WO2002020594A1 - A novel polypeptide-homodna topoisomerase ii-beta(top2b)29.48 and polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide - HOMO DNA topoisomerase II-beta(TOP2B) 29.48 and polynucleotide encoding said polypeptide and a process for producing said polypeptide by DNA recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as chromosome disease, geneogenous deformity and dysgenopathy. Antagonist and the therapeutic use of the polypeptide is also disclosed. In addition, it refers to the use of polynucleotide encoding said HOMO DNA topoisomerase II-beta(TOP2B)29.48.

Description

A New Polypeptide One ": DM topoisomerase Π-beta (TOP2B) 29.48 and a polynucleotide encoding this polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a DNA topoisomerase Π-beta (TOP2B) 29.48, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique

 Concentration of chromosomes and separation of chromatids play a very important role, and can also release torsional stress due to DNA transcription and replication (Oca, 1995). The catalytic activity of type II topoisomerase includes the covalent binding of the enzyme to double-stranded DM, and a transient cleavage mixture is formed along with DNA cleavage. This enzyme is then able to bind ATP and change its conformation so that a secondary DNA double helix can pass through the cracked mixture. This was followed by hydrolysis of ATP and reclosure of the DNA topology.

 In avian and mammalian cells, there are two isomeric forms of topoisomerases, topo II α (TOP2A) and topo II (3 (TOP2B)) (Chung et al., 1989). There is only a single form of topoisomerase in the promoter cell. TOP2A is located in the chromosome, chromosome 17q21-22, and TOP2B is located in chromosome 3p24 (Tsai-Pf lugfelder et al., 1988; Jenkins et al., 1992). Two different The high degree of evolution of constructs in eukaryotic organisms indicates that they perform different physiological functions, and they differ in some biochemical and pharmacological properties (Mirski and Cole, 1997;

Austin and Marsh, 1998). Their expression levels vary widely in different tissues, different growth stages, and the entire cell cycle (Capranico et al., 1992).

 Sequence analysis of the T0P2A and T0P2B genes revealed that the full-length sequence of T0P2A is more divergent than T0P2B, indicating that the T0P2B gene is more selective. The TOP2B gene contains 36 exons with a molecular weight greater than 49Kb, one more exon than T0P2A (Shapiro and Senapathy, 1987). The internal exon length varies from 44 to 232bp. The average internal exon length is l ^ bp. T0P2A is similar to T0P2B.

 The protein products of T0P2A and T0P2B genes play a more important role in cells. They can be used as intracellular targets for some drugs widely used in the treatment of human cancer. Accept these drugs and combine them with them to make them in cells. Function.

Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc stimulation without growth factor, 1013HC, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, In jejunal adenocarcinoma and cardia cancer, the expression profile of the polypeptide of the present invention is very similar to the expression profile of DNA topoisomerase II-beta (TOP2B), so the functions of the two may also be similar. The invention is named DNA topoisomerase II-beta (TOP2B) 29.48.

 As mentioned above, the DNA topoisomerase II-beta (TOP2B) 29.48 protein plays an important role in regulating important functions of the body, such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art Identification of more DNA topoisomerase Π-beta (TOP2B) 29.48 proteins involved in these processes, especially the amino acid sequence of this protein. The isolation of the new DNA topoisomerase II-beta (TOP2B) 29.48 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 An object of the present invention is to provide an isolated novel polypeptide, a DNA topoisomerase II-beta.

(TOP2B) 29.48 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a DNA topoisomerase Π-beta (TOP2B) 29.48.

 Another object of the present invention is to provide a DNA topoisomerase Il-beta (TOP2B)

A genetically engineered host cell of a 29.48 polynucleotide.

 Another object of the present invention is to provide a method for producing DNA topoisomerase II-beta (TOP2B) 29.48.

 Another object of the present invention is to provide an antibody against the polypeptide-DNA topoisomerase Il-beta (TOP2B) 29.48 of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-to DNA isomerase II-beta (TOP2B) 29.48 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormality of DNA topoisomerase Il-beta (TOP2B) 29.48.

The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2. The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 207-1013 in SEQ ID NO: 1; and (b) a sequence having 1-1339 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to the polypeptide of the invention.

 The present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit DNA topoisomerase I I- be ta (TOP2B) 29. 48 protein activity, which comprises utilizing the polypeptide of the present invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to diseases associated with abnormal expression of DNA topoisomerase I I-beta (TOP2B) 29.48 protein, which comprises detecting the polypeptide or a polynucleoside encoded therein in a biological sample. Mutations in the acid sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the polypeptides and / or polynucleotides of the present invention which are prepared for use in the treatment of cancer, developmental disease or immune disease or other due to abnormal expression of DNA topoisomerase I I-beta (TOP2B) 29.48. Use of medicine for disease.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

"Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

 An "agonist" is a molecule that, when combined with DNA topoisomerase I I-beta (TOP2B) 29.48, causes a change in the protein and thereby regulates the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to DNA topoisomerase I I-beta (TOP2B) 29.48.

 An "antagonist" or "inhibitor" refers to a DNA topoisomerase I l-beta (TOP2B) 29 that can block or regulate DNA when combined with DM topoisomerase I I-beta (TOP2B) 29.48. 48 biologically or immunologically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to DNA topoisomerase I I-beta (TOP2B) 29.48.

 "Regulation" refers to changes in the function of DNA topoisomerase I l-beta (TOP2B) 29. 48, including increased or decreased protein activity, changes in binding characteristics, and DNA topoisomerase I I-beta (TOP2B ) Any other biological, functional or immune change in 29. 48.

 "Substantially pure '" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify DM topoisomerase I l-beta using standard protein purification techniques. (TOP2B) 29. 48. A substantially pure DNA topoisomerase Π- beta (TOP2B) 29 · 48 can produce a single main band on a non-reducing polyacrylamide gel. DNA topoisomerase I I- beta (T0P2B) 29. 48 The purity of the peptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to a polynucleotide that naturally binds by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-TG-A" can be combined with the complementary sequence "G-ACT". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction. ,

 "Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (La sergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of groups into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:

 The number of residues matching between sequence A and sequence B X 100 The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or using a well-known Methods such as; Totun Hein determine percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumo logy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" means

"Sense strand" A complementary nucleic acid strand.

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and Fv, which can specifically bind to the epitope of DNA topoisomerase I I-beta (TOP2B) 29.48.

"Humanized antibody" means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody Antibodies that are similar but still retain the original binding activity.

 The term "isolated" refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated DNA topoisomerase I I-beta (TOP2B) 29.48" means DNA topoisomerase Π-beta (TOP2B) 29. 48 is substantially free of other proteins naturally associated with it, Lipids, sugars or other substances. Those skilled in the art can purify DNA topoisomerase I I-beta (TOP2B) 29. 48 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. DM topoisomerase I I-beta (TOP2B) 29. 48 The purity of the peptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, a DNA topoisomerase I I-beta (TOP2B) 29. 48, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives and analogs of the DNA topoisomerase I I-beta (TOP2B) 29.48. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to the DM topoisomerase I I-beta (TOP2B) 29. 48 which basically maintains the same biological function or activity. Peptide. A fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (Π) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One in which a mature polypeptide is associated with another compound (such as an extended polypeptide half-life Phase compound, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide) formed by fusing additional amino acid sequences into a mature polypeptide or Proteomic sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1339 bases, and its open reading frame 207-1013 encodes 268 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to the DNA topoisomerase I I-beta (TOP2B). It can be inferred that the DM topoisomerase I I-beta (TOP2B) 29. 48 has DNA. Topoisomerase I I- be ta (T0P2B) has similar functions.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DM can be a coding chain or a non-coding chain. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The present invention also relates to a polynucleotide that hybridizes to the sequence described above (the two sequences have at least 5 and preferably 70% identity). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "stringent conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 6 (TC; or (2) added when hybridizing Denaturing agents, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only the identity between the two sequences is at least Crosses occur at 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding DNA topoisomerase I I-beta (TOP2B) 29.48.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the DNA topoisomerase I I-beta (TOP2B) 29. 48 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). CDNA library is constructed in a conventional method (Sambrook, et al., Mo lecular Cloning, A Laboratory Manua l, Cold Spr ing Harbor Labora tory. New York, 1989) 0 commercially available library may also be obtained cDM, such as Clontech Laboratories, Inc. Different cDNA libraries. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of DNA topoisomerase Π-beta (TOP2B) 29. 48 The level of transcripts; (4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleosides Acid, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product for detecting the DNA topoisomerase II-beta (TOP2B) 29.48 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). .

 A method for amplifying DNA / RM using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Selected and synthesized by conventional methods. The amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using DNA topoisomerase II-beta (TOP2B) 29.48 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.

 In the present invention, a polynucleotide sequence encoding a DNA topoisomerase Il-beta (TOP2B) 29.48 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods that are well known to those skilled in the art can be used to construct a DNA topoisomerase II-beta

(TOP2B) 29.48 DNA sequence and an expression vector with appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombinant technology (Sarabroook, et al. Molecular Cloning, a Labora tory Manua l, cold Spring Harbor Labora tory.

New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or p promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a DNA topoisomerase I I-beta (TOP2B) 29.48 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant. Genetically engineered host cells for vectors. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

By the conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant DNA topoisomerase I l-beta (TOP2B) 29. 48 (Sc ience, 1984; 224: 1431). Generally there are the following steps: (1) Use the polynucleotide (or variant) encoding human DNA topoisomerase I I-beta (TOP2B) 29.48 of the present invention, or transform or transduce with a recombinant expression vector containing the polynucleotide A suitable host cell;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Figure 1 is the DNA topoisomerase I I-beta (TOP2B) 29. 48 and DNA topoisomerase Π-beta of the present invention

(TOP2B) Gene chip expression profile comparison chart. The top graph is a graph of the DNA topoisomerase I I-beta (TOP2B) 29. 48, and the bottom graph is the graph of the DNA topoisomerase I I-beta (TOP2B) expression. Among them, 1-bladder mucosa, 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4- normal fibroblasts 1024NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor Stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated DM topoisomerase I l-beta (TOP2B) 29.48. 29kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these embodiments are only for illustration The invention is not intended to limit the scope of the invention. In the following examples, the experimental methods without specific conditions are usually performed according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of DM topoisomerase Il-beta (TOP2B) 29.48

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mT was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library. Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the 5 'and y-terminal sequences of all clones. The determined cDNA sequence was compared with a public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0994E12 was new DNA. The inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers. The results showed that the 0994E12 clone contained a full-length cDNA of 1339bp (as shown in Seq ID NO: 1), and an open reading frame (0RF) of 806bp from 207bp to 1013bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0.994E12 and the encoded protein was named DM topoisomerase II-beta (TOP2B) 29.48. Example 2: Cloning of the gene encoding DNA topoisomerase II-beta (TOP2B) 29.48 by RT-PCR method. Using fetal brain cells total A as a template and oligo-dT as a primer for reverse transcription reaction to synthesize cDNA.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primerl: 5'- GGGAGGTGCGCGCACGGACGAGCG -3 '(SEQ ID NO: 3)

 Primer2: 5,-GAGGGATGTCTGTTTATTTACAGT -3, (SEQ ID N0¾4)

 Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl of KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5ramol / L MgCl ₂ , 200 μmol / L dNTP, lOpmol in a 50 μ 1 reaction volume Primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain. During RT-PCR, β-actin was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1339bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of DM topoisomerase Π-beta (TOP2B) 29.48 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.0) were used to uniformly paddle the tissue, and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 gRNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. ³² -P-labeled DNA probes were prepared by a random primer method using a ^- 32PdATP. The DNA probe used was the PCR-amplified DNA topoisomerase II-beta (TOP2B) 29.48 coding region sequence (207bp to 1013bp) shown in FIG. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ ( pH7.4) -5 X SSC-5 X Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 ^x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant DNA topoisomerase II-beta (TOP2B) 29.48 According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed, The sequence is as follows:

 Primer3: 5'-CCCCATATGATGGCTCTACCAGTACTGGCCTCA-3 '(Seq ID No: 5)

Primer4: 5'-CCCGAATTCTCAGGAGCGGCCCGGATTGAGCAT-3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively. The Ndel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). The pBS-0994E12 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μΐ containing PBS-0994E12 plasmid 10 pg, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. Ligation products were transformed by the calcium chloride method Escherichia coli DH5a bacteria, after (final concentration of 30μ β _/ ιη1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (pET-0994E12) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In kanamycin-containing (final concentration 30 μ g / ml) of LB liquid medium, the host bacteria BL21 (pET-0994E12) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1 mmol / L, and the culture was continued for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and the layers were layered with an affinity column His s. Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). Analysis, and the purified target protein DNA topoisomerase II-beta (TOP2B) 29. 48 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 29 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-DM topoisomerase II-beta (TOP2B) 29.48 antibodies

 A peptide synthesizer (product of PE company) was used to synthesize the following DNA topoisomerase I I-beta (TOP2B) 29. 48 specific peptides:

NH2-Met-Ala-Leu-Pro-Val-Leu-Ala-Ser-Gly-Pro-Ala-Ser-Ser-Ala-Pro-C00 H (SEQ ID NO: 7). The peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al. Iramunochemi stry, 1969; 6: 43 ₀ Immunize with 4rag of the above hemocyanin polypeptide complex and complete Freund's adjuvant. Rabbits, 15 days later, were boosted with hemocyanin polypeptide complex and incomplete Freund's adjuvant. 15A titer plate coated with 15 μg / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to DM topoisomerase I I-beta (TOP2B) 29. 48. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are: The sample-fixed filter is first The hybridization buffer of the probe is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

I. Selection of probes. The selection of oligonucleotide fragments for hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects that need to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70 »/», non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGGCTCTACCAGTACTGGCCTCAGGGCCAGCCAGCTCCGCT-3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'-TGGCTCTACCAGTACTGGCCCCAGGGCCAGCCAGCTCCGCT-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning laboratory manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

Sample Preparation: 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) cold homogenization buffer (0.25mol / L sucrose; 25raraol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mmol / L MgCl 2) was suspended precipitate (approximately 10ml / g). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (1 X 10 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain the residual ethanol. Air-dry for 10-15 minutes to evaporate the surface ethanol. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully lysed, and add approximately 1 ul per 1-5 x 10 ^δ cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DM solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and protease 1 :, the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove The aqueous phase was re-extracted with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuged for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volume of cold ethanol, mix and set at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ "to test the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe, so that it can be used in the following experimental steps The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ ″ ² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) combining the first peak was collected after ^{32 P_Prob} _e is prepared as required (the second peak to the free γ- ³² P- dATP). Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-lOrag prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml) was added.

CT DNA (calf thymus DNA). ), After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice). 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) 0. lxSSC, 0.1 ° /. Wash in SDS at 55 ° C for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature. X-ray autoradiography

 -70, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 的 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the hybrid spots of the above two probes; while the hybridization experiments conducted under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was significantly stronger To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or gene microarray (DNAMicroarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature, for example, see the literature DeRisi, J.L., Lyer, V. & Brown, P.0.

 (1997) Science 278, 680-686. And literature Helle, R. A., Schema,., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μm. The spotted slides are hydrated, dried, and exposed to UV light. Cross-link in the cross-linker, and then dry after elution to fix the DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen). The fluorescent test J Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRM of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5— Amino— propargyl—2'-deoxyur idine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, purified and prepared for detection. needle. For specific steps and methods, see:

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Nat l. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davi s, R Ψ. (1995) Science. 270. (20): 467-480.

 (Three) cross

 The probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 <SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

The above specific tissues (or stimulated cell lines) are bladder mucosa, PMA + E _CV 304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC :, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, Prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the DNA topoisomerase I I-beta (TOP2B) 29. 48 and the DNA topoisomerase I I-beta (TOP2B) expression profiles are very similar. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Topoisomerase is responsible for the conversion of the supercoil and relaxed state of DNA topoisomers in the body. Its abnormal expression can affect DNA replication and protein transcription, and also affect chromosome concentration and chromatid separation. This leads to the occurrence of chromosomal diseases. The expression profile of the polypeptide of the present invention is consistent with the expression profile of human DNA topoisomerase Π-beta (TOP2B) protein, and both have similar biological functions. The polypeptide of the present invention is responsible for the transformation between the supercoil and the relaxed state of DM topoisomers in vivo. The abnormal expression can affect DNA replication and protein transcription, and also affect chromosome concentration and chromatid separation. Causes the occurrence of chromosomal diseases, including but not limited to:

 Kl inefel ter syndrome, XYY syndrome, XX male syndrome, XXX female syndrome, Turner syndrome, 21-trisomy syndrome, Meow syndrome, 13-trisomy syndrome, 18-trisomy syndrome, Fragile X syndrome, chromosome break syndrome, etc .;

 Chromosomal aberrations can cause abnormalities in embryonic development and directly lead to the occurrence of various congenital malformations, which can lead to related diseases, including but not limited to:

 1. Common deformities of face, neck and limbs: cleft lip (most common, may be accompanied by alveolar cleft and cleft palate), cleft palate, oblique cleft face, cervical pouch, cervical fistula, etc .;

 2. Common deformities of the limbs:

 1) Missing limbs:

 Transverse shortcomings: congenital short limbs: no arms, no forearms, no hands, no fingers, no legs, no toes, etc .;

 Absence of longitudinal limbs: Absence of radial or ulnar side of the upper limb, absence of tibial or fibula of the lower limb, seal-like hand or foot deformity, etc .;

 2) Limb differentiation disorder: Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger toe malformation, etc.

3. Common malformations of the digestive system: thyroglossal duct cysts, atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital aganglion-free megacolon, impervious anus, abnormal bowel transition, bile duct atresia , Circular pancreas, etc .; 4. Common malformations of the respiratory system: laryngotracheal stenosis or occlusion, tracheoesophageal fistula, hyaline membrane disease, unilateral lung does not occur, Ectopic lung lobe, congenital lung cyst, pulmonary insufficiency, etc .;

 5. Common deformities of the urinary system: polycystic kidney, ectopic kidney, horse tellurium, double ureter, umbilical fistula, bladder eversion, etc .;

6. Common malformations of the reproductive system: cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, testicular feminization syndrome, etc .;

7. Common malformations of the cardiovascular system: atrial septal defect, ventricular septal defect, abnormal separation of arterial trunk such as misalignment of aorta and pulmonary artery, aortic or pulmonary artery stenosis, pulmonary artery stenosis, arterial duct is not closed, etc .;

 Common malformations of the nervous system: neural tube insufficiency such as spina bifida, anencephaly malformation, brain (meningeal) bulge, craniocerebral fissure, neural tube cysts; brain developmental malformations such as foramen malformations, total forebrain, hydrocephalus deformities; nerves Metamigration disorders such as abnormal brain gyrus formation; other malformations such as aqueduct malformations, cerebellar dysplasia, Down syndrome, spinal deformity, congenital hydrocephalus, congenital cerebral nucleus dysplasia syndrome, etc .;

 Common malformations of eyes and ears: iris defects, congenital cataracts, congenital glaucoma, small eye deformities, congenital deafness, auricle deformities, etc .;

 The abnormal expression of DNA topoisomerase I l-beta (TOP2B) can affect the replication of DNA and the transcription of proteins, which can lead to the development of disorders of growth and development. The expression profile of the polypeptide of the present invention is consistent with the expression profile of human DNA topoisomerase I I-beta (TOP2B) protein, and both have similar biological functions. The polypeptide of the present invention is responsible for the transformation between the supercoil and the relaxed state of DNA topoisomers in the body, and its abnormal expression can affect the replication of DM and the transcription of proteins, and then lead to the development of disorders of growth and development. These diseases include but not limited to:

 Mental retardation, cerebral palsy, mental retardation, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasias such as congenital skin sagging, premature aging, congenital keratosis Bad, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation, etc .;

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used for the treatment of diseases, especially chromosomal diseases, congenital malformations, and disorders of growth and development.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) DNA topoisomerase I I-beta (TOP2B) 29.48. Agonists increase DNA topoisomerase I l-beta (TOP2B) 29. 48 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing a DNA topoisomerase I I-beta (TOP2B) 29.48 and a labeled DNA topoisomerase I I-beta (TOP2B) 29. 48 Cultivate together. The ability of the drug to increase or block this interaction is then measured.

DNA topoisomers I l-beta (TOP2B) 29. 48 antagonists include antibodies, Compounds, receptor deletions, and the like. The antagonist of DNA topoisomerase II-beta (TOP2B) 29.48 can bind to DNA topoisomerase II-beta (TOP2B) 29.48 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.

 When screening compounds as antagonists, DNA topoisomerase II-beta (TOP2B)

29.48 was added to the bioanalytical assay to determine whether a compound is an antagonist by measuring its effect on the interaction between DNA topoisomerase II-beta (TOP2B) 29.48 and its receptor. In the same manner as described above for the screening of compounds, it is possible to screen for receptor deletions and analogs that act as antagonists. Polypeptide molecules capable of binding to DNA topoisomerase Π-beta (TOP2B) 29.48 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the DNA topoisomerase II-beta (TOP2B) 29.48 molecule should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the DNA topoisomerase II-beta (TOP2B) 29.48 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by direct injection of DM topoisomerase II-beta (TOP2B) 29.48 into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like. Techniques for preparing monoclonal antibodies to DM topoisomerase II-beta (TOP2B) 29.48 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against DNA topoisomerase II-beta (TOP2B) 29.48.

 Antibodies against DNA topoisomerase II-beta (TOP2B) 29.48 can be used in immunohistochemistry to detect DM topoisomerase Π-beta (TOP2B) 29.48 in biopsy specimens.

 Monoclonal antibodies that bind to DNA topoisomerase Il-beta (TOP2B) 29.48 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. DNA topoisomerase

II-beta (TOP2B) 29.48 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to use a thiol crosslinking agent such as SPDP, By attacking the amino group of the antibody and binding the toxin to the antibody through the exchange of disulfide bonds, this hybrid antibody can be used to kill DNA topoisomerase I I-beta (TOP2B) 29. 48 positive cells.

 The antibodies in the present invention can be used to treat or prevent diseases related to DNA topoisomerase I l-beta (TOP2B) 29.48. Administration of an appropriate dose of antibody can stimulate or block the production or activity of DNA topoisomerase I l-beta (TOP2B) 29.48.

 The invention also relates to a quantitative and localized detection method for a DNA topoisomerase I l-beta (TOP2B) 29.48 level diagnostic test. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of DM topoisomerase I I-beta (TOP2B) 29.48 detected in the test can be used to explain the importance of DNA topoisomerase I l-beta (TOP2B) 29.48 in various diseases and It is used to diagnose diseases where DNA topoisomerase I l-beta (TOP2B) 29. 48 works.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

 The polynucleotide encoding the DNA topoisomerase I I-beta (TOP2B) 29.48 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of MA topoisomerase I I-beta (TOP2B) 29.48. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated DM topoisomerase I I-beta (TOP2B) 29.48 to inhibit endogenous DM topoisomerase I l-beta (TOP2B ) 29. 48 activity. For example, a mutated DNA topology isomerase I l-beta (TOP2B) 29.48 may be a shortened DNA topoisomerase I I-beta (TOP2B) 29.48, although it may be Binding to downstream substrates, but lacking signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of DNA topoisomerase I I-beta (TOP2B) 29.48. Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a DNA topoisomerase I l-beta (TOP2B) 29.48 Into the cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a DNA topoisomerase I I-beta (TOP2B) 29.48 can be found in existing literature (Sambrook, et al.). In addition, a polynucleotide encoding a DNA topoisomerase I l-beta (TOP2B) 29. 48 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense) that inhibit DNA topoisomerase Π- beta (TOP2B) 29. 48 mRNA

RNA and DNA) and ribozymes are also within the scope of the invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and then carries out nucleic acid. Inward action. Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RM. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding DNA topoisomerase I I-beta (TOP2B) 29.48 can be used for the diagnosis of diseases related to DNA topoisomerase Π-beta (TOP2B) 29.48. The polynucleotide encoding the DNA topoisomerase I I-beta (TOP2B) 29.48 can be used to detect the expression of the DNA topoisomerase I I-beta (TOP2B) 29.48 or the DNA topology is different in the disease state. Aberrant expression of the constitutive enzyme I I-beta (TOP2B) 29. 48. For example, the DNA sequence encoding DNA topoisomerase Π-beta (TOP2B) 29.48 can be used to hybridize biopsy specimens to determine the expression of DNA topoisomerase I l-beta (TOP2B) 29.48. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. DNA topoisomerase I I-beta (TOP2B) 29. 48 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect DNA topoisomerase I l-beta (TOP2B) 29 48 transcripts.

 Detection of DNA topoisomerase I I-beta (TOP2B) 29.48 gene mutations can also be used to diagnose DNA topoisomerase I I-beta (TOP2B) 29. 48-related diseases. DNA topoisomerase I I-beta (TOP2B) 29.48 mutations include point mutations, translocations, and deletions compared to normal wild-type DNA topoisomerase I I-beta (TOP2B) 29.48 DM sequences , Reorganization, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nor thern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. At present, the specific and locus of each gene on the chromosome needs to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

In short, PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only Hybrid cells that contain human genes corresponding to the primers will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Ve Fiber et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l an an inher tance in Man (available online with Johns Hopkins Univer s Wetch Med ica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. DNA topoisomerase I l-beta (T0P2B) 29. 48 to Is administered in an amount effective to treat and / or prevent a particular indication. The amount and dose range of DM topoII-beta (TOP2B) 29.48 administered to a patient will depend on many factors, such as the health condition of the person who is being administered and the judgment of the diagnostician.

Claims

Request for Profit

 1. An isolated polypeptide-DNA topoisomerase I I-beta (TOP2B) 29. 48, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment of the polypeptide , Analogs or derivatives.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95½ identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) a polynucleotide that is at least 70% identical to) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 207-1013 in SEQ ID NO: 1 or the sequence of positions 1-1339 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 with a plasmid, virus or a carrier expression vector Carrier.

 8 A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having DNA topoisomerase I I-beta (TOP2B) 29.48 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing DNA topoisomerase I l-beta (TOP2B) 29.48;

 (b) A polypeptide having DNA topoisomerase I I-beta (TOP2B) 29.48 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to DM topoisomerase I I-beta (TOP2B) 29. 48 Specific binding antibody.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of the DNA topoisomerase I I-beta (TOP2B) 29.48.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used to regulate the activity of DNA topoisomerase Π-beta (TOP2B) 29.48 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a polypeptide related to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening DNA topoisomerase I I-beta (TOP2B) 29. 48 mimics, agonists, antagonists Agents or inhibitors; or for peptide fingerprinting.

 16. The use of a nucleic acid molecule according to any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used for manufacturing a gene chip or a microarray. Array.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with DNA topoisomerase I I-beta (TOP2B) 29. 48 abnormalities.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.