WO2001083686A2 - Nouveau polypeptide, proteine humaine 9 semblable a l'inclusine, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 9 semblable a l'inclusine, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001083686A2
WO2001083686A2 PCT/CN2001/000642 CN0100642W WO0183686A2 WO 2001083686 A2 WO2001083686 A2 WO 2001083686A2 CN 0100642 W CN0100642 W CN 0100642W WO 0183686 A2 WO0183686 A2 WO 0183686A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
polypeptide
polynucleotide
human
inclusionin
Prior art date
Application number
PCT/CN2001/000642
Other languages
English (en)
Chinese (zh)
Other versions
WO2001083686A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU76239/01A priority Critical patent/AU7623901A/en
Publication of WO2001083686A2 publication Critical patent/WO2001083686A2/fr
Publication of WO2001083686A3 publication Critical patent/WO2001083686A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ -inclusion protein-like protein 9 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the mutual transport of substances inside and outside the cell is an important part of cell life, because all connections and reactions that occur between the cell and the environment must be completed by the mutual conversion of substances inside and outside the cell, such as the extracellular substance entering the cell or the intracellular substance being discharged.
  • Cells etc. There are several mechanisms for transmembrane transport of organism cells, such as the mediation of transport proteins, active transport, and passive transport.
  • transport proteins can mediate the transport of many small polar molecules, but cannot transport large molecules such as proteins, polynucleotides, and polysaccharides.
  • the cellular transport of these macromolecular substances involves the sequential formation and fusion of small vesicles with bounded membranes, which are separated after transport to the destination. This process is called endocytosis.
  • Some macromolecular substances in the cells of an organism are transported through small nests or vesicles. These envelopes and capsules are composed of proteins. The most important protein is the inclusion protein or inclusion protein, which is a kind of fibrin.
  • inclusion protein is a kind of fibrin.
  • another smaller polypeptide forms a coated structural unit, a trigeminal radial monomer, which includes three inclusions.
  • Peptide and three smaller peptides Pentahedrons and hexahedrons are arranged in a grid-like arrangement by polymerization of trigeminal radiation-type monomers, covering the surface of the capsular and the cytoplasmic surface of the crypt. This protein works synergistically with the junctionin protein on the cell membrane to regulate the transport of macromolecular substances inside and outside the cell.
  • the connexin protein can recognize the characteristic stretch of the tail peptide signal amino acid residues on the cytoplasmic surface of the receptor to regulate the correct transport of macromolecular substances in the cell. It can be seen that inclusionin and its similar proteins play an important role in the regulation of macromolecular transport in living cells. It is an important component of cells with small nests and small capsules. It is an important component of intracellular macromolecular substance transport vesicles.
  • This protein will lead to abnormal transport of macromolecular substances in the cell, and then cause a series of related intracellular metabolism and tissue development disorders.
  • This protein is usually closely related to the occurrence of some related metabolic disorders, developmental disorders, endocrine disorders and abnormal inflammation reactions in some tissues in the body.
  • the protein can also be used for the diagnosis and treatment of various related diseases mentioned above.
  • the human inclusion protein 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these processes.
  • the human inclusionin-like protein 9 protein in particular, identifies the amino acid sequence of this protein. Isolation of the newcomer 9-like protein-encoding gene also provides a basis for studying the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important.
  • An object of the present invention is to provide an isolated novel polypeptide-human inclusionin-like protein 9 and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human inclusionin-like protein 9.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human inclusionin-like protein 9.
  • Another object of the present invention is to provide a method for producing human inclusionin-like protein 9.
  • Another object of the present invention is to provide an antibody against the polypeptide-human inclusionin-like protein 9 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human inclusionin-like protein 9.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human inclusionin-like protein 9. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the The polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 143-403 in SEQ ID NO: 1; and (b) having a sequence of 1-1036 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human inclusionin-like protein 9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method. '
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human inclusionin-like protein 9 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of endocrine diseases, developmental disorders, various tumors, growth disorders, inflammation, immune diseases, blood diseases, HIV infection or other causes Use of a medicament for diseases caused by abnormal expression of human inclusionin-like protein 9.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the human intein-like protein 9 and human intein-like protein in the present invention.
  • the upper graph is a graph of the expression profile of human inclusionin-like protein 9
  • the lower graph is the graph of the expression profile of human inclusionin-like protein 9.
  • 1 represents fetal kidney
  • 2 represents fetal large intestine
  • 3 represents fetal small intestine
  • 4 represents fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +
  • lhr As 3+
  • 9 indicates ECV304 PMA-
  • 10 indicates ECV304 PMA +
  • 11 indicates fetal liver
  • 12 indicates normal liver
  • 13 indicates Thyroid
  • 14 for skin
  • 18 for fetal spleen
  • 19 for spleen
  • 20 for prostate
  • 21 for fetal heart
  • 22 for heart
  • 23 for muscle
  • 25 Indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human inclusionin-like protein 9. 9 Da is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human inclusionin-like protein 9, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human inclusionin-like protein 9.
  • An "antagonist” or “inhibitor” refers to a molecule that can block or regulate the biological or immunological activity of human inclusionin-like protein 9 when combined with human inclusionin-like protein 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human inclusionin-like protein 9.
  • Regular refers to a change in the function of human clathrin-like protein 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human clathrin-like protein 9. .
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art will be able to purify human inclusionin-like protein 9 using standard protein purification techniques. Basically pure human inclusionin-like protein 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human inclusionin-like protein 9 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madi son Wis.). The MEGAUGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method divides each group of sequences by checking the distance between all pairs. Arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • Residues sequences - sequences spacer residues - the sequence of residues X 3 intervals The assay may be Jotim Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzyraology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human inclusionin-like protein 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human inclusionin-like protein 9 means that human inclusionin-like protein 9 is essentially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human inclusionin-like proteins 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human inclusionin-like protein 9 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide I ⁇ ⁇ inclusionin-like protein 9 which is basically composed of SEQ ID NO: 2
  • the amino acid sequence shown is composed.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human inclusionin-like protein 9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human inclusionin-like protein 9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1036 bases, and its open reading frame 143-403 encodes 86 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human inclusionin-like protein, and it can be deduced that the human inclusionin-like protein 9 has similar functions to human inclusionin-like protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0. iy.
  • SDS, 6 (TC; or (2) when adding a denaturing agent, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or ( 3) Hybridization occurs only when the identity between the two sequences is at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide is mature as shown in SEQ ID NO: 2 Polypeptides have the same biological function and activity.
  • a denaturing agent such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .
  • Hybridization occurs only when the identity between the two sequences is at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide is mature as shown in SEQ ID NO: 2 Polypeptides have the same biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • nucleic acid fragment having a length of at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 Nucleotides or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human inclusionin-like protein 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human inclusionin-like protein 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cMA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library. There are many mature techniques for extracting raRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spice Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human inclusion protein-like protein 9; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a D sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products of human inclusionin-like protein 9 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a coding sequence for human inclusion protein 9, and a method for producing the polypeptide of the present invention by recombinant technology .
  • a polynucleotide sequence encoding a human inclusionin-like protein 9 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: groups expressed in bacteria Expression vector for the T7 promoter (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human inclusionin-like protein 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • the D sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human inclusionin-like protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transforming a host cell with a DNA sequence of the invention or a recombinant vector containing the D sequence can This is done using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • can absorb DM competent cells harvested after exponential growth phase may be treated with (3 ⁇ 4 (1 2 method used in the step are well known in the art.
  • MgCl 2 is used If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as salamander injection, electroporation, and lipid Body packaging, etc.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human inclusionin-like protein 9 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Endocytosis is an important form of intracellular and extracellular transport.
  • the crypts and crypts in the cytoplasm are mainly composed of inclusion protein.
  • Inclusion is a kind of fibrin, which works in concert with the junctionin protein on the cell membrane to regulate the transport of macromolecular substances inside and outside the cell.
  • inclusionin and its similar proteins play an important role in the regulation of macromolecular transport in the body's cells. It is an important component of cells with small nests and small capsules, and coating is a cell. An important component of the intracellular macromolecular substance transport vesicles. The mutation or abnormal expression of this protein will cause abnormal transport of macromolecular substances in the cell, which will lead to a series of related intracellular metabolism and tissue development.
  • the protein is usually closely related to the occurrence of some related metabolic disorders, developmental disorders, endocrine disorders and abnormal inflammation reactions in some tissues in the body.
  • the protein can also be used for the diagnosis and treatment of various related diseases mentioned above.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of proteins similar to human inclusionin, both of which have similar biological functions. It participates in the transport of substances inside and outside the cell in the cell, mainly the transport of macromolecular substances in the cell, and then involves a series of related intracellular metabolism. Its abnormal expression is usually associated with some related metabolic disorders, developmental disorders, endocrine The occurrence of diseases such as disorders and abnormal inflammation of some tissues are closely related and produce related diseases.
  • the abnormal expression of the human inclusionin-like protein 9 of the present invention will produce various diseases, especially endocrine diseases, developmental disorders, various tumors, growth disorders, inflammation, and immune diseases. These diseases include but not limited to:
  • Endocrine diseases diabetes insipidus, precocious puberty, giants and acromegaly, hypohypoxia in adults, dwarfism, pituitary tumors, simple goiter, thyroiditis, hyperthyroidism, hypothyroidism, hypothyroidism Hyperparathyroidism, Hypoparathyroidism, Cortisol, Primary Aldosterone, Adrenal Insufficiency, Premenstrual Tension, Menopause Syndrome, Ovarian Dysfunction, Amenorrhea, Male sexual Glands Hypofunction, precocious puberty in men
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, astrocytoma, ependymoma, glioblastoma, colon cancer, bladder Cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the human inclusionin-like protein 9 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially endocrine diseases, developmental disorders, various tumors, growth Developmental disorders, inflammation, immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human inclusionin-like protein 9.
  • Agonists enhance biological functions such as human inclusion protein 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human inclusionin-like protein 9 can be cultured with labeled human inclusionin-like protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human inclusion protein-like protein 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human inclusion protein-like protein 9 can bind to human inclusion protein-like protein 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human inclusion protein-like protein 9 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human inclusion protein-like protein 9 and its receptor.
  • Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human inclusionin-like protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9 molecules of human inclusion protein should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies directed against the human epitopin-like protein 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human inclusion protein-like protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human inclusion protein-like protein 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human inclusionin-like protein 9.
  • Antibodies against human inclusionin-like protein 9 can be used in immunohistochemistry to detect human inclusionin-like protein 9 in biopsy specimens. Monoclonal antibodies that bind to human inclusionin-like protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human inclusion protein-like protein 9 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human 9-positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human inclusionin-like protein 9.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human inclusionin-like protein 9.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human inclusionin-like protein 9.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human inclusionin-like protein 9 detected in the test can be used to explain the importance of human inclusionin-like protein 9 in various diseases and to diagnose diseases in which human inclusionin-like protein 9 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry .
  • the polynucleotide encoding human inclusionin-like protein 9 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human inclusion protein-like protein 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human inclusion protein-like protein 9 to inhibit endogenous human inclusion protein-like protein 9 activity.
  • a variant human inclusionin-like protein 9 may be a shortened human inclusionin-like protein 9 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human inclusionin-like protein 9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human inclusionin-like protein 9 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a human inclusionin-like protein 9 can be found in the literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human inclusionin-like protein 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and D
  • ribozymes that inhibit human inclusion protein-like protein 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • nucleic acid molecule In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human inclusionin-like protein 9 can be used for the diagnosis of diseases related to human inclusionin-like protein 9.
  • the polynucleotide encoding human inclusionin-like protein 9 can be used to detect the expression of human inclusionin-like protein 9 or the abnormal expression of human inclusionin-like protein 9 in a disease state.
  • the DNA sequence encoding human inclusionin-like protein 9 can be used to hybridize biopsy specimens to determine the expression of human inclusionin-like protein 9.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human intein-like protein 9 specific primers can also be used to detect human intein-like protein 9 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Detection of mutations in the human inclusion protein-like protein 9 gene can also be used to diagnose human inclusion protein-like protein 9-related diseases.
  • the human inclusion protein-like protein 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human inclusion protein-like protein 9 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only Heterozygous cells that contain human genes corresponding to the primers produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cD sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capability corresponds to one gene per 20kb).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. -These compositions can be used as medicines for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptide of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human inclusion protein-like protein 9 for effective treatment and / or prevention The specific indication amount is to be administered.
  • the amount and dosage range of human inclusionin-like protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms CDM by reverse transcription.
  • the Smart cDM cloning kit purchased from Clontech was used to insert the cDM fragment into the multi-cloning site of the P BSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined CDM sequence was compared with the existing public DNA sequence database (Genebank), and the cDNA sequence of one of the clones 0561a09 was found to be new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0561a09 clone contained a full-length cDNA of 1036bp (as shown in Seq ID NO: l), and a 261bp open reading frame (0RF) from 143bp to 403bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0561a09 and the encoded protein was named human inclusion protein-like protein 9.
  • Example 2 Cloning of a gene encoding human inclusionin-like protein 9 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5
  • GGGATAGATTACAATCCAATTATG-3 5
  • Primer 2 5 — ATATTCTTTATCCATGTTTGGTCA -3, (SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l of Kol, 10 mmol / L Tris-HCl pH 8, 5, 1. 5 ramol / L MgCl 2 , 200 ⁇ M ⁇ dNTP, 1 Opmol primer, 1U Taq DNA polymerization in 50 ⁇ 1 reaction volume Enzyme (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1036bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of the expression of human inclusionin-like protein 9 gene
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then , Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human inclusionin-like protein 9
  • Primer 3 5'- CCCCATATGATGTCATCCCAGTGCTGTTTGACA -3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTAACTTTGTAAGTGTGTAATTCT -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively , followeded by the coding sequence of the 5, and 3 'ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid P ET- 2 8b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using pBS-0561a09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0561a09 plasmid, primers Primer-3 and Primer-4 are lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively. Do not recover large fragments and ligate with T4 ligase.
  • the ligation product was transformed into E.coli M5 cc using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0561a09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 '(pET-0561a09) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified human inclusion protein-like protein 9 was obtained.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following specific peptides of human inclusionin-like protein 9: NH2-Met-Ser-Ser-Gln-Cys-Cys-Leu-Thr-Trp-Pro-Ala-Ser-Glu -Ala-Glu-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin for methods, see: Avrameas, et al. I Sahua chemistry, 1969; 6: 43.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the multinucleus of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 14 Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, each l_5xl0 6 cells extracted about plus lul.
  • steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 PP r0 (the second peak is free ⁇ - 32 P-dATP) to be prepared.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases, such as genetic diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2--deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the raRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl -2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mR of the body, and the probe was prepared after purification.
  • Cy3dUTP 5-Amino-propargyl-2--deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 9 semblable à l'inclusine, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de l'endocrinopathie, des troubles du développement, de toutes sortes de tumeurs, des troubles du développement et de la croissance, des inflammations, des maladies immunitaires, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine 9 semblable à l'inclusine.
PCT/CN2001/000642 2000-04-29 2001-04-28 Nouveau polypeptide, proteine humaine 9 semblable a l'inclusine, et polynucleotide codant pour ce polypeptide WO2001083686A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU76239/01A AU7623901A (en) 2000-04-29 2001-04-28 A novel polypeptide, a human protein 9 similar to inclusin, and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115525 CN1321646A (zh) 2000-04-29 2000-04-29 一种新的多肽——人包涵素相似蛋白9和编码这种多肽的多核苷酸
CN00115525.3 2000-04-29

Publications (2)

Publication Number Publication Date
WO2001083686A2 true WO2001083686A2 (fr) 2001-11-08
WO2001083686A3 WO2001083686A3 (fr) 2002-03-28

Family

ID=4584971

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000642 WO2001083686A2 (fr) 2000-04-29 2001-04-28 Nouveau polypeptide, proteine humaine 9 semblable a l'inclusine, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1321646A (fr)
AU (1) AU7623901A (fr)
WO (1) WO2001083686A2 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5324639A (en) * 1990-09-04 1994-06-28 The Salk Institute Biotechnology/Industrial Assoc, Inc. Production of insulin-like growth factor-1 in methylotrophic yeast cells
US5688651A (en) * 1994-12-16 1997-11-18 Ramot University Authority For Applied Research And Development Ltd. Prevention of protein aggregation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5324639A (en) * 1990-09-04 1994-06-28 The Salk Institute Biotechnology/Industrial Assoc, Inc. Production of insulin-like growth factor-1 in methylotrophic yeast cells
US5688651A (en) * 1994-12-16 1997-11-18 Ramot University Authority For Applied Research And Development Ltd. Prevention of protein aggregation

Also Published As

Publication number Publication date
AU7623901A (en) 2001-11-12
WO2001083686A3 (fr) 2002-03-28
CN1321646A (zh) 2001-11-14

Similar Documents

Publication Publication Date Title
WO2001094568A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10 de type ii, et polynucleotide codant ce polypeptide
WO2001083688A2 (fr) Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001083686A2 (fr) Nouveau polypeptide, proteine humaine 9 semblable a l'inclusine, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001055399A1 (fr) Nouveau polypeptide, dipeptide aminopeptidase humaine 28, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001074870A1 (fr) Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide
WO2001073055A1 (fr) Nouveau polypeptide, phosphatidyl phosphatase humaine 2-12, et polynucleotide codant pour ce polypeptide
WO2001049726A1 (fr) Nouveau polypeptide, recepteur du peptide natriuretique humain 18, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001073008A1 (fr) Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2002000698A1 (fr) Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide
WO2001055197A1 (fr) Nouveau polypeptide, facteur humain de liberation de la corticotropine 23(hcrf-23), et polynucleotide codant pour ce polypeptide
WO2001096568A1 (fr) Nouveau polypeptide, proteine humaine de liaison 51 d'une proteine precurseur de l'amyloide, et polynucleotide codant ce polypeptide
WO2001074883A1 (fr) Nouveau polypeptide, proteine endoase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001087965A1 (fr) Nouveau polypeptide, proteine humaine 15 associee a la voie de transmission synaptique, et polynucleotide codant pour ce polypeptide
WO2001087970A1 (fr) Polypeptide de tyrosinase 12 humaine, et polynucleotide le codant
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001077165A1 (fr) Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001072792A1 (fr) Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide
WO2001072810A1 (fr) Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP