WO2001075053A2 - A novel polypeptide, human chaperonine 14 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, human chaperonine 14 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001075053A2 WO2001075053A2 PCT/CN2001/000500 CN0100500W WO0175053A2 WO 2001075053 A2 WO2001075053 A2 WO 2001075053A2 CN 0100500 W CN0100500 W CN 0100500W WO 0175053 A2 WO0175053 A2 WO 0175053A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- sequence
- chaperone protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human chaperone protein 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
- Chaperone proteins are involved in many important biological processes such as protein folding and aggregation of oligomeric protein complexes, maintaining protein precursors in an unfolded state to facilitate protein transmembrane transport, and enabling denatured proteins to be disaggregated and repaired. It is mainly to help other peptides maintain the normal conformation to form the correct oligomeric structure, thereby exerting normal physiological functions. They are widely distributed, from bacteria to humans, animals and plants, and are abundant in prokaryotes, chloroplasts and mitochondria. The abnormal expression of such proteins in the organism will lead to the formation of normal conformations of some proteins, which will affect the normal physiological functions of various proteins and cause various diseases related to abnormal transport of substances, such as some metabolic disorders, immune disorders, etc. .
- the chaperone forms an oligomeric complex, which is composed of two different subunits: one is a 60 Kd protein, such as cpn60 (groEL in bacteria); the other is a 13 Kd protein, such as c pnl O (in G roES in bacteria). They all interact with some proteins in the body to regulate the functions of various proteins in the living body.
- the cpn60 protein has weak ATPase activity. This subunit of all chaperone proteins consists of highly conserved 55 0-580 amino acid residues. The cpn60 protein contains a conserved consensus sequence fragment consisting of 12 amino acid residues, which is shown below:
- This sequence fragment is an important part of the interaction of this subunit with other proteins to coordinate the molecular chaperone to perform normal physiological functions. This fragment is also an important site for the ATPase activity of this subunit. Mutations in this sequence segment will cause the subunit to malfunction, which will affect the function of the entire chaperone in the organism.
- the protein can also combine with other related proteins in the body to play a variety of similar protein regulation. Therefore, it is closely related to the occurrence of diseases such as various metabolic disorders and immune system disorders in the body.
- the human chaperone protein 1 4 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes
- the human chaperone protein 1 4 protein, especially the amino acid sequence of this protein is identified. Isolation of the new chaperone protein 1 4 protein-coding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human chaperone protein 1 4.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human chaperone protein 1 4.
- Another object of the present invention is to provide a method for producing a human chaperone protein 14.
- Another object of the present invention is to provide an antibody against the polypeptide-human chaperone protein 1 4 of the present invention.
- Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide-human chaperone protein 1 4 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human chaperone protein 14.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 400-780 in SEQ ID NO: 1; and (b) a sequence having 1-1226 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human chaperone protein 14 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human chaperone protein 1 4 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human chaperone protein 14.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with a human chaperone protein 14, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human chaperone protein 14.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human chaperone protein 14 when combined with human chaperone protein 14.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human chaperone protein 14.
- Regular refers to a change in the function of human chaperone protein 14, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human chaperone protein 14.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human chaperone proteins using standard protein purification techniques.
- Substantially pure human chaperone protein 14 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human chaperone 14 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blot or Northern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean strict Conditions with reduced sex allow non-specific binding because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son Wis,). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. J., (1990) Methods in emzumology 183: 625-6400) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human chaperone protein 14.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human chaperone protein 1 4" means that human chaperone protein 1 4 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
- Those skilled in the art can purify human chaperone protein 14 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human chaperone protein 14 peptide can be analyzed by amino acid sequences.
- the present invention provides a new polypeptide, a human chaperone protein 14, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human chaperone protein 14.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human chaperone protein 1 4 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1,226 bases in length, and its open reading frame 400-780 encodes 126 amino acids.
- this peptide has a similar expression profile with the human molecular chaperone CPN60 protein 1 3, and it can be deduced that the human molecular chaperone protein 14 has a similar function to the human molecular chaperone CPN60 protein 13.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 xSSC, 0.1% SDS, 60 ° C; or (2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only in two sequences Crosses occur only when the identity between them is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
- core Acid fragments
- Nucleic acid fragments are at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides.
- Nucleic acid fragments It can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human chaperone protein 14.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human chaperone protein 14 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) measuring the level of the human molecular chaperone protein 14 transcript; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product for detecting the expression of the human chaperone protein 14 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention. Especially difficult to get from the library For full-length cDNA, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used.
- the primers used for PCR can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. .
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human chaperone protein 14 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- the polynucleotide sequence encoding the human chaperone protein 14 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human chaperone protein 14 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 on the late side of the origin of replication. SV40 enhancers up to 270 base pairs, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human chaperone protein 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human chaperone protein 14 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include but Not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC
- FIG. 1 is a comparison diagram of gene chip expression profiles of human chaperone protein 14 and human chaperone CPN60 protein 13 of the present invention.
- the upper graph is a graph of the expression profile of the human molecular chaperone protein 14, and the lower graph is the graph of the expression profile of the human molecular chaperone CPN60 protein 13.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates unstarved L02
- 8 indicates L02 +, lhr, As 3+
- 9 ECV304 PMA- 10
- ECV304 PMA + 11 fetal liver, 12 normal liver, 13 thyroid
- 14 skin
- 18 fetal spleen
- 20 is the prostate
- 21 is the fetal heart
- 22 is the heart
- 23 is the muscle
- 24 is the testis
- 25 is the fetal thymus
- 26 is the thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human chaperone protein 14 isolated.
- kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and one of the clones was found.
- the cDNA sequence of 0105E04 is new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the results show that the 0105E04 clone contains a full-length cDNA of 1226bp (as shown in Seq ID NO: 1), and a 380bp open reading frame (0RF) from 400bp to 780bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- Example 2 Cloning of a gene encoding human chaperone protein 14 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5 — AAATGCATACTGTTTTGGGCATAA— 3, (SEQ ID NO: 3)
- Primer2 5,-GTCCCTATCATTAAGCAAGAGCCT- 3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (C 1 on tech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perki nElmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min 0
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation cx- 32 P dATP with 32 P- DNA probe labeled by the random primer method.
- the DNA probe used was the PCR-encoded human molecular chaperone 14 coding region sequence (400bp to 780bp) shown in FIG. 1.
- a 32P-labeled probe (approximately 2 X 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20G g / mi salmon sperm DNA. After hybridization, the filters were placed in 1x SSC-0.1% SDS at 55. C Wash for 30min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human chaperone protein 14
- Primer3 5'- CCCCATATGATGTGTATATTATTACAACTATGT-3 '(Seq ID No: 5)
- Primer4 5 -CATGGATCCTCAGAGTGGGCTTTGAAGCTCCTT-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences at the 5 'and 3' ends of the target gene, respectively.
- BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
- the pBS-0105E04 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were: pBS- 0105E (M plasmid 10pg, primers Primer-3 and Primer- 4 points in 50 ⁇ 1 total volume) and 1 J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
- Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Digestion of the amplified product and plasmid pET-28 (+) with Ndel and BamHI, respectively, to recover large fragments, and use T4 Ligase ligation. The ligated product was transformed into E.
- coli DH5 CC using the calcium chloride method, cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), and positive clones were screened by colony PCR and sequenced. Select positive clones (PET-0105E04) with correct sequence and transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) with calcium chloride method.
- the host bacteria BL21 (pET-0105E04) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, and the culture was continued for 5 hours.
- the cells were collected by centrifugation, and broken by ultrasound. Collect the supernatant by centrifugation, and use 6His-Tag The purified affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used for chromatography to obtain the purified human protein chaperone protein 14.
- the following peptides specific for human chaperone protein 14 were synthesized using a peptide synthesizer (product of PE company): Ile-Lys- C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Use 4mg of the above blood blue eggs
- the white peptide complex plus complete Freund's adjuvant was used to immunize rabbits. After 15 days, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Probes 1 3 ⁇ l Probe (0.10D / 10 ⁇ 1), add 2 ⁇ IKinase buffer, 8-10 uCi ⁇ - 32 P- dATP + 2U Kinase, to make up to a final volume of 20 ⁇ 1.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many major national laboratory pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, silicon Wait on the carrier, then use fluorescence detection and computer software for data comparison and analysis, in order to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Hel Is, RA, Schema, M. Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5— Amino— propargy 2'— deoxyuridine 5'— triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) labeled human mixed tissue mRNA
- Cy5dUTP (5- Amino- propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified probes.
- Cy3dUTP 5— Amino— propargy 2'— deoxyuridine 5'— triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech
- Cy5dUTP 5- Am
- the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000
- the instrument purchased from General Scanning Company, USA was used for scanning.
- the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- Chaperone proteins are involved in many important biological processes such as protein folding and aggregation of oligomeric protein complexes, maintaining protein precursors in an unfolded state to facilitate protein transmembrane transport, and enabling denatured proteins to be disaggregated and repaired. It is mainly to assist other peptides to maintain the normal conformation to form the correct oligomeric structure, thereby exerting normal physiological functions.
- the specific sequence of the molecular chaperone subunit cpn60 protein is an important part of its interaction with other proteins to coordinate the normal physiological functions of the molecular chaperone. This fragment is also an important part of the ATPase activity of this subunit. Mutations in this sequence segment will cause the subunit to malfunction, which will affect the function of the entire chaperone in the organism.
- the abnormal expression of the specific cpn60 protein motif will cause the invention containing the motif
- the peptide functions abnormally, which leads to the loss of the functions of coordinating protein folding, disaggregation, assembly and repair after transmembrane transport, and produces related diseases such as tumors, embryonic developmental disorders, growth and development disorders, inflammation, etc.
- the abnormal expression of the molecular chaperone cpn60 protein 14 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include, but are not limited to:
- Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias , Bisexual deformity, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital cataract, Congenital glaucoma or cataract, Congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
- Inflammation various infections, allergic reactions, bronchial asthma, adult respiratory distress syndrome, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, Osteoporosis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, Graves' disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis , Systemic lupus erythematosus, myasthenia gravis, cerebrospinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener's granulomatosis, autoimmune thyroiditis, pancreatitis, myocarditis, atherosclerosis, multiple Scleroderma: various infections, allergic reactions, bronchial asthma, adult respiratory distress syndrome, rhe
- Abnormal expression of the molecular chaperone cpn60 protein 14 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human chaperone protein 1 4.
- Agonists enhance biological functions such as human chaperone protein 14 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human chaperonin 14 are cultured with labeled human chaperonin 14. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human chaperone protein 14 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of human chaperone protein 14 can bind to human chaperone protein 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human chaperonin 14 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human chaperonin 14 and its receptor.
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human chaperone protein 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the molecular chaperone protein 14 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against human molecular chaperone protein 14 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human chaperone protein 14 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human chaperone protein 14 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
- Existing techniques for producing single-chain antibodies can also be used to produce single chain antibodies against human chaperone protein 14.
- Antibodies against human chaperone protein 14 can be used in immunohistochemical techniques to detect human chaperone protein 14 in biopsy specimens.
- Monoclonal antibodies that bind to human chaperone protein 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Such as human chaperone protein 14 high affinity monoclonal antibodies can interact with bacterial or plant toxins (such as diphtheria toxin, ricin, red beans Base, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human molecular chaperone protein 14 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human molecular chaperone protein 14. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human chaperone protein 14.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human chaperone protein 14 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The levels of human chaperone protein 14 detected in the test can be used to explain the importance of human chaperone protein 1 4 in various diseases and to diagnose diseases in which human chaperone protein 14 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human chaperone proteins 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human chaperone protein 1 4.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human chaperone protein 14 to inhibit endogenous human chaperone protein 14 activity.
- a mutated human chaperone protein 14 may be a shortened human chaperone protein 14 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human chaperone protein 14.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human chaperone protein 14 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human chaperone protein 14 can be found in the existing literature (Sambrook, et al.).
- a polynucleotide encoding human chaperone protein 1 4 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human chaperone protein 14 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecule The DM sequence was obtained by in vitro or in vivo transcription.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human chaperone protein 14 can be used for the diagnosis of diseases related to human chaperone protein 14.
- the polynucleotide encoding human chaperone protein 14 can be used to detect the expression of human chaperone protein 14 or the abnormal expression of human chaperone protein 14 in a disease state.
- the DNA sequence encoding human chaperone protein 14 can be used to hybridize biopsy specimens to determine the expression of human chaperone protein 14.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human chaperonin 14 specific primers can also be used to detect the transcription of human chaperonin 14 using RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Detection of mutations in the human chaperone protein 14 gene can also be used to diagnose human chaperone protein 14-related diseases.
- Human chaperone 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human chaperone 14 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so Northern blotting and Western blotting can be used to indirectly determine the presence or absence of mutations in a gene.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific cDNA library.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human chaperone protein 14 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human chaperone proteins administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU63727/01A AU6372701A (en) | 2000-03-29 | 2001-03-26 | A novel polypeptide, human chaperonine 14 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115285 CN1315449A (en) | 2000-03-29 | 2000-03-29 | Polypeptide-human molecular chaperone protein 14 and polynucleotide for coding it |
CN00115285.8 | 2000-03-29 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075053A2 true WO2001075053A2 (en) | 2001-10-11 |
WO2001075053A3 WO2001075053A3 (en) | 2002-02-28 |
Family
ID=4584753
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000500 WO2001075053A2 (en) | 2000-03-29 | 2001-03-26 | A novel polypeptide, human chaperonine 14 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315449A (en) |
AU (1) | AU6372701A (en) |
WO (1) | WO2001075053A2 (en) |
-
2000
- 2000-03-29 CN CN 00115285 patent/CN1315449A/en active Pending
-
2001
- 2001-03-26 AU AU63727/01A patent/AU6372701A/en not_active Abandoned
- 2001-03-26 WO PCT/CN2001/000500 patent/WO2001075053A2/en active Application Filing
Non-Patent Citations (4)
Title |
---|
BIOCHEM. MOL. MED. vol. 58, no. 1, 1996, pages 52 - 58 * |
BIOCHIM. BIOPHYS. ACTA vol. 1218, no. 3, 1994, pages 478 - 480 * |
BIOCHIM. BIOPHYS. ACTA vol. 1219, no. 1, 1994, pages 189 - 190 * |
SOMAT. CELL MOL. GENET. vol. 24, no. 6, 1998, pages 315 - 326 * |
Also Published As
Publication number | Publication date |
---|---|
CN1315449A (en) | 2001-10-03 |
WO2001075053A3 (en) | 2002-02-28 |
AU6372701A (en) | 2001-10-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001046410A1 (en) | A novel polypeptide- chaperone cpn60 protein 13 and the polynucleotide encoding said polypeptide | |
WO2001075053A2 (en) | A novel polypeptide, human chaperonine 14 and the polynucleotide encoding the polypeptide | |
WO2001046409A1 (en) | A novel polypeptide- ribosome s7 protein 9 and the polynucleotide encoding said polypeptide | |
WO2001075048A2 (en) | A novel polypeptide, human ribosomal protein s11 23 and the polynucleotide encoding the polypeptide | |
WO2001081594A1 (en) | A novel polypeptide, a human pax protein 17 and the polynucleotide encoding the polypeptide | |
WO2001070965A1 (en) | A novel polypeptide, a human regulatory transcription factor 15 and the polynucleotide encoding the polypeptide | |
WO2001072801A1 (en) | A novel polypeptide - human ribosomal s11 protein 12 and a polynucleotide sequence encoding the same | |
WO2001064735A1 (en) | A NOVEL POLYPEPTIDE - HUMAN CHAPERONIN cpn60 PROTEIN 8 AND A POLYNUCLEOTIDE SEQUENCE ENCODING THE SAME | |
WO2001075101A1 (en) | A novel polypeptide- human transcription regulator 8 and the polynucleotide encoding said polypeptide | |
WO2001066770A1 (en) | Novel polypeptide--- a human signal peptidase 15 and polynucleotide encoding it | |
WO2001072796A1 (en) | A novel polypeptide, a human cell differentiation transcription factor 11 and the polynucleotide encoding the polypeptide | |
WO2001073072A1 (en) | Novel polypeptide--- a human molecular chaperone 18 and polynucleotide encoding it | |
WO2001075003A2 (en) | A NOVEL POLYPEPTIDE, A HUMAN UTERUS PROTEIN ASSOCIATED WITH A cpn 60 26 MOLECULE AND THE POLYNUCLEOTIDE ENCODING THE POLYPEPTIDE | |
WO2001070956A1 (en) | A novel polypeptide, a human dna mismatch repair protein 8 and the polynucleotide encoding the polypeptide | |
WO2001081399A1 (en) | A novel polypeptide, a human pax protein 14 and the polynucleotide encoding the polypeptide | |
WO2001090173A1 (en) | A novel polypeptide, a molecular chaperone cpn60 protein 10 and the polynucleotide encoding the polypeptide | |
WO2001079437A2 (en) | Novel polypeptide a human cell differential transcriptional factor 14 and polynucleotide encoding it | |
WO2001074893A1 (en) | A novel polypeptide - human regulatory transcription factor 11.8 and a polynucleotide sequence encoding the same | |
WO2001048194A1 (en) | A novel polypeptide-ribosome protein s18 13 and the polynucleotide encoding said polypeptide | |
WO2001046411A1 (en) | A novel polypeptide, a ribosomal protein s17 10 and the polynucleotide encoding the polypeptide | |
WO2001048198A1 (en) | A novel polypeptide, a ribosomal protein s4 8 and the polynucleotide encoding the polypeptide | |
WO2001081396A1 (en) | A new polypeptide - human ribosomal s7 protein 14 and the polynucleotide encoding it | |
WO2001066581A1 (en) | A novel polypeptide, human ribosomal protein s4-19 and the polynucleotide encoding thereof | |
WO2001072795A1 (en) | A novel polypeptide, a human quinoprotein reductase 16 and the polynucleotide encoding the polypeptide | |
WO2001048010A1 (en) | A NOVEL POLYPEPTIDE - RIBOSOMAL s19e PROTEIN 10 AND A POLYNUCLEOTIDE ENCODING THE SAME |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |