WO2002026812A1 - A novel peptide---human dna cgg repeated associative protein 16.17 and the polynucleotide coding this novel peptide - Google Patents

Abstract

The invention disclosed a novel peptide--- Human DNA CGG Repeated associative protein 16.17, polynucleotide coding this peptide and the method producing this peptide by DNA recombination techniques. This invention also disclosed the therapeutical methods with this peptide for several diseases, such as embryo heteroplasia, tumors and illness of protein decompensation, et al. This invention also disclosed an antagonist against this peptide and its therapeutical effect. The invention also disclosed the use of this polynucleotide coding the novel human DNA CGG Repeated associative protein 16.17.

Description

A New Polypeptide-Human DNA CGG Repeat Binding Protein 16.17 and Polynucleotide Encoding the Polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ~~ A-type DNA CGG repeat binding protein 16.17, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. technical background

Repeated DNA is a major component of the human genome. Unstable triple-line repeats have been linked to several major neurodegenerative diseases [Warren, ST, and Nelson, DL1993. Curr. Opin. Neurobiol. 3, 752-759] [Warren, ST1996. Science271, 1374-1375] [Ashley, CT, Jr., and Warren, ST1995. Annu. Rev. Genet. 29, 703-728]. The amplification of these repeats can terminate the expression of adjacent genes or directly affect their amino acid sequence when the repeats are part of the coding sequence [Pieretti, M., Zhang, FP, Fu, Υ. H., Warren, ST , Oostra, BA et al. 1991. Cell 66, 817-822] [Chung, MY, Ranum, LP, Duvick, LA et al. 1993. Nat. Genet. 5, 254-258]. Fragile X syndrome (FraX) usually causes mental retardation in men. A normal person has 5,-(CGG) _n -3 on Xq27.3, and the repeater usually has a n value of 6-50, and the value can reach 50-200 on the corresponding chromosome of a non-symptomatic pre-mutation carrier, and Through maternal inheritance and methylation of these amplifying repeats, the fragile X syndrome is directly caused [Chiurazzi, P., Pouponi,. G., Willemsen, R., Oostra, BA, et al . 1998. Hum. Mol. Genet. 7, 109-113].

The 5,-(CGG) _n -3 'repeat is located in the 5, untranslated region (UTR) of the fragile X syndrome 1 gene (FMR1). If the n value is greater than 200 and the gene is methylated and inactivated, the gene product will be widely expressed in many human tissues, the first being the human nervous system [Devys, D., Lutz, Y., Rouyer, et al. 1993 Nat. Genet. 4, 335-340].

Recently, biologists found a 20kDa 5,-(CGG) _n -3,-binding protein from the nucleus of human HeLa cells, named the CGBGP1 or p20 protein. The p20 protein is a nuclear protein and is abundantly expressed in mammals [Deissler, H., WUm, M., Genc, et al. 1997. J. Biol. Chem. 272, 16761-16768], and is specific in the human genome Binding to 5,-(CGG) _n -3, repeaters. The p20 protein is located in the nucleus and carries nuclear localization signals (NLS) between 80 and 84. The amino acid residues between 69 and 71 and between 95 and 167 are responsible for binding to 5,-(CGG) _n -3, . Because p20 protein can bind to the human FMR1 protein promoter, p20 protein (at least when overexpressed in human cells) can reduce the activity of the promoter, and the degree of inhibition may depend on 5'- (CGG) _n -3 ' Repeater length, especially when repeaters are amplified. The p20 protein may exist as an oligomer when it binds to 5'- (CGG) _n -3 '.

The P20 protein can specifically bind to the 28s ribosomal RNA gene-rich 5, _ (CGG) _n -3, regions on the short arms of human chromosomes 13, 14, 15, 21, and 22. In the next 5,-(CGG) _n -3 repeat repeat amplification reaction, the P20 protein can inactivate the FMR1 gene.

 Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, F ibrob las t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 10ΠΗΤ, Scar into fc without stimulation with growth factor, 1013HC :, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer, the present invention The expression profile of the peptide is very similar to the expression profile of the human DM CGG repeat binding protein, so their functions may be similar. The invention is named human DNA CGG repeat binding protein 16.17.

 As described above, the human DNA CGG repeat binding protein 16.17 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art The human DM CGG repeat binding protein 16.17 protein involved in these processes, in particular the amino acid sequence of this protein was identified. New human DNA CGG repeat binding protein 16.17 The isolation of the protein-encoding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention

 An object of the present invention is to provide an isolated novel polypeptide-human DNA CGG repeat binding protein 16.17 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human DNA CGG repeat binding protein 16.17.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human DNA CGG repeat binding protein 16.17.

Another object of the present invention is to provide a method for producing a human DNA CGG repeat binding protein. 16. 17. Another object of the present invention is to provide an antibody against the polypeptide-human DNA CGG repeat binding protein 16.17 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-human DNA CGG repeat binding protein 16.17 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human DM CGG repeat binding protein 16.17. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No., or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 511-5954 in SEQ ID NO: 1; and (b) a sequence having 1-1570 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human DM CGG repeat binding protein 16.17 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human DNA CGG repeat binding protein 16.17 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the polypeptide and / or polynucleotide of the present invention in the preparation for the treatment of cancer, developmental disease or immune disease or other due to human DNA CGG repeat binding protein 16. 17 abnormal expression cited Use of medicines for diseases.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human DNA CGG repeat binding protein 16. 17 and human DM CGG repeat binding protein according to the present invention. The upper graph is a graph of the expression profile of human DNA CGG repeat binding protein 16.17, and the lower graph is the graph of the expression profile of human DM CGG repeat binding protein. Among them, 1-bladder mucosa, 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5- Fibroblas t, growth factor stimulation, 1024NT, 6- scar fc growth factor Stimulation, 101 3HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13- Placenta, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human DNA CGG repeat binding protein 16.17. 16kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Is missing.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" is a molecule that, when combined with the human DNA CGG repeat binding protein 16.17, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human DNA CGG repeat binding protein 16.17.

 "Antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human DNA CGG repeat binding protein 16.17 when combined with human DM CGG repeat binding protein 16.17. . Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human DNA CGG repeat binding protein 16.17.

 "Regulation" refers to changes in the function of human DNA CGG repeat binding protein 16.17, including the increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of human DM CGG repeat binding protein 16.17 Or changes in immune properties.

"Substantially pure ¹ 'means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify human DM CGG repeat binding protein 16. 17 The substantially pure human DNA CGG repeat binding protein 16. 17 can generate a single main band on a non-reducing polyacrylamide gel. The human DM CGG repeat binding protein 16. 17 The purity of the polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding because conditions with reduced stringency require two sequences Mutual binding is specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged into clusters. Each cluster is then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues between sequence and sequence

^ Sequence of residues - the sequence of spacer residues - the sequence of residues ^X interval S

The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Me thods in enzymology 183: 625-645). ₀

"Similarity" refers to the degree of identical or 'conservative substitutions' of amino acid residues at corresponding positions in the alignment between amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b ')} 2 and F _V, which specifically binds to human DM CGG repeat protein antigen binding determinants 16.17.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated human DM CGG repeat binding protein 16. 17" refers to human DNA CGG repeat binding protein 16. 17 which is substantially free of other proteins, lipids, carbohydrates or other substances naturally associated with it. Those skilled in the art can purify human DM CGG repeat binding protein 16.17 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human DM CGG repeat binding protein 16. 17 The purity of the polypeptide can be analyzed by amino acid sequence.

 The present invention provides a novel polypeptide-human DM CGG repeat binding protein 16. 17, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of the human DNA CGG repeat binding protein 16.17. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human DM CGG repeat binding protein 16.17 of the invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. Polynucleotides of the invention are found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1570 bases in length and its open reading frames 511-5954 encode 147 amino acids. Based acid. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with the human DNA CGG repeat binding protein, and it can be inferred that the human DNA CGG repeat binding protein 16.17 has a similar function as the human DNA CGG repeat binding protein.

 The polynucleotide of the present invention may be in the form of DM or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) L ° /。 Denaturing agents are added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /. Fi co l l, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate human DNA CGG repeat binding protein 16. 17 的 多 Nucleotides.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human DM CGG repeat binding protein 16.17 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. -When combined with polymerase reaction technology, even very few expression products can be cloned.

 The genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) the determination of the transcript level of human DNA CGG repeat binding protein 16.17 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of the human D CGG repeat binding protein 16. 17 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

Methods for Amplifying DNA / RNA Using PCR Techniques (Saiki, et a l. Science 1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain full-length CDM from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cD sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human DNA CGG repeat binding protein 16.17 coding sequence, and the recombinant technology to produce the present invention Said method of polypeptide.

 In the present invention, a polynucleotide sequence encoding a human DNA CGG repeat binding protein 16.17 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct recombinant expression vectors. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a MA sequence encoding human DM CGG repeat binding protein 16.17 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM. Synthesis technology, in vivo recombination technology, etc. (Sambroook, eta l. Molecular Cloning, a Laboratory Manua, Co. Harbor Harbor Labora tory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide the synthesis of raRNA. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of an enhancer sequence into the vector will Its transcription is enhanced in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a human DNA CGG repeat binding protein 16.17 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector. cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (Method _12, using the procedure well known in the art. Alternatively, it is a MgCl _2. If If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.

 By the conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human DNA CGG repeat binding protein 16. 17 (Sc ience, 1984; 224: 1431). Generally speaking, there are the following steps:

 (1) using the polynucleotide (or variant) encoding the human human MA CGG repeat binding protein 16.17 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

(2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and The cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

Repeated DNA is a major component of the human genome. The amplification of these repeats can terminate the expression of adjacent genes or directly affect their amino acid sequence when the repeats are part of the coding sequence. Human DNA CGG repeat-binding protein is a protein that specifically binds to the 5,-(CGG) _n -3, repeater in the human genome and is involved in or regulates the expression of certain genes. Abnormal expression in the body can cause abnormal gene expression in the human body, which in turn leads to the occurrence of related diseases.

The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human DNA CGG repeat binding protein, and both have similar biological functions. The polypeptide of the present invention is a protein that specifically binds to 5,-(CGG) _n -3, repeaters in the human genome in vivo, and is involved in or regulates the expression of certain genes. Abnormal expression can cause human gene expression. Abnormalities, which in turn lead to the development of embryonic malformations, tumors and disorders of protein metabolism. These diseases include but are not limited to:

 Common Embryonic Malformations

 1. Common deformities of face, neck and limbs:

 1. Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.

 2. Common deformities of the limbs:

 1) Missing limbs:

 Horizontal absence (congenital short limbs): no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;

 Seal-like hand / foot deformities, etc .;

 2) Limb differentiation disorder: Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, and finger (toe) deformity, horseshoe varus, etc .;

Common malformations of the digestive system: Thyroglossal duct cysts, atresia or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital aganglion-free giant colon, impotence of the anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc

 3. Common malformations of the respiratory system: laryngotracheal stenosis / occlusion, tracheoesophageal fistula, hyaline membrane disease, unilateral lung does not occur, ectopic lung lobe, congenital lung cyst, pulmonary insufficiency, etc .;

 4. Common deformities of the urinary system: polycystic kidney, ectopic kidney, horseshoe kidney, double ureter, umbilical fistula, bladder eversion, etc.

 V. Common malformations of the reproductive system: cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, true / false hermaphroditism, testicular feminization syndrome, etc.

 6. Common malformations of the cardiovascular system: atrial septal defect, ventricular septal defect, abnormal separation of arterial trunk (dislocation of aorta and pulmonary artery, aortic or pulmonary stenosis), open artery duct, etc.

 7. Common malformations of the nervous system: neural tube defects (no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele), hydrocephalus inside / outside the brain, etc.

 8. Common malformations of eyes and ears: iris defect, retention of pupillary membrane, congenital cataract, congenital glaucoma, sole / no / small eye deformity, congenital deafness, auricle deformity, etc.

 Common tumors in various tissues:

 I. Epithelial tissue:

 Papilloma, squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenomas (carcinoma) [ovary], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;

 Mesenchymal organization:

 Fibrous (sarcoma) [limbs], (Malignant) fibrohistiocytoma [limbs], lipo (sarcoma) [subcutaneous tissue, lower limbs, retroperitoneum], leiomyosarcoma (uterus and gastrointestinal), striated muscle (Sarcoma) [head and neck, genitourinary tract, limbs], hemangioma (sarcoma), lymphangioma (sarcoma) [skin, subcutaneous tissue, tongue, lips], bone (sarcoma) [cranium, long bone], (evil Giant cell tumor [femoral / tibia / upper humerus], cartilage (sarcoma) [hand and foot short bone, pelvis / rib / femur / humerus / scapula], synovial (sarcoma) tumor [knee / ankle / wrist / shoulder / Near the elbow], (malignant) mesothelioma [thoracic / peritoneal], etc .;

 Three. Lymphatic hematopoietic tissue:

 Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;

 4. Nervous tissue:

Nerve fiber (sarcoma) [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (evil Sex) meningiomas [meninges], ganglioblastomas / neuroblastomas [mediastinum and retroperitoneum / adrenal medulla], etc .;

 V. Other tumors:

 Moles, malignant melanoma [skin, mucous membrane], (malignant) hydatidiform mole, chorionic epithelial cancer [uterine], (malignant) supporter cells, stromal cell tumor, (malignant) granulosa cell tumor [ovarian, testicular], fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .;

 Diseases related to protein metabolism disorders

 Disorders of protein metabolism can affect the following major physiological functions of proteins, which can lead to the occurrence of related diseases:

 I. Provide body energy to maintain tissue growth, renewal and repair:

 Muscle atrophy, weak limbs, weight loss, severe cases can be "caustic"

 2. Produce some physiologically active substances, such as hormones, antibodies, amines, etc .:

 1. Protein peptide hormone dysfunction can cause the following diseases:

 1) Insulin and glucagon: diabetes, hypoglycemia, etc .;

 2) Hypothalamus and pituitary hormones: Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;

 3) parathyroid hormone: hyperparathyroidism, hypoparathyroidism, etc .;

 4) Gastrointestinal hormones: peptic ulcer, chronic indigestion, chronic gastritis, etc .;

 2. Disorders of amine metabolism can cause the following diseases:

 Arrhythmia, shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;

 3. Antibody deficiency is prone to various infections:

 Septicemia, suppurative meningitis, pneumonia, bronchitis, otitis media, pyoderma, etc .;

 Physiological effects of certain proteins:

Various hemoglobin diseases (anemia, jaundice, tissue hypoxia-induced organic acidemia), various coagulation factors Deficiency (bleeding), muscle spasm, muscle coercion, muscle paralysis (actin), hyperlipoproteinemia, etc. In summary, the polypeptide of the present invention and its antagonist, agonist and inhibitor can be used directly Treatment of a variety of diseases, such as embryonic malformations, tumors, and disorders of protein metabolism.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human DNA CGG repeat binding protein 16.17. Agonists enhance human DM CGG repeat binding protein 16. 17 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human DNA CGG repeat binding protein 16.17 can be cultured with labeled human DM CGG repeat binding protein I ^6. I ⁷ in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human DNA CGG repeat binding protein 16. 17 include antibodies, compounds, receptor deletions and analogs that have been screened. Antagonist of human DNA CGG repeat binding protein 16.17 can bind to human DM CGG repeat binding protein 16.17 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.

 When screening compounds as antagonists, human DNA CGG repeat binding protein 16.17 can be added to the bioanalytical assay by determining the effect of the compound on the interaction between human DM CGG repeat binding protein 16.17 and its receptors Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human DM CGG repeat binding protein 16. 17 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human DM CGG repeat binding protein 16.17 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human DNA CGG repeat binding protein 16.17 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human DNA CGG repeat binding protein 16.17 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on. Techniques for preparing monoclonal antibodies to human DM CGG repeat binding protein 16.17 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, E-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) It can also be used to produce single chain antibodies against human DM CGG repeat binding protein 16.17.

 Antibodies against human DM CGG repeat binding protein 16. 17 can be used in immunohistochemical techniques to detect human DNA CGG repeat binding protein 16. 17 in biopsy specimens.

 Monoclonal antibodies that bind to human DNA CGG repeat binding protein 16.17 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human DM CGG repeat binding protein 16. 17 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human DNA CGG repeat binding protein 16. 17 Positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human DM CGG repeat binding protein 16.17. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human DNA CGG repeat binding protein 16.17.

 The present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human DNA CGG repeat binding protein 16.17. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of 16.17 human DM CGG repeat binding protein detected in the test can be used to explain the importance of human DNA CGG repeat binding protein 16. 17 in various diseases and to diagnose human DM CGG repeat binding protein 16. 17 A working disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding the human DM CGG repeat binding protein 16.17 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human DNA CGG repeat binding protein 16.17. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human DM CGG repeat binding protein 16.17 to inhibit endogenous human DNA CGG repeat binding protein 16.17 activity. For example, a variant human DNA CGG repeat binding protein 16.17 may be a shortened human MA CGG repeat binding protein 16.17 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling active. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human DNA CGG repeat binding protein 16.17. Virus-derived expression vectors such as retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode the human DNA CGG repeat binding protein 16. 17 The polynucleotide is transferred into the cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human DM CGG repeat binding protein 16.17 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human DNA CGG repeat binding protein 16.17 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RM and DM) and ribozymes that inhibit human DM CGG repeat binding protein 16.17 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation. Antisense RNA, DM and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

 The polynucleotide encoding human DNA CGG repeat binding protein 16. 17 can be used for the diagnosis of diseases related to human DNA CGG repeat binding protein 16. 17. The polynucleotide encoding human DNA CGG repeat binding protein 16. 17 can be used to detect the expression of human DNA CGG repeat binding protein 16. 17 or abnormal expression of human DNA CGG repeat binding protein 16. 17 in a disease state. For example, the DNA sequence encoding human DM CGG repeat binding protein 16. 17 can be used to hybridize biopsy specimens to determine the expression of human DNA CGG repeat binding protein 16. 17. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human DNA CGG repeat binding protein 16. 17 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human DNA CGG repeat binding protein 16. 17 transcription products.

Detection of mutations in the human DNA CGG repeat binding protein 16.17 gene can also be used to diagnose human DNA CGG repeat binding protein 16.17-related diseases. Human DNA CGG repeat binding protein 16.17 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human DNA CGG repeat binding protein 16.17 DNA sequence. Available technologies such as Southern India Detection of mutations by trace method, D sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inheri tance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers Liquid, glycerin and their combinations. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human DNA CGG repeat binding protein 16. 17 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human DNA CGG repeat binding protein 16.17 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, experimental conditions without specific conditions are generally described according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), Or as recommended by the manufacturer.

 Example 1 Cloning of human DM CGG repeat binding protein 16.17

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRM forms cDNA by reverse transcription. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0613H01 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full-length cDNA contained in clone 0613H01 is 1570bp (as shown in Seq ID N0: l), and has a 443bp open reading frame (0RF) from 511bp to 95 ⁴ b _P , which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS-0613H01 and the encoded protein was named human DNA CGG repeat binding protein 16.17. Example 2 The gene encoding human DNA CGG recombination protein 16.17 was cloned by the RT-PCR method. Fetal brain cells were used as a template, and oligo-dT was used as a primer for reverse transcription to synthesize cDNA. The following primers are used for PCR amplification:

 Primerl: 5,-GATGGCTTTGTGCTCCCAGCCTTT -3, (SEQ ID NO: 3)

 Primer2: 5'- GTAAGGAACATTAATTCTTTAATG -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Amplification conditions: 50 μl reaction volume containing 50 mmol / LKCl, 10 mraol / L Tris-HCl pH 8.5, 1.5 mmol / L MgCl ₂ , 20 (^ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerization Enzyme (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. Simultaneously during RT-PCR Set β-act in as the positive control and template blank as the negative control. The amplified product was purified using QIAGEN's kit, and TA clone kit was used to connect to the pCR vector (Invitrogen). The DNA sequence analysis results showed that the PCR product was The DNA sequence is exactly the same as l-1570bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human DNA CGG repeat binding protein 16.17 gene expression

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water. With 20μ ₈ RNA, electrophoresed on containing 20mM 3- (N- morpholino) propanesulfonic acid (pH7.0) 1.2% agarose gel -5mM -ImM EDTA-2.2M sodium acetate formaldehyde. It was then transferred to a nitrocellulose membrane. A- ³² P dATP with ^{32 Ρ} prepared by random priming Method - labeled DNA probe. The DNA probe used was the 16.17 coding region sequence (511bp to 954bp) of the PCR amplified human DNACGG repeat binding protein shown in FIG. 1. 32P-labeled probes (approximately 2 x 10 ⁶ cpra / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4) -5 x SSC-5 x Denhardt, s solution and 200 μg / ml salmon sperm DM. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4 In vitro expression, isolation, and purification of recombinant human DNA CGG repeat binding protein 16.17 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed. The columns are as follows:

Pr imer3: 5'-CCCCATATGATGCACTTGGGTGCTTTGTTCCCC-3 '(Seq ID No: 5) Pr iraer4: 5, -CATGGATCCTCAGATTCGGCCCTGAAGGGCCAC-3, (Seq ID No: 6) These two primers contain Ndel and BamHI digestion sites respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Ndel and BamHI restriction sites correspond to the expression vector plasmid pET- ² 8b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. A PCR reaction was performed using the PBS-0613H01 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of PBS-0613H01 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli bacteria M5 C using the calcium chloride method. After culturing overnight on LB plates containing kanamycin (final concentration 3 (^ g / ml)), positive clones were selected by colony PCR and sequenced. Select positive clones (PET-0613H01) with the correct sequence and transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) using calcium chloride method. In LB liquid containing kanamycin (final concentration 30μ _§ / ιη1) In the medium, the host strain BL21 (pET-0613H01) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and the culture was continued for 5 hours. The cells were collected by centrifugation, and the cells were collected by centrifugation and ultrasonication Chromatography using a His. Bind Quick Cartridge (Novagen) affinity chromatography column capable of binding 6 histidines (6His-Tag) to obtain purified human protein CGG repeat binding protein 16 17. After SDS-PAGE electrophoresis, a single band was obtained at 16 kDa (Figure 2). The band was transferred to a PVDF membrane and analyzed by N-terminal amino acid sequence using the Edams hydrolysis method. As a result, 15 N-terminal 15 amino acids at the N-terminus of SEQ ID NO: 2 The acid residues are exactly the same. Example 5 Production of anti-human DNA CGG repeat binding protein 16. 17 antibodies

 Using a peptide synthesizer (product of PE company), the following human DNA CGG repeat binding protein 16. 17 specific peptides were synthesized:

NH2-Met-His-Leu-Gly-Ala-Leu-Phe-Pro-Phe-Leu-His-Leu-Pro-Ala-His-C00H (SEQ ID NO: 7). The polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. I Jean-Unochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.釆 Using a 15 g / ml bovine serum albumin peptide complex-coated titer plate as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column and affinity chromatography was performed from total IgG. Isolation of anti-peptide antibodies. Immunoprecipitation demonstrated that the purified antibody could specifically bind to human DM CGG repeat binding protein 16.17. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% or more than 15 Two consecutive bases are completely the same, the primary probe should generally not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGCACTTGGGTGCTTTGTTCCCCTTTCTCCATTTGCCAGCC-3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

 5-TGCACTTGGGTGCTTTGTTCCCCTTTCTCCATTTGCCAGCC-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 (USA ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1, DNA extraction from fresh or frozen, tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 imnol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ral per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, D phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (Ix10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Protease K was added to a final concentration of ^{2 00ug} / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C gently shake overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol ( ²⁴ : 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. Of course After that, purification of DM and ethanol precipitation were performed.

 3.Purification and ethanol precipitation of DM

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until DM is fully dissolved, and add approximately 1 ul for each 1- 5 × 10 ^δ cells extracted.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DNA solution to a final concentration of 100u _g / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. 37. C was held for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well-20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A _2δ . And A ₂₈ . To check the purity and yield of DM. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place in 0.5raol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

3) Add 1/5 volume of bromophenol blue indicator (BPB). 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) The ³² P-Probe (the second peak is free γ- ³² P-dATP) to be prepared after the collection solution of the first peak is combined.

 Pre-hybridization

Place the sample membrane in a plastic bag and add the 3-1111 2 prehybridization solution (1 (^ 061111 _& 1 (^ '3; 6 33 (, 0.1rag / ml CT DNA (calf thymus DNA)). Seal the bag After the mouth, shake in a 68 ° C water bath for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 ° / oSDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C wash for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 40. Wash for 15 minutes (twice) and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results: '

的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with Probe 1. Practical Example 7 DNA Microarray

Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target D for gene chip technology for high-throughput research on the function of new genes; finding and screening new tissue-specific genes, especially diseases such as tumors _: related genes; diagnosis of diseases such as genetics Sexually transmitted diseases. The specific method steps have been reported in the literature. For example, see the literature DeRi si, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the amplified product was purified to adjust its concentration to about 500ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe labeling

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and another ¹ J was separated by reverse transcription. The fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare the probe. For specific steps and methods, see:

 Schena 'M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science. 270 (20): 467-480.

 (Three) cross

 The probes from the above two tissues and the chip were respectively hybridized in a UniHyb ™ Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of the human DNA CGG repeat-binding protein 16.17 and the human DM CGG repeat-binding protein according to the present invention are very similar.

Claims

Uncle demand

1. An isolated polypeptide-human DM CGG repeat binding protein 16.17, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative of the polypeptide Thing.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide (a); or.

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 511-1954 in SEQ ID NO: 1 or a sequence of positions 1-1570 in SEQ ID NO: 1. sequence.

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide described in any of claims 4-6 and a plasmid, virus or vector expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human DNA CGG repeat binding protein 16.17 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell of claim 8. under conditions of expressing human DNA CGG repeat binding protein 16.17;

(b) A polypeptide having human DNA CGG repeat binding protein 16.17 activity was isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human DM CGG repeat binding protein 16.17.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human DNA CGG repeat binding protein 16.17.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 1 3. A use of the compound according to claim 11, characterized in that the compound is used for regulating the activity of human DNA CGG repeat binding protein 16.17 in vitro and in vivo.

 14. A method for detecting a disease or disease susceptibility related to the polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression amount of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used to screen a mimic, agonist, antagonist or inhibitor of human DNA CGG repeat binding protein 16.17; Or used for peptide fingerprint identification.

 16. The use of a nucleic acid molecule as claimed in any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human DNA CGG repeat binding protein 16.17 abnormality.

 18. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.