WO2001070802A1 - Nouveau polypeptide, proteine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001070802A1
WO2001070802A1 PCT/CN2001/000246 CN0100246W WO0170802A1 WO 2001070802 A1 WO2001070802 A1 WO 2001070802A1 CN 0100246 W CN0100246 W CN 0100246W WO 0170802 A1 WO0170802 A1 WO 0170802A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
zinc finger
finger protein
sequence
Prior art date
Application number
PCT/CN2001/000246
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU46299/01A priority Critical patent/AU4629901A/en
Publication of WO2001070802A1 publication Critical patent/WO2001070802A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a finger protein 11 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • Zinc-binding proteins are usually involved in gene expression and regulation as transcription factors and signal transduction molecules. These proteins constitute a large family of proteins, called zinc finger proteins.
  • a zinc atom binding domain usually consists of 25 to 30 amino acid residues, which make up one or more atomic binding sites. The combination of zinc atoms folds proteins into certain structural units, and these structures can be well adapted to the interactions between macromolecules (Berg, J. M. et al., 1996, Science, 271: 1081-1085).
  • the study found that zinc finger protein is expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, various tumor-related tissues, and tissues of immortal cell lines. It plays a very important regulatory role in the gene expression process of these tissues.
  • All zinc finger proteins contain a conserved zinc finger structure.
  • C2H2 and C2C2 There are two main types of zinc finger structures: C2H2 and C2C2.
  • C2H2 zinc finger structure found in yeast gene activation factors.
  • Two Zn atoms are closely aligned with six Cys to form a "zinc cluster" core structure.
  • the C2H2 type is the most widely distributed.
  • the C2H2 zinc finger domain that is, the Zn atom is bound to 2 Cys and 2 His residues (C2H2), and there is a relatively conservative sequence in this type of zinc finger unit: (Tyr, Phe) -X- Cys -X (2, 4)-Cys-X3-P e-X5-Leu-X2-Hi sX (3, 5) -Hi s (where X represents any amino acid residue; cysteine and histidine and zinc
  • the atom forms a coordination bond and binds to the zinc atom; the other three conserved amino acid residues form a hydrophobic central region; other changed amino acid residues are responsible for mediating protein interactions with other molecules).
  • Zinc finger proteins In zinc finger proteins, the role of Zn is to make protein molecules form a finger conformation backbone and bind to DM. Zinc finger structures are found in many proteins involved in "protein-nucleic acid" and "protein-protein” interactions.
  • a zinc finger protein may contain one or more zinc finger domains, which independently perform their own functions in the body.
  • proteins containing zinc finger domains interact with special double-stranded and single-stranded DNA sequences, acting as transcriptional regulators and signaling factors.
  • C2H2 zinc finger domains not only play an important regulatory role in the gene expression process of some tissues, but also play a key role in the developmental regulation and the formation of some tissue tumors use.
  • C2H2 type zinc finger proteins can also be divided into various families according to their structural characteristics. Kruppel-type zinc finger proteins form an independent family in the body. Members of this family contain zinc finger motifs that are conserved by the zinc finger protein family, and each motif is connected by a conserved H / C junction region. The region contains a conserved amino acid sequence: TGEKPY / F [Schuh R., Aicher W. Et a l., Cel l, 1986, 47: 1025-1032]. In addition, Bel lefroid et al.
  • KRAB Kruppel -as socia ted box domain.
  • This domain is a domain that binds the N-terminus of the zinc finger protein to DNA and is highly conserved in evolution [Judi th F. Margol in et a l., Proc. Nat l. Acad. Sci. USA, 1994, 91: 4509- 4513].
  • This domain is divided into two box structures, A and B, which are rich in changed amino acid residues and form two hydrophilic helices.
  • KRAB domain is a potential transcriptional repression domain, in which a 45-amino-acid hydrophilic helical segment is necessary for transcriptional repression, and amino acid substitution in the helical structure will weaken the protein's transcriptional repression function, thus causes dysregulation of gene transcription and triggers various developmental and malignant disorders-related diseases [N. Tommerup et al., Genomics, 1995, 27: 259-264].
  • the KRAB domain and the first zinc finger structure also contain a conserved linking region, which contains at least one nucleic acid localization signal, which is related to the correct localization and function of the protein.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of zinc finger protein 69, so their functions may also be similar.
  • the invention is named zinc finger protein 11.
  • zinc finger protein 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more zinc involved in these processes Refers to protein 11 protein, especially the amino acid sequence of this protein. Isolation of the new zinc finger protein 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Object of the invention
  • An object of the present invention is to provide an isolated novel polypeptide, zinc finger protein 11 and fragments thereof, Analogs and derivatives.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a zinc finger protein 11.
  • Another object of the present invention is to provide a method for producing zinc finger protein 11.
  • Another object of the present invention is to provide an antibody against the polypeptide-zinc finger protein 11 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-zinc finger protein 11 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of zinc finger protein 11. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 302-607 in SEQ ID NO: 1; and (b) a sequence having 1-4528 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the zinc finger protein 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to an in vitro detection of a disease or disease associated with abnormal expression of zinc finger protein 11 protein.
  • a method for susceptibility comprising detecting mutations in said polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of developmental disorders and cancers in some specific tissues or other diseases caused by abnormal expression of zinc finger protein 11.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of zinc finger protein 11 and zinc finger protein 69 of the present invention.
  • the upper graph is a histogram of the expression profile of zinc finger protein 11 and the lower graph is a histogram of the expression profile of zinc finger protein 69.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated zinc finger protein 11.
  • llkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Is missing.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with zinc finger protein 11, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind zinc finger protein 11.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of zinc finger protein 11 when combined with zinc finger protein 11.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind zinc finger protein 11.
  • Regular refers to a change in the function of zinc finger protein 11, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of zinc finger protein 11.
  • Substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify zinc finger protein 11 using standard protein purification techniques. Essentially pure Zinc finger protein 11 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the zinc finger protein 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T- G- A
  • complementary sequence G-A-C-T
  • the dendrite between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity means the sequence is the same in two or more amino acid or nucleic acid sequence comparisons Similar percentages.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the Clus ter method checks each pair by checking the distance between all pairs. Groups of sequences are arranged into clusters. Each cluster is then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules. '
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and? ⁇ It can specifically bind to the epitope of zinc finger protein 11.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • Polynucleoside in its natural state Acids and polypeptides are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances in their natural state.
  • isolated zinc finger protein 11 means that zinc finger protein 11 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify zinc finger protein 11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the zinc finger protein 11 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, zinc finger protein 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (such as bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of zinc finger protein 11.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the zinc finger protein 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, and their derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 4528 bases in length and its open reading frames 302-607 encode 101 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with zinc finger protein 69, and it can be inferred that the zinc finger protein 11 has a similar function to zinc finger protein 69.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DM forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region shown in SEQ ID NO: 1
  • the sequences are identical or degenerate variants.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding zinc finger protein 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the zinc finger protein 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the D fragment sequence of the present invention can also be obtained by the following methods: 1) Isolating double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DM sequence to obtain double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • raRNA extraction There are many mature techniques for raRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) measuring the level of zinc finger protein 11 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of the zinc finger protein 11 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. MAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a vector or a
  • ⁇ G ⁇ A host cell produced by genetic engineering using a zinc finger protein 11 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding a zinc finger protein 11 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding zinc finger protein 11 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a zinc finger protein 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • W 01 cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing D can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following D transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant zinc finger protein 11 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat developmental disorders and cancers of some specific tissues.
  • the zinc finger protein 11 of the present invention can be used to prevent and treat various malignant tumors and cancers related to its expression.
  • tumors and cancers include but are not limited to the following: cancers of hematopoietic cells and tissues, including leukemia, lymphoma, lymphosarcoma, myeloma, etc .; cancers of the brain and nervous tissues, including neuromas, gliomas, meningiomas, Neurofibromas and astrocytomas; various cancers that secrete or absorb tissues, glands, and organs, including: adrenal, thyroid, lung, pancreas, liver, prostate, uterus, bladder, kidney, testis, and gastrointestinal tract ( Small intestine, colon, rectum, and stomach); and some diseases related to abnormal cell differentiation, proliferation, and degradation, including diseases such as hyperthyroidism, hypothyroidism, gastritis, colon polyps, and gastroduodenal ulcers.
  • the zinc finger protein 11 of the present invention contains a KRAB domain, which is a potential transcriptional repression domain. Mutations of amino acids in its helical structure will weaken the protein's transcriptional suppression function, and may also cause the disorder of gene transcription and expression and Causes various developmental and malignant disorders.
  • These diseases include, but are not limited to, such as: spina bifida, hydrocephalus, cartilage hypoplasia, dwarfism, renal tubular acidosis, anemia, gonad hypoplasia, congenital glaucoma or cataract, congenital sensorineural hearing loss, Epileptic disorders such as cerebral palsy, epilepsy, cerebrovascular disease caused by cerebral ischemia or hypertension, hereditary neurological diseases such as neurofibromas, and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) zinc finger protein 11.
  • Agonists increase zinc finger protein 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing zinc finger protein 11 can be cultured together with labeled zinc finger protein 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of zinc finger protein II include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of zinc finger protein 11 can bind to zinc finger protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • zinc finger protein 11 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between zinc finger protein 11 and its receptor.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to zinc finger protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 11 molecules of zinc finger protein should generally be labeled.
  • the present invention provides polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. To produce antibodies. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against zinc finger protein 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting zinc finger protein 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to zinc finger protein 11 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridization Tumor technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against zinc finger protein 11.
  • Anti-zinc finger protein 11 antibodies can be used in immunohistochemical techniques to detect zinc finger protein 11 in biopsy specimens.
  • Monoclonal antibodies that bind to zinc finger protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Such as zinc finger protein 11 high affinity monoclonal antibodies can be covalently bound to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill zinc finger protein 11-positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to zinc finger protein 11.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of zinc finger protein 11.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of zinc finger protein 11 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of zinc finger protein 11 detected in the test can be used to explain the importance of zinc finger protein 11 in various diseases and to diagnose diseases in which zinc finger protein 11 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.
  • Polynucleotides encoding zinc finger protein 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by non-expression or abnormal / inactive expression of zinc finger protein 11.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant zinc finger protein 11 to inhibit endogenous zinc finger protein 11 activity.
  • a variant zinc finger protein 11 can be The short zinc finger protein 11 lacking the signaling domain, although it can bind to downstream substrates, lacks signaling activity. Therefore, the gene therapy vectors of group ⁇ can be used to treat diseases caused by abnormal expression or activity of zinc finger protein 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a zinc finger protein 11 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a zinc finger protein 11 can be found in existing literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding zinc finger protein 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit zinc finger protein 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense MA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding zinc finger protein 11 can be used for the diagnosis of diseases related to zinc finger protein 11.
  • Polynucleotides encoding zinc finger protein 11 can be used to detect the expression of zinc finger protein 11 or the abnormal expression of zinc finger protein 11 in disease states.
  • the DNA sequence encoding zinc finger protein 11 can be used to hybridize biopsy specimens to determine the expression of zinc finger protein 11.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Zinc finger protein 11 specific primers can also be used to detect zinc finger protein 11 transcription products by MA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Zinc finger protein 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type finger protein 11 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it.
  • chromosome Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells that combined individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct a chromosome-specific c-threat library.
  • Fluorescent in situ hybridization of cD clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Zinc finger protein 11 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and range of zinc finger protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a CDM library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0 2 11B03 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain cell total R as a template and ol igo-dT as a primer. After purification of Qiagene's kit, PCR amplification was performed with the following primers:
  • Pr iraerl 5, one GAAAAAATGTTGCTAGAAATCCAA —3, (SEQ ID NO: 3)
  • Primer2 5'- GCACGGCTGCGAGAAGACGAAGCT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • a 50 ⁇ l reaction volume contains 50 mmo l / LC 1, 10 mmol / L Tris-HCl, pH 8. 5, 1. 5 mmol / L MgCl 2 , 200J O1 / L dNTP, 1 Opmol primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elraer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QUGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was identical to that of 1-4528bp in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of zinc finger protein 11 gene expression
  • Primer3 5'- CATCCATGGATGAAGGCTGGAGCAGCACACTCC -3 '(Seq ID No: 5)
  • Primer 4 5'- CATGGATCCCCGCCCTTCCCTTTTCCAGTTTC -3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ncol and BaniHI restriction sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ncol and BamHI restriction sites correspond to the expression vector plasmid pET-28b ( +) (Novagen, Cat. No. 69865. 3) selective endonuclease site.
  • PCR was performed using the PBS-0211B03 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0211B03 plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 rain, a total of 25 cycles.
  • Ncol and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), the positive clones were screened by colony PCR method and sequenced. A positive clone (PET-0211B03) with the correct sequence was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method. LB containing kanamycin (final concentration 3 ( ⁇ g / ml)) In the liquid medium, the host bacteria BL21 (pET-0211B03) was cultured at 37 ° C.
  • a peptide synthesizer (product of PE company) was used to synthesize the following zinc finger protein 11-specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharos B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody specifically binds to zinc finger protein 11.
  • oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes. Uses: if the probe can be used to hybridize to the genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous to the gene fragment of SEQ ID NO: 1 Or complementary (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1
  • cold homogenization buffer (0.25 raol / L sucrose; 25 nifflol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 surface ol / L MgCl 2 ).
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, in order to follow the experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt-s; 6xSSC, 0, lrag / ral CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt-s; 6xSSC, 0, lrag / ral CT DNA (calf thymus DM)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data Analysis in order to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DMs, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul.
  • the M Cartes ian 7500 spotter (purchased from Cartesian Company, USA) was spotted on the glass medium. The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargy 1-2 ⁇ -deoxyur id ine 5--triphate coupled to C 3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- Propargyl-2, -deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy5dUTP (5-Amino- Propargyl-2, -deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed at room temperature with a washing solution (1 ⁇ SSC, 0.2% SDS) Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of zinc finger protein 11 and zinc finger protein 69 according to the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine à doigt de zinc 11, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypepde certains cancers spécifiques des tissus. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine à doigt de zinc 11.
PCT/CN2001/000246 2000-03-10 2001-02-26 Nouveau polypeptide, proteine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide WO2001070802A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU46299/01A AU4629901A (en) 2000-03-10 2001-02-26 A novel polypeptide, zinc finger protein 11 and the polynucleotide encoding thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111962 CN1313293A (zh) 2000-03-10 2000-03-10 一种新的多肽——锌指蛋白11和编码这种多肽的多核苷酸
CN00111962.1 2000-03-10

Publications (1)

Publication Number Publication Date
WO2001070802A1 true WO2001070802A1 (fr) 2001-09-27

Family

ID=4581858

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000246 WO2001070802A1 (fr) 2000-03-10 2001-02-26 Nouveau polypeptide, proteine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1313293A (fr)
AU (1) AU4629901A (fr)
WO (1) WO2001070802A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999021991A1 (fr) * 1997-10-29 1999-05-06 Shanghai Second Medical University Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse
WO1999062951A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene humain de proteine a doigts de zinc (bmzf3)
WO1999062952A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene de proteine humaine a doigts de zinc (bmzf2)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999021991A1 (fr) * 1997-10-29 1999-05-06 Shanghai Second Medical University Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse
WO1999062951A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene humain de proteine a doigts de zinc (bmzf3)
WO1999062952A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene de proteine humaine a doigts de zinc (bmzf2)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
K.S. DAI ET AL.: "Characterization of a novel gene encoding zinc finger domains identified fro expressed sequence tags (ESTs) of a human heart cDNA database", J. MOL. CELL. CARDIOL., vol. 30, no. 11, November 1998 (1998-11-01), pages 2365 - 2375 *
X.A. LI ET AL.: "Cloning and characterization of a novel human gene encoding a zinc finger protein with 25 fingers", BIOCHEM. BIOPHYS. ACTA, vol. 1489, no. 2-3, 23 December 1999 (1999-12-23), pages 405 - 412 *

Also Published As

Publication number Publication date
AU4629901A (en) 2001-10-03
CN1313293A (zh) 2001-09-19

Similar Documents

Publication Publication Date Title
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001070802A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 11, et polynucleotide codant pour ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001083688A2 (fr) Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001083677A2 (fr) Nouveau polypeptide, proteine humaine fh2-13 de deformation des ailes de coq, et polynucleotide codant pour ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001074865A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001072799A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001049726A1 (fr) Nouveau polypeptide, recepteur du peptide natriuretique humain 18, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001090167A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 11, et polynucleotide codant ce polypeptide
WO2001068872A1 (fr) Nouveau polypeptide, sous-unite c humaine de la pompe a proton vacuolaire atpase 22, et polynucleotide codant pour ce polypeptide
WO2001090349A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 12, et polynucleotide codant ce polypeptide
WO2001074993A2 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 17, et polynucleotide codant pour ce polypeptide
WO2001073008A1 (fr) Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide
WO2001072803A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide
WO2001083676A2 (fr) Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide
WO2001066580A1 (fr) Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001088154A1 (fr) Nouveau polypeptide, facteur humain de regulation 17 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP