WO2002000834A2 - A novel polypeptide--human protein phosphatase 9.68 and the polynucleotide - Google Patents
A novel polypeptide--human protein phosphatase 9.68 and the polynucleotide Download PDFInfo
- Publication number
- WO2002000834A2 WO2002000834A2 PCT/CN2001/000962 CN0100962W WO0200834A2 WO 2002000834 A2 WO2002000834 A2 WO 2002000834A2 CN 0100962 W CN0100962 W CN 0100962W WO 0200834 A2 WO0200834 A2 WO 0200834A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polynucleotide
- polypeptide
- protein phosphatase
- human protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human protein phosphatase 9.68, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
- Protein phosphorylation and dephosphorylation are catalyzed by protein kinases and protein phosphatases, respectively.
- Protein phosphatase is considered paramount because this enzyme shuts down the signaling pathways activated by the kinase, preventing the unrestricted transmission of signals.
- Protein phosphatase is involved in a series of important physiological activities such as regulating enzyme activity, assembling large molecular proteins, intracellular protein distribution, regulating proteolysis, signaling pathways, cell cycle cycling, ⁇ cell activation and neurotransmitter receptor activation. play an important role.
- Protein phosphatase 2 (PP2A) is found in various cells and accounts for 0.3-1% of total cellular protein. It is the major serine / tyrosine protein phosphate in the cell.
- One of the enzymes, which regulates mitogen-activated protein kinase (MAPK) plays an important role in physiological activities such as cell cycle regulation, growth factor signaling, and tumorigenesis. [Current O inion in Cell Biology 2000,
- the PPP2R1B gene encodes the ⁇ isozyme of PP2A. It has now been found that mutations in PPP2R1B can cause lung cancer, rectal cancer, breast cancer, uterine cancer, and other cancers, so it is considered a tumor suppressor gene. [Biochim. Biophys. Acta 1155: 207-226, 1993.]
- the human protein phosphatase 9.68 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes. There has been a need in the domain to identify more human protein phosphatase 9.68 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the novel human protein phosphatase 9.68 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for the disease, and it is therefore important to isolate its coding DNA. Disclosure of invention
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human protein phosphatase 9.68.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human protein phosphatase 9.68.
- Another object of the present invention is to provide a method for producing human protein phosphatase 9.68.
- Another object of the present invention is to provide antibodies against the polypeptide-human protein phosphatase 9.68 of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human protein phosphatase 9.68.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with a human protein phosphatase 9.68 abnormality.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 488-754 in SEQ ID NO: 1; and (b) a sequence having 1-1247 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
- the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
- the invention also relates to an antibody capable of specifically 'binding' to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human protein phosphatase 9.68 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of human protein phosphatase 9.68 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human protein phosphatase 9.68.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Biological activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human protein phosphatase 9.68, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human protein phosphatase 9.68.
- Antagonist refers to a molecule that, when combined with human protein phosphatase 9.68, can block or regulate the biological or immunological activity of human protein phosphatase 9.68.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human protein phosphatase 9.68.
- Regular refers to a change in the function of human protein phosphatase 9.68, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human protein phosphatase 9.68 change.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human protein phosphatase 9.68 using standard protein purification techniques. Basic The pure human protein phosphatase 9.68 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human protein phosphatase 9.68 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGAL IGN program
- the MEGALI GN program can compare two or more sequences (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244) 0 C l us ter method checks the distance between all pairs of sequence groups each arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 1 00 The number of residues in sequence A-the interval residues in sequence A The number of spacer residues in counting sequence B can also be determined by the Cluster method or using methods known in the art such as Jotun He in (%).
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human protein phosphatase 9.68.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). Polynucleotides in their natural state in living cells It is not isolated and purified from polypeptides, but the same polynucleotide or polypeptide is separated and purified from other substances existing in its natural state.
- isolated human protein phosphatase 9. 68 means human protein phosphatase 9. 68 is substantially free of other proteins, lipids, carbohydrates or other substances that are naturally associated with it. Those skilled in the art can purify human protein phosphatase 9.68 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human protein phosphatase 9. 68 peptide can be analyzed by amino acid sequences.
- the present invention provides a new polypeptide, human protein phosphatase 9.68, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human protein phosphatase 9.68.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human protein phosphatase 9.68 of the present invention.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1247 bases, and its open reading frames 488-754 encode 88 amino acids.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, Due to genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
- hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human protein phosphatase 9.68.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human protein phosphatase 9.68 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) expression The antibodies of the library are screened to detect cloned polynucleotide fragments having common structural characteristics.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontecti. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or loss of marker gene function; (3) measuring the level of human protein phosphatase 9.68 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product for detecting human protein phosphatase 9.68 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length NA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA. sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human protein phosphatase 9.68 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human protein phosphatase 9.68 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human protein phosphatase 9.68 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- E. coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as fly S2 or Sf 9
- animal cells such as CH0, COS, or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl.
- the steps used are well known in the art.
- the alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant human protein phosphatase 9.68 (Scene, 1984; 224: 1431) by a conventional recombination method. Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- FIG. 1 is a comparison diagram of gene chip expression profiles of human protein phosphatase 9.68 and human PPP2R1B gene of the present invention.
- the upper graph is a graph of the expression profile of human protein phosphatase 9.68
- the lower graph is the graph of the expression profile of human PPP2R1B gene.
- 1-bladder mucosa 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4- normal fibroblasts 1024NC, 5- Fibroblast, growth factor stimulation, 1024NT, 6-scar into fc growth factor stimulation , 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin , 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human protein phosphatase 9.68.
- lOkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
- the Quik mRNA Isolation Kit (Qiegene) was used to isolate poly (A) n cliffs from total MA. 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
- Dye terminate cycle reaction sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elraer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0947E09 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification of Qiagene's kit, PCR amplification was performed with the following primers:
- Primerl 5 — GACATTTAGCAACATCTGGAGACA -3 '(SEQ ID NO: 3)
- Primer2 5'- GGAACACAGATTTGATGTTTTAAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions reaction volume containing 5 0 ⁇ 1 in 50mmol / L KC1, 10mmol / L Tris- CI, (pH8.5), 1.5ramol / L MgCl 2, 200 ⁇ mol / L dNTP, lOpmol primer, 1U of Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72. C 2rain.
- ⁇ -actin was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1- 1247b P shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human protein phosphatase 9.68 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt, s solution and 200 yg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human protein phosphatase 9.68
- Primer 3 5'-CATCCATGGATGAGCTATATACACATAAATCTT-3 '(Seq ID No: 5)
- Priraer4 5,-CATGGATCCCCCGAAGTCAGGAGATCGAGACC- 3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Ncol and BamHI restriction sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
- the Ncol and BamHI restriction sites correspond to the expression vector plasmid pET-28b ( +) (Novagen, Cat. No. 69865.3).
- the pBS-0947E09 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of plasmid pBS-0947E09, primers? 1 ⁇ 0161 "-3 Hekou? 1: 11116]: -4 points and another!] Is 1 ( ⁇ 11101, Advantage polymerase Mix (Clontech)) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 C 2 min, 25 cycles in total. Digestion of the amplified product and plasmid pET-28 (+) with Ncol and BaraHI respectively, large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed with calcium chloride Escherichia coli DH5 ⁇ was cultured overnight on LB plates containing kanamycin (final concentration 30 g / ral), and colonies were used to screen positive clones and sequenced. Select positive clones with the correct sequence (PET-0947E09 ) The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- peptides specific to human protein phosphatase 9.68 were synthesized using a peptide synthesizer (product of PE): NH2-Met-Ser-Tyr-I le-His-Ile-Asn-Leu-Leu-Leu-Leu-Leu-Leu-Phe -Val-Phe-COOH (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Rabbits were immunized with 1 ⁇ 2 g of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15 using a 15 ⁇ g / ml bovine serum albumin peptide complex-coated titer plate for ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Se P har 0 se4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially the same as this Polynucleotide of the invention SEQ ID NO: 1 Identical or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely identical to the gene fragment of SEQ ID NO: 1 Homologous or complementary (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Example 7 DNA Mi croarray
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data Analysis in order to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5) was used.
- the probes from the above two tissues and the chips were respectively hybridized in a Un iHyb TM Hybrid i zat i on Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (lx SSC, 0.2) was used at room temperature. % SDS) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed by Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point is calculated.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the human protein phosphatase 9.68 and human PPP2R1B gene expression profile according to the present invention are very similar. Industrial applicability
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Protein phosphorylation and dephosphorylation are catalyzed by protein kinases and protein phosphatases, respectively.
- Protein phosphatase is considered paramount because this enzyme shuts down the signalling pathways activated by the kinase, preventing unrestricted transmission of signals.
- Protein phosphatase is involved in a series of important physiological activities such as regulating enzyme activity, assembling large-molecular protein, intracellular protein distribution, regulating proteolysis, signal pathways, cell cycle, T cell activation and neurotransmitter receptor activation. play an important role.
- Protein phosphatase 2 regulatory subunit A total enzyme (prote in phosphatase 2 (PP2A)) is found in various cells and accounts for 0.3-1% of total cellular protein, which is the main serine / tyrosine in the cell
- P2A prote in phosphatase 2
- a total enzyme is found in various cells and accounts for 0.3-1% of total cellular protein, which is the main serine / tyrosine in the cell
- One of the acidic protein phosphatases, which regulates mitogen-activated protein kinase (MAPK) plays an important role in physiological activities such as cell cycle regulation, growth factor signaling, and tumorigenesis.
- the PPP2R1B gene encodes a ⁇ isozyme of PP2A. It has now been found that mutations in PPP2R1B can cause lung cancer, rectal cancer, breast cancer, uterine cancer and other cancers, and are therefore considered to be a tumor suppressor gene.
- the PPP2R1B gene is one of the major serine / tyrosine protein phosphatases in the cell, regulates mitogen-activated protein kinases, and regulates cell cycle, growth factor signaling, and tumorigenesis. It plays an important role in the abnormal expression, which can cause abnormal cell proliferation, which in turn leads to embryonic development disorders and tumor diseases.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human PPP2R1B protein, and both have similar biological functions.
- the polypeptide of the present invention is one of the major serine / tyrosine protein phosphatases in the cell in vivo, and regulates mitogen-activated protein kinases, and plays an important role in physiological activities such as cell cycle regulation, growth factor signaling, and tumorigenesis.
- Abnormal expression can cause abnormal cell proliferation, which can lead to embryonic development disorders and tumor diseases. These diseases include, but are not limited to:
- Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.
- Absent in longitudinal direction Absence of upper limb radius / ulnar side, lower limb tibia / fibula side, etc .;
- Limb differentiation disorder Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multiple finger (toe) deformity, and finger (toe) deformity, horse tellurium varus etc .;
- Thyroglossal duct cysts atresia or stenosis of the digestive tract, ileal diverticulum, umbilical diaphragm, congenital umbilical hernia, congenital non-gangliomegaly, imperforate anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc .;
- Papilloma squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .; 2.
- Mesenchymal tissue :
- Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
- Nerve fiber [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges], ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;
- malignant melanoma [skin, mucous membrane], (malignant) hydatidiform mole, chorionic epithelial cancer [uterine], (malignant) supporter cells, stromal cell tumor, (malignant) granulosa cell tumor [ovary, testis],.
- Seminoma testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .;
- polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as embryonic developmental disorders, tumor diseases and the like.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human protein phosphatase 9.68.
- Agonist enhances human protein phosphatase 9.68 to stimulate cell proliferation and other organisms Function, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- a mammalian cell or a membrane preparation expressing human protein phosphatase 9.68 can be cultured with a labeled human protein phosphatase 9.68—in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human protein phosphatase 9.68 include antibodies, compounds, receptor deletions, and analogs that have been screened.
- An antagonist of human protein phosphatase 9.68 can bind to human protein phosphatase 9.68 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human protein phosphatase 9.68 can be added to the bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human protein phosphatase 9.68 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Peptide molecules capable of binding to human protein phosphatase 9.68 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9.68 molecules of human protein phosphatase should be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human protein phosphatase 9.68 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by direct injection of human protein phosphatase 9.68 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies against human protein phosphatase 9.68 include, but are not limited to, hybridoma technology (Kohler and Milste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morr et al, PNAS, 1985, 81: 6851). 0
- Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single chain antibodies against human protein phosphatase 9.68
- Antibodies against human protein phosphatase 9. 68 can be used in immunohistochemical techniques to detect human protein phosphatase 9. 68 in biopsy specimens.
- Monoclonal antibodies that bind to human protein phosphatase 9. 68 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human protein phosphatase 9.68 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human protein phosphatase 9.68.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human protein phosphatase 9.68.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human protein phosphatase 9.68.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human protein phosphatase 9.68 detected in the test can be used to explain the importance of human protein phosphatase 9.68 in various diseases and to diagnose diseases in which human protein phosphatase 9.68 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human protein phosphatase 9.68 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human protein phosphatase 9.68.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human protein phosphatase 9.68 to inhibit endogenous human protein phosphatase 9.68 activity.
- a mutated human protein phosphatase 9.68 may be a shortened human protein phosphatase 9.68 lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human protein phosphatase 9.68.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human protein phosphatase 9.68 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human protein phosphatase 9.68 can be found in existing literature
- a recombinant polynucleotide encoding human protein phosphatase 9.68 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human protein phosphatase 9.68 raRNA.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA and DNA and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphoryl The technology of oligonucleotide synthesis by amine chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human protein phosphatase 9.68 can be used for the diagnosis of diseases related to human protein phosphatase 9.68.
- the polynucleotide encoding human protein phosphatase 9. 68 can be used to detect the expression of human protein phosphatase 9. 68 or the abnormal expression of human protein phosphatase 9. 68 in a disease state.
- a DNA sequence encoding human protein phosphatase 9.68 can be used to hybridize biopsy specimens to determine the expression of human protein phosphatase 9.68.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- a microarray Microray
- a DNA chip also known as a "gene chip”
- 68 specific primers can also be used to detect human protein phosphatase 9.
- Detection of mutations in the human protein phosphatase 9.68 gene can also be used to diagnose human protein phosphatase 9.68-related diseases.
- Human protein phosphatase 9. 68 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human protein phosphatase 9. 68 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
- Fluorescent in situ hybridization (FI SH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FI SH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mende l i an
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- containers containing one or more ingredients of the pharmaceutical composition of the invention.
- the polypeptides of the invention can be used in combination with other therapeutic compounds. .
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human protein phosphatase 9. 68 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human protein phosphatase 9.68 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89542/01A AU8954201A (en) | 2000-06-14 | 2001-06-11 | A novel polypeptide, a human phosphatase protein 9.68 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00116488.0 | 2000-06-14 | ||
CN 00116488 CN1328148A (en) | 2000-06-14 | 2000-06-14 | Polypeptide-human protein phosphatase 9.68 and polynucleotide for coding it |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2002000834A2 true WO2002000834A2 (en) | 2002-01-03 |
WO2002000834A3 WO2002000834A3 (en) | 2002-04-18 |
Family
ID=4585892
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000962 WO2002000834A2 (en) | 2000-06-14 | 2001-06-11 | A novel polypeptide--human protein phosphatase 9.68 and the polynucleotide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1328148A (en) |
AU (1) | AU8954201A (en) |
WO (1) | WO2002000834A2 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998024915A1 (en) * | 1996-12-04 | 1998-06-11 | Vereniging Het Nederlands Kanker Instituut | Protein phosphatase 2a subunit polypeptide |
-
2000
- 2000-06-14 CN CN 00116488 patent/CN1328148A/en active Pending
-
2001
- 2001-06-11 WO PCT/CN2001/000962 patent/WO2002000834A2/en active Application Filing
- 2001-06-11 AU AU89542/01A patent/AU8954201A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998024915A1 (en) * | 1996-12-04 | 1998-06-11 | Vereniging Het Nederlands Kanker Instituut | Protein phosphatase 2a subunit polypeptide |
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [Online] 18 February 2000 TRACEY A. Retrieved from NCBI, accession no. GI:6425593 Database accession no. (AL096712.20) * |
DATABASE PROTEIN [Online] 10 March 1997 WESTIN E.H. ET AL. Retrieved from NCBI, accession no. GI:1872200 Database accession no. (AAB49034.1) * |
Also Published As
Publication number | Publication date |
---|---|
AU8954201A (en) | 2002-01-08 |
WO2002000834A3 (en) | 2002-04-18 |
CN1328148A (en) | 2001-12-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002006477A1 (en) | A novel polypeptide-homo topoisomerase 12.1 and polynucleotide encoding said polypeptide | |
WO2002026812A1 (en) | A novel peptide---human dna cgg repeated associative protein 16.17 and the polynucleotide coding this novel peptide | |
WO2002006334A1 (en) | A novel polypeptide - human large protein 10.01 and a polynucleotide encoding the same | |
WO2002000829A2 (en) | A novel peptide--- human ftsh protein 16.83 and the polynucleotide coding this novel peptide | |
WO2002000834A2 (en) | A novel polypeptide--human protein phosphatase 9.68 and the polynucleotide | |
WO2002048355A1 (en) | A novel polypeptide, a human garp protein 12.98 and the polynucleotide encoding the polypeptide | |
WO2002012318A1 (en) | A novel peptide--glycophosphatidylinositol f11.22 and the polynucleotide coding this novel peptide | |
WO2002006335A1 (en) | A novel polypeptide - human serine/threonine protein kinase 16.17 and a polynucleotide encoding the same | |
WO2002012302A1 (en) | A novel polypeptide-the human splicing factor 9.24 and the polynucleotide encoding said polypeptide | |
WO2001075101A1 (en) | A novel polypeptide- human transcription regulator 8 and the polynucleotide encoding said polypeptide | |
WO2001070965A1 (en) | A novel polypeptide, a human regulatory transcription factor 15 and the polynucleotide encoding the polypeptide | |
WO2001070956A1 (en) | A novel polypeptide, a human dna mismatch repair protein 8 and the polynucleotide encoding the polypeptide | |
WO2001075048A2 (en) | A novel polypeptide, human ribosomal protein s11 23 and the polynucleotide encoding the polypeptide | |
WO2001066584A1 (en) | A novel polypeptide, human pax protein 9 and the polynucleotide encoding thereof | |
WO2002012313A1 (en) | A novel polypeptide - human protein phosphatase 12.43 and a polynucleotide encoding the same | |
WO2002011512A1 (en) | Novel polypeptide--the human mitochonrial cadherin 10.12 and polynucleotide encoding it | |
WO2001090172A1 (en) | A novel polypeptide-human ribosomal l39 protein 13 and the polynucleotide encoding said polypeptide | |
WO2002012300A1 (en) | A novel polypeptide-human cyclin g29.13 and the polynucleotide encoding said polypeptide | |
WO2002032948A1 (en) | A novel polypeptide-homo macro-protein 10.12 and polynucleotide encoding said polypeptide | |
WO2001064735A1 (en) | A NOVEL POLYPEPTIDE - HUMAN CHAPERONIN cpn60 PROTEIN 8 AND A POLYNUCLEOTIDE SEQUENCE ENCODING THE SAME | |
WO2001075053A2 (en) | A novel polypeptide, human chaperonine 14 and the polynucleotide encoding the polypeptide | |
WO2002012493A1 (en) | Novel polypeptide--- an insulin like growth factor binding protein 11.88 and polynucleotide encoding it | |
WO2002006488A1 (en) | A NOVEL POLYPEPTIDE, A HUMAN DNA POLYMERASE δ 12.65 AND THE POLYNUCLEOTIDE ENCODING THE POLYPEPTIDE | |
WO2002026969A1 (en) | A novel polypeptide-human dna-dependent rna polymerase ac40 subunit inhibitor 9.13 and the polynucleotide encoding said polypeptide | |
WO2002020588A1 (en) | A novel polypeptide-human transcriptional control factor zfm1 isomer 25.63 and the polynucleotide encoding said polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |