WO2001074881A1 - A novel polypeptide - homo ribosome protein s18-10 and polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide - HOMO ribosome protein S18-10 and polynucleotide encoding said polypeptide and a process for producing said polypeptide by DNA recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as cancer, hemopahty, HIV infection, immune disease and phlogosis, antagonist and the therapeutic use of the polypeptide is also disclosed. In addition, it refers to the use of polynucleotide encoding said HOMO ribosome protein S18-10.

Description

 -A new type of polypeptide-human ribosomal protein SI 8-10 and polynucleotide encoding this polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human ribosomal protein S18-10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the method and application of the preparation of the polynucleotide and the polypeptide. technical background

 The correct translation of proteins is very important for all bacteria and higher organisms. The research on the regulation mechanism of protein translation is obtained from E. coli. The protein translation process is mainly completed by various aminoacyl-tRNA synthetases, various tRNAs and ribosomes. The ribosome and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribose Only when the overall structure of the body is complete. Therefore, the ribosome and its constituent subunits act synergistically in the body and play an important physiological function.

Ribosomes are organelles that synthesize proteins. Their only function is to synthesize polypeptide chains from amino acids in accordance with the instructions of mRNA. It is called ribosome, and is simply called ribosome or ribosome. Ribosomes are found in almost all cells, and both prokaryotic and eukaryotic cells have a large number of ribosomes. The ribosome is a granular structure without a membrane, and its diameter is 25nm. The main components are protein and RM. The ribosome MA is called rRNA. The protein content is about 40% and RM is about 60 ° /. . Protein molecules are mainly distributed on the surface of the ribosome, while rRNA is located internally, and the two are bound together by non-covalent bonds (Zi Zhonghe Higher Education Press, Cell Biology, PPl22-129). Functional research of ribosomes has focused on ribosomal RM. There are many rRNA functional domains that determine different functions of ribosomes (Anmi Rev Biochem 1991; 60 191-227). ₀

 There are two basic types of ribosomes in biological organism cells: one is a ribosome of 70S (S is the Sverdberg sedimentation coefficient unit). The ribosomes of all prokaryotic cells are 70S eukaryotic cells. Approximately 70S. The other is 80S ribosomes, the ribosomes of eukaryotic cells (except for mitochondria and chloroplast ribose) are 80S. Ribosomes, whether 70S or 80S, are composed of two subunits of different sizes.

 The ribosome size subunits are often free in the cytoplasmic matrix within the cell. Only when the small subunits are combined with fflRNA does the large subunits combine with the small subunits to form a complete ribosome. After the peptide synthesis is terminated, the large and small subunits dissociate and then exist freely in the cytoplasmic matrix.

In the human recombinant cDNA library, a polynucleoside homologous to the gene encoding mouse S18 was cloned Acid, this protein is considered to be ribosomal protein S18 (Nucleic Acids Reseach, 1993, Vol 21, No 3, 745).

 S18 is one of the small subunits of ribosomal binding proteins, and it and homologous proteins exist in most prokaryotic and eukaryotic cells.

The structural protein S18 of the small subunit of the 40S ribosome found in the murine recombinant cDNA library, and its structural study found that S18 has 152 amino acids, and the mRM encoding this protein has approximately 600 nucleotides. E.coli S13 similar structure of this protein, but also with plant mitochondria, S13 similar to other bacteria (Biochem Biophys Res Commun 1991 Aug 15 ; 178 (3): 1212-8) investigate the role of _e-ribosomal protein S18 is not It is clear, but according to the existing research results, it is speculated that S18 can bind to the small subunit of the ribosome, and can also interact with S6 to function.

 The most important point of the role of ribosomal protein S18 is that it is related to the binding of aminoacyl-tRNA on the ribosome, which has extremely important regulatory significance for the role of the A site of the ribosome (McDougall J., Choli T ·, Kruf t V., Kapp U., Wittmann-Liebold B. FEBS Lett. 245: 253-260 (1989)).

 Ribosomal protein S18 plays an important role in the translation process of proteins. If it is deleted or chemically modified, or the gene encoding it is mutated, it will affect the function of ribosomes and reduce the activity of peptide synthesis. Although the research on the function of ribosomal protein S18 is not thorough enough, according to various research results, it can be proved that the functions of ribosomal protein S18 include: (1) It is very important for rRNA to fold into a functional three-dimensional structure; ) In protein synthesis, the spatial conformation of the ribosome undergoes a series of changes, and the ribosome protein may play a "fine-tuning" role in the conformation of the ribosome; Ribosome proteins work together with rRNA.

Deletion of this protein will slow down cell growth [J. Stephen Gantt, Michael D. Thompson, 1990, J. Biol. Chem., 265: 2763-2767] ₀ Therefore, the ribosomal protein S18 is transcribed and translated by DM It plays an extremely important role in cell proliferation. Its abnormal expression will cause the growth rate of the tissue to slow down, which will cause various developmental disorders, such as stunting.

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic-stimulated L02 L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung, and fetal heart The expression profile of the polypeptide of the present invention is very similar to the expression profile of human ribosomal protein S18 13, so the functions of the two may also be similar. The invention is named human ribosomal protein S18-10.

As mentioned above, the human ribosomal protein S18-10 protein regulates cell division and embryonic development. It plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes, so the art has always needed to identify more human ribosomal protein S18-10 proteins involved in these processes, especially the amino acid sequence of this protein. . Isolation of the new human ribosomal protein S18-10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide, human ribosomal protein S18-10, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ribosomal protein S18-10.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human ribosomal protein S18-10.

 Another object of the present invention is to provide a method for producing human ribosomal protein S18-10.

 Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human ribosomal protein S18-10.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human ribosomal protein S 18-10.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human ribosomal protein S18-10. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 946-1212; and (b) a sequence of positions 1-1529 in SEQ ID NO: 1.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ribosomal protein S 18-10 protein, which comprises using the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human ribosomal protein S18-1 G protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ribosomal protein S 18-10.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of human ribosomal protein S 18-10 and human ribosomal protein S 18 1 3 according to the present invention. The upper graph is a graph of the expression profile of human ribosomal protein S 18-10, and the lower graph is the graph of the expression profile of human ribosomal protein S 18 1 3. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates unstarved L02, 8 indicates L02 +, lhr, As ³⁺ , and 9 indicates ECV304 PMA-, 10 means ECV304 PMA +, 11 means fetal liver, 12 means normal liver, 1 means thyroid, 14 means skin, 15 means fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 means spleen , 20 means prostate, 21 means fetal heart, 22 means heart, 23 means muscle, 24 means testis, 25 means fetal thymus, 26 means thymus.

FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human ribosomal protein S18-10. OkDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention

 The following terms used in this specification and the claims shall have the following meanings unless specifically stated: "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human ribosomal protein S18-10, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ribosomal protein S 18-10.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human ribosomal protein S 18-10 when combined with human ribosomal protein S 18-10. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds to human ribosomal protein S18-10.

 "Regulation" refers to a change in the function of human ribosomal protein S18-10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human ribosomal protein S18-10 Change of nature.

"Substantially pure '" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. W quality. Those skilled in the art can purify human ribosomal protein S18-10 using standard protein purification techniques. The substantially pure human ribosomal protein S18-10 produced a single main band on a non-reducing polyacrylamide gel. The purity of human ribosomal protein S18-10 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program

(Lasergene sof tware package, DNASTAR, Inc., Madi son Wi s.). The MBGALIGN program can compare two or more sequences (Hi gg ins, D. G. and

PM Sharp (1988) Gene 73: 237-244) 0 Clus ter method by examining the distances between all pairs of each set of sequence arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues between sequence and sequence

Number of residues in sequence ^ (number of interval residues in sequence ^-number of interval residues in sequence 3 ^X

May be measured as Jotun He in the percentage of identity between nucleic acid sequences Clus ter or a method well known in the art (Hein L, (1990) Methods in enzymology 183: 625-645) 0

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine. .

"Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand". "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and?, Which specifically bind to the epitope of human ribosomal protein S18-10.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human ribosomal protein S18-10" means that human ribosomal protein S18-10 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human ribosomal protein S18-10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ribosomal protein S18-10 peptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human ribosomal protein S18-10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of the human ribosomal protein S18-10. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human ribosomal protein S18-10 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non- Conservative amino acid residues (preferably conservative amino acid residues) are substituted, and the substituted amino acid may or may not be encoded by the genetic codon; or (Π) such a type in which one or more of the amino acid residues Each group is substituted by another group to include a substituent; or (III) such a method in which the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a A polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1,529 bases in length, and its open reading frame 946-1212 encodes 88 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human ribosomal protein S18 13 and it can be deduced that the human ribosomal protein S18-10 has similar functions to human ribosomal protein S18 13.

 The polynucleotide of the present invention may be in the form of DNA or RM. DM forms include cDNA, genomic DM or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, "" degenerate variant "in the present invention refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); and non-coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes . The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /. (V / v) formamide, 0.1. /. Calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ribosomal protein S18-10.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human ribosomal protein S18-10 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cMA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the human ribosomal protein S18-10 transcript; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is any part of the polynucleotide of the present invention Homologous, at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human ribosomal protein S18-10 gene.

 A method (Sa iki, et al. Science 1985; 230: 1350-1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from the library, the RACE method (RACE-cDM terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human ribosomal protein S 18-10 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

In the present invention, a polynucleotide sequence encoding human ribosomal protein S18-10 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, eta l. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain replication origins, promoters, marker genes, and translational control methods. Methods well known to those skilled in the art can be used to construct a DNA sequence encoding human ribosomal protein S18-10 and appropriate transcription / Translation regulatory element expression vector. These methods include in vitro recombinant DNA Technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide niRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs in size, and act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human ribosomal protein S18-10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the MA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, M _g Cl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

Using conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human ribosomal protein S18-10 (Science, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human human ribosomal protein S18-10 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 The correct translation of proteins requires the cooperation of various aminoacyl-tRNA synthetases, various tRMs, and ribosomes. Ribosomes and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribosome. Only if the overall structure is complete. Ribosome protein S18 is one of the proteins in the small ribosomal subunit. The most important point of the role of ribosomal protein S18 is that it is related to the binding of aminoacyl-tRNA on the ribosome, which has extremely important regulatory significance for the role of the A site of the ribosome. It plays a very important role in the correct tRNA selection in the initial stage of protein synthesis. The S18 protein can select the correct tRM to bind to small ribosomal subunits to avoid mismatches, which is directly related to the stability of the passage of the organism. And the loss of ribosomal protein will cause the cell to slow down.

 It can be seen that the abnormal expression of the specific S18 family protein mot if will cause the dysfunction of the polypeptide containing the mot if of the present invention, resulting in mistranslation of fflRM, and related diseases such as tumors, embryonic development disorders, growth and development. Obstacles, etc.

It can be seen that the abnormal expression of the human ribosomal protein S18-10 of the present invention will produce various diseases, especially embryonic developmental disorders, growth and development disorders, various tumors, and inflammations. These diseases include, but are not limited to: Embryonic developmental disorders: congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness

 Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, larynx Cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma various inflammations: allergic reaction, adult respiratory distress syndrome, pulmonary eosinophilia, rheumatoid Arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, dermatomyositis, polymyositis, Addison's disease, telangiectasia ataxia

 The abnormal expression of the human ribosomal protein S18-10 of the present invention will also produce certain hereditary, hematological and immune system diseases.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribosomal protein S18-10. Agonists enhance biological functions such as human ribosomal protein S18-10 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human ribosomal protein S18-10 can be cultured together with labeled human ribosomal protein S18-10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human ribosomal protein S18-10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human ribosomal protein S18-10 can bind to human ribosomal protein S18-10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.

When screening compounds as antagonists, human ribosomal protein S18-10 can be added to a bioanalytical assay to determine whether a compound is a compound by measuring the effect of the compound on the interaction between human ribosomal protein S18-10 and its receptor. Antagonist. Using the same method for screening compounds as above, Antagonist receptor deletions and analogs. Polypeptide molecules capable of binding to human ribosomal protein S18-10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human ribosomal protein S18-1 G molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human ribosomal protein S18-10 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human ribosomal protein S 18-10 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to human ribosomal protein S18-10 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human ribosomal protein S 18-10.

 Antibodies against human ribosomal protein S18-10 can be used in immunohistochemistry to detect human ribosomal protein S18-10 in biopsy specimens.

 Monoclonal antibodies that bind to human ribosomal protein S18-10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human ribosomal protein S18-1 0 monoclonal antibodies with high affinity can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human ribosomal protein S18-10 positive Cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to human ribosomal protein S18-10. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human ribosomal protein S18-10.

The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human ribosomal protein S18-10. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human ribosomal protein S18-10 detected in the test can be used to explain the importance of human ribosomal protein S18-10 in various diseases and to diagnose diseases in which human ribosomal protein S18-10 plays a role. The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding human ribosomal protein S18-10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ribosomal protein S 18-10. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human ribosomal protein S 18-10 to inhibit endogenous human ribosomal protein S 18-10 activity. For example, a mutated human ribosomal protein S18-10 may be a shortened human ribosomal protein S18-10 which lacks a signaling functional domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human ribosomal protein S 18-10. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ribosomal protein S 18-10 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding the human ribosomal protein S18-10 can be found in the existing literature (Sambrook, et al.). In addition, the recombinant polynucleotide encoding human ribosomal protein S 18-10 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human ribosomal protein S18-10 raRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DM synthesis techniques, such as the solid-phase phosphoramidite synthesis method for oligonucleotide synthesis. Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human ribosomal protein S18-10 can be used for the diagnosis of diseases related to human ribosomal protein S18-10. The polynucleotide encoding human ribosomal protein S 18-10 can be used to detect the expression of human ribosomal protein S 18-10 or the abnormal expression of human ribosomal protein S 18-10 in a disease state. For example, a DNA sequence encoding human ribosomal protein S 18-10 can be used to hybridize biopsy specimens to determine the expression of human ribosomal protein S 18-10. Hybridization techniques include Sou thern blotting, Nor thern blotting, In situ hybridization, etc. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be immobilized on a microarray as probes

(Microarray) or DM chip (also called "gene chip"), used to analyze differential expression analysis and gene diagnosis of genes in tissues. Human ribosomal protein S18-10 specific primers can also be used to detect the transcription products of human ribosomal protein S18-10 by MA-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of mutations in the human ribosomal protein S18-10 gene can also be used to diagnose human ribosomal protein S18-10 related diseases. Human ribosomal protein S18-10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribosomal protein S18-10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so Northern blotting and Western blotting can be used to indirectly determine the presence or absence of a gene.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions. Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human ribosomal protein S18-10 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human ribosomal protein S18-10 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions described in Conditions recommended by the manufacturer.

 Example 1 Cloning of human ribosomal protein S18-10

Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total MA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. A Smart cDM cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5α to form a cDNA library. With Dye The terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with an existing public DNA sequence database (Genebank), it was found that the CDM sequence of one of the clones 0560f01 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the 0560f01 clone contains a full-length cDNA of 1529bp (as shown in Seq ID N0: l), and has a 266bp open reading frame (0RF) from 946bp to 1212bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS- 0560f 01 and the encoded protein was named human ribosomal protein S 18-10. Example 2 Cloning of a gene encoding human ribosomal protein S 18-10 by RT-PCR

 CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Primer 1: 5, one GGTGTGCAGGTGGAGCCCGGGAGA -3, (SEQ ID NO: 3)

 Primer2: 5'- AGTTGTACCGAAGCTTCATTTAAT -3 '(SEQ ID NO: 4)

 Priraerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;

Primer ² is the ³ 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: _μ 1 of reaction volume containing ^{5 0 50mmo l / L KC1,} 10 face ol / L Tr i s-HCl , pH8 5, 1. 5mmol / L MgCl 2, 2 (mol / L. dNTP, lOpmol primer, 1U Taq DNA polymerase (product of Clontech). Reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. Set β-act in as a positive control and template blank as a negative control at the same time during RT-PCR. The amplification products were purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invi trogen). Product). DNA sequence analysis results show that the DNA sequence of the PCR product is exactly the same as the 1-1529bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human ribosomal protein S18-10 gene expression

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. 2 g RNA, performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2. 2M formaldehyde electrophoresis then transferred to nitrocellulose by a -. ³² P dATP by random priming labeled Preparation ^{32 Ρ-} DM probe. The DNA probe used was the PCR amplified human ribosomal protein S 18_10 coding region sequence (946bp to 1212bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH ₂ P0 ₄ (pH7. 4)-5 x SSC- 5 x Denhardt's solution and 20 (^ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then Phosphor Imager was used for analysis and quantification. Example 4 In vitro expression, isolation and purification of recombinant human ribosomal protein S18-10

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:.

Pr imer 3: 5'- CATGCTAGCATGTCACCATGCCCGGCACCCGTG -3 '(Seq ID No: 5) Pr imer4: 5'- CATGGATCCTCAATGCTCTTCTGTATCAAAAAA-3, (Seq ID No: 6) These two primers contain Nhel and BamHI digestion respectively Sites, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Nhel and BaraHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. The PCR reaction was performed using the pBS-0560f01 plasmid containing the full-length target gene as a template. PCR reaction conditions were: 1 in a total volume of ₅₀ μ plasmid pBS- 0560f01 containing 10pg, primer Primer-3 and Primer-4, respectively lOpmol, Advantage polymerase Mix (Clontech Products) 1 _μ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5C by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (^ _g / ml)), the positive clones were screened by colony PCR method and sequenced. A positive clone (PET-0560f 01) with the correct sequence was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) using calcium chloride method. In LB containing kanamycin (final concentration 30 _μ§ / ηι1) a liquid medium the host bacteria BL21 _(P ET-0560f01) incubated at 37 ° C to logarithmic phase, IPTG was added to a final concentration of 1 vertical ol / L, incubation was continued for 5 hours. harvested by centrifugation, disrupted bacteria by ultrasonic The supernatant was collected by centrifugation, and subjected to chromatography using an affinity column His. Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag) to obtain a purified target protein. Ribosomal protein S18-10. After SDS-PAGE electrophoresis, a single band was obtained at 1 OkDa (Figure 2). The band was transferred to a PVDF membrane and analyzed by N-terminal amino acid sequence using Edams hydrolysis method. Results 15 amino acids at the N-terminus and 15 amino acids at the N-terminus shown in SEQ ID NO: 2 Residues exactly word. S18- 10 antibodies produced in Example 5 embodiment anti-human ribosomal protein

Polypeptide synthesizer (product of PE company) was used to synthesize the following specific human ribosomal protein S18-10. NH2-Met-Ser-Pro-Cys-Pro-Ala-Pro-Val-Lys-Leu-Ser-Arg-Thr-Gly-Thr-C00H (SEQ ID NO: 7). The polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.釆 Using a 15 g / ml bovine serum albumin peptide complex-coated titer plate as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human ribosomal protein S18-10. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select suitable oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes, and to identify whether or not the multinucleus of the present invention is incorporated in some tissues by a filter hybridization method. Nucleotide sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

The oligonucleotide fragment selected from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe shall be Following the following principles and several aspects to consider:

 1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGTCACCATGCCCGGCACCCGTGAAGCTATCTCGCACTGGA -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

 5'- TGTCACCATGCCCGGCACCCCTGAAGCTATCTCGCACTGGA -V (SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambruck et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1000g for 10 minutes. 3) Suspend the pellet (approximately 10 ml / g) with a cold homogenization buffer (0.25 raol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 ol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (add 1 ml per 0.1 g of the original tissue sample), then connect the following 2, DM extraction of phenol

Steps: 1) Wash cells with 1-1 Oml cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (I x ^{10 8} cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / nil. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge f for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper, and gradually increase TE, mix until DM is fully dissolved, and add approximately 1 ul per 1-5 × 10 ^δ cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DM solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100u _g / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 180 vols of 2mol / L sodium acetate and 2.5 vols of cold ethanol, and mix well--20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps ^3-6 . 14) Determine A _{2δ ()} and A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so as to be used in the following experimental steps The film was washed with high-strength conditions and strength conditions, respectively.

2) Pipette and control 15 μl each, spot on the sample film, and dry at room temperature. 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and put in 0.5raol / L Tris-HCl (pH7.0), 3raol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) The ³² P-Probe (the second peak is free γ- ³² P-dATP) to be prepared after the collection solution of the first peak is combined.

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-lOnig prehybridization solution (10xDenhardt> s; 6xSSC, 0.1 mg / rnl CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1 in medium, wash at 40 ° C for 15 minutes (twice).

 4) 0. IxSSC, 0.1% SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0. IxSSC, 0.1 SDS, wash at 37 ° C for 15 minutes (twice).

4) 0. IxSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (2 times), and dry at room temperature. X-ray autoradiography:

 -70. C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology developed and developed by hundreds of national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific methods and steps have been reported in the literature, for example, see the literature DeRi s i, J. L., Lyer, V. & Brown, P. 0.

(1997) Science 278, 680-686. And literature Hel le, R. A., Schema, M., Chai, A., Shalom, D.,

(1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DMs, including the polynucleotides of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95. C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0; 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). The fluorescent test Cy3dUTP (5-Amino-propargyl-2 '-deoxyur idine 5' -tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 -Amino-propargyl-2'-deoxyur idine 5 '-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech, to label mRNA of specific tissues (or stimulated cell lines) in the body, and prepare probes after purification . For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Nat l. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Sha lon, Dar i., Davi s, RW (1995) Science. 270 (20): 467-480.

 (Three) cross

 The probes from the above two tissues were hybridized with the chip in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 x SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profile of human ribosomal protein S18-10 and human ribosomal protein S18 13 according to the present invention are very similar.

Claims

Rights request

1. An isolated polypeptide-human ribosomal protein S18-10, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog or derivative thereof.

 2. The polypeptide according to claim 1, wherein the amino acid sequence of said polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SBQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 946-1212 in SEQ ID NO: 1 or the sequence of positions 1-1529 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human ribosomal protein S18-10 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human ribosomal protein S18-10;

 (b) Isolating a polypeptide having human ribosomal protein S18-10 activity from the culture.

10.An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to a human ribosomal protein S18-10 specific binding antibody.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human ribosomal protein S18-10.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human ribosomal protein S18-10 in vivo and in vitro. .

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human ribosomal protein S18-10; or Identification of peptide fingerprints.

 16. The application of the nucleic acid molecule according to any of the claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing Gene chip or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human ribosomal protein S18-10 abnormalities.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.