WO2002012318A1 - Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002012318A1 WO2002012318A1 PCT/CN2001/000934 CN0100934W WO0212318A1 WO 2002012318 A1 WO2002012318 A1 WO 2002012318A1 CN 0100934 W CN0100934 W CN 0100934W WO 0212318 A1 WO0212318 A1 WO 0212318A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- glycosylphosphatidylinositol
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a glycosylphospholipid inositol F11.22, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- glycosylphosphatidylinositol The protein is anchored to the cell membrane surface by glycosylphosphatidylinositol (GPI).
- GPI glycosylphosphatidylinositol
- the core structure of GPI is conserved in both protozoa and mammals (Thomas, J.R., Dwek,. A., and Rademacher, T.W., 1990; Cross, G.A., 1990).
- Many proteins, such as glycosyltransferases are essential for the biosynthesis of GPI anchors, and glycosylphosphatidylinositol F (PIG-F) in human cells is one of them.
- the full-length cDM of PIG-F contains an open reading frame of 917 bases and encodes a protein of 219 amino acid residues.
- the 5 'untranslated region of PIG-F contains a typical translation initiation consensus sequence (Kozak, M., 1987), but its signal peptide does not have a typical N-terminal hydrophobic sequence.
- the amino acid sequence of PIG-F it can be inferred that the protein is very hydrophobic (containing more than 55% of hydrophobic residues), so most of its amino acid residues are embedded in the cell membrane.
- PIG-F may directly participate in the biosynthesis process of GPI anchors and play a role in the last step of the seven. It may also have ethanolamine phosphate (EthN-P) transferase activity, which can catalyze the transfer of ethanolamine phosphate to the GPI intermediate state (there are three mannitol residues). In addition, PIG-F is also closely related to the biosynthesis of alkylated phosphatidylinositol (PI).
- PI alkylated phosphatidylinositol
- glycosylphosphatidylinositol F11. 22 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so identification in the art has been required. More glycosylphosphatidylinositol F11. 22 proteins involved in these processes, and in particular the amino acid sequence of this protein was identified. Isolation of the novel glycosylphosphatidylinositol glycan F11.22 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases and therefore it is important to isolate its coding for DM. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a glycosylphosphatidylinositol glycan F11.22.
- Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a glycosylphosphatidylinositol glycan F11.22.
- Another object of the present invention is to provide a method for producing a glycosylphosphatidylinositol glycan F11.22.
- Another object of the present invention is to provide an antibody against the polypeptide glycosylphosphatidylinositol glycan F11. 22 of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide glycosylphosphatidylinositol glycan F11. 22 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of glycosylphosphatidylinositol FH.22.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 519-827 in SEQ ID NO: 1; and (b) a sequence having 1-1489 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of glycosylphosphatidylinositol F11. 22 protein, which comprises using the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to the abnormal expression of glycosylphosphatidylinositol F11. 22 protein in vitro, which comprises detecting the polypeptide in a biological sample or its coding polynucleotide sequence. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide or V mimic of the invention, an activator, an antagonist or a preparation and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of glycosylphosphatidylinositol F11. 22 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the technology herein.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic MA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where substitutions Amino acids have similar structural or chemical properties as the original amino acids, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioly active refers to a protein that has the structure, regulatory, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with a glycosylphosphatidylinositol glycan F1 1.22, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to the glycosylphosphatidylinositol F1 1.22.
- Antagonist refers to a biological activity that can block or regulate glycosylphosphatidylinositol F1 1.22 when combined with glycosylphosphatidylinositol F11. 22 or Immunologically active molecules.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the glycosylphosphatidylinositol glycan F11.22.
- Regular refers to changes in the function of glycosylphosphatidylinositol F11. 22, including an increase or decrease in protein activity, changes in binding characteristics, and any other organism of glycosylphosphatidylinositol F11. 22 Changes in nature, function, or immunity.
- substantially pure ' means essentially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify glycosylphosphatidylinositol F11 using standard protein purification techniques. 22. The substantially pure glycosylphosphatidylinositol F11. 22 can produce a single main band on a non-reducing polyacrylamide gel. The purity of the glycosylphosphatidylinositol F11. 22 polypeptide is available. Amino acid sequence analysis.
- Complementary refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology” refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Southern blotting or
- Substantially homologous sequences or hybridization probes can compete and inhibit complete homology Binding of the target sequence to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (La sergene sof tware package, DNASTAR, Inc., Madis on Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cl us ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Cluster's method or using methods known in the art such as Jotun He in. The percentage identity between nucleic acid sequences (He in J., (1990) Methods in emzumo logy 183: (625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of the glycosylphosphatidylinositol glycan F11.22.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (eg, Environment).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- glycosylphosphatidylinositol F11. 22 means glycosylphosphatidylinositol F11. 22 is substantially free of other proteins, lipids, carbohydrates, or others that are naturally associated with it. substance. Those skilled in the art can purify the glycosylphosphatidylinositol glycan F11.22 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the glycosylphosphatidylinositol F11. 22 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, a glycosylphosphatidylinositol glycan F11. 22, which is basically composed of the amino acid sequence shown in SBQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the glycosylphosphatidylinositol glycan F11.22.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the glycosylphosphatidylinositol glycan F11. 22 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by the genetic code; or UI) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as Leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1489 bases in length and its open reading frame 519-827 encodes 102 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to glycosylphosphatidylinositol F. It can be inferred that the glycosylphosphatidylinositol F11. 22 has a glycosylphosphatidylinositol F similar functionality.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be a coding or non-coding strand.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- the degenerate variant "in the present invention means a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 Nucleotides, preferably at least 100 nucleotides.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding glycosylphosphatidylinositol glycan F11.22.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the glycosylphosphatidylinositol glycan F11. 22 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- raRNA extraction There are several well-established techniques for raRNA extraction, and kits are also commercially available (Qiagene).
- construction of cDNA libraries is also a common method (Sambrook, et al., Molecula Cloning, A Laboraty Manua, Collspring Harbor Labora tory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the glycosylphosphatidylinositol glycan F11.22 transcript (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2,000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the glycosylphosphatidylinositol F11. 22 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). .
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the substance can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by a conventional method.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a glycosylphosphatidylinositol glycan F11. 22 coding sequence, and recombinant technology to produce the present invention. A method of inventing the polypeptide.
- a polynucleotide sequence encoding a glycosylphosphatidylinositol glycan F11. 22 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding a glycosylphosphatidylinositol glycan F11. 22 and suitable transcription / translation regulatory elements. These methods include in vitro recombination DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo lecul ar Cloning, Labora tory Manua l, Col Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide Phenotypic traits of host cells such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide Phenotypic traits of host cells such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a glycosylphosphatidylinositol glycan F11. 22 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
- Host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells such as fly S 2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells, etc. .
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method.
- the steps used are well known in the art.
- the alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant glycosylphosphatidylinositol glycan F11. 22 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- Fig. 1 is a comparison diagram of gene chip expression profiles of glycosylphosphatidylinositol F11.22 and glycosylphosphatidylinositol F of the present invention.
- the upper graph is a graph of the glycosylphosphatidylinositol F11.22 expression profile, and the lower graph is the glycosylphosphatidylinosin F expression profile.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1 ⁇ 24 ⁇ , 6- scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated glycosylphosphatidylinositol glycan F11.22.
- llkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- MRNA is formed by reverse transcription cDNA Quik mRNA Isolation Kit (Qiegene Co.) isolated from the total RNA poly (A) mRNA 0 2ug poly ( A) used.
- the Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a.
- the bacteria formed a cDNA library.
- the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cycle react ion sequencing ID (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1021G04 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
- PCR amplification was performed with the following primers:
- Primerl 5'- CCTTTACAGTTTTATTAATAATTA -3, (SEQ ID NO: 3)
- Primer2 5'- GCCCATCCTTTTGATTTTTGAGCA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1. ⁇
- Amplification conditions 5.0 ⁇ l / L KCl, 10 mmol / L in 50 ⁇ 1 reaction volume
- Tris-Cl (pH 8.5), 1.5 crypto ol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -actin was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a MA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- 32P-labeled probes (approximately 2 X 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1 ° / «SDS at 55 ° C for 30 min. Then Analysis and quantification using Phosphor Imager.
- Example 4 In vitro expression, isolation and purification of recombinant glycosylphosphatidylinositol glycan F11.22 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers was designed, and the sequences are as follows:
- Pr imer 3 5'-CATGCTAGCATGCTGGAGTGCAGCAGTGCAATC-3 '(Seq ID No: 5)
- Pr imer4 5 '-CATGGATCCTCAGTGAACCTGTAGACTAGTCC A- 3' (Seq ID No: 6)
- the 5 ends of these two primers contain Nhel and BamHI digestion sites, respectively, followed by the 5 'and 3' ends of the target gene, respectively.
- the sequence, Nhel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
- PCR was performed using the pBS-1021G04 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-1021G04 plasmid, primers Primer-3 and Primer-4 were Opmo l, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pBT-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a using the calcium chloride method.
- glycosylphosphatidylinositol glycan F11 22-specific peptide was synthesized using a peptide synthesizer (product of PE Company): NH2-Met-Leu-Glu-Cys-Ser-Ser-Ala-I le-Ser-Ala -Hi s-Cys-Asn-Leu-Cys-C00H (SEQ ID NO: 7) 0
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemi s try, 1969 6:43.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether the polynucleotide sequence of the present invention is combined with the detected homologous polynucleotide sequence, and the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then use the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 (probel belongs to the first type of probe and is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (P robe2), belong to the second probe, corresponding to SEQ ID NO: replacing a gene fragment or a complementary fragment of a mutated sequence (41Nt):
- cold homogenization buffer (0.25raol / L sucrose; 25 cryptool / L Tris-HCl, pH 7.5; 25mraol / LnaCl; 25 leg ol / L MgCl 2 ).
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Two NC membranes are needed for each probe for later experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- Pipette and control 15 microliters each, place on the sample film, and dry at room temperature.
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze data to To achieve the purpose of fast, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeRisi, J ,, Lyer, V. & Brown, P.0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
- Cy5 fluorescent dye purchased from Amersham Phamacia Biotech
- the probes from the two types of tissues were hybridized with the chip in UniHyb TM Hybridinium Solution (purchased from Tel eChem) hybridization solution for 16 hours, and the washing solution (1> ⁇ SSC, 0. 2% SDS) After washing, scan with a ScanArray 3000 scanner (purchased from Genera Scanning, USA). The scanned images are analyzed by Imagene software (Biodi scovery, USA), and the Cy3 / Cy5 ratio of each point is calculated. .
- bladder mucosa bladder mucosa
- PMA + Ecv304 cell line LPS + Ecv304 cell line thymus
- normal fibroblasts 1024NC Fibroblas t
- growth factor stimulation 1024NT
- scar-like fc growth factor Stimulation 1013HT
- scar into fc without stimulation with growth factor 101 3HC :
- bladder cancer construct cells EJ bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer.
- Industrial applicability is very similar.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- GPI glycosylphosphatidylinositol
- GPI anchors Many proteins, such as glycosyltransferases, are essential for the biosynthesis of GPI anchors, and glycosylphosphatidylinositol F (PIG-F) in human cells is one of them.
- PAG-F glycosylphosphatidylinositol F
- membrane protein is an important component of cell membrane, and many physiological functions of cell membrane are completed by membrane protein. When the function of membrane proteins is impaired, it can lead to disturbances in many aspects of physiological functions such as cell recognition, cellular immunity, and hormone action.
- Glycosylphosphatidylinositol F (PI GF) in human cells is essential for the biosynthesis of glycosylphosphatidylinositol (GPI) anchors in the body, and its abnormal expression can affect cell membrane proteins and cell membranes Combination, leading to the occurrence of related diseases.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human glycosylphosphatidylinositol F (PIG-F) protein, and both have similar biological functions.
- the polypeptide of the present invention is indispensable for the biosynthesis of glycosylphosphatidylinositol (GPI) anchor in vivo.
- Abnormal expression can affect the binding of cell membrane proteins to cell membranes, leading to cell recognition, cell immunity, and hormonal effects. Disorders in many aspects of physiological functions, which in turn lead to the occurrence of related diseases, including but not limited to: First of all, in higher organisms, the mutual recognition and combination of cells is extremely important in life. From fertilization (recognition, adhesion and fusion of sperm and eggs), blastocyst implantation (recognition, adhesion and interaction between blastocysts and endometrial cells), morphogenesis, organ formation, and maintenance of adult structure and function, It is closely related to cell recognition and adhesion. During the development of the embryo, if the cells recognize and adhere normally, they can develop into fully functional tissues and organs.
- Cleft lip most common, with alveolar cleft and cleft palate
- cleft palate facial oblique cleft
- cervical pouch cervical fistula
- Horizontal absence congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;
- Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger toe malformation, etc.
- neural tube defects no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele
- hydrocephalus inside / outside the brain, etc.
- iris defect iris defect, retention of pupillary membrane, congenital cataract, congenital glaucoma Eye, sore / no / small eye malformations, congenital deafness, auricular deformities, followed by membrane proteins on the surface of immune cells (T cells, B cells, etc.) such as differentiation antigen (CD), surface receptors (IgFc receptors, cytokines) Receptors, complement receptors, etc.) are closely related to the physiological function of immune cells.
- T cells, B cells, etc. such as differentiation antigen (CD), surface receptors (IgFc receptors, cytokines) Receptors, complement receptors, etc.) are closely related to the physiological function of immune cells.
- Abnormal expression can lead to disorders of the body's immune function, which in turn leads to the occurrence of related diseases, including but not limited to:
- measles virus measles, measles bronchitis, pneumonia, otitis media, subacute sclerosis panencephalitis
- herpes virus herpes zoster, chicken pox
- polio virus poliomyelitis
- hepatitis virus A, B, C, D, E, A, G
- polio virus poliomyelitis
- hepatitis virus A, B, C, D, E, A, G
- Malignant tumors leukemia, lymphatic tumors, etc .;
- Autoimmune diseases systemic lupus erythematosus, rheumatoid arthritis, malignant anemia, etc.
- the cell delivery system is on the cell membrane. External stimuli cause a series of changes by transmitting information into the cell, and finally respond accordingly.
- hormones exert their physiological effects by binding to specific protein receptors on the cell membrane. It is conceivable that a defect in this protein receptor on the cell membrane will lead to the occurrence of corresponding hormone dysfunction diseases.
- protein-peptide hormone disorders including but not limited to:
- Insulin and glucagon diabetes, hypoglycemia, etc .;
- Hypothalamus and pituitary hormones giant disease, dwarfism, acromegaly, cortisol syndrome (Cushing's syndrome), primary aldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (Small illness, Juvenile hypothyroidism, Adult hypothyroidism), Male / female infertility, Month Menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, menopausal syndrome), sexual development disorders, diabetes insipidus, improper antidiuretic hormone secretion syndrome, abnormal lactation, etc .; 3. Parathyroid Parathyroid hormone: hyperparathyroidism, hypoparathyroidism, etc .;
- Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
- polypeptides of the present invention can be directly used for the treatment of various diseases, especially embryonic developmental malformations, immune dysfunction diseases and hormone metabolism disorders.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) the glycosylphosphatidylinositol glycan F11.22.
- Agonists enhance biological functions such as glycosylphosphatidylinositol F11. 22 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing glycosylphosphatidylinositol F11. 22 and labeled glycosylphosphatidylinositol F11. 22 can be cultured in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of glycosylphosphatidylinositol F11. 22 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of glycosylphosphatidylinositol F11. 22 can bind to glycosylphosphatidylinositol F11. 22 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
- glycosylphosphatidylinositol F11. 22 can be added to the bioanalytical assay, and by measuring the compounds on glycosylphosphatidylinositol F11. 22 and its receptors Effect to determine whether a compound is an antagonist. Receptor deletions and analogues that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to glycosylphosphatidylinositol glycan F11. 22 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the glycosylphosphatidylinositol F11. 22 molecule should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the glycosylphosphatidylinositol F11. 22 epitope.
- These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by direct injection of glycosylphosphatidylinositol glycan F11. 22 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like.
- Techniques for preparing monoclonal antibodies to glycosylphosphatidylinositol F11. 22 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morr is on et al, PNAS, 1985, 81: 6851).
- the technology for producing single chain antibodies (US Pat. No. 4946778) can also be used to produce single chain antibodies against glycosylphosphatidylinositol glycan F11.22.
- Antibodies against glycosylphosphatidylinositol F11. 22 can be used in immunohistochemistry to detect glycosylphosphatidylinositol F11. 22 in biopsy specimens.
- Monoclonal antibodies that bind to glycosylphosphatidylinositol F11. 22 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill glycosylphosphatidylinositol F11 . 22 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to glycosylphosphatidylinositol F11.22.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of the glycosylphosphatidylinositol glycan F11.22.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of glycosylphosphatidylinositol F11. 22.
- These tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of glycosylphosphatidylinositol F11. 22 detected in the test can be used to explain the importance of glycosylphosphatidylinositol F11. 22 in various diseases and to diagnose glycosylphosphatidylinoscopy Diseases where Glycan F11. 22 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
- the polynucleotide encoding the glycosylphosphatidylinositol glycan F11. 22 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of glycosylphosphatidylinositol glycan F11.22.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant glycosylphosphatidylinositol F11. 22 to inhibit endogenous glycosylphosphatidylinositol F11. 22 activity. For example, a variant glycosylphosphatidylinositol F11.
- 22 may be a shortened glycosylphosphatidylinositol F11. 22 that lacks a signaling domain, although it can bind to a downstream substrate, However, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of glycosylphosphatidylinositol F11. 22.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a glycosylphosphatidylinositol glycan F11. 22 into a cell.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit glycosylphosphatidylinositol F1 1.22 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA to perform endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding glycosylphosphatidylinositol F11. 22 can be used for the diagnosis of diseases related to glycosylphosphatidylinositol F11. 22.
- the polynucleotide encoding glycosylphosphatidylinositol F11. 22 can be used to detect the expression of glycosylphosphatidylinositol F11. 22 or glycosylphosphatidylinositol F11. 22 in a disease state. Abnormal expression.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DM chip (also known as a "gene chip"), and used to analyze differential expression analysis and gene diagnosis of genes in tissues. .
- the glycosylphosphatidylinositol F11. 22 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the glycosylphosphatidylinositol F11. 22 transcription products. '
- glycosylphosphatidylinositol F11. 22 gene can also be used to diagnose glycosylphosphatidylinositol polysaccharide F11. 22-related diseases.
- the forms of glycosylphosphatidylinositol F11.22 mutation include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type glycosylphosphatidylinositol F11. 22 DM sequence. Mutation can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only few chromosome markers based on actual sequence data are available for labeling staining. Color body position.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus ck, Mendel ian Inher tance in Man (available online with Johns Hopkins University Wet ch Medi ca l Li brary). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) 2 0kb per capacity corresponding to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- the glycosylphosphatidylinositol glycan F1 1.22 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of glycosylphosphatidylinositol F11.22 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89528/01A AU8952801A (en) | 2000-06-12 | 2001-06-11 | A novel peptide--glycophosphatidylinositol f11.22 and the polynucleotide coding this novel peptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00116460.0 | 2000-06-12 | ||
CN 00116460 CN1328000A (zh) | 2000-06-12 | 2000-06-12 | 一种新的多肽——糖基磷脂酰肌醇聚糖f11.22和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002012318A1 true WO2002012318A1 (fr) | 2002-02-14 |
Family
ID=4585864
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000934 WO2002012318A1 (fr) | 2000-06-12 | 2001-06-11 | Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1328000A (zh) |
AU (1) | AU8952801A (zh) |
WO (1) | WO2002012318A1 (zh) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7850970B2 (en) | 2003-08-26 | 2010-12-14 | The Regents Of The University Of Colorado | Inhibitors of serine protease activity and their use in methods and compositions for treatment of bacterial infections |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999050435A1 (en) * | 1998-03-27 | 1999-10-07 | Genetics Institute, Inc. | Gpi-122, a novel glycophosphatidylinositol-anchored protein |
-
2000
- 2000-06-12 CN CN 00116460 patent/CN1328000A/zh active Pending
-
2001
- 2001-06-11 WO PCT/CN2001/000934 patent/WO2002012318A1/zh active Application Filing
- 2001-06-11 AU AU89528/01A patent/AU8952801A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999050435A1 (en) * | 1998-03-27 | 1999-10-07 | Genetics Institute, Inc. | Gpi-122, a novel glycophosphatidylinositol-anchored protein |
Non-Patent Citations (3)
Title |
---|
DATABASE GENBANK [online] 22 February 2000 (2000-02-22), WATANABE K. ET AL., retrieved from GI7020625 accession no. NCBI Database accession no. BAA91205.1 * |
DATABASE GENBANK [online] 5 November 1999 (1999-11-05), INOUE N. ET AL., retrieved from GI:1082413 accession no. NCBI Database accession no. A46097 * |
DATABASE GENBANK [online] 8 November 1998 (1998-11-08), STONE N.E. ET AL., retrieved from GI:3851208 accession no. NCBI Database accession no. AC004067.1 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7850970B2 (en) | 2003-08-26 | 2010-12-14 | The Regents Of The University Of Colorado | Inhibitors of serine protease activity and their use in methods and compositions for treatment of bacterial infections |
Also Published As
Publication number | Publication date |
---|---|
CN1328000A (zh) | 2001-12-26 |
AU8952801A (en) | 2002-02-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002006477A1 (en) | A novel polypeptide-homo topoisomerase 12.1 and polynucleotide encoding said polypeptide | |
WO2002026812A1 (fr) | Nouveau polypeptide, proteine de type humain 16.17 de liaison a la repetition adn cgg, et polynucleotide codant ce polypeptide | |
WO2002012318A1 (fr) | Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001066584A1 (fr) | Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide | |
WO2002048355A1 (fr) | Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2002006335A1 (fr) | Nouveau polypeptide, sérine/thréonine protéine kinase 16.17, et polynucléotide codant ce polypeptide | |
WO2002012302A1 (fr) | Nouveau polypeptide, facteur humain de cisaillement 9.24, et polynucleotide codant ce polypeptide | |
WO2002012315A1 (fr) | Nouveau polypeptide, proteine mid1 10.56 du gene de type « ring finger », et polynucleotide codant ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2002000834A2 (en) | A novel polypeptide--human protein phosphatase 9.68 and the polynucleotide | |
WO2002000823A2 (fr) | Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide | |
WO2002020594A1 (fr) | Nouveau polypeptide, adn topo-isomerase ii-beta (top2b) 29.48, et polynucleotide codant ce polypeptide | |
WO2002012301A1 (fr) | Nouveau polypeptide, proteine de liaison 16.17 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide | |
WO2001090172A1 (fr) | Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide | |
WO2002020586A1 (fr) | Nouveau polypeptide, grande proteine humaine 10.23, et polynucleotide codant ce polypeptide | |
WO2001094532A2 (fr) | Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide | |
WO2002000830A2 (en) | A novel peptide, phosphoenolpyruvate-dependant phosphotransferase 12 and the polynucleotide coding this novel peptide | |
WO2001094398A1 (fr) | Nouveau polypeptide, proteine de liaison 10.45 du facteur de croissance de type insuline, et polynucleotide codant ce polypeptide | |
WO2001075126A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide | |
WO2001081384A1 (fr) | Nouveau polypeptide, laminine 16, et polynucleotide codant pour ce polypeptide | |
WO2001079436A2 (en) | A novel polypeptide - human cell differentiation transcription factor 10 and the polynucleotide encoding said polypeptide | |
WO2002012300A1 (fr) | Nouveau polypeptide, proteine humaine g29.13 du cycle cellulaire, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |