WO2002020594A1 - Nouveau polypeptide, adn topo-isomerase ii-beta (top2b) 29.48, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, adn topo-isomerase ii-beta (top2b) 29.48, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020594A1
WO2002020594A1 PCT/CN2001/000935 CN0100935W WO0220594A1 WO 2002020594 A1 WO2002020594 A1 WO 2002020594A1 CN 0100935 W CN0100935 W CN 0100935W WO 0220594 A1 WO0220594 A1 WO 0220594A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
top2b
beta
dna
Prior art date
Application number
PCT/CN2001/000935
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001295374A priority Critical patent/AU2001295374A1/en
Publication of WO2002020594A1 publication Critical patent/WO2002020594A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a DNA topoisomerase ⁇ -beta (TOP2B) 29.48, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • the catalytic activity of type II topoisomerase includes the covalent binding of the enzyme to double-stranded DM, and a transient cleavage mixture is formed along with DNA cleavage. This enzyme is then able to bind ATP and change its conformation so that a secondary DNA double helix can pass through the cracked mixture. This was followed by hydrolysis of ATP and reclosure of the DNA topology.
  • topoisomerases In avian and mammalian cells, there are two isomeric forms of topoisomerases, topo II ⁇ (TOP2A) and topo II (3 (TOP2B)) (Chung et al., 1989). There is only a single form of topoisomerase in the promoter cell. TOP2A is located in the chromosome, chromosome 17q21-22, and TOP2B is located in chromosome 3p24 (Tsai-Pf lugfelder et al., 1988; Jenkins et al., 1992). Two different The high degree of evolution of constructs in eukaryotic organisms indicates that they perform different physiological functions, and they differ in some biochemical and pharmacological properties (Mirski and Cole, 1997;
  • T0P2A and T0P2B genes Sequence analysis of the T0P2A and T0P2B genes revealed that the full-length sequence of T0P2A is more divergent than T0P2B, indicating that the T0P2B gene is more selective.
  • the TOP2B gene contains 36 exons with a molecular weight greater than 49Kb, one more exon than T0P2A (Shapiro and Senapathy, 1987).
  • the internal exon length varies from 44 to 232bp.
  • the average internal exon length is l ⁇ bp.
  • T0P2A is similar to T0P2B.
  • T0P2A and T0P2B genes play a more important role in cells. They can be used as intracellular targets for some drugs widely used in the treatment of human cancer. Accept these drugs and combine them with them to make them in cells. Function.
  • the DNA topoisomerase II-beta (TOP2B) 29.48 protein plays an important role in regulating important functions of the body, such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art Identification of more DNA topoisomerase ⁇ -beta (TOP2B) 29.48 proteins involved in these processes, especially the amino acid sequence of this protein.
  • the isolation of the new DNA topoisomerase II-beta (TOP2B) 29.48 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide, a DNA topoisomerase II-beta.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a DNA topoisomerase ⁇ -beta (TOP2B) 29.48.
  • Another object of the present invention is to provide a DNA topoisomerase Il-beta (TOP2B)
  • a genetically engineered host cell of a 29.48 polynucleotide A genetically engineered host cell of a 29.48 polynucleotide.
  • Another object of the present invention is to provide a method for producing DNA topoisomerase II-beta (TOP2B) 29.48.
  • Another object of the present invention is to provide an antibody against the polypeptide-DNA topoisomerase Il-beta (TOP2B) 29.48 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-to DNA isomerase II-beta (TOP2B) 29.48 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormality of DNA topoisomerase Il-beta (TOP2B) 29.48.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 207-1013 in SEQ ID NO: 1; and (b) a sequence having 1-1339 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to the polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit DNA topoisomerase I I- be ta (TOP2B) 29. 48 protein activity, which comprises utilizing the polypeptide of the present invention. The invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to diseases associated with abnormal expression of DNA topoisomerase I I-beta (TOP2B) 29.48 protein, which comprises detecting the polypeptide or a polynucleoside encoded therein in a biological sample. Mutations in the acid sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • TOP2B DNA topoisomerase I I-beta
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention which are prepared for use in the treatment of cancer, developmental disease or immune disease or other due to abnormal expression of DNA topoisomerase I I-beta (TOP2B) 29.48. Use of medicine for disease.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a protein or polynucleotide “variant” refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” is a molecule that, when combined with DNA topoisomerase I I-beta (TOP2B) 29.48, causes a change in the protein and thereby regulates the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to DNA topoisomerase I I-beta (TOP2B) 29.48.
  • Antagonist refers to a DNA topoisomerase I l-beta (TOP2B) 29 that can block or regulate DNA when combined with DM topoisomerase I I-beta (TOP2B) 29.48.
  • TOP2B DNA topoisomerase I l-beta
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to DNA topoisomerase I I-beta (TOP2B) 29.48.
  • Regular refers to changes in the function of DNA topoisomerase I l-beta (TOP2B) 29. 48, including increased or decreased protein activity, changes in binding characteristics, and DNA topoisomerase I I-beta (TOP2B ) Any other biological, functional or immune change in 29. 48.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • DM topoisomerase I l-beta can purify DM topoisomerase I l-beta using standard protein purification techniques.
  • TOP2B DNA topoisomerase ⁇ - beta
  • T0P2B DNA topoisomerase I I- beta
  • Complementary or “complementary” refers to a polynucleotide that naturally binds by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-TG-A
  • complementary sequence G-ACT
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • Homology refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid.
  • the inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (La sergene sof tware package, DNASTAR, Inc., Madi son Wis.).
  • the MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244).
  • the Clus ter method arranges groups of groups into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the number of residues matching between sequence A and sequence B X 100
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or using a well-known Methods such as; Totun Hein determine percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand” means
  • Sense strand A complementary nucleic acid strand.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of DNA topoisomerase I I-beta (TOP2B) 29.48.
  • Humanized antibody means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody Antibodies that are similar but still retain the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated DNA topoisomerase I I-beta (TOP2B) 29.48 means DNA topoisomerase ⁇ -beta (TOP2B) 29. 48 is substantially free of other proteins naturally associated with it, Lipids, sugars or other substances. Those skilled in the art can purify DNA topoisomerase I I-beta (TOP2B) 29. 48 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. DM topoisomerase I I-beta (TOP2B) 29. 48 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a DNA topoisomerase I I-beta (TOP2B) 29. 48, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of the DNA topoisomerase I I-beta (TOP2B) 29.48.
  • fragment As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to the DM topoisomerase I I-beta (TOP2B) 29. 48 which basically maintains the same biological function or activity. Peptide.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One in which a mature polypeptide is associated with another compound (such as an extended polypeptide half-life Phase compound, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide) formed by fusing additional amino acid sequences into a mature polypeptide or Proteomic sequences)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1339 bases, and its open reading frame 207-1013 encodes 268 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to the DNA topoisomerase I I-beta (TOP2B). It can be inferred that the DM topoisomerase I I-beta (TOP2B) 29. 48 has DNA. Topoisomerase I I- be ta (T0P2B) has similar functions.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be a coding chain or a non-coding chain.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (the two sequences have at least 5 and preferably 70% identity).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • stringent conditions means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding DNA topoisomerase I I-beta (TOP2B) 29.48.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the DNA topoisomerase I I-beta (TOP2B) 29. 48 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • CDNA library is constructed in a conventional method (Sambrook, et al., Mo lecular Cloning, A Laboratory Manua l, Cold Spr ing Harbor Labora tory. New York, 1989) 0 commercially available library may also be obtained cDM, such as Clontech Laboratories, Inc. Different cDNA libraries. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of DNA topoisomerase ⁇ -beta (TOP2B) 29. 48 The level of transcripts; (4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleosides Acid, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product for detecting the DNA topoisomerase II-beta (TOP2B) 29.48 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). .
  • a method for amplifying DNA / RM using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Selected and synthesized by conventional methods.
  • the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using DNA topoisomerase II-beta (TOP2B) 29.48 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • TOP2B DNA topoisomerase II-beta
  • a polynucleotide sequence encoding a DNA topoisomerase Il-beta (TOP2B) 29.48 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • TOP2B 29.48 DNA sequence and an expression vector with appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombinant technology (Sarabroook, et al. Molecular Cloning, a Labora tory Manua l, cold Spring Harbor Labora tory.
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis.
  • promoters are: the lac or p promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a DNA topoisomerase I I-beta (TOP2B) 29.48 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant DNA topoisomerase I l-beta (TOP2B) 29. 48 (Sc ience, 1984; 224: 1431). Generally there are the following steps: (1) Use the polynucleotide (or variant) encoding human DNA topoisomerase I I-beta (TOP2B) 29.48 of the present invention, or transform or transduce with a recombinant expression vector containing the polynucleotide A suitable host cell;
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Figure 1 is the DNA topoisomerase I I-beta (TOP2B) 29. 48 and DNA topoisomerase ⁇ -beta of the present invention
  • TOP2B Gene chip expression profile comparison chart.
  • the top graph is a graph of the DNA topoisomerase I I-beta (TOP2B) 29. 48, and the bottom graph is the graph of the DNA topoisomerase I I-beta (TOP2B) expression.
  • 1-bladder mucosa 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4- normal fibroblasts 1024NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor Stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated DM topoisomerase I l-beta (TOP2B) 29.48. 29kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mT was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with a public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0994E12 was new DNA.
  • the inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- GGGAGGTGCGCGCACGGACGAGCG -3 '(SEQ ID NO: 3)
  • Primer2 5,-GAGGGATGTCTGTTTATTTACAGT -3, (SEQ ID N03 ⁇ 44)
  • Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5ramol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a 50 ⁇ 1 reaction volume Primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1339bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of DM topoisomerase ⁇ -beta (TOP2B) 29.48 gene expression:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.0) were used to uniformly paddle the tissue, and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( pH7.4) -5 X SSC-5 X Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant DNA topoisomerase II-beta (TOP2B) 29.48 According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed, The sequence is as follows:
  • Primer3 5'-CCCCATATGATGGCTCTACCAGTACTGGCCTCA-3 '(Seq ID No: 5)
  • Primer4 5'-CCCGAATTCTCAGGAGCGGCCCGGATTGAGCAT-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • the pBS-0994E12 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • PCR reaction conditions were as follows: a total volume of 50 ⁇ containing PBS-0994E12 plasmid 10 pg, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method Escherichia coli DH5a bacteria, after (final concentration of 30 ⁇ ⁇ / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (pET-0994E12) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • kanamycin-containing final concentration 30 ⁇ g / ml
  • the host bacteria BL21 pET-0994E12
  • IPTG was added to a final concentration of 1 mmol / L
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was collected by centrifugation, and the layers were layered with an affinity column His s.
  • Bind Quick Cartr idge product of Novagen capable of binding to 6 histidines (6His-Tag).
  • TOP2B target protein DNA topoisomerase II-beta
  • a peptide synthesizer (product of PE company) was used to synthesize the following DNA topoisomerase I I-beta (TOP2B) 29. 48 specific peptides:
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-fixed filter is first The hybridization buffer of the probe is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-lOrag prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml) was added.
  • 3-lOrag prehybridization solution lOxDenhardt's; 6xSSC, 0.1 mg / ml
  • CT DNA (calf thymus DNA).
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRisi, J.L., Lyer, V. & Brown, P.0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ m. The spotted slides are hydrated, dried, and exposed to UV light. Cross-link in the cross-linker, and then dry after elution to fix the DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen).
  • the fluorescent test J Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRM of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5— Amino— propargyl—2'-deoxyur idine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, purified and prepared for detection. needle.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5'-tr
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are bladder mucosa, PMA + E CV 304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC :, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, Prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the DNA topoisomerase I I-beta (TOP2B) 29. 48 and the DNA topoisomerase I I-beta (TOP2B) expression profiles are very similar. Industrial applicability
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Topoisomerase is responsible for the conversion of the supercoil and relaxed state of DNA topoisomers in the body. Its abnormal expression can affect DNA replication and protein transcription, and also affect chromosome concentration and chromatid separation. This leads to the occurrence of chromosomal diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human DNA topoisomerase ⁇ -beta (TOP2B) protein, and both have similar biological functions.
  • TOP2B human DNA topoisomerase ⁇ -beta
  • the polypeptide of the present invention is responsible for the transformation between the supercoil and the relaxed state of DM topoisomers in vivo.
  • the abnormal expression can affect DNA replication and protein transcription, and also affect chromosome concentration and chromatid separation. Causes the occurrence of chromosomal diseases, including but not limited to:
  • Kl inefel ter syndrome XYY syndrome, XX male syndrome, XXX female syndrome, Turner syndrome, 21-trisomy syndrome, Meow syndrome, 13-trisomy syndrome, 18-trisomy syndrome, Fragile X syndrome, chromosome break syndrome, etc .;
  • Chromosomal aberrations can cause abnormalities in embryonic development and directly lead to the occurrence of various congenital malformations, which can lead to related diseases, including but not limited to:
  • cleft lip (most common, may be accompanied by alveolar cleft and cleft palate), cleft palate, oblique cleft face, cervical pouch, cervical fistula, etc .;
  • Absence of longitudinal limbs Absence of radial or ulnar side of the upper limb, absence of tibial or fibula of the lower limb, seal-like hand or foot deformity, etc .;
  • Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger toe malformation, etc.
  • Atrial septal defect ventricular septal defect, abnormal separation of arterial trunk such as misalignment of aorta and pulmonary artery, aortic or pulmonary artery stenosis, pulmonary artery stenosis, arterial duct is not closed, etc .;
  • neural tube insufficiency such as spina bifida, anencephaly malformation, brain (meningeal) bulge, craniocerebral fissure, neural tube cysts
  • brain developmental malformations such as foramen malformations, total forebrain, hydrocephalus deformities
  • nerves Metamigration disorders such as abnormal brain gyrus formation
  • other malformations such as aqueduct malformations, cerebellar dysplasia, Down syndrome, spinal deformity, congenital hydrocephalus, congenital cerebral nucleus dysplasia syndrome, etc .
  • the abnormal expression of DNA topoisomerase I l-beta can affect the replication of DNA and the transcription of proteins, which can lead to the development of disorders of growth and development.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human DNA topoisomerase I I-beta (TOP2B) protein, and both have similar biological functions.
  • the polypeptide of the present invention is responsible for the transformation between the supercoil and the relaxed state of DNA topoisomers in the body, and its abnormal expression can affect the replication of DM and the transcription of proteins, and then lead to the development of disorders of growth and development. These diseases include but not limited to:
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used for the treatment of diseases, especially chromosomal diseases, congenital malformations, and disorders of growth and development.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) DNA topoisomerase I I-beta (TOP2B) 29.48.
  • Agonists increase DNA topoisomerase I l-beta (TOP2B) 29. 48 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a DNA topoisomerase I I-beta (TOP2B) 29.48 and a labeled DNA topoisomerase I I-beta (TOP2B) 29. 48 Cultivate together. The ability of the drug to increase or block this interaction is then measured.
  • DNA topoisomers I l-beta (TOP2B) 29. 48 antagonists include antibodies, Compounds, receptor deletions, and the like.
  • the antagonist of DNA topoisomerase II-beta (TOP2B) 29.48 can bind to DNA topoisomerase II-beta (TOP2B) 29.48 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.
  • TOP2B DNA topoisomerase II-beta
  • TOP2B 29.48 was added to the bioanalytical assay to determine whether a compound is an antagonist by measuring its effect on the interaction between DNA topoisomerase II-beta (TOP2B) 29.48 and its receptor. In the same manner as described above for the screening of compounds, it is possible to screen for receptor deletions and analogs that act as antagonists.
  • Polypeptide molecules capable of binding to DNA topoisomerase ⁇ -beta (TOP2B) 29.48 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the DNA topoisomerase II-beta (TOP2B) 29.48 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the DNA topoisomerase II-beta (TOP2B) 29.48 epitope.
  • TOP2B DNA topoisomerase II-beta
  • These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of DM topoisomerase II-beta (TOP2B) 29.48 into immunized animals (such as rabbits, mice, rats, etc.).
  • TOP2B DM topoisomerase II-beta
  • a variety of adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to DM topoisomerase II-beta (TOP2B) 29.48 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against DNA topoisomerase II-beta (TOP2B) 29.48.
  • TOP2B DNA topoisomerase II-beta
  • TOP2B 29.48 Antibodies against DNA topoisomerase II-beta (TOP2B) 29.48 can be used in immunohistochemistry to detect DM topoisomerase ⁇ -beta (TOP2B) 29.48 in biopsy specimens.
  • Monoclonal antibodies that bind to DNA topoisomerase Il-beta (TOP2B) 29.48 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body. DNA topoisomerase
  • TOP2B High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to use a thiol crosslinking agent such as SPDP, By attacking the amino group of the antibody and binding the toxin to the antibody through the exchange of disulfide bonds, this hybrid antibody can be used to kill DNA topoisomerase I I-beta (TOP2B) 29. 48 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to DNA topoisomerase I l-beta (TOP2B) 29.48.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of DNA topoisomerase I l-beta (TOP2B) 29.48.
  • the invention also relates to a quantitative and localized detection method for a DNA topoisomerase I l-beta (TOP2B) 29.48 level diagnostic test.
  • TOP2B DNA topoisomerase I l-beta
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of DM topoisomerase I I-beta (TOP2B) 29.48 detected in the test can be used to explain the importance of DNA topoisomerase I l-beta (TOP2B) 29.48 in various diseases and It is used to diagnose diseases where DNA topoisomerase I l-beta (TOP2B) 29. 48 works.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding the DNA topoisomerase I I-beta (TOP2B) 29.48 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of MA topoisomerase I I-beta (TOP2B) 29.48.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated DM topoisomerase I I-beta (TOP2B) 29.48 to inhibit endogenous DM topoisomerase I l-beta (TOP2B ) 29. 48 activity.
  • a mutated DNA topology isomerase I l-beta (TOP2B) 29.48 may be a shortened DNA topoisomerase I I-beta (TOP2B) 29.48, although it may be Binding to downstream substrates, but lacking signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of DNA topoisomerase I I-beta (TOP2B) 29.48.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • TOP2B DNA topoisomerase I l-beta
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a DNA topoisomerase I I-beta (TOP2B) 29.48 can be found in existing literature (Sambrook, et al.).
  • a polynucleotide encoding a DNA topoisomerase I l-beta (TOP2B) 29. 48 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides that inhibit DNA topoisomerase ⁇ - beta (TOP2B) 29. 48 mRNA
  • RNA and DNA are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and then carries out nucleic acid. Inward action.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RM.
  • This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding DNA topoisomerase I I-beta (TOP2B) 29.48 can be used for the diagnosis of diseases related to DNA topoisomerase ⁇ -beta (TOP2B) 29.48.
  • the polynucleotide encoding the DNA topoisomerase I I-beta (TOP2B) 29.48 can be used to detect the expression of the DNA topoisomerase I I-beta (TOP2B) 29.48 or the DNA topology is different in the disease state. Aberrant expression of the constitutive enzyme I I-beta (TOP2B) 29. 48.
  • DNA sequence encoding DNA topoisomerase ⁇ -beta (TOP2B) 29.48 can be used to hybridize biopsy specimens to determine the expression of DNA topoisomerase I l-beta (TOP2B) 29.48.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • 48 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect DNA topoisomerase I l-beta (TOP2B) 29 48 transcripts.
  • DNA topoisomerase I I-beta (TOP2B) 29.48 gene mutations can also be used to diagnose DNA topoisomerase I I-beta (TOP2B) 29. 48-related diseases.
  • DNA topoisomerase I I-beta (TOP2B) 29.48 mutations include point mutations, translocations, and deletions compared to normal wild-type DNA topoisomerase I I-beta (TOP2B) 29.48 DM sequences , Reorganization, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nor thern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • the specific and locus of each gene on the chromosome needs to be identified.
  • Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only Hybrid cells that contain human genes corresponding to the primers will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l an an inher tance in Man (available online with Johns Hopkins Univer s Wetch Med ica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the amount and dose range of DM topoII-beta (TOP2B) 29.48 administered to a patient will depend on many factors, such as the health condition of the person who is being administered and the judgment of the diagnostician.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une ADN topo-isomérase II-béta (TOP2B) 29.48, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies liées aux chromosomes, de malformations congénitales et de maladies liées aux troubles du développement et de la croissance au métabolisme des protéines, des lipides et des sucres de l'organisme. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant l'ADN topo-isomérase II-béta (TOP2B) 29.48.
PCT/CN2001/000935 2000-06-12 2001-06-11 Nouveau polypeptide, adn topo-isomerase ii-beta (top2b) 29.48, et polynucleotide codant ce polypeptide WO2002020594A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295374A AU2001295374A1 (en) 2000-06-12 2001-06-11 A novel polypeptide-homodna topoisomerase ii-beta(top2b)29.48 and polynucleotideencoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116461 CN1328136A (zh) 2000-06-12 2000-06-12 一种新的多肽——DNA拓扑异构酶Ⅱ－beta(TOP2B)29.48和编码这种多肽的多核苷酸
CN00116461.9 2000-06-12

Publications (1)

Publication Number Publication Date
WO2002020594A1 true WO2002020594A1 (fr) 2002-03-14

Family

ID=4585865

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000935 WO2002020594A1 (fr) 2000-06-12 2001-06-11 Nouveau polypeptide, adn topo-isomerase ii-beta (top2b) 29.48, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1328136A (fr)
AU (1) AU2001295374A1 (fr)
WO (1) WO2002020594A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
YE CHUANGZHONG ET AL.: "Immunohistochemical study of topoisomerase expression in transitional cell carcinoma of bladder", CHIN. J. UROL., vol. 20, no. 1, January 1999 (1999-01-01) *
YE YUMEI ET AL.: "Effect of hainaensine derivative HH07A on activities of DNA topoisomerase II and protein kinase C in tumor cells", CHINESE JOURNAL OF PHARMACOLOGY AND TOXICOLOGY, vol. 11, no. 3, August 1997 (1997-08-01), pages 211 - 214 *
ZHANG QIANG ET AL.: "Expression of topoisomerase II in renal cell carcinoma and it's clinical significance", J. CLIN EXP. PATHOL., vol. 15, no. 6, December 1999 (1999-12-01), pages 501 - 503 *

Also Published As

Publication number Publication date
AU2001295374A1 (en) 2002-03-22
CN1328136A (zh) 2001-12-26

Similar Documents

Publication Publication Date Title
WO2002006477A1 (fr) Nouveau polypeptide, topologie isomerase humaine 12.1, et polynucleotide codant ce polypeptide
WO2002000829A2 (fr) Nouveau polypeptide, proteine humaine 16.83 ftsh, et polynucleotide codant ce polypeptide
WO2002020594A1 (fr) Nouveau polypeptide, adn topo-isomerase ii-beta (top2b) 29.48, et polynucleotide codant ce polypeptide
WO2002012318A1 (fr) Nouveau polypeptide, glycosyl phosphatidylinositol polysaccharide f11.22, et polynucleotide codant ce polypeptide
WO2001072832A1 (fr) Nouveau polypeptide, famille de proteines 11 a laquelle appartiennent des hormones de croissance, et polynucleotide codant pour ce polypeptide
WO2002002615A1 (fr) Nouveau polypeptide, cytochrome b5-9.57, et polynucleotide codant ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001049737A1 (fr) Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2001081389A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une proteine ribosomale l19, et polynucleotide codant pour ce polypeptide
WO2001070803A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide
WO2001074881A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-10, et polynucleotide codant pour ce polypeptide
WO2001081396A1 (fr) Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2002014365A1 (fr) Nouvelle proteine 12 activatrice du polypeptide-ras gtp et le polynucleotide codant pour ladite proteine
WO2002004632A1 (fr) Nouveau polypeptide, latexine humaine 53, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001070784A1 (fr) Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide
WO2001081384A1 (fr) Nouveau polypeptide, laminine 16, et polynucleotide codant pour ce polypeptide
WO2002020577A1 (fr) Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP