNA synthetases for modulating inflammation
WO2011072265A1 (fr) * 2009-12-11 2011-06-16 Atyr Pharma, Inc. AMINOACYL-ARNt SYNTHÉTASES DESTINÉES À MODULER UNE INFLAMMATION
US8980253B2 (en) 2010-04-26 2015-03-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of cysteinyl-tRNA synthetase
US10030077B2 (en) 2010-04-26 2018-07-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of cysteinyl-tRNA synthetase
US10717786B2 (en) 2010-04-26 2020-07-21 aTye Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Cysteinyl-tRNA synthetase
US10150958B2 (en) 2010-04-27 2018-12-11 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of threonyl-tRNA synthetases
US10563192B2 (en) 2010-04-27 2020-02-18 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of threonyl-tRNA synthetases
US8986681B2 (en) 2010-04-27 2015-03-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of threonyl-tRNA synthetases
US9896515B2 (en) 2010-04-27 2018-02-20 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of isoleucyl tRNA synthetases
US9528103B2 (en) 2010-04-27 2016-12-27 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of isoleucyl tRNA synthetases
US8961960B2 (en) 2010-04-27 2015-02-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of isoleucyl tRNA synthetases
US8993723B2 (en) 2010-04-28 2015-03-31 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of alanyl-tRNA synthetases
US9034320B2 (en) 2010-04-29 2015-05-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Valyl-tRNA synthetases
US9623093B2 (en) 2010-04-29 2017-04-18 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of asparaginyl tRNA synthetases
US8986680B2 (en) 2010-04-29 2015-03-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Asparaginyl tRNA synthetases
US9068177B2 (en) 2010-04-29 2015-06-30 Atyr Pharma, Inc Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutaminyl-tRNA synthetases
US10189911B2 (en) 2010-04-29 2019-01-29 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Valyl-tRNA synthetases
US10179906B2 (en) 2010-05-03 2019-01-15 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-alpha-tRNA synthetases
US9340780B2 (en) 2010-05-03 2016-05-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of seryl-tRNA synthetases
US8961961B2 (en) 2010-05-03 2015-02-24 a Tyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of arginyl-tRNA synthetases
US9034321B2 (en) 2010-05-03 2015-05-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-alpha-tRNA synthetases
US8946157B2 (en) 2010-05-03 2015-02-03 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of seryl-tRNA synthetases
US8981045B2 (en) 2010-05-03 2015-03-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of methionyl-tRNA synthetases
US9593323B2 (en) 2010-05-03 2017-03-14 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-alpha-tRNA synthetases
US10160814B2 (en) 2010-05-04 2018-12-25 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutamyl-prolyl-tRNA synthetases
US9062301B2 (en) 2010-05-04 2015-06-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutamyl-prolyl-tRNA synthetases
US9062302B2 (en) 2010-05-04 2015-06-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of p38 multi-tRNA synthetase complex
US9404104B2 (en) 2010-05-04 2016-08-02 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of P38 multi-tRNA synthetase complex
US10220080B2 (en) 2010-05-14 2019-03-05 aTyr Pharam, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-tRNA synthetases
US9687533B2 (en) 2010-05-14 2017-06-27 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-tRNA synthetases
US8945541B2 (en) 2010-05-14 2015-02-03 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-tRNA synthetases
US10179908B2 (en) 2010-05-17 2019-01-15 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of leucyl-tRNA synthetases
US9790482B2 (en) 2010-05-17 2017-10-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of leucyl-tRNA synthetases
US9034598B2 (en) 2010-05-17 2015-05-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of leucyl-tRNA synthetases
US9347053B2 (en) 2010-05-27 2016-05-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutaminyl-tRNA synthetases
US8962560B2 (en) 2010-06-01 2015-02-24 Atyr Pharma Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Lysyl-tRNA synthetases
US10196628B2 (en) 2010-07-12 2019-02-05 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US8999321B2 (en) 2010-07-12 2015-04-07 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases
US9315794B2 (en) 2010-07-12 2016-04-19 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of aspartyl-tRNA synthetases
US10669533B2 (en) 2010-07-12 2020-06-02 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Histidyl-tRNA synthetases
US9422539B2 (en) 2010-07-12 2016-08-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US9796972B2 (en) 2010-07-12 2017-10-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases
US8969301B2 (en) 2010-07-12 2015-03-03 Atyr Pharma Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of aspartyl-tRNA synthetases
US10196629B2 (en) 2010-07-12 2019-02-05 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases
US9637730B2 (en) 2010-07-12 2017-05-02 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US9029506B2 (en) 2010-08-25 2015-05-12 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of tyrosyl-tRNA synthetases
US9428743B2 (en) 2010-08-25 2016-08-30 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of tyrosyl-trna synthetases
US10563191B2 (en) 2010-10-06 2020-02-18 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of tryptophanyl tRNA synthetases
US9714419B2 (en) 2011-08-09 2017-07-25 Atyr Pharma, Inc. PEGylated tyrosyl-tRNA synthetase polypeptides
US9822353B2 (en) 2011-12-06 2017-11-21 Atyr Pharma, Inc. PEGylated aspartyl-tRNA synthetase polypeptides
US9816084B2 (en) 2011-12-06 2017-11-14 Atyr Pharma, Inc. Aspartyl-tRNA synthetases
US9688978B2 (en) 2011-12-29 2017-06-27 Atyr Pharma, Inc. Aspartyl-tRNA synthetase-Fc conjugates
US9273302B2 (en) 2012-02-16 2016-03-01 Atyr Pharma, Inc. Histidyl-tRNA synthetases for treating autoimmune and inflammatory diseases
US8835387B2 (en) 2012-02-16 2014-09-16 Atyr Pharma, Inc. Histidyl-tRNA synthetases for treating autoimmune and inflammatory diseases
US10711260B2 (en) 2013-03-15 2020-07-14 Atyr Pharma, Inc. Histidyl-tRNA synthetase-Fc conjugates
US10093915B2 (en) 2013-03-15 2018-10-09 Atyr Pharma Inc. Histidyl-tRNA synthetase-Fc conjugates
US10472618B2 (en) 2013-03-15 2019-11-12 Atyr Pharma, Inc. Histidyl-tRNA synthetase-Fc conjugates
US11072787B2 (en) 2013-03-15 2021-07-27 Atyr Pharma Inc. Histidyl-tRNA synthetase-Fc conjugates
US11767520B2 (en) 2017-04-20 2023-09-26 Atyr Pharma, Inc. Compositions and methods for treating lung inflammation

Also Published As

Publication number Publication date
AU7044401A (en) 2001-12-17
CN1322818A (zh) 2001-11-21

Similar Documents

Publication Publication Date Title
WO2001094568A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10 de type ii, et polynucleotide codant ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001092323A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 17 de type ii, et polynucleotide codant ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001040487A1 (fr) NOUVEAU POLYPEPTIDE, SYNTHASE HUMAINE 9 DE TYPE II A BASE AMINEE D'ARNt, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001049726A1 (fr) Nouveau polypeptide, recepteur du peptide natriuretique humain 18, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001075058A2 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 15 de type ii, et polynucleotide codant pour ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001074865A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001055399A1 (fr) Nouveau polypeptide, dipeptide aminopeptidase humaine 28, et polynucleotide codant pour ce polypeptide
WO2001074883A1 (fr) Nouveau polypeptide, proteine endoase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001083686A2 (fr) Nouveau polypeptide, proteine humaine 9 semblable a l'inclusine, et polynucleotide codant pour ce polypeptide
WO2001072807A1 (fr) Nouveau polypeptide, neuropeptide humain 11, et polynucleotide codant pour ce polypeptide
WO2001092328A1 (fr) Nouveau polypeptide, proteine humaine 10.78 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001068872A1 (fr) Nouveau polypeptide, sous-unite c humaine de la pompe a proton vacuolaire atpase 22, et polynucleotide codant pour ce polypeptide
WO2001070802A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide
WO2001072816A1 (fr) Nouveau polypeptide, proteine humaine associee au transport vesiculaire 11, et polynucleotide codant pour ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001075050A2 (fr) Nouveau polypeptide, proteine humaine associee au transport vesiculaire 9, et polynucleotide codant pour ce polypeptide
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP