WO2001036487A2 - Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognized thereby and cells obtained thereby - Google Patents
Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognized thereby and cells obtained thereby Download PDFInfo
- Publication number
- WO2001036487A2 WO2001036487A2 PCT/IB2000/001832 IB0001832W WO0136487A2 WO 2001036487 A2 WO2001036487 A2 WO 2001036487A2 IB 0001832 W IB0001832 W IB 0001832W WO 0136487 A2 WO0136487 A2 WO 0136487A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bdca
- cells
- antigen
- cell
- composition according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
- A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
- A61K47/6813—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin the drug being a peptidic cytokine, e.g. an interleukin or interferon
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
- A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
- A61K47/6817—Toxins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/04—Organic compounds
- A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
- A61K51/10—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
- A61K51/1027—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against receptors, cell-surface antigens or cell-surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/10—Antimycotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/14—Ectoparasiticides, e.g. scabicides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/7056—Lectin superfamily, e.g. CD23, CD72
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
- C12N5/064—Immunosuppressive dendritic cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5094—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for blood cell populations
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K2035/122—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells for inducing tolerance or supression of immune responses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5154—Antigen presenting cells [APCs], e.g. dendritic cells or macrophages
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/77—Internalization into the cell
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/998—Proteins not provided for elsewhere
Definitions
- the present invention relates to antibodies and derivatives thereof specific for subpopulations of dendritic cells (DCs).
- DCs dendritic cells
- Compositions and methods of use thereof are also provided including isolation and purification of DCs and subpopulations thereof and antibody- or ligand-mediated immunotherapy.
- the invention also provides substantially isolated DC subpopulations.
- Methods of use thereof are also provided including DC-based immunotherapy, characterization of various diseases and in vivo numeric DC expansion for instance with flt3-Ligand. BACKGROUND OF THE INVENTION
- DCs dendritic cells
- APCs potent antigen presenting cells
- Immunol. 150:821-834 Like in blood, there may be three distinct subsets of DCs present in the thymus: 1) plasmacytoid CD4+CDllc- DCs; 2) CD4+CDllc+ DCs and 3) interdigitating DCs. It has been proposed that thymic DCs and T cells arise from a common stem cell. Thomas et al. (1996) Stem Cells 14:196-206. Generation of large numbers of DCs for potential clinical use has recently been accomplished through the in vitro culturing of progenitors with cytokines. Various strategies have been adopted to introduce antigens into dendritic cells so that they may be more effectively presented to T cells in the context of costimulation. It has also been shown that dendritic cells can influence the T cell response to antigen to follow either a humoral or systemic pathway.
- T cells are unable to respond to unprocessed proteins, rather, they require accessory cells to present antigen as peptide epitopes displayed on the cell surface in conjunction with MHC molecules.
- Antigens generated endogenously in the cell cytoplasm are typically presented in the Class I pathway and stimulate cytotoxic T lymphocyte (CTL) reactions while exogenous protein is process in MHC Class II compartments and induce helper (CD4) T cell responses.
- CTL cytotoxic T lymphocyte
- CD4 helper
- the stimulation of na ⁇ ve T cells requires the presence of costimulatory molecules that act as secondary signals in the activation of primary immunity.
- APCs such as B cells and macrophages are typically incapable of inducing primary responses.
- dendritic cells drive their potency from the constitutive unregulated expression of costimulatory, adhesion and MHC Class I and II molecules essential for the initiation of effective cellular immunity.
- costimulatory, adhesion and MHC Class I and II molecules essential for the initiation of effective cellular immunity.
- DCs are APC that are essential for initiation of primary immune responses and the development of tolerance.
- DCs express MHC, necessary for stimulation of naive T cell populations.
- the hematopoietic development of DCs is distinct and may follow several precursor pathways, some of which are closely linked to monocytes. See, for review, Avigan (1999) Blood Rev. 13:51-64. Different DC subsets have distinct developmental pathways. The emerging concept is that one DC subset has regulatory functions that may contribute to the induction of tolerance to self-antigens. Austyn (1998) Curr. Opin. Hematol. 5:3-15.
- DCs, or a subset thereof may also be involved in the induction of immune responses to self-proteins. It is thought that certain autoimmune responses may be due to microenvironmental tissue injury followed by local DC activation and subsequent interaction with T cells to initiate an immune response.
- autoimmune responses may be due to microenvironmental tissue injury followed by local DC activation and subsequent interaction with T cells to initiate an immune response.
- DCs are generated in vitro from CD34 + cells or monocytes, pulsed with tumor-derived peptides or proteins and returned to the patient to act as APCs in cancer-specific T cell induction.
- Animal models have demonstrated that DC tumor vaccines reverse T cell anergy and result in subsequent tumor rejection.
- DC have also been proposed for use in enhancing immunity after stem cell transplantation. Brugger et al. (1999) Ann. NY Acad. Sci. 363-371. DCs play a number of potential roles in immunology. For instance, DCs are involved in human immunodeficiency virus (HTV) infection. Zoeteweij et al. (1998) J. Biomed. Sci. 5:253-259. DCs have also been proposed as suitable for use in HIV therapy. Weissman et al. (1997) Clin. Microbiol. Rev.
- HTV human immunodeficiency virus
- CDla + DCs are typically generated ex vivo from monocytes and from CD34 + hematopoietic progenitor cells. Bender et al. (1996) J. Immunol. Met. 196:121-135;
- CMRF44 A mAb designated CMRF44 has been used to monitor DCs in stem cell transplant patients.
- CMRF44 + cells were proposed to be suitable for use in initiating, maintaining and directing immune responses.
- US Patent No. 5,972,627 describes "hematopoietic cells enriched for human hematopoietic dendritic progenitor cells” as having "at least 80% expressing CD34,
- CD45RA and CD10 but not CD19, CD2, CD3, CD4, CD8, CD20, CD14, CD15, CD16 CD56 and glycophorin.”
- Isolation of DCs from blood relies on a multitude of immunophenotypic criteria, like the absence of a panel of leukocyte lineage (lin)-specific antigens (e.g. CD3, CD14, CD19 and CD56) and the presence of HLA-DR, CD4 or CD33.
- leukocyte lineage (lin)-specific antigens e.g. CD3, CD14, CD19 and CD56
- DC are not a homogeneous cell population but a mixture of at least two populations.
- the first blood DC subpopulation is CD123 b ⁇ ght CD1 lc ⁇ DC, which possesses a plasmacytoid morphology and potent T cell stimulatory function.
- the second blood DC subpopulation is CD123 dim GDI lc b ⁇ ght , which is rather monocytoid in appearance, expresses CD45RO and spontaneously develops into typical mature DCs even when cultured without any exogenous cytokines.
- Plasmacytoid CD123 b ⁇ ght CD1 lc ⁇ DC display some features, like the expression of the pre-T cell receptor ⁇ chain, which indicate that they may arise from lymphoid precursors. Strobl et al. (1998); Rissoan et al. (1999); and Bruno et al. (1997) J. Exp. Med. 185:875-884.
- CD123 dim CD1 lc bright DC display all the criteria of myeloid DCs. O'Doherty et al. (1994); and Ito et al. (1999). Robinson et al. (1999); Kohrgruber et al. (1999); and Strobl et al. (1998).
- DCs resembling plasmacytoid CD123 bight CDllc " DC have been detected in the T cell-rich areas of lymphoid tissue and were initially erroneously designated plasmacytoid T cells or plasmacytoid monocytes due to their morphology and phenotype.
- C-type lectins are a family of glycoproteins that exhibit amino acid sequence similarities in their carbohydrate recognition domains (CRD) and that bind to selected carbohydrates in a Ca 2+ -dependent manner. C-type lectins have been subdivided into four categories (Vasta et al., 1994; and Spiess 1990).
- the first group comprises type II membrane-integrated proteins, such as asialoglycoprotein receptors, macrophage galactose and N-acetyl glucosamine (GlcNac)-specific lectin, and CD23 (Fc ⁇ RLI).
- the second group includes cartilage and fibroblast proteoglycan core proteins.
- the third group includes the so-called “collectins” such as serum mannose-binding proteins, pulmonary surfactant protein SP-A, and conglutinin.
- the fourth group includes certain adhesion molecules known as LEC-CAMs (e.g., Mel-14, GMP-140, and ELAM-1).
- C-type lectins are known to function as agglutinins, opsonins, complement activators, and cell-associated recognition molecules (Vasta et al. 1994; Spiess 1990; and Kery 1991).
- macrophage mannose receptors serve a scavenger function (Shepherd et al., 1990), as well as mediating the uptake of pathogenic organisms, including Pneumocystis carinii (Ezekowitz et al. 1991) and Candida albicans (Ezekowitz et al. 1990).
- Serum mannose-binding protein mimics Clq in its capacity to activate complement through the classical pathway. Genetic mutations in this lectin predispose for severe recurrent infections, diarrhea, and failure to thrive (Reid et al. 1994).
- C-type lectins exhibit diverse functions with biological significance.
- Carbohydrate moieties do not necessarily serve as "natural" ligands for C-type lectins.
- CD23 FC ⁇ RII
- FC ⁇ RII which belongs to the C-type lectin family as verified by its binding of Gal-Gal-Nac (Kijimoto-Ochiai et al. 1994) and by its CRD sequence, is now known to recognize IgE in a carbohydrate-independent manner; an enzymatically deglycosylated form of IgE as well as recombinant (non-glycosylated) IgE produced in E. coli both bind to CD23 (Vercelli et al. 1989).
- C-type lectins recognize polypeptide sequences in their natural ligands.
- C-type lectins have been identified on the surface of DCs.
- Jiang et al. cloned the protein recognized by the NLDC-145 mAb, one of the most widely used mAb against murine DC (Jiang et al., 1995).
- This protein now termed DEC-205, was found to be a new member of the C-type lectin family, one that contains ten distinct CRD.
- Second, Sallusto et al. reported that human DC express macrophage mannose receptors (MMR), which also contain multiple CRD (Sallusto et al., 1995).
- MMR macrophage mannose receptors
- Both receptors have been proposed to mediate endocytosis of glycosylated molecules by DC, based on the observations that: a) polyclonal rabbit antibodies against DEC-205 not only bound to DEC-205 on DC surfaces, but were subsequently internalized; b) these DC activated effectively a T cell line reactive to ⁇ rabbit JgG; and c) intemalization of FITC-dextran by DC was blocked effectively with mannan, a mannose receptor competitor (Jiang et al. 1995; and Sallusto et al. 1995).
- DEC-205 is now known to be also expressed, albeit at lower levels, by B cells and epithelial cells in thymus, intestine, and lung (Witmer-Pack et al. 1995; and Inaba et al. 1995) and MMR is also expressed even more abundantly by macrophages (Stahl 1992).
- DC surfaces include DCIR, MDL-1, NURPIA,Dectin-l, Dectin-2, CLEC-1, CLEC-2, Langerin; and DC-sign. Allergies
- Allergic responses are characterized by an early phase response, which occurs within seconds to minutes of allergen exposure and is characterized by infiltration of eosinophils into the site of allergen exposure.
- an early phase response occurs within seconds to minutes of allergen exposure and is characterized by infiltration of eosinophils into the site of allergen exposure.
- activation of Th2-type lymphocytes stimulates the production of antigen-specific IgE antibodies, which in turn triggers the release of histamine and other mediators of inflammation from mast cells and basophils.
- IL-4 and IL-5 production by CD4+ Th2 cells is elevated.
- antigen immunotherapy for allergic disorders involves the subcutaneous injection of small, but gradually, increasing amounts, of antigen in a process called desensitization therapy. Antigen immunotherapy is merely palliative and, at present, not curative. Weber (1997) JAMA 278:1881-1887; Stevens (1998) Acta Clinica Beligica 53:66- 72; and Canadian Society of Allergy and Clinical Immunology (1995) Can. Med. Assoc. J. 152:1413-1419.
- Antigen immunotherapy treatments present the risk of inducing potentially lethal IgE- mediated anaphylaxis and do not address the cytokine-mediated events of the allergic late phase response. This therapy has been described as "having the potential for misadventure.” Weber (1997).
- Another significant problem with antigen immunotherapy is that the risk of adverse reactions, especially anaphylaxis, significantly reduces the dosage of antigen both ⁇ with respect to the amount given per administration and the amount given over a period of time.
- traditional allergy immunotherapy is protracted and thus time-consuming, inconvenient, and expensive.
- the invention relates to methods of enriching for hematopoietic cell populations enriched in DCs and subsets thereof. Compositions enriched for the cells and populations of cells obtained therefrom are also provided by the invention. Methods of making genetically modified DCs are also provided. Compositions of genetically modified DCs are also provided. Methods of use of the cells are also included. Antigen-binding fragments specific for BDCA-2 and BDCA-3 and the antigens recognized thereby are also provided.
- the invention encompasses antigen-binding fragments specific for a subset of DCs specifically recognized by an antibody designated AC144, AD5-1311, AD5-20E5, AD5- 17F6, AD5-4B8, AD5-5E8, AD5-14H12 or AD5-8E7.
- the invention encompasses antigen- binding fragments specific for an epitope of an antigen designated BDCA-2 (SEQ ID NO: ).
- the invention encompasses antigen-binding fragments specific for an epitope of an antigen designated BDCA-3.
- the invention encompasses a substantially isolated or concentrated DC population or subpopulation specifically recognized by an antigen-binding fragment of the invention.
- antigen-binding fragments can be any one of AC144, AD5-1311, AD5-20E5, AD5- 17F6, AD5-4B8, AD5-5E8, AD5-14H12 or AD5-8E7 or antigen-binding fragments specific for BDCA-1, BDCA-2, BDCA-3 or BDCA-4.
- Antigen-binding fragments recognizing neuropilin-1 also recognize BDCA-4 and are suitable for use herein.
- the invention further encompasses populations or subpopulations of DCs wherein substantially all of the cells express or are isolated, concentrated or enumerated on the basis of expression of at least one of BDCA-1 , BDCA-2, BDCA-3 and BDCA-4. These cells can be suspended in any physiologically acceptable excipient. Preferably, the excipient is pharmacologically acceptable.
- the invention further encompasses methods for obtaining compositions of hematopoietic cells enriched for DCs by separating a mixture of human hematopoietic cells into a fraction wherein at least 80% of the cells in the fraction are BDCA-1 "1" .
- the invention further encompasses methods for obtaining compositions of hematopoietic cells enriched for DCs by separating a mixture of human hematopoietic cells into a fraction wherein at least 80% of the cells in the fraction are BDCA-2 "1" .
- the invention further encompasses methods for obtaining compositions of hematopoietic cells enriched for DCs by separating a mixture of human hematopoietic cells into a fraction wherein at least 80% of the cells in the fraction are BDCA-3 + .
- the invention further encompasses methods for obtaining compositions of hematopoietic cells enriched for DCs by separating a mixture of human hematopoietic cells into a fraction wherein at least 80% of the cells in the fraction are BDCA-4 + .
- the invention further encompasses methods for isolating a substantially pure subset of DCs by a) obtaining a mixture of human hematopoietic cells; and b) substantially isolating cells from the mixture specifically recognized by an antigen-binding fragment specific for the antigen designated BDCA-2.
- the invention further encompasses methods for isolating a substantially pure subset of DCs by a) obtaining a mixture of human hematopoietic cells; and b) substantially isolating cells from the mixture specifically recognized by an antigen-binding fragment specific for the antigen designated BDCA-3.
- the invention further encompasses methods for isolating a substantially pure subset of DCs by a) obtaining a mixture of human hematopoietic cells; and b) substantially isolating cells from the mixture specifically recognized by an antigen-binding fragment specific for the antigen designated BDCA-4.
- the invention further encompasses methods for enumerating DCs by: a) obtaining a mixture of cells; and b) labeling the cells with an antigen-binding fragment specific for any one or more of the antigens BDCA-1, BDCA-2, BDCA-3, and BDCA-4.
- the invention further encompasses methods of modulating the immune capacity of DCs by: isolating a substantially pure population or subpopulation of DCs; and modulating the calcium mobilization of the DCs.
- the invention further encompasses methods of screening for test agents for the presence of pharmaceutically effective agents by isolating a substantially pure population or subpopulation of DCs with an antigen-binding fragment specific for any one or more of the antigens BDCA-1, BDCA-2, BDCA-3, and BDCA-4; screening the isolated cells with test agents; monitoring the response of the cells to the agents; comparing the response of the cells to the agents to cells exposed to a control agent; and determining whether the test agent modulated any one immunologic properties of the isolated cell.
- the invention further encompasses methods of modulating an immunologic property of DCs by altering the ability of the DC to mobilize calcium.
- the invention further encompasses immunogenic and immunomodulating compositions of DCs preferably in a physiologically acceptable excipient.
- the invention further encompasses methods of treating a physiologic condition by administering to a subject in need thereof an effective amount of immunogenic or immunomodulating compositions of DCs.
- the invention further encompasses methods of producing DC cytokines by isolating a substantially pure population or subpopulation of DCs with an antigen-binding fragment specific for any one or more of BDCA-1, BDCA-2, BDCA-3, and BDCA-4; and isolating cytokines from the cells or cellular products or supematants.
- the invention further encompasses methods of modulating DC cytokine production by isolating a substantially pure population or subpopulation of DCs with an antigen-binding fragment specific for any one or more of BDCA-1, BDCA-2, BDCA-3, and BDCA-4; and treating the cells with agents that modulate DC cytokine production.
- the invention further encompasses methods of modulating in vivo DC cytokine production by administering to a subject in need thereof an effective amount of an agent that modulates DC cytokine production.
- the invention further encompasses methods of generating antibodies specific for an antigen by administering to a subject in need thereof an effective amount of a substantially pure population or subpopulation of DCs loaded with the antigen and isolated with an antigen-binding fragment specific for any one or more of BDCA-1, BDCA-2, BDCA-3, and BDCA-4 wherein the DCs are modulated to induce a Th2 response.
- BDCA-1, BDCA-2, BDCA-3, and BDCA-4 wherein the cells are modulated to induce a Thl response.
- the invention further encompasses polypeptides prepared by expressing, in a recombinant host cell, the polypeptides and purifying the expressed polypeptide away from ' total recombinant host cell components, wherein the polypeptide contains about 5 contiguous amino acid residues from SEQ ID NO:2.
- the invention further encompasses of purified polypeptides and compositions thereof, wherein the polypeptide contains about 5 contiguous amino acid residues from SEQ ID NO:2.
- the invention further encompasses fusion proteins of a polypeptide amino acid sequence linked to a polypeptide amino acid sequence that is not SEQ ID NO: 2, wherein the amino acid sequence contains about 5 contiguous amino acid residues from SEQ ED NO:2.
- the invention further encompasses polypeptides containing at least one splice variant of BDCA-2.
- the invention further encompasses a polynucleotide or a complement thereof encoding at least 5 contiguous amino acid residues of BDCA-2, a splice variant or a fragment thereof
- the invention further encompasses recombinant host cells containing a polynucleotide or a complement thereof encoding at least 5 contiguous amino acid residues of BDCA-2, a splice variant or a fragment thereof.
- the invention further encompasses a method of inhibiting an interaction of a DC with a T cell by contacting a composition containing DC and T cells with an effective amount of an agent that inhibits the interaction of BDCA-2, BDCA-3, or BDCA-4 with the T cell.
- the invention further encompasses a method of treating inflammation by administering to a subject in need thereof an amount of an agent that inhibits the interaction of BDCA-2, BDCA-3, or BDCA-4 with the T cell effective to reduce inflammation in the subject.
- the invention further encompasses a method of suppressing the expression of BDCA- 2 in a cell by expressing a BDCA-2 antisense polynucleotide in the cell.
- the invention further encompasses a transgenic animal containing the polynucleotide or a complement thereof encoding at least 5 contiguous amino acid residues of BDCA-2, a splice variant or a fragment thereof.
- Figure 1 shows dot plots from the flow cytometric analysis of peripheral blood mononuclear cells (PBMC) isolated by Ficoll-Paque density gradient centrifugation. In Figure 1, expression of BDCA-2, BDCA-3 and CDlc (BDCA-1) on PBMC is shown.
- PBMC peripheral blood mononuclear cells
- Figure 1 A shows staining of PBMC with FTTC-conjugated mAb against BDCA-2 (AC144), BDCA-3 (AD5-5E8) and CDlc (AD5-8E7), and PE-conjugated mAb against the , TCR( ⁇ heterodimer, CD14 ,CD19 and CD56, respectively.
- the numbers indicate the percentage of cells in the respective quadrant. Propidium iodide fluorescence and light scatter signals were used for gating of live cells.
- Figure IB shows the scatter profile of (a) PBMC, (b) gated BDCA-2 + cells, (c) gated BDCA-3 + cells and (d) gated CDlc + cells.
- FIG. 2 shows that BDCA-2, BDCA-3, BDCA-4 and CDlc (BDCA-1) are expressed on three distinct blood DC subsets.
- Blood DC were isolated from PBMC by depletion of CD3, CDl lb and CD16 positive cells followed by enrichment of CD4 positive cells. The purity of blood DC is demonstrated by light-scatter properties (upper-left dotplot) and anti- HLA-DR-Cy5 vs. anti-Lin-FITC (anti-TCR ⁇ , CD14, CD19 and CD56) staining (upper- middle dotplot). Note that only few lin + cells are present.
- BDCA-2, BDCA-3, BDCA-4 and CDlc on blood DC is characterized in a series of two-color stainings with PE- and FTTC-conjugated mAb against CDllc, CD123 and the antigens themselves.
- BDCA-2, BDCA-3, BDCA-4 and CDlc are exclusively expressed on only one of three distinct blood DC subsets each. The subsets are defined according to staining of blood DC with CD123-PE vs. CDl lc-FTTC (upper-left dotplot): CDl lc ⁇ CD123 bright blood DC; CDl lc bright CD123 dim blood DC; and CDl lc ⁇ CD ⁇ - blood DC.
- FIG. 3 depicts expression of BDCA-4 on PBMC. Shown is a two-color staining of PBMC with FTTC-conjugated mAb against BDCA-2 (AC144) and PE-conjugated mAb against BDCA-4 (AD5-17F6). Note that a few single positive (BDCA-2+BDCA-4 — and
- BDCA-2— BDCA-4+) PBMC are detected.
- Figure 4 shows the expression of BDCA-2, BDCA-3 and BDCA-4 on purified blood DC after various periods of culture in the presence of IL-3.
- Purified blood DC were cultured for 0 h, 1 h, 3 h, 6 h, 9 h, 12 h, 18 h, 24 h, 36 h, and 48 h in the presence of rlL-3 and then flow cytometrically analyzed for the expression of CDl lc, BDCA-3, BDCA-2 and BDCA-4.
- FIG. 1 Histograms show staining of gated CDllc- and CDllc + blood DC with PE-conjugated anti-BDCA-2 mAb (AC144) and anti-BDCA-4 mAb (AD5-17F6) (bold lines), and PE- conjugated isotype-matched control mAb (faint lines), respectively.
- Dot plots show staining of blood DC with CDllc-PE vs. anti-BDCA-3 (AD5-5E8) biotin/streptavidin-APC.
- FIG. 1 shows mean fluorescence intensity (MFI) values for anti-BDCA-2-PE, anti-BDCA- 4-PE, and anti-BDCA-3 biotin/streptavidin-APC staining of CDl lc ⁇ ( O and CDl lc + ( ⁇ ) DC, respectively.
- MFI values were calculated by subtracting the ⁇ values obtained with isotype control mAb from the values obtained with the AC 144 and AD5-17F6, respectively.
- BDCA-3 MFI values are calculated by subtracting the values obtained without any staining mAb (autofluorescence) from the values obtained with AD5- 5E8.
- Figure 5 shows the amino acid sequence of one isoform of BDCA-2 with all six exons being expressed (SEQ ID NO:2).
- FIG. 6 shows that BDCA-1 -specific mAb AD5-8E7 blocks binding of the CDlc mAb M241 to MOLT-4 cells.
- MOLT-4 cells were pre-incubated with saturating amounts of AD5-8E7 mAb (bold line) or an isotope control mAb (faint line) and then stained with PE- conjugated CDlc mAb (M241).
- Figure 7 shows the expression of BDCA-2, BDCA-3 and BDCA-4 on Mo-DC and CD34 + cell-derived DC (CD34-DC).
- CD 14 + monocytes and CD34 + hematopoietic progenitor cells were immunomagnetically purified via direct magnetic labeling with CD14 and CD34 mAb-conjugated microbeads, respectively.
- Purified monocytes were cultured for 7 d in the presence of rGM-CSF and rIL-4, and purified CD34-DC were cultured for 11 d in the presence of rflt3-ligand, rTGF- ⁇ l, rTNF- ⁇ , rSCF and rGM-CSF.
- Figure 8 shows that culturing of anti-BDCA-2 mAb-labeled BDCA-2 + cells results in rapid mAb intemalization.
- PBMC were labeled at 4°C with FTTC-conjugated anti-BDCA-2 mAb (AC144, IgGl), incubated at 37°C for the time periods indicated, and were then stained at 4°C with PE-conjugated rat anti-mouse IgGl mAb (X56) and Cy5-conjugated CD123 mAb (AC 145, IgG2a). Shown are MFI values of anti-BDCA-2-FITC ( ⁇ ) and rat anti-mouse IgGl mAb-PE ( ⁇ ) staining of gated BDCA-2 + CD123 + cells.
- Figure 9 shows the morphology of immunomagnetically purified CDlc + , BDCA-2 + and BDCA-3 + blood DC.
- CDlc + , BDCA-2 + and BDCA-3 + cells were isolated from PBMC by indirect magnetic labeling with PE-conjugated primary mAb (AD5-8E7, AC144 and AD5- 5E8) and anti-PE mAb-conjugated microbeads followed by enrichment of labeled cells by MACS.
- the dotplots show staining of PBMC with HLA-DR-FTTC and the PE-conjugated mAb before (left dotplots) and after (right dotplots) magnetic enrichment of CDlc + (upper ' dotplots) BDCA-2 + (middle dotplots) and BDCA-3 + (lower dotplots) cells, respectively.
- the three pictures on the right side show May Grunwald/Giemsa staining of isolated CDlc + (upper picture), BDCA-2 + (middle picture) and BDCA-3 + cells after cytocentrifugation. Note that small lymphocytes can be seen in the picture of the enriched CDlc + cells. These are CDlc + B cells.
- Figure 10 shows up-regulation of MHC class ⁇ , CD83 and co-stimulatory molecules on CDlc + , BDCA-2 + and BDCA-3 + blood DC upon culturing.
- Purified CDlc + (A), BDCA- 2 + (C) and BDCA-3 + (B) were cultured for 1 day in medium (CDlc + and BDCA-3 + BDC) or for 2 days in medium with rIL-3 and anti-CD40 mAb on CD32-transfected L cells (BDCA-2 + DC), respectively.
- "Immature" Mo-DC (D) were generated by culturing of monocytes for 7 days in medium in the presence of rGM-CSF and rLL-4.
- Mo-DC (E) were generated by culturing of immature Mo-DC for another 3 days in medium in the presence of TNF ⁇ .
- the histograms show cell staining with CDla-FITC, CD80-PE, CD83-PE, CD86-PE and HLA-DR-PE, respectively (bold lines).
- the faint lines show cell staining with isotype and fluorochrome-matched control mAb.
- Figure 11 shows endocytic capacity of freshly isolated CDlc + , BDCA-2 + and BDCA- 3 + blood DC in comparison with purified CD3 + T cells.
- Isolated CDlc + DC ( ⁇ ), BDCA-2 + BDC ( ⁇ ), BDCA-3 "1" DC ( ⁇ ) and CD3 + T cells (*) were incubated at 37°C in medium with 1 mg/ml Lucifer Yellow (LY) for 0, 15, 45 and 75 min, washed three times in ice cold PBS EDTA/BSA and were then analyzed by flow cytometry. Shown are the MFI values for LY fluorescence after subtracting the MFI values, which are obtained upon incubation at 4°C in the absence of LY.
- LY Lucifer Yellow
- Figure 12 depicts the cDNA sequence of BDCA-2 (seq id no 1).
- Figure 13 shows intracellular Ca 2+ mobilization is induced in immunomagnetically purified BDCA-2 + BDCA-4 + blood DC (A, B) and BDCA-2-transfected U937 cells (D), but not in non-transfected U937 cells (E) via anti-BDCA-2 mAb alone (A) and or anti-BDCA-2 plus crosslinking secondary mAb (B, D, E).
- A, B immunomagnetically purified BDCA-2 + BDCA-4 + blood DC
- D non-transfected U937 cells
- E non-transfected U937 cells
- B anti-BDCA-2 plus crosslinking secondary mAb
- Ligation of BDCA-4 on immunomagnetically purified BDCA-2 + BDCA-4 + BDC with anti-BDCA-4 mAb and cross-linking secondary mAb does not induce intracellular Ca 2+ mobilization.
- A is BDCA-2+BDCA-4+ blood DC, anti-BDCA-2 (AC144, IgGl).
- B is BDCA-2+ BDCA-4+ blood DC, anti-BDCA-2 (AC144, IgGl) plus rat anti-mouse IgGl (X56).
- C is BDCA-2+ BDCA-4+ blood DC, anti-BDCA-4 (AD5-17F6, IgGl) plus rat anti- ' mouse IgGl (X56).
- D is BDCA-2 transfected U937 cells, anti-BDCA-2 (AC144,' IgGl) plus rat anti-mouse IgGl (X56).
- E is non-transfected U937 cells, anti-BDCA-2 (AC144, IgGl) plus rat anti-mouse IgGl (X56).
- Figure 14 shows ligation of BDCA-2 but not of BDCA-4 with a specific mAb followed by a secondary cross-linking mAb inhibits secretion of type I interferon by plasmacytoid BDCA-2 + BDCA-4 + DC from blood or tonsils in response to stimulation with influenza virus strain PR8.
- Plasmacytoid BDCA-2 + BDCA-4 + DC from freshly isolated blood (A) or tonsils (B) were cultured for 24 hours in the presence of IL-3 alone (control); IL-3, anti-BDCA-2 mAb and rat anti-mouse IgGl mAb (AC144+RamGl); LL-3, anti-BDCA-2 mAb, rat anti-mouse IgGl mAb, and influenza virus strain PR8 (AC144+RamGl+FLU); IL- 3 and influenza virus strain PR8 (FLU); IL-3, anti-cytokeratin mAb, rat anti-mouse IgGl mAb, and influenza virus strain PR8 (CK3+RamGl+FLU); IL-3, anti-BDCA-4 mAb, rat anti-mouse IgGl mAb, and influenza virus strain PR8 (17F6+RamGl+FLU).
- Figure 15 shows presentation of anti-BDCA-2 mAb (AC144, IgGl) to a T cell clone specific for mouse IgGl by isolated BDCA-2- and BDCA-4-expressing plasmacytoid DC.
- BDCA-2 + BDCA-4 + plasmacytoid DC present anti-BDCA-2 mAb (AC144, IgGl, ⁇ ) to T cells much more efficiently than anti-ILT-3 mAb (ZM3.8, IgGl, ⁇ ) and anti-cytokeratin mAb (CK3-11D5, IgGl, •).
- Figure 16 shows expression of BDCA-2 and BDCA-4 on tonsillar plasmacytoid CD123 + DC.
- Figure 17 shows that neuropilin-1 (GenBank Accession No. 003873) is immunoprecipitated from cell lysates of neuropilin-1 -transfected PEA cells (NP), but not of non-transfected PAE cells (P) with the anti-BDCA-4 mAb AD5-17F6 (anti-NRP-l (ML)). Precipitated proteins were analyzed by SDS-PAGE and Western blotting with the BDCA-4- specific mAb AD5-17F6 (ML) or an neuropilin-1-specific mAb from Shay Soker, Children's Hospital, Boston, MA (S).
- Figure 18 shows ligation of BDCA-2 but not of BDCA-4 with a specific mAb followed by a secondary cross-linking mAb inhibits secretion of INF- ⁇ by plasmacytoid BDCA-2 + BDCA-4 + DC from blood or tonsils in response to stimulation with poly I:C.
- Plasmacytoid BDCA-2+ BDCA-4+ DC from blood were cultured with lO ⁇ g/ml of AC144 mAb (2 and 4) or mouse IgGl mAb (CF6B, anti-TPO, 1 and 3) at 37°C for 30 min.
- Figure 19 shows an analysis of human multiple tissue cDNA panels from CLONTECH (lane 1: heart; lane 2: brain; lane 3: placenta; lane 4: lung; lane 5: liver; lane 6: skeletal muscle; lane 7: kidney; lane 8: pancreas; lane 9: spleen; lane 10: thymus; lane 11: testis; lane 12: ovary; lane 13: small intestine; lane 14: lymph node; lane 15: bone marrow; lane 16: fetal liver; lane 17: tonsil) and an analysis of cDNAs prepared from different populations of blood leukocytes (lane 18: T cells; lane 19: B cells; lane 20: NK cells; lane 21: monocytes; lane 22: CDllc bright CD123 low BDC; lane23: CDl lc-CD123 bright plasmacytoid DC) for BDCA-2 cDNA.
- the control is G3PDH.
- Figure 20 shows the splice variants of the BDCA-2 transcript. Splice variants were analyzed by RT-PCR using the specific primers for BDCA-2 used in expression analysis. The amplified fragments were cloned to plasmid vectors and sequenced.
- Figure 21 shows the splice variants of Dectin-2 transcripts.
- Figure 22 shows an alignment of the mRNA sequences of BDCA-2 and mouse Dectin-2 with the precise positions of the deduced introns indicated.
- * represents identical conserved residues in all the aligned sequences, : represents conserved substitutions, . represents semi-conserved substitutions, shaded areas denote the conserved carbohydrate recognition domain (CRD), italics show putative transmembrane domains.
- CRD carbohydrate recognition domain
- Figure 23 shows the alignment of the amino acid sequences of human BDCA-2, human DCTR and mouse Dectin-2.
- Figure 24 shows BDCA-3 immunoprecipitated from cell lysates of surface biotinylated HD-MY-Z cells with the BDCA-3-specific mAb AD5-14H12 (IgGl).
- the CD19-specific mAb SJ25-C1 IgGl was used.
- Precipitated proteins were analyzed by SDS-PAGE (4-12%) and Western blotting with streptavidin- ⁇ peroxidase.
- the BDCA-3 -specific mAb AD5-14H12 specifically immunoprecipitates a cell surface protein of about 100 kD from HD-MY-Z cells.
- BDCA-3 has an apparent molecular weight of 100 kD.
- the invention relates to methods of enriching for cell populations enriched in DCs and subsets thereof.
- Compositions enriched for the DCs and populations of cells obtained therefrom are also provided by the invention.
- Methods and compositions for modified cells are also provided.
- Compositions of modified cells, including genetically modified cells are also provided.
- Methods of use of the cells both modified and non-modified are provided.
- Antigen-binding fragments and the antigens recognized thereby are also provided.
- BDCA-2 BDCA-3 and BDCA-4.
- BDCA-2 and BDCA-3 are novel.
- the antigen has been identified as neuropilin-1, a receptor for the collapsin/semaphorin family that mediates neuronal cell guidance. He et al. (1997) Cell 90:739-751.
- BDCA-2 and BDCA-4 are strictly confined to plasmacytoid CD123 b ⁇ ght CDllc — DC, whereas expression of BDCA-3 is restricted to a small population of CD123 ⁇ CD1 lc dim DC.
- This BDCA-3 + DC population shares many immunophenotypic features with classical CD123 d ⁇ m CDl lc bnght DC, but, unlike CD123 dim CDllc dim DC, BDCA-3 + DC lack expression of CDlc (BDCA-1), CD2 and several of the Fc receptors.
- the unpurified source of DCs may be any known in the art, such as the bone marrow, fetal, neonate or adult or other hematopoietic cell source, e.g., fetal liver, peripheral blood or umbilical cord blood tonsil, lymph node, nasal membrane, spleen, skin, airway epithelia, lung, liver gut, Peyers patches, etc.
- DCs can also be isolated from cultured cells such as DCs derived from progenitor cells. Various techniques can be employed to separate the cells. For instance, negative selection methods can remove non-DCs initially. mAbs are particularly useful for identifying markers associated with particular cell lineages and/or stages of differentiation for both positive and negative selections.
- a large proportion of terminally differentiated cells can be initially removed using a relatively crude negative separation.
- magnetic bead separations can be used initially to remove large numbers of irrelevant cells. At least about 80%, usually at least ⁇ 70% of the total cells will be removed prior to isolation of DCs.
- the DC are directly isolated from the cell source by positive selection
- Procedures for separation include, but are not limited to, density gradient centrifugation; rosetting; coupling to particles that modify cell density; magnetic separation with antibody-coated magnetic beads or antibody-coated fero fluids (nonoporticles); affinity chromatography; cytotoxic agents joined to or used in conjunction with a mAb, including, but not limited to, complement and cytotoxins; and panning with antibody attached to a solid matrix, e.g. plate, elutriation or any other convenient technique.
- Techniques providing accurate separation and analysis include, but are not limited to, magnetic bead separation and flow cytometry, which can have varying degrees of sophistication, e.g., a plurality of color channels, low angle and obtuse light scattering detecting channels, impedance channels, etc.
- the cells can be selected against dead cells, by employing dyes associated with dead cells such as propidium iodide (PI).
- the cells are collected in a medium comprising 2% serum, such as fetal calf serum (FCS) or, human serum albumin (HSA) or any other suitable, preferably sterile, isotonic medium.
- FCS fetal calf serum
- HSA human serum albumin
- Genetic modification of the cells can be accomplished at any point during their maintenance by transducing a substantially homogeneous cell composition with a recombinant DNA construct, transfected with RNA, cell fusion, loading with antigens and various methods known in the and/or described herein.
- a retroviral vector can be employed, however any other suitable vector, delivery system or cellular modification can be used. These include, e.g., adenovirus, adeno-associated virus, artificial chromosomes, derived from yeast and RNA derived from an antigen source such as a tumor.
- the genetic modification if any, need not be permanent as mature DCs have a limited lifetime. Genetic approaches are used to express foreign (tumor, viral, parasitic, etc.) antigens or autoantigens in DCs in order to induce immunity or tolerance. The longevity of the modification can also be controlled by suicide genes to limit therapy (as with T cells).
- Methods of transduction include any known in the art including, without limitation, direct co-culture of the cells with producer cells, e.g., by the method described by Bregni et al. (1992) Blood 80:1418-1422, or culturing with viral supernatant alone with or without appropriate growth factors and polycations, e.g., by the method described by Xu et al. (1994) Exp. Hemat. 22:223-230; and Hughes et al. (1992) J. Clin. Invest. 89:1817.
- T cells Upon reintroduction of the modified cells expressing or loaded with an antigen so as to present the antigen, into the host, T cells are activated, anergized or deleted and are specifically directed against the antigen.
- suitable antigens include those expressed by virally infected cells, or cancer cells, bacteria, yeast, protozoan, autoantigens (tolerogens) and allergens. More specifically, suitable antigens include, but are not limited to, viral proteins, proteins of cancer cells, tissue-specific proteins or tolerogenic proteins. "Induction" of T cells can include inactivation of antigen-specific T cells such as by deletion or anergy. Inactivation is particularly useful to establish or reestablish tolerance such as in organ transplantation and autoimmune disorders respectively.
- the modified DCs can be administered by any method known in the art including, but not limited to, intravenously, subcutaneously, intranodally and directly to the thymus. Preferably, administration is intravenous (TV).
- TV intravenous
- cell immunotherapy involves removal of bone marrow leukopheresis harvests or other source of cells from a human host, isolating the cells from the source. Meanwhile, the host may be treated to partially, substantially or completely ablate native hematopoietic capability if hematopoietic stem cell transplantation is to occur.
- the isolated cells can be modified during this period of time, so as to provide for cells having the desired modification. In the case of complete hematopoietic ablation, stem cell augmentation will also be required.
- the cells or modified cells can then be restored to the host to provide for the new capability.
- the methods of cell removal, host ablation and stem/progenitor cell repopulation are known in the art.
- the modified cells can be administered in any physiologically acceptable vehicle, normally intravascularly, intranodal and subcutaneously. Usually, at least 1 x 10 5 cells will be administered, preferably 1 x 10 6 or more.
- the cells can be introduced by injection, catheter, or the like.
- factors can also be included, including, but not limited to, interleukins, e.g. JL-2, LL-3, IL-4, IL-12, and flt-Ligand, as well as the other interleukins, the colony stimulating factors, such as G-, M- and GM-CSF, interferons, e.g. ⁇ -interferon.
- polypeptide polypeptide
- peptide protein
- polymers of amino acid residues of any length can be linear or branched, it can comprise modified amino acid residues or amino acid analogs, and it can be interrupted by chemical moieties other than amino acid residues.
- the terms also encompass an amino acid polymer that has been modified naturally or by intervention; including, but not limited to, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component.
- antigen-binding fragment includes any polypeptide monomer or polymer with immunologic specificity, including the intact antibody, and smaller and larger functionally equivalent polypeptides, as described herein. 1. Antigen-binding fragments and compositions thereof
- This invention encompasses antigen-binding fragments that specifically recognize DCs. That is, the antigen is found on DCs such that antigen-binding fragments that recognize the antigen preferentially recognize or bind to DCs or a subset thereof. Or, as with BDCA-4, the antigen may be found on other cell types; but within hematopoietic cells, the antigen is predominately present on DCs.
- the invention further encompasses a composition of matter comprising an isolated antigen-binding fragment that binds specifically to at least one DC antigen.
- the antigen-binding fragment is or is derived from a mAb designated AC 144, AD5-13A11, AD5- 20E5, AD5-17F6, AD5-4B8, AD5-5E8, AD5-14H12 and AD5-8E7.
- Table 1 shows the antigen and epitope recognized by each mAb and the isotype of the mAbs specific for DC.
- BDCA-2 and BDCA-4 are expressed by a CD123 b ⁇ ght CDCl lc — DC population. This DC population is now commonly referred to as plasmacytoid DC.
- plasmacytoid DC This DC population is now commonly referred to as plasmacytoid DC.
- BDCA-2 or BDCA-4 as a surface marker for immunomagnetic isolation and/or flow cytometric identification of plasmacytoid DC, the results presented herein on frequency, immunophenotype, morphology, endocytic capacity, and maturation of these cells, were completely consistent with previous reports, where a large panel of leukocyte antigens was used. This clearly illustrates that both antigens are useful markers for plasmacytoid DC in non-cultured human blood.
- T cell zone associated plasmacytoid DC in peripheral lymphoid organs can also be discriminated from other lymphoid tissue-associated DC populations, such as germinal center DC, interdigitating DC and follicular DC based on the expression of BDCA-2 and BDCA-4.
- BDCA-4 is also expressed on several in vitro differentiated DC populations: (1) in contrast to BDCA-2, BDCA-4 is expressed on both Mo-DC and CD34- DC; (2) whereas expression of BDCA-2 is completely down-regulated on plasmacytoid DC once they have undergone IL-3-mediated maturation in culture, expression of BDCA-4 is in fact up-regulated on cultured plasmacytoid DC; and (3) in contrast to BDCA-2, BDCA-4 becomes expressed within 12 h by a majority of cultured CDl lc + DC, whereby it is unclear whether this is only true for the larger CDlc + CDllc b ⁇ ght population or also true for the smaller CDlc-CDl lC dim CD123- population.
- the finding that no other BDCA-4 + cells than plasmacytoid DC are present in non-cultured human blood indicates that no counterparts of the in vitro differentiated BDCA-4 + DC populations mentioned above are present in blood.
- BDCA-2 may be a receptor with antigen-capture function.
- BDCA-2 is a C-type lectin, is rapidly internalized after ligation ( Figure 8), and BDCA-2 ligand(s) are processed and presented to T cells ( Figure 15).
- BDCA-2 has an antigen uptake and presentation function for ligands to T cells.
- Expression of BDCA-3 is restricted to a small population of CDlc-
- CDllc dim CD123 DC in non-cultured human blood. With respect to phenotype, morphology, endocytic capacity, and maturation requirements, this DC population is quite similar to the CDlc + CDl lc bright CD123 dim DC population. However, apart from BDCA-3 and CDlc expression themselves, the immunophenotypic analysis has revealed some striking " differences: in contrast to CDlc + BDC, BDCA-3 + BDC do not express the Fc receptors CD32, CD64 and EcORI, and they do not express CD2. The lack of Fc receptor expression indicates that BDCA-3 + BDC, unlike CDlc + BDC do not have the capability of Ig-mediated antigen uptake. Fanger et al. (1996) J. Immunol.
- BDCA-3 is a lOOkD protein.
- CDlc + CDl lc brighl DC in contrast to CDlc ⁇ CDl lc dim DC, have the capacity to acquire Langerhans cell characteristics (expression of Lag antigen, E- cadherin and Langerin, and presence of Birbeck granules) when cultured with GM-CSF, IL-4 and TGF- ⁇ 1. If BDCA-3 + DC and CD 1 c + DC represent maturational stages of the same cell type, this would indicate that BDCA-3 + DC have either already lost or not yet acquired the capacity to differentiate into Langerhans cells.
- the antigen- binding fragments are also useful in detecting, enumerating and/or isolating DCs from tissues, both non-hematopoietic tissues (including, without limitation, airway epithelia, skin, gut, lung, and liver) and hematopoietic tissues (including, without limitation, tonsil, spleen, lymph node and thymus).
- Hybridomas secreting the antibodies are also encompassed by the invention as are other cells expressing antigen-binding fragments thereof. Also encompassed by the invention are any antigen-binding fragments that specifically recognize BDCA-2, or BDCA-3 or BDCA-4. As seen from Table 1 and the Examples provided herein, multiple types of mAbs can be produced which specifically recognize these antigens. As also seen from the results presented herein, the antigen-binding fragments need not recognize the same epitope on the same antigen. All such antigen-binding fragments and compositions thereof are encompassed by the invention.
- antigen-binding fragment includes any moiety that binds preferentially to a DC or a sub-population thereof.
- Suitable moieties include, without limitation, oligonucleotides known as aptomers that bind to desired target molecules (Hermann and Pantel (2000) Science 289:820-825), carbohydrates, lectins, Ig fragments as Fab, F(ab') 2 , Fab', scFv (both monomer and polymeric forms) and isolated H and L chains.
- An antigen- binding fragment retains specificity of the intact Ig, although avidity and/or affinity can be altered.
- compositions and methods described herein relate generally to antibodies and derivatives thereof which having provided the anti genie determinants herein, can be generated routinely by standard immunochemical techniques. These include, but are not limited to, antigen-binding fragments coupled to another compound, e.g. by chemical conjugation, or associated with by mixing with an excipient or an adjuvant. Specific conjugation partners and methods of making them are described herein and known in the art.
- Antigen-binding fragments are typically generated by genetic engineering, although they can be obtained alternatively by other methods and combinations of methods. This classification includes, but is not limited to, ' engineered peptide fragments and fusion peptides.
- Preferred compounds include polypeptide fragments containing the anti-DC CDRs, antibody fusion proteins containing cytokine effector components, antibody fusion proteins containing adjuvants or drugs, antibody fusion proteins containing tumor cell-derived antigens, viral antigens, bacterial antigens, parasite antigens, yeast antigens, autoantigens or antigenic peptides (T cell epitopes) derived therefrom, and, single chain V region proteins.
- Antigen-binding fragments are considered to be of human origin if they are isolated from a human source, and used directly or cloned and expressed in other cell types and derivatives thereof or whole human chromosomes or portions thereof (such as mice with human chromosomes encoding V H , DH, J H ,V L> JL L , CH, C gene segments).
- a “fusion polypeptide” is a polypeptide comprising contiguous peptide regions in a different position than would be found in nature.
- the regions can normally exist in separate proteins and are brought together in the fusion polypeptide; they can normally exist in the same protein but are placed in a new arrangement in the fusion polypeptide; or they can be synthetically arranged.
- the invention encompasses recombinant proteins (and the polynucleotides encoding the proteins or complementary thereto) that are comprised of a functional portion of an antigen-binding fragment and another peptide such as a toxin. Methods of making these fusion proteins are known in the art and are described for instance in WO93/07286.
- a "functionally equivalent fragment" of a polypeptide varies from the native sequence by any combination of additions, deletions, or substitutions while preserving at least one functional property of the fragment relevant to the context in which it is being used.
- the antigen-binding fragments are useful in palliating the clinical conditions related to immunologic disorders.
- the invention further comprises polypeptide derivatives of the antigen-binding fragments and methods for using these compositions in diagnosis, treatment, and manufacture of novel reagents.
- the invention also encompasses antigen-binding fragments conjugated to a chemically functional moiety.
- the moiety is a label capable of producing a detectable signal.
- conjugated antigen-binding fragments are useful, for example, in detection systems such as quantitation of DCs in various tissues, in various diseases, after stem cell transplantation, and after immunoablative therapy like chemotherapy and radiation, and imaging of DCs for instance in following chemotherapy or autoimmune therapy.
- labels are known in the art and include, but are not limited to, radioisotopes, enzymes, fluorescent compounds, chemiluminescent compounds, bioluminescent compounds, substrate ' cofactors and inhibitors and magnetic particles.
- U.S. Patent Nos See, for instance U.S. Patent Nos.
- the moieties can be covalently linked, recombinantly linked, or conjugated (covalently or non-covalently) through a secondary reagent, such as a second antibody, protein A, or a biotin-avidin complex.
- a secondary reagent such as a second antibody, protein A, or a biotin-avidin complex.
- Other functional moieties include, without limitation, signal peptides, agents that enhance immunologic reactivity, agents that facilitate coupling to a solid support, vaccine carriers, bioresponse modifiers, paramagnetic labels and drugs.
- Signal peptides include prokaryotic and eukaryotic forms.
- Agents that enhance immunologic reactivity include, but are not limited to, bacterial superantigens and adjuvants.
- Agents that facilitate coupling to a solid support include, but are not limited to, biotin, avidin or derivatives thereof.
- Immunogen carriers include, but are not limited to, any physiologically acceptable buffer.
- Bioresponse modifiers include, but are not limited to, cytokines, particularly tumor necrosis factor (TNF), IL-2, interleukin-4 (IL-4), GM-CSF; IL-10, IL-12, TGF- ⁇ and certain interferons, and chemokines (MIP-3 ⁇ , SDF-1, Lymphotactin, DC-CKl, Eotaxins, IP-10, TARC, Rantes, MIP- lx, MTP-1B, SLC, 1-TAC, MIG, MDC, MCP-1, TCA-3, MCP-2,- 3, -1.
- a "signal peptide” or “leader sequence” is a short amino acid sequence that directs a newly synthesized protein through a cellular membrane, usually the endoplasmic reticulum (ER) in eukaryotic cells, and either the inner membrane or both inner and outer membranes of bacteria.
- ER endoplasmic reticulum
- Signal peptides are typically at the N-terminus of a polypeptide and are removed enzymatically between biosynthesis and secretion of the polypeptide from the cell or through the membrane of the ER. Thus, the signal peptide is not present in the secreted protein but is present only during protein production.
- Immunotoxins including single chain conjugates, can be produced by recombinant means. Production of various immunotoxins is well known in the art, and methods can be found, for example, in "Monoclonal Antibody-toxin Conjugates: Aiming the Magic Bullet," Thorpe et al. (1982) Monoclonal Antibodies in Clinical Medicine, Academic Press, pp. 168— 190; Vitatta (1987) Science 238:1098-1104; and Winter and Milstein (1991) Nature 349:293-299.
- Suitable toxins include, but are not limited to, ricin, radionuclides, pokeweed antiviral protein, Pseudomonas exotoxin A, diphtheria toxin, ricin A chain, fungal toxins such ' as fungal ribosome inactivating proteins such as gelonin, restrictocin and phospholipase enzymes. See, generally, “Chimeric Toxins,” Olsnes and Pihl, Pharmac. Ther. 15:355-381 (1981); and “Monoclonal Antibodies for Cancer Detection and Therapy," eds. Baldwin and Byers, pp. 159-179, 224-266, Academic Press (1985).
- the chemically functional moieties can be made recombinantly for instance by creating a fusion gene encoding the antigen-binding fragment and functional regions from other genes (e.g. enzymes). In the case of gene fusions, the two components are present within the same gene.
- antigen-binding fragments can be chemically bonded to the moiety by any of a variety of well known chemical procedures. For example, when the moiety is a protein, the linkage can be by way of homo- or hetero-bifunctional cross linkers, e.g., SPDP, SMCC, carbodiimide glutaraldehyde, or the like.
- the moieties can be covalently linked, or conjugated, through a secondary reagent, including, but not limited to, a second antibody, protein A, or a biotin-avidin complex.
- a secondary reagent including, but not limited to, a second antibody, protein A, or a biotin-avidin complex.
- Paramagnetic moieties and the conjugation thereof to antibodies are well-known in the art. See, e.g., Miltenyi et al. (1990) Cytometry 11:231-238.
- mice were injected on days -3, 0, 4, 7, 11, and 14 with Bristol-8 B lymphoblastoma cells, while the right footpads were injected with DC on days 0, 4, 7, 11, and 14.
- Naive B an T cells with specificity for shared antigens e.g. HLA class ⁇ molecules, should become activated by Bristol-8 cells between d -3 and 0 in the left popliteal lymph node and thereupon be retained there, while all lymphocytes with specificity for antigens unique to DC should remain available for activation after d 0 in the right popliteal lymph node.
- Antigen-binding fragments can also be purified on affinity columns comprising DCs or an antigenic portion thereof.
- fragments are purified using Protein-A-CL-SepharoseTM 4B chromatography followed by chromatography on a DEAE-SepharoseTM 4B ion exchange column.
- the invention also encompasses hybrid antibodies, in which one pair of H and L chains is obtained from a first antibody, while the other pair of H and L chains is obtained from a different second antibody.
- one pair of L and H chains is from anti-DC antibody.
- each L-H chain pair binds different epitopes of a DC-specific antigen.
- Such hybrids can also be formed using humanized H or L chains.
- the invention also encompasses other bispecific antibodies such as those containing two separate antibodies covalently linked through their constant regions.
- antigen-binding fragments encompassed by this invention are antibodies in which the H or L chain has been modified to provide additional properties. For instance, a change in amino acid sequence can result in reduced immunogenicity of the resultant polypeptide. The changes range from changing one or more amino acid residues to the complete redesign of a region such as a C region domain. Typical changes include, but are not limited to, those related to complement fixation, interaction with membrane receptors, and other effector functions. A recombinant antibody can also be designed to aid the specific delivery of a substance (such as a cytokine) to a cell. Also encompassed by the invention are peptides in which various Ig domains have been placed in an order other than that which occurs in nature.
- the size of the antigen-binding fragments can be only the minimum size required to provide a desired function. It can optionally comprise additional amino acid sequence, either ' native to the antigen-binding fragment, or from a heterologous source, as desired.
- Anti-DC antigen-binding fragments can contain only 5 consecutive amino acid residues from an antibody V region sequence. Polypeptides comprising 7 amino acid residues, more preferably about 10 amino acid residues, more preferably about 15 amino acid residues, more preferably about 25 amino acid residues, more preferably about 50 amino acid residues, more preferably about 75 amino acid residues from the antibody L or H chain V region are also included. Even more preferred are polypeptides, comprising the entire antibody L or H chain V region.
- Substitutions can range from changing or modifying one or more amino acid residue to complete redesign of a region, such as the V region.
- Amino acid residue substitutions if present, are preferably conservative substitutions that do not deleteriously affect folding or functional properties of the peptide.
- Groups of functionally related amino acid residues within which conservative substitutions can be made are glycine/alanine; valine/isoleucine/leucine; asparagine/glutamine; aspartic acid/glutamic acid; serine/threonine/methionine; lysine/arginine; and phenylalanine/tyrosine/tryptophan.
- Antigen-binding fragments can be glycosylated or unglycosylated, can be modified posttranslationally (e.g., acetylation, and phosphorylation) or can be modified synthetically (e.g., the attachment of a labeling group).
- Polypeptide derivatives comprising both an L chain and an H chain can be formed as separate L and H chains and then assembled, or assembled in situ by an expression system for both chains.
- Such expression systems can be created by transfecting with a plasmid comprising separate transcribable regions for the L and H chain, or by co-transfecting the same cell with plasmids for each chain.
- a suitable plasmid with an H chain encoding region is transfected into an H chain loss mutant.
- H chain loss mutants can be obtained by treating anti-DC antibody producing cells with fluorescein-labeled rabbit anti-mouse IgG (H chain specific, DAKO Corporation, Carpinteria, CA) according to the supplier's instruction.
- the stained and unstained cell populations are analyzed by flow cytometry. Unstained cells are collected in a sterilized tube and placed in 96-well plates at 1 cell/well by limiting dilution. Culture supematants are then assayed by ELISA using goat anti-mouse IgG (H chain specific) and goat anti-mouse kappa. Clones having a kappa-positive, IgG-negative phenotype are subcloned at least 3 times to obtain stable anti-DC _H mutants. mRNA from putative H chain loss mutants can be isolated and the sequence of the L chain V region cDNA determined.
- Reverse PCR of the mRNA for " the VH is performed with 2 sets of 5'- and 3'- primers, and used for cloning of anti-DC (_H) cDNA.
- An H chain loss mutant yields no detectable DNA band with these primers.
- Transfection of the cells proceeds with a suitable H chain plasmid.
- Another antigen-binding fragment derivative encompassed by this invention is an antibody in which the constant region of the H or L chain has been modified to provide additional properties. For instance, a change in amino acid sequence can result in altered immunogenicity of the resultant polypeptide. The changes range from one or more amino acid residues to the complete redesign of constant region domain. Changes contemplated affect complement fixation, interaction with membrane receptors, and other effector functions.
- a recombinant antibody can also be designed to aid the specific delivery of a substance (such as a lymphokine or an antigen or an antigenic peptide derived from a tumor, virus, parasite or bacteria, or tolerogen (autoantigen)) to a cell.
- the invention also encompasses single chain V region fragments ("scFv") of anti-DC antibodies.
- Single chain V region fragments are made by linking L and/or H chain V regions by using a short linking peptide.
- Any peptide having sufficient flexibility and length can be used as a linker in a scFv.
- the linker is selected to have little to no immunogenicity.
- An example of a linking peptide is (GGGGS) 3 , which bridges approximately 3.5 nm between the carboxy terminus of one V region and the amino terminus of another V region.
- linker sequences can also be used, and can provide additional functions, such as a for attaching to a drug or solid support or specific delivery of a substance (such as a lymphokine or an antigen or an antigenic peptide derived from a tumor, virus, parasite or bacteria, or tolerogen (autoantigen)) to a cell.
- a substance such as a lymphokine or an antigen or an antigenic peptide derived from a tumor, virus, parasite or bacteria, or tolerogen (autoantigen)
- All or any portion of the H or L chain can be used in any combination.
- the entire V regions are included in the scFv.
- the L chain V region can be linked to the H chain V region.
- a portion of the L chain V region can be linked to the H chain V region, or portion thereof.
- scFvs in which the H chain V region is from an antibody described herein, and the L chain V region is from another Ig.
- a biphasic, scFv can be made in which one component is an antigen-binding fragment and another component is a different polypeptide, such as a T cell epitope.
- the scFvs can be assembled in any order, for example, V H — (linker) — V L or V L — (linker) — V H . There can be a difference in the level of expression of these two ' configurations in particular expression systems, in which case one of these forms can be preferred. Tandem scFvs can also be made, such as (X) — (linker) — (X) — (linker) — (X), in which X are scFvs , or combinations thereof with other polypeptides.
- single chain antibody polypeptides have no linker polypeptide, or just a short, inflexible linker. Possible configurations are V L — VH and V H — VL. The linkage is too short to permit interaction between V and V H within the chain, and the chains form homodimers with a VI/V H antigen-binding site at each end. Such molecules are referred to as "diabodies.”
- ScFvs can be produced recombinantly or synthetically.
- an automated synthesizer can be used for synthetic production of scFv.
- a suitable plasmid-containing polynucleotide that encodes the scFv can be introduced into a suitable host cell, either eukaryotic, such as yeast, plant, insect or mammalian cells, or prokaryotic, such as Escherichia coli, and the expressed protein can be isolated using standard protein purification techniques.
- ScFvs can also be obtained from a phage display library.
- a particularly useful system for the production of scFvs is plasmid pET-22b(+) (Novagen, Madison, WI).
- Escherichia coli pET-22b(+) contains a nickel ion binding domain consisting of 6 sequential histidine residues, which allows the expressed protein to be purified on a suitable affinity resin.
- pcDNA3 Invitrogen, San Diego, CA.
- Conditions of gene expression preferably ensure that the scFv assumes optimal tertiary structure.
- the plasmid used especially promoter activity
- the invention also encompasses polymeric forms of antigen-binding fragments, containing a plurality of DC-specific antigen-binding fragments.
- One embodiment is a linear polymer of antigen-binding fragments, optionally conjugated to carrier.
- linear polymers can comprise multiple copies of a single antigen-binding fragment polypeptide, or combinations of different polypeptides, and can have tandem polypeptides, or polypeptides separated by other amino acid sequences.
- Another embodiment is multiple antigen peptides (MAPs).
- MAPs have a small immunologically inert core having radially branching lysine dendrites, onto which a number of antigen-binding fragment polypeptides are covalently attached. See for instance, Posnett et al. (1988) J. Biol. Chem. 263:1719-1725; and Tarn (1989) Met. Enz. 168:7-15.
- MAPs are efficient immunogens and useful antigens for immunoassays.
- the core for creating MAPs can be made by standard peptide synthesis techniques, or obtained commercially (Quality Controlled Biochemicals, Inc., Hopkinton, MA).
- a typical core matrix is made up of three levels of lysine and eight amino acid residues.
- the invention further includes anti-idiotypic antigen-binding fragments to the DC-specific antigen-binding fragments of the invention.
- anti-idiotypes can be made by any method known in the art.
- TAA tumor-associated antigens
- TAA tumor-associated antigens
- Immunization with a given antigen generates an immune response including a CTL response, preferably a strong CTL response.
- the production of antibodies against the antigen can be helpful if the tumor cells are killed by ADCC (antibody- dependent cellular cytotoxicity).
- the invention encompasses the use of DCs identified and isolated by use of the anti gen -binding fragments of the invention in inducing specific immune responses by methods known in the art.
- the immune responses can be specific to any antigen including, without limitation, those associated with cancer, infectious viruses, infectious bacteria, infectious parasites, infectious yeast, and autoimmune diseases (the induce tolerance).
- Hybrid cells e.g. DC/tumor cell
- Modified cells including, without limitation, activated, in vitro matured, modulated with respect to their T helper cell polarizing capacity (Thl v Th2 v Th3/Th-R), and modulated with respect to their T cell stimulating or anergizing or deleting capacity
- Subpopulations include, without limitation, a particular differentiation stage within one lineage and a separate lineage of differentiation.
- the invention further provides DCs, subpopulations thereof and mixtures thereof.
- the cells are selected using the antigen-binding fragments provided herein by any separation method known in the art.
- Compositions comprising the isolated cells are also encompassed by the invention. These include pharmaceutical and therapeutic compositions and any other composition containing the isolated cells.
- the DCs subpopulations isolated by the methods ' described herein are preferably substantially homogeneous. That is, cells isolated by a BDCA-specific antigen-binding fragments are preferably more than about 80% BDCA + , more preferably more than about 90% BDCA + and most preferably more than about 95% BDCA + .
- subsequent combinations of the cells with other DCs, or other hematopoietic cells can decrease the percentage of BDCA + cells, such combinations are also encompassed by the invention.
- DCs obtained by the methods described herein are suitable for use in any method of treatment known in the art include references here.
- DCs altered to achieve these methods are also encompassed by the invention. These methods include, but are not limited to: a) therapy with isolated DCs to induce specific T cell tolerance (killing or anergy instead of stimulation) in autoimmune diseases, allergies, graft versus host disease (GvHD), allograft rejection.
- DCs specific for such T cells can be modified to contain lysis, inactivating or death-inducing moieties so as to specifically target the T cells involved in the unwanted immune response for instance by antigen labeling or genetic modification such as by CD95L transfection.
- DC specificity for T cells is primarily caused by presentation of the appropriate T cell epitopes (peptides) via MHC I and II.
- the particular subsets of DCs with tolerance-inducing functions can be administered directly to the patient.
- Peripheral tolerance can be mediated by DCs modified to induce deletion (killing), anergy and suppression/regulation of T cells; b) immunomodulation therapy with isolated DCs to induce particular cytokine expression profiles in specific T cells. This is particularly useful to influence production of Thl (cytokines for specific inflammatory immune responses), Th2 (cytokines for specific humoral immune responses) or Th3 (cytokines for specific immunosuppression) cytokines.
- Thl cytokines for specific inflammatory immune responses
- Th2 cytokines for specific humoral immune responses
- Th3 cytokines for specific immunosuppression
- induction of a Thl response may reduce or eliminate the symptom-producing Th2 response; c) therapy with DCs presenting antigens including, but not limited to, tumor antigens, viral antigens and cellular antigens; d) therapy with DCs (with or without presenting antigens) and various cofactors including, but not limited to cytokines, costimulatory molecules and effector molecules in amounts and under conditions sufficient to modulate the immune response; and e) stimulating T cells in vitro to obtain antigen-specific T cells.
- antigens including, but not limited to, tumor antigens, viral antigens and cellular antigens
- various cofactors including, but not limited to cytokines, costimulatory molecules and effector molecules in amounts and under conditions sufficient to modulate the immune response
- stimulating T cells in vitro to obtain antigen-specific T cells.
- the antigen-binding fragments described herein are also suitable for a number of methods of treatment. These include, but are not limited to: ' a) antibodies mimicking the ligand- or ligand-mediated immunotherapy for instance of DCs involved in autoimmunity or in vivo targeting of antigens or nucleic acids (viruses, plasmid DNA, RNA etc) to DCs for optimal and selective uptake/transfection.
- BDCA-2 may be particularly useful in this context as it appears to be a molecule with antigen uptake and processing function; and b) immunomonitoring: e.g. enumeration and characterization of BDCA-2 + , BDCA-3 + and BDCA-4 + DCs in various diseases and upon mobilization e.g. with a proliferation inducing ligand, e.g. flt3-Ligand or G-CSF.
- Suitable carriers are typically large, slowly metabolized macromolecules such as proteins; polysaccharides (such as latex functionalized Sepharose, agarose, cellulose, cellulose beads and the like); polymeric amino acid residues (such as polyglutamic acid, polylysine, and the like); amino acid copolymers; and inactive virus particles or attenuated bacteria, such as Salmonella.. 2.
- Methods of obtaining additional DC-specific antigen-binding fragments The invention encompasses methods of obtaining DC-specific antigen-binding fragments.
- Methods of generating new DC-specific antigen-binding fragments include, but are not limited to: 1) employing phage display techniques by which cDNA encoding antibody repertoires are preferably amplified from lymphocyte or spleen RNA using PCR and oligonucleotide primers specific for species-specific V regions; 2) immunizing mammals with the antigen and generating polyclonal or mAbs; and 3) employing phage display to make antibodies without prior immunization by displaying on phage, very large and diverse V gene repertoires. See, generally Hoogenboom et al. (1998) Immunotechnol. 4:1-20.
- non-human antigen binding fragments are to be used, these can be humanized by any method known in the art.
- antibodies can be obtained from mice (such as BALB/c) after injection with purified DC-specific antigen.
- mAbs are generated using standard hybridoma technology. Maiti et al. (1997) Biotechnol. Int. 1:85-93 (human hybridomas); and Kohler and Milstein (1975) Nature 256:495-497 (mouse hybridomas).
- Murine antibodies can be subsequently humanized for instance by the methods described by Rosok et al. (1996) J. Biol. Chem. 271:22611-22618; Baca et al. (1997) J. Biol. Chem. 272:10678-10684; Rader et al. Proc. Natl. Acad. Sci. USA 95:8910-8915; and Winter and Milstein (1991) Nature 349:293- 299.
- a phage display approach can also be used to rapidly generate human antibodies against DCs. This approach can employ the method described by Henderikx et al. (1998) Cancer Res. 58:4324-32.
- Antibody fragments displayed on phage are selected from a large na ⁇ ' ve phage antibody/fragment library containing different single chain antibodies by separating those that bind to immobilized antigen or DCs.
- Human antibody fragments are selected from naive repertoires constructed either from germline V-domains or synthesized with many mutations (mutations are targeted either by homologous gene re-assortments or error prone PCR) in both the framework and CDR regions.
- Antigen-binding fragments specifically reactive with DCs can be identified by screening against tumor and normal cells as described herein in order to identify DC-specific antigen-binding fragments.
- the invention also encompasses methods of identifying antigen-binding fragments specific for a DCs by generating a suitable phage display library; isolating DC-specific antigens; screening the phage display library with the antigens according to standard immunochemical techniques to obtain phage that display an antigen-binding fragment that binds specifically to DCs; or screening the phage display library obtained for DC specific antigen-binding fragments, by screening against DCs and other, related cells such as APCs and selecting the phage that bind preferentially to DCs.
- Methods of generating antigen- binding fragments by phage display are well known in the art. Hoogenboom et al. (1998). Lymphocyte (PBL) or spleen RNA is typically used to make antibody fragment repertoires. Mutagenesis using homologous reassortment or error prone PCR increases the diversity. Any method known in the art can be used.
- Repertoires of antibody genes can be amplified from immunized mice or humans using PCR and scFv or Fab antibody fragments obtained thereby can be cloned and expressed on the surface of bacteriophage.
- the antibody gene repertoires are amplified from lymphocyte or spleen RNA using PCR and oligonucleotide primers specific for host animal- specific V regions. Phage display can also be used to make antibodies without prior immunization by displaying very large and diverse V gene repertoires on phage.
- the natural V gene repertoires present in PBL are isolated by PCR amplification and the VH and VL regions are spliced together at random using PCR.
- An improved library construction method uses cloned VH and VL gene repertoires in separate plasmid vectors to provide a stable and limitless supply of material for scFv assembly. Sheets et al. (1998) Proc. Natl. Acad. Sci. USA 95:6175-6162. Also, the efficiency is increased by having DNA encoding the linker region at the 5' end of the VL library. Therefore there are only two fragments to be ligated instead of three.
- Anti-DC-antigen-binding fragments can also be derived or manipulated.
- the immunogenic activity of the V regions of the L and H chains can be screened by preparing a series of short polypeptides that together span the entire V region amino acid sequence. Using a series of polypeptides of 20 or 50 amino acid residues in length, each V region can be surveyed for useful functional properties. It is also possible to carry out a computer analysis of a protein sequence to identify potentially immunogenic polypeptides. Such peptides can then be synthesized and tested.
- antigen-binding fragments described herein combined in various fashions to yield other anti-DC antigen-binding fragments with desirable properties.
- antigen-binding fragments with modified residues can be comprised in MAPs.
- an scFv is fused to a cytokine, such as IL-2. All such combinations are encompassed by this invention.
- the antigen-binding fragments can be made by any suitable procedure, including proteolysis, recombinant methods or chemical syntheses. These methods are known in the art and need not be described in detail. Examples of proteolytic enzymes include, but are not limited to, trypsin, chymotrypsin, pepsin, papain, V8 protease, subtilisin, plasmin, and thrombin. Intact antigen-binding fragments can be incubated with one or more proteases simultaneously or sequentially. Alternatively, or in addition, intact antibody can be treated with disulfide reducing agents. Peptides can then be separated from each other by techniques known in the art, including but not limited to, gel filtration chromatography, gel electrophoresis, and reverse-phase HPLC.
- Anti-DC antigen-binding fragments can also be made by expression from a polynucleotide encoding the peptide, in a suitable expression system by any method known in the art.
- polynucleotides encoding a suitable polypeptide are ligated into an expression vector under control of a suitable promoter and used to genetically alter the intended host cell. Both eukaryotic and prokaryotic host systems can be used.
- the polypeptide is then isolated from lysed cells or from the culture medium and purified to the extent needed for its intended use. Examples of prokaryotic host cells appropriate for use with this invention include E. coli, Bacillus subtilis and any other suitable host cell.
- eukaryotic host cells include, but are not limited to yeast, avian, insect, plant, and animal cells such as COS7, HeLa, and CHO cells.
- matrix-coated channels or beads and cell co-cultures can be included to enhance growth of antigen-binding fragment producing cells.
- the method of raising ascites generally comprises injecting hybridoma cells into an immunologically na ⁇ ve, histocompatible or immunotolerant mammal, especially a mouse.
- the mammal can be primed for ascites production by prior administration of a suitable composition; e.g., Pristane.
- the ascitic fluid is removed from the animal and processed to isolate antibodies.
- antigen-binding fragments can be chemically synthesized using amino acid sequence data and other information provided in this disclosure, in conjunction with standard methods of protein synthesis.
- a suitable method is the solid phase Merrifield technique. Automated peptide synthesizers are commercially available, such as those manufactured by Applied Biosystems, Inc. (Foster City, CA). Another method of obtaining anti-DC antigen-binding fragments is to immunize suitable host animals with BDCA-2, BDCA-3 and/or BDCA-4 and follow standard methods for polyclonal or mAb production and isolation. mAbs thus produced can be "humanized” by methods known in the art. The invention thus encompasses humanized mAbs. In “humanized” antibodies at least part of the sequence has been altered from its initial form to render it more like human Igs. In one version, the H chain and L chain C regions are replaced with human sequence.
- the CDR regions comprise anti-DC amino acid sequences, while the V framework regions have also been converted human sequences. See, for example, EP 0329400.
- V regions are humanized by designing consensus sequences of human and mouse V regions, and converting residues outside the CDRs that are different between the consensus sequences. In making humanized antibodies, the choice of framework residues can aid in retaining high binding affinity. In principle, a framework sequence from any human antibody can serve as the template for CDR grafting; however, it has been demonstrated that straight CDR replacement into such a framework can lead to significant loss of antigen binding affinity. Glaser et al.
- the antigen-binding fragment can be stored without purification. Fiedler et al. (1995) Biotechnol. 13:1090-1093.
- the polypeptide is at least partially purified from other cellular constituents.
- the peptide is at least about 50% pure as a weight percent of total protein. More preferably, the peptide is at least about 50-75% pure.
- the peptide is preferably at least about 80% pure.
- the peptides are to be administered to an individual, preferably it is at least 80% pure, more preferably at least 90% pure, even more preferably at least 95% pure and free of pyrogens and other contaminants.
- the percent purity is calculated as a weight percent of the total protein content of the preparation, and does not include constituents which are deliberately added to the composition purification.
- the invention also encompasses methods of detecting, enumerating and/or identifying DCs and subsets thereof, in a biological sample and measuring antigens such as soluble BDCA-2, BDCA-3 or BDCA-4 and/or DCs in body fluids.
- the methods include obtaining a biological sample, contacting the sample with an antigen-binding fragment described herein under conditions that allow antibody-antigen-binding and detecting binding, if any, of the antibody to the sample as compared to a control, biological sample.
- a biological sample is suitably prepared, for instance by enriching for DC concentration or antigen concentration, it is mixed with excess antigen-binding fragments under conditions that permit formation of a complex between DCs or antigen and the antibody.
- the amount of complex formed or the number of complex bearing DCs then determined, and eventually compared with complexes formed with standard samples containing known amounts of target antigen in the range expected or known DC concentrations.
- Complex formation can be observed by immunoprecipitation or nephelometry, but it is generally more sensitive to employ a reagent labeled with such labels as radioisotopes like 125 I, enzymes like peroxidase and ⁇ -galactosidase, or fluorochromes like fluorescein.
- Methods of detecting cells and antigens are well known in the art. For cell detection, flow cytometry is particularly useful, with antigen, ELISA is preferred.
- an anti -DC antigen-binding fragment to an antigen can be tested by any immunoassay known in the art. Any form of direct binding assay is suitable.
- one of the binding partners, the antigen or the putative antigen-binding fragment is labeled. Suitable labels include, but are not limited to, radioisotopes such as 1 S I, enzymes such as peroxidase, fluorescent labels such as fluorescein, and chemiluminescent labels.
- the other binding partner is insolubilized (for example, by coating onto a solid phase such as a microtiter plate) to facilitate removal of unbound soluble binding partner. After combining the labeled binding partner with the unlabeled binding partner, the solid phase is washed and the amount of bound label is determined.
- the antigen-binding fragments described herein can be unlabeled or labeled with a therapeutic agent as described herein and as known in the art. These' agents can be coupled either directly or indirectly to the antigen-binding fragments of the invention.
- a therapeutic agent as described herein and as known in the art.
- These' agents can be coupled either directly or indirectly to the antigen-binding fragments of the invention.
- indirect coupling is by use of a spacer moiety. These spacer moieties, in turn, can be either insoluble or soluble (Diener et al. (1986) Science 231:148) and can be selected to enable drug release at the target site.
- antigens including tumor antigens, viral antigens, bacterial antigens, parasite-derived antigens and autoantigens, bioresponse modifiers, drugs, radioisotopes, lectins, and toxins.
- Bioresponse modifiers include cytokines and chemokines which include, but are not limited to, JL-2, IL-3, IL-4, G-CSF, GM-CSF, IL-10, IL-12, TGF- ⁇ , MTP-AB, SDF-1, Lymphotactin, DC-CKl, Eotoxins, IP-10, TARC, Rantes, MTP-l ⁇ , MlP-l ⁇ , SLC, ITAC,
- Interferons with which antigen- binding fragments can be labeled include IFN- ⁇ , TFN- ⁇ , and TFN- ⁇ and their subtypes.
- radioisotopically conjugated antigen-binding fragments for immunotherapy, certain isotypes can be more preferable than others depending on such factors as isotype stability and emission. If desired, cell population recognition by the antigen-binding fragment can be evaluated by the in vivo diagnostic techniques described below.
- ⁇ and ⁇ particle-emitting radioisotopes are preferred in immunotherapy. For example, a high energy ⁇ emitter capable of penetrating several millimeters of tissue, such as 90 Y, can be preferable. On the other hand, a short range, high energy ⁇ emitter, such as Bi, can be preferable.
- radioisotopes which can be bound to the antigen-binding fragments of the invention for therapeutic purposes include, but are not limited to, 125 I, 131 I, 90 Y, 67 Cu, 212 Bi, 2n At, 212 Pb, 47 Sc, 109 Pd, and 188 Re.
- Lectins are proteins, usually isolated from plant material, which bind to specific sugar moieties. Many lectins are also able to agglutinate cells and stimulate lymphocytes. However, ricin is a toxic lectin which has been used immunotherapeutically. This is preferably accomplished by binding the ⁇ peptide chain of ricin, which is responsible for toxicity, to the antibody molecule to enable site specific delivery of the toxic effect.
- Toxins are poisonous substances produced by plants, animals, or microorganisms that, in sufficient dose, are often lethal.
- Diphtheria toxin is a substance produced by Corynebacterium diphtheria which can be used therapeutically. This toxin consists of an ⁇ and ⁇ subunit which under proper conditions can be separated.
- the toxic A chain component can be bound to an antigen-binding fragment described herein and used for site specific delivery to a specific subset of DCs.
- Recombinant methods are well known in the art. The practice of the invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.
- the invention provides various polynucleotides encoding BDCA antigens.
- the invention also encompasses polynucleotides encoding for functionally equivalent variants and derivatives of these antigens and functionally equivalent fragments thereof that can enhance, decrease or not significantly affect properties of the polypeptides encoded thereby.
- These functionally equivalent variants, derivatives, and fragments may display the ability to specifically bind to their respective antibodies.
- changes that will not significantly affect properties of the encoded polypeptide include, but are not limited to changes in a DNA sequence that do not change the encoded amino acid sequence, as well as those that result in conservative substitutions of amino acid residues, one or a few amino acid residue deletions or additions, and substitution of amino acid residues by amino acid analogs.
- Conservative substitutions are those which conservative amino acid substitutions are glycine/alanine; valine/isoleucine/leucine; asparagine/glutamine; aspartic acid/glutamic acid; serine/threonine/methionine; lysine/arginine; and phenylalanine/tyrosine/tryptophan.
- polynucleotides of the invention can comprise additional sequences, such as additional encoding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, and polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, and transformation of a host cell, and any such construct as can be desirable to provide embodiments of this invention.
- the invention encompasses a polynucleotide of at least about 15 consecutive nucleotides, preferably at least about 20 nucleotides, more preferably at least about 25 consecutive nucleotides, more preferably at least about 35 consecutive nucleotides, more preferably at least about 50 consecutive nucleotides, even more preferably at least about 75 nucleotides, still more preferably at least about 100 nucleotides, still more preferably at least about 200 nucleotides, and even more preferably at least about 300 nucleotides that forms a stable hybrid with a polynucleotide encoding BDCA-2 and BDCA-3, preferably the cDNA sequence found in Figure 12. Any set of conditions can be used for this test, provided at least one set exists where the test polynucleotide demonstrates the required specificity. Hybridization reactions can be performed under conditions of different "stringency".
- Conditions that increase stringency of a hybridization reaction are published. See, for example, Sambrook and Maniatis. Examples of relevant conditions include (in order of increasing stringency): incubation temperatures of 25°C, 37°C, 50°C and 68°C; buffer concentrations of 10 x SSC, 6 x SSC, 1 x SSC, 0.1 x SSC (where SSC is 0.15 M NaCl and 15 mM citrate buffer) and their equivalent using other buffer systems; formamide concentrations of 0%, 25%, 50%, and 75%; incubation times from 5 minutes to 24 hours; 1, 2, or more washing steps; wash incubation times of 1, 2, or 15 minutes; and wash solutions of 6 x SSC, 1 x SSC, 0.1 x SSC, or deionized water.
- the invention also provides polynucleotides encoding the BDCA polypeptides.
- the polypeptides are or are derived from those in Figure 12.
- the invention also provides polynucleotides covalently linked with a detectable label. Such polynucleotides are useful, for example, as probes for detection of related nucleotide sequences.
- polynucleotides of this invention can be obtained using chemical synthesis, recombinant cloning methods, PCR, or any combination thereof. Methods of chemical polynucleotide synthesis are well known in the art and need not be described in detail herein. One of skill in the art can use the sequence data provided herein to obtain a desired polynucleotide by employing a DNA synthesizer or ordering from a commercial service.
- nucleotides encoding BDCAs and the peptides encoded thereby can be obtained from a producing cell line, cloning vector, or expression vector.
- RNA or DNA encoding the desired sequence can be isolated, amplified, and processed by standard recombinant techniques. Such techniques include digestion with restriction nucleases, and amplification by polymerase chain reaction (PCR), or a suitable combination thereof.
- PCR technology is described in U.S. Patent Nos. 4,683,195; 4,800,159; 4,754,065; and 4,683,202, as well as PCR: The Polymerase Chain Reaction, Mullis et al. eds., Birkauswer Press, Boston (1994). Isolation and purification of the peptides encoded thereby can be by any method known in the art.
- Polynucleotides comprising a desired sequence can be inserted into a suitable vector, the vector in turn can be introduced into a suitable host cell for replication and amplification.
- Polynucleotides can be inserted into host cells by any means known in the art. Cells are transformed by introducing an exogenous polynucleotide by direct uptake, endocytosis, transfection, f-mating or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated vector (such as a plasmid) or integrated into the host cell genome.
- Amplified DNA can be isolated from the host cell by standard methods. See, e.g., Sambrook et al. (1989). RNA can also be obtained from transformed host cell, it can be obtained by using a DNA-dependent RNA polymerase.
- the present invention further includes a variety of vectors comprising a polynucleotide encoding BDCA-2 and/or BDCA-3. These vectors can be used for expression of recombinant polypeptides as well as a source of BDCA-encoding polynucleotides.
- Cloning vectors can be used to obtain replicate copies of the polynucleotides, or for storing the polynucleotides in a depository for future recovery.
- Expression vectors and host cells containing these expression vectors
- Suitable cloning and expression vectors include any known in the art e.g., those for use in bacterial, mammalian, yeast and insect expression systems. Specific vectors and suitable host cells are known in the art and are not described in detail herein.
- Cloning and expression vectors typically contain a selectable marker (for example, a gene encoding a protein necessary for the survival or growth of a host cell transformed with the vector), although such a marker gene can be carried on another polynucleotide sequence co-introduced into the host cell. Only those host cells into which a selectable gene has been introduced will grow under selective conditions. Typical selection genes either: (a) confer resistance to antibiotics or other toxic substances, e.g., ampicillin, neomycin, methotrexate; (b) complement auxotrophic deficiencies; or (c) supply critical nutrients not available from complex media.
- a selectable marker for example, a gene encoding a protein necessary for the survival or growth of a host cell transformed with the vector
- Typical selection genes either: (a) confer resistance to antibiotics or other toxic substances, e.g., ampicillin, neomycin, methotrexate; (b) complement auxotrophic deficiencies; or (c) supply critical nutrients not available from complex media
- Vectors also typically contain a replication system recognized by the host. Suitable cloning vectors can be constructed according to standard techniques, or can be selected from a large number of cloning vectors available in the art. While the cloning vector selected can vary according to the host cell intended to be used, useful cloning vectors will generally have the ability to self-replicate, can possess a single target for a particular restriction endonuclease, or can carry genes for a marker that can be used in selecting clones containing the vector.
- Suitable examples include plasmids and bacterial viruses, e.g., pUC18, mpl8, mpl9, pBR322, pMB9, ColEl, pCRl, RP4, phage DNAs, and shuttle vectors such as pSA3 and pAT28. These and many other cloning vectors are available from commercial vendors such as BioRad, Stratagene, and Invitrogen.
- Expression vectors generally are replicable polynucleotide constructs that contain a polynucleotide encoding a BDCA of interest. The polynucleotide encoding BDCA is operatively linked to suitable transcriptional controlling elements, such as promoters, enhancers and terminators.
- one or more translational controlling elements are also usually required, such as ribosome binding sites, translation initiation sites, and stop codons.
- These controlling elements transcriptional and translational
- a polynucleotide sequence encoding a signal peptide can also be included to allow a BDCA to cross or lodge in cell membranes or be secreted from the cell.
- a number of expression vectors suitable for expression in eukaryotic cells including yeast, avian, and mammalian cells are known in the art.
- an expression vector is pcDNA3 (Invitrogen, San Diego, CA), in which transcription is driven by the cytomegalovirus (CMV) early promoter/enhancer. This vector also contains recognition sites for multiple restriction enzymes for insertion of the polynucleotide of interest.
- CMV cytomegalovirus
- Another example of an expression vector (system) is the baculovirus/insect system.
- Other suitable for use in antibody-targeted gene therapy comprising a polynucleotide encoding a BDCA. Suitable systems are described for instance by Brown et al. (1994) Virol. 198:477-488; and Miyamura et al. (1994) Proc. Natl. Acad. Sci. USA 91:8507-8511.
- the vectors containing the polynucleotides of interest can be introduced into the host cell by any of a number of appropriate means, including electroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; upofection; and infection.
- electroporation employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances
- microprojectile bombardment upofection
- infection infections.
- the choice of means of introducing vectors or polynucleotides encoding BDCAs will often depend on features of the on the host cell.
- expression of a BDCA can be determined using any assay known in the art. For example, the presence thereof can be detected by RIA or ELISA of the culture supernatant (if the polypeptide is secreted) or cell lysates.
- a vector of this invention can contain one or more polynucleotides encoding a BDCA. It can also contain polynucleotide sequences encoding other polypeptides that enhance, facilitate, or modulate the desired result, such as cytokines, including, but not limited to, IL-2, JL-4, GM-CSF, TNF- ⁇ and IFN- ⁇ . Also embodied in this invention are vaccinia vectors encoding for recombinant BDCAs.
- prokaryotic host cells include, but are not limited to, bacterial cells, for example E. coli and mycobacteria.
- Eukaryotic hosts include, but are not limited to, yeast, insect, avian, plant and mammalian cells. Host systems are known in the art and need not be described in detail herein. Examples of a mammalian host cells include, but are not limited to, CHO and NSO, obtainable from the European Collection of Cell Cultures (England).
- the host cells of this invention can be used, inter alia, as repositories of polynucleotides encoding BDCAs, or as vehicles for production thereof. They can be used also as vehicles for in vivo expression of BDCAs.
- the polynucleotides of this invention have several uses. They are useful, for example, in expression systems for the production of BDCA. They are also useful as hybridization probes to assay for the presence of polynucleotides encoding BDCAs or related sequences in a sample using methods well known to those in the art. Further, the polynucleotides are also useful as primers to effect amplification of desired polynucleotides. The polynucleotides of this invention are also useful in pharmaceutical compositions including vaccines and for gene therapy. The polynucleotides can also be used as hybridization probes for detection of BDCA- encoding sequences. Suitable hybridization samples include cells transformed ex vivo for use in gene therapy.
- DNA or RNA is extracted from a sample, and optionally run on a gel and/or digested with restriction nucleases.
- the processed sample polynucleotide is typically transferred to a medium suitable for washing.
- the sample polynucleotide is then contacted with the BDCA-encoding polynucleotide probe under conditions that permit a stable duplex to form if the sample contains a complementary polynucleotide sequence.
- Any stable duplexes formed are detected by any suitable means.
- the polynucleotide probe can be supplied in labeled form, and label remaining with the sample after washing will directly reflect the amount of stable duplex formed.
- hybridization is performed in situ. A suitably prepared tissue sample is overlaid with a labeled probe to indicate the location of BDCA-encoding sequences.
- a short polynucleotide can also be used as a primer for a PCR reaction, particularly to amplify a longer sequence comprising a region hybridizing with the primer. This can be conducted preparatively, in order to produce polynucleotide for further genetic manipulation. It can also be conducted analytically, to determine whether a BDCA-encoding polynucleotide is present, for example, in a sample of diagnostic interest.
- polynucleotides are in vaccines and gene therapy.
- the general principle is to administer the polynucleotide so that it either promotes or attenuates the expression of the polypeptide encoded thereby.
- the present invention includes methods of inducing an immune response and methods of treatment comprising administration of an effective amount of polynucleotides encoding BDCAs to an individual.
- a polynucleotide encoding BDCA is administered to an individual, either directly or via cells transfected with the polynucleotide.
- the polynucleotide is in the form of a circular plasmid, preferably in a supercoiled configuration.
- the polynucleotide is replicated inside a cell.
- the polynucleotide is operatively linked to a suitable promoter, such as a heterologous promoter that is intrinsically active in cells of the target tissue type.
- a suitable promoter such as a heterologous promoter that is intrinsically active in cells of the target tissue type.
- plasmids persist as circular non-replicating episomal molecules. In vitro mutation can be carried out with plasmid constructs to encode, for example, molecules with greater affinity and/or avidity.
- plasmids containing BDCA polynucleotides are capable of expression in eukaryotic cells.
- cells such as COS-7, CHO, or HeLa can be transfected with the plasmids.
- Expression is then determined by immunoassay; for example, by Western blot.
- Smaller BDCAs can be detected, for example, by constructing the plasmid so that the resultant polypeptide is fused with a tag, such as a target epitope or enzyme label. Further characterization of the expressed polypeptide can be achieved by purifying the peptide and then conducting one of the functional assays described herein.
- the polynucleotides of this invention are used for genetically altering cells ex vivo.
- cells removed from a donor or obtained from a cell line are transfected or transduced with BDCA vectors, and then administered to a recipient.
- Suitable cells for transfection include peripheral blood mononuclear cells.
- the polynucleotides of this invention are used for genetically altering cells in vivo. The purpose can include, but is not limited to, treating various types of cancer.
- the polynucleotides can also be used to produce cells that do not express BDCA-2, and transgenic animals expressing BDCA-2. Also obtained from the invention are cells engineered not to express or to express at significantly reduced levels BDCA-2. Such cells may be produced by selecting a cell, preferably a DC, and providing to the cell an expression construct comprising a polynucleotide encoding a BDCA-2 gene wherein the polynucleotide is positioned antisense to and operatively linked to a promoter. The expression of such a polynucleotide effectively produces a cell deficient in BDCA-2.
- the present invention provides a method for the preparation of recombinant host cells that produce significantly reduced amounts or even "knockout" the production of BDCA-2.
- recombinant host cells can be prepared by using one or more means that are well known to those of skill in the art.
- gene expression can be inhibited by the incorporation of constructs for antisense DNA or RNA into the genome. Deletions or mutations of the endogenous BDCA-2 genes can render them nonfunctional.
- Nucleic acids encoding ribozymes— RNA-cleaving enzymes— that specifically cleave BDCA- 2 mRNA can be introduced into the recombinant host cells.
- knockout refers to partial or complete suppression of the expression of at least a portion of a protein encoded by an endogenous DNA sequence, e.g. BDCA-2, in a cell.
- knockout construct refers to a nucleic acid sequence that is designed to decrease or suppress expression of a protein encoded by endogenous DNA sequences in a cell.
- knockout mammals such that the production of BDCA-2 is suppressed in DCs.
- the preparation of knock out and transgenic animals is well known to those of skill in the art and is described in 5,434,340, 5,530,179 and 5,557,032.
- the invention further provides methods for producing animals and the animals so produced that over-express BDCA-2. These methods generally comprise introducing animal cells into an animal, the animal cells having been treated in vitro to insert therein a DNA segment encoding a BDCA-2 polypeptide, the animal cells expressing in vivo in the animal BDCA-2.
- kits containing anti-DC-specific antigen-binding fragments for measuring BDCA-2 including soluble BDCA-2, including isoforms thereof, in serum and other sources. Diagnostic procedures using the kits can be performed by diagnostic laboratories, experimental laboratories, practitioners, or private individuals. The clinical sample is optionally pre-treated for enrichment of the target being tested for. The user then applies a reagent contained in the kit in order to detect the changed level or alteration in the diagnostic component.
- the reagent can be conjugated with a label to permit detection of any complex formed with the target in the sample.
- a second reagent is provided that is capable of combining with the first reagent after it has found its target and thereby supplying the detectable label.
- labeled anti-murine IgG can be provided as a secondary reagent.
- Labeled avidin is a secondary reagent when the primary reagent has been conjugated to biotin.
- kits can be employed on a variety of biological samples including, both liquid samples, cell suspensions and tissue samples. Suitable assays that can be supplied in kit form include those described herein.
- Each reagent is supplied in a solid form or dissolved/suspended in a liquid buffer suitable for inventory storage and later for exchange or addition into the reaction medium when the test is performed.
- Suitable packaging is provided.
- the kit can optionally provide additional components that are useful in the procedure. These optional components include, but are not limited to, buffers, capture reagents, developing reagents, labels, reacting surfaces, means for detection, control samples, instructions, and interpretive information.
- compositions described herein are conducted in accordance with generally accepted procedures for the preparation of pharmaceutical preparations. See, for example, Remington's Pharmaceutical Sciences 18th Edition (1990), E.W. Martin ed., Mack Publishing Co., PA. Depending on the intended use and mode of administration, it can be desirable to process the active ingredient further in the preparation of pharmaceutical compositions. Appropriate processing can include sterilizing, mixing with appropriate non-toxic and non-interfering components, dividing into dose units, and enclosing in a delivery device.
- the therapeutic compositions contain DCs, subpopulations thereof or mixtures thereof.
- the compositions contain the antigen-binding fragments described herein.
- the antigen-binding fragments are, or are derived from, the mAbs listed in Table 1.
- the DC compositions contain DCs isolated with one of these antigen-binding fragments.
- compositions of the invention are administered by a mode appropriate for the form of composition.
- Typical routes include intravenous, subcutaneous, intramuscular, intraperitoneal, intradermal, oral, intranasal, intradermal, and intrapulmonary (i.e., by aerosol).
- Pharmaceutical compositions for human use are typically administered by a parenteral route, most typically intravenous, subcutaneous, intramuscular.
- pharmaceutical compositions are preferably supplied in unit dosage form suitable for administration of a precise amount.
- Also contemplated by this invention are slow release or sustained release forms, whereby a relatively consistent level of the active compound are provided over an extended period.
- Liquid pharmaceutically acceptable compositions can, for example, be prepared by dissolving or dispersing a polypeptide or polynucleotide embodied herein in a liquid excipient, such as water, saline, aqueous dextrose, glycerol, or ethanol.
- a liquid excipient such as water, saline, aqueous dextrose, glycerol, or ethanol.
- the composition can optionally also contain other medicinal agents, pharmaceutical agents, carriers, and auxiliary substances such as wetting or emulsifying agents, and pH buffering agents.
- Compositions for injection can be supplied as liquid solutions or suspensions, as emulsions, or as solid forms suitable for dissolution or suspension in liquid prior to injection.
- compositions for oral, intranasal, or topical administration can be supplied in solid, semi-solid or liquid forms, including tablets, capsules, powders, liquids, and suspensions.
- a preferred composition is one that provides a solid, powder, or liquid aerosol when used with an appropriate aerosolizer device.
- the invention also encompasses compositions comprising liposomes with membrane bound peptide to specifically deliver the liposome to the area of the tumor or neoplastic cells or to the immune system. These liposomes can be produced such that they contain, in addition to peptide, immunotherapeutic agents such as those described above which would then be released at the recognition site.
- Another such delivery system utilizes chimeric parvovirus B19 capsids for presentation of the antigen-binding fragments. Brown et al. (1994) Virol. 198:477-488; and Miyamura et al. (1994) Proc. Natl. Acad. Sci. USA 91:8507-8511. Such chimeric systems are encompassed for use herein.
- test compounds are prepared as a suitable pharmaceutical composition and administered to test subjects.
- Initial studies are preferably done in small animals such as mice or rabbits, optionally next in non-human primates and then ultimately in humans. Immunogenicity is preferably tested in individuals without a previous antibody response.
- a test composition in an appropriate test dose is administered on an appropriate treatment schedule. It can be appropriate to compare different doses and schedules within the predicted range.
- the dosage ranges for the administration of antigen-binding fragments are large enough to produce the desired effect in which the symptoms of the disease are ameliorated without causing undue side effects such as unwanted cross-reactions and anaphylactic reactions.
- the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any complication. Generally, when the compositions are administered conjugated with therapeutic agents, lower dosages, comparable to those used for in vivo immunodiagnostic imaging, can be used.
- Antigen-binding Fragments The invention encompasses pharmaceutical compositions containing the antigen- binding fragments described herein.
- Such pharmaceutical compositions are useful for inducing or aiding an immune response and treating neoplastic diseases, or including tolerance and treating autoimmune diseases, (GvHD, allograft rejection, allergen, etc.) either alone or in conjunction with other forms of therapy, such as chemotherapy, radiotherapy or immune therapies described in WO98/23735; WO98/34642; WO97/10000; WO97/10001 ; and WO97/06821.
- Suitable diseases include, without limitation, viral, parasitic, bacterial, fungal, neoplastic and autoimmune.
- Flt3-Ligand a stimulatory cytokine for a variety of hematopoietic lineages, including DCs and B cells
- Flt3-L a stimulatory cytokine for a variety of hematopoietic lineages, including DCs and B cells
- DCs can also be loaded with or transduced to express tumor antigens; these cells are then used as adjuvants to tumor vaccination.
- DCs present tumor-associated antigens endogenously to the afferent lymphatic system in the appropriate MHC-restricted context. Wan et al. (1997) Hum ' . Gene Ther. 8:1355-63; Peiper et al.
- Vaccines can be packaged in pharmaceutically acceptable carriers, admixed with adjuvants or other components (such as cytokines) as known in the art. Vaccines for veterinarian use are substantially similar to that in humans with the exception that adjuvants containing bacteria and bacterial components such as Freund's complete or incomplete adjuvants, are allowed in the formulations. F. Methods of Treatment
- the methods comprise administering an amount of a pharmaceutical composition containing a composition of the invention in an amount effective to achieve the desired effect, be it palliation of an existing condition or prevention of recurrence.
- the amount of a pharmaceutical composition administered is an amount effective in producing the desired effect.
- An effective amount can be provided in one or a series of administrations.
- An effective amount can be provided in a bolus or by continuous perfusion.
- Suitable active agents include the anti-neoplastic drugs, bioresponse modifiers and effector cells such as those described by Douillard et al. (1986) Hybridomas (Supp. 1:5139).
- compositions and treatment modalities are suitable for treating a patient by either directly or indirectly eliciting an immune response against neoplasia.
- An "individual,” “patient” or “subject” is a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to: humans, wild animals, feral animals, farm animals, sport animals, and pets.
- a “cancer subject” is a mammal, preferably a human, diagnosed as having a malignancy or neoplasia or at risk thereof.
- treatment refers to clinical intervention in an attempt to alter the disease course of the individual or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology.
- Therapeutic effects of treatment include without limitation, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastases, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
- the "pathology" associated with a disease condition is any condition that compromises the well-being, normal physiology, or quality of life of the affected individual. This can involve, but is not limited to, destructive invasion of affected tissues into previously unaffected areas, growth at the expense of normal tissue function, irregular or suppressed biological activity, aggravation or suppression of an inflammatory or immunologic response, increased susceptibility to other pathogenic organisms or agents, and undesirable clinical symptoms such as pain, fever, nausea, fatigue, mood alterations, and such other disease- related features as can be determined by an attending physician.
- an "effective amount” is an amount sufficient to effect a beneficial or desired clinical result upon treatment.
- An effective amount can be administered to a patient in one or more doses.
- an effective amount is an amount that is sufficient to palliate, ameliorate, stabilize, reverse or slow the progression of the disease, or otherwise reduce the pathological consequences of the disease.
- the effective amount is generally determined by the physician on a case-by-case basis and is within the skill of one in the art. Several factors are typically taken into account when determining an appropriate dosage to achieve an effective amount. These factors include age, sex and weight of the patient, the condition being treated, the severity of the condition and the form and effective concentration of the antigen-binding fragment administered.
- immunomodulatory or “modulating an immune response” as used herein includes immunostimulatory as well as immunosuppressive effects.
- Immunostimulatory effects include, but are not limited to, those that directly or indirectly enhance cellular or humoral immune responses.
- immunostimulatory effects include, but are not limited to, increased antigen-specific antibody production; activation or proliferation of a lymphocyte population such as NK cells, CD4 + cells, CD8 + cells, macrophages and the like; increased synthesis of cytokines or chemokines including, but not limited to, JL-1, LL-2, IL-4, IL-5, LL-6, ⁇ L-12, interferons, TNF- ⁇ , LL-10, TGF- ⁇ and the like.
- Immunosuppressive effects include those that directly or indirectly decrease cellular or humoral immune responses.
- immunosuppressive effects include, but are not limited to, a reduction in antigen-specific antibody production such as reduced IgE production; activation of lymphocyte or other cell populations that have immunosuppressive activities such as those that result in immune tolerance; and increased synthesis of cytokines that have suppressive effects toward certain cellular functions including, but not limited to IL-10 and TGF- ⁇ .
- IFN- ⁇ which appears to block IL-4 induced class switch to IgE and IgGl, thereby reducing the levels of these antibody subclasses.
- Suitable human subjects for cancer therapy further comprise two treatment groups, which can be distinguished by clinical criteria.
- Patients with "advanced disease” or "high tumor burden” are those who bear a clinically measurable tumor.
- a clinically measurable tumor is one that can be detected on the basis of tumor mass (e.g., by palpation, CAT scan, sonogram, mammogram or X-ray; positive biochemical or histopathologic markers on their own are insufficient to identify this population).
- a pharmaceutical composition embodied in this invention is administered to these patients to elicit an anti-tumor response, with the objective of palliating their condition.
- reduction in tumor mass occurs as a result, but any clinical improvement constitutes a benefit.
- Clinical improvement includes decreased risk or rate of progression or reduction in pathological consequences of the tumor.
- a second group of suitable subjects is known in the art as the "adjuvant group.” These are individuals who have had a history of cancer, but have been responsive to another mode of therapy. The prior therapy can have included (but is not restricted to, surgical resection, radiotherapy, and traditional chemotherapy. As a result, these individuals have no clinically measurable tumor. However, they are suspected of being at risk for progression of the disease, either near the original tumor site, or by metastases.
- adjuvant as used herein has several meanings, all of which will be clear depending on the context in which the term is used.
- an adjuvant is a chemical or biological agent given in combination (whether simultaneously or otherwise) with, or recombinantly fused to, an antigen to enhance immunogenicity of the antigen.
- an antigen to enhance immunogenicity of the antigen.
- Isolated DCs have also been suggested for use as adjuvants.
- Compositions for use therein are included in this invention.
- adjuvant refers to a class of cancer patients with no clinically detectable tumor mass, but who are suspected of risk of recurrence.
- This group can be further subdivided into high-risk and low-risk individuals. The subdivision is made on the basis of features observed before or after the initial treatment. These features are known in the clinical arts, and are suitably defined for each different cancer. Features typical of high-risk subgroups are those in which the tumor has invaded neighboring tissues, or who show involvement of lymph nodes. Another suitable group is those with a genetic predisposition to cancer but who have not yet evidenced clinical signs of cancer. For instance, women testing positive for a genetic mutation associated with breast cancer, but still of childbearing age, can wish to receive one or more of the antigen-binding fragments described herein in treatment prophylactically to prevent the occurrence of cancer until it is suitable to perform preventive surgery.
- Human cancer patients including, but not limited to, glioblastoma, melanoma, neuroblastoma, adenocarcinoma, glioma, soft tissue sarcoma, and various carcinomas (including small cell lung cancer) are especially appropriate subjects.
- Suitable carcinomas further include any known in the field of oncology, including, but not limited to, astrocytoma, fibrosarcoma, myxosarcoma, liposarcoma, oligodendroglioma, ependymoma, medulloblastoma, primitive neural ectodermal tumor (PNET), chondrosarcoma, osteogenic sarcoma, pancreatic ductal adenocarcinoma, small and large cell lung adenocarcinomas, chordoma, angiosarcoma, endotheliosarcoma, squamous cell carcinoma, bronchoalveolarcarcinoma, epithelial adenocarcinoma, and liver metastases thereof, lymphangiosarcoma, lymphangioendotheliosarcoma, hepatoma, cholangiocarcinoma, synovioma, mesothelioma, Ewing's
- the patients can have an advanced form of disease, in which case the treatment objective can include mitigation or reversal of disease progression, and/or amelioration of side effects.
- the patients can have a history of the condition, for which they have been treated, in which case the therapeutic objective will typically include a decrease or delay in the risk of recurrence.
- Autoimmune disorders are the caused by a misdirected immune response resulting in self-destruction of a variety of cells, tissues and organs. The cause of these disorders is unknown. Recognition of self through the MHC is known to be of importance in an immune response. However, prevention of an autoimmune response and the cells responsible for autoimmunity are not well understood.
- autoimmune disorders are characterized by B cell hyperactivity, marked by proliferation of B cells and autoantibodies and by hypergammaglobulinemia. B cell hyperactivity is probably related to T cell abnormalities. Hormonal and genetic factors strongly influence the incidence of autoimmune disorders; for example, lupus erythematosus predominantly affects women of child-bearing age, and certain HLA haplotypes are associated with an increased risk of specific autoimmune disorders.
- Common autoimmune disorders include, but are not limited to, rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, SjOgren's syndrome, lupus erythematosus, Goodpasture's syndrome, Reiter's syndrome, scleroderma, vasculitis, polymyositis and dermatomyositis. Many of these conditions include aberrant inflammatory reactions related to the immunologic disorders.
- the DCs described herein are suitable for use in treatment of these disorders particularly when used to inactivate or induce tolerogenization in T cells involved in the disorder. Methods of treatment are known in the art.
- one or more of the subsets of DCs obtained by the methods described herein are suitable for use in treatment of autoimmunity.
- Immunologic activity of an antigen-binding fragment refers to specifically binding the antigen which the intact antibody recognizes. Such binding can or can not elicit an immune response.
- a specific immune response can elicit antibody, B cell responses, T cell responses, any combination thereof, and effector functions resulting therefrom. Included, without limitation, are the antibody-mediated functions ADCC and complement-mediated cytolysis (CDC).
- the T cell response includes, without limitation, T helper cell function, cytotoxic T cell function, inflammation/inducer T cell function, and T cell mediated immune suppression.
- Antigen-binding fragment "activity" or “function” refers to any of the immunologic activities of an antibody, including detection, amelioration or palliation of cancer.
- Immune response refers to induction or enhancement of an immunologic response to malignant or diseased tissue, disease-causing agents and other foreign agents to which the body is exposed.
- Immune responses can be humoral, as evidenced by antibody production; and/or cell-mediated, as evidenced by cytolytic responses demonstrated by such cells as natural killer cells or cytotoxic T lymphocytes (CTLs) and the cytokines produced thereby.
- Immune responses can be monitored by a mononuclear cell infiltrate at the site of infection or malignancy. Typically, such monitoring is by histopathology.
- a "cancer- specific immune response” is one that occurs against the malignancy but not against non- cancerous cells.
- the treatments described herein typically induce or augment a cell-mediated immune response but can also induce or augment an antibody-mediated immune response.
- the treatments can also influence the type of immune response to the antigen.
- the compositions according to the invention are also suitable for use in inducing an antigen-specific Thl immune response.
- Stimulating a Thl-type immune response can be measured in a host treated in accordance with the invention and can be determined by any method known in the art including, but not limited to, a reduction in levels of LL-4 measured before and after antigen challenge; or detection of lower (or even absent) levels of IL-4 in a treated host as compared to an antigen-primed, or primed and challenged, control treated without the compositions of the invention; an increase in levels of LL-12, IL-18 and/or IFN ( ⁇ , ⁇ or ⁇ , preferably TFN- ⁇ in a treated host as compared to an antigen-primed or primed and challenged control; IgG2a antibody production in a treated host as compared to an untreated control; a reduction in levels of antigen-specific IgE as measured before and after antigen challenge or detection of lower (or even absent) levels of antigen-specific IgE in a treated host as compared to an antigen primed or primed and challenged untreated host.
- a variety of these determinations can be made by measuring cytokines made by APCs and/or lymphocytes, preferably DCs and/or T cells, in vitro or ex vivo using methods described herein and known in the art. Methods to determine antibody production include any known in the art.
- Thl biased cytokine induction produces enhanced cellular immune responses, such as those performed by NK cells, cytotoxic killer cells, Thl helper and memory cells. These responses are particularly beneficial for use in protective or therapeutic vaccination against viruses, fungi, protozoan parasites, bacteria, allergic diseases and asthma, as well as tumors.
- the invention further includes down-regulation of type I interferon production via ligation of BDCA-2, down-regulation of Thl immune responses via ligation of BDCA-2, and polarization of an immune response to Th2 via ligation of BDCA-2. These indications can be reversed by interfering with ligation of BDCA-2.
- the invention further encompasses screening for suitable moieties for interfering with ligation of BDCA-2 and compositions of these moieties.
- antigen-binding fragments When antigen-binding fragments are used in combination with various therapeutic agents, the administration of both usually occurs substantially contemporaneously.
- substantially contemporaneously means that they are administered reasonably close together with respect to time.
- the administration of the therapeutic agent can be daily, or at any other suitable interval, depending upon such factors, for example, as the nature of the ailment, the condition of the patient and half-life of the agent.
- Therapeutic compositions can be administered by injection or by gradual perfusion over time.
- the antigen-binding fragments can be administered intravenously, intraperitoneally, intra-muscularly, subcutaneously, intracavity, intranodal, intrathecally or transdermally, alone or in combination with other therapeutic agents.
- Another method of administration is intralesionally, for instance by injection directly into the tumor.
- Intralesional administration of various forms of immunotherapy to cancer patients does not cause the toxicity seen with systemic administration of immunologic agents.
- compositions can be administered locally to the area in need of treatment; this can be achieved by, for example, local infusion during surgery, by injection, by means of a catheter, or by means of an implant, the implant being of a porous, non-porous, or gelatinous material, including membranes, such as silastic membranes, or fibers.
- a suitable such membrane is Gliadel® provided by Guilford sciences.
- D) DC are usually thought of as antigen-presenting cells for T cells. However, recent studies from several laboratories have shown that they have important roles in B-cell activation and regulation of antibody synthesis. B cell responses can therefore be modulated via BDCA-2 on DCs. The same can also be true for NK cell responses.
- BDCA-2 polarizes CD4 + T cell responses towards Th2 cell development
- inhibition of BDCA-2 signaling polarizes CD4 + T cell responses towards Thl cell development.
- the invention thus encompasses the polarization of CD4 + T cell responses towards Th2 or Thl cell development by triggering of BDCA-2 signaling or inhibition of triggering of BDCA-2 signaling, respectively.
- mice Five 6-8 week old female Balb/c mice (Simonsen Laboratories, Gilroy, CA) were inoculated with approximately 5 x 10 5 to 1 X 10 6 purified HLA-DR + lin — blood DC under anesthesia on d 0, 4, 7, 11, and 14 in the right hand footpad, and approximately 1 X 10 6 HLA- A2 + Bristol-8 B lymphoblastoma cells in the left hand footpad on d -3, 0, 4, 7, 11, and 14. Both cell types were incubated with 1 : 100 PHA (Gibco/BRL, Gaithersburg, MD) for 10 min at room temperature and washed with PBS before injection. This treatment provides nonspecific adjuvant effects and obviates the need for adjuvants such as Freund's adjuvant.
- HLA-DR + lin ⁇ DC On d 15, one day after the fifth injection of HLA-DR + lin ⁇ DC, the mouse right hand popliteal lymph nodes were removed. A lymphocyte suspension was prepared and the cells were fused to SP2/0 Agl4 myeloma cells using a modification of the method described by Kohler and Milstein (1975) Nature 256:495. Fused cells were plated on 96-well plates in DMEM supplemented with 20% FCS (HyClone, Logan, UT), 2 mmol/L Lglutamine, 15 mmol/L Hepes, 10 -4 mmol/L hypoxanthine (Gibco/BRL), and placed in a 37°C incubator with 9% C0 2 .
- FCS HyClone, Logan, UT
- 2 mmol/L Lglutamine 15 mmol/L Hepes
- 10 -4 mmol/L hypoxanthine Gabco/BRL
- supematants from these wells were screened by flow cytometry for antibody secretion and for non-reactivity ( ⁇ 1% positive cells) to PBMC. Briefly, a mixture of rat anti-mouse kappa mAb-conjugated polystyrene beads (2.5 ⁇ m in diameter, Interfacial Dynamics Corp., Portland, OR) and PBMC was incubated with' 50 ⁇ l hybridoma supernatant for 20 min at room temperature.
- the bead/cell mixture was then washed twice with PBS, pH 7.4, containing 5 mmol/L EDTA and 0.5% BSA (PBS/EDTA/BSA), and binding of mouse IgM, IgGl, IgG2a and IgG2b from the supematants to the beads and the test cells was detected by staining with PE conjugated rat anti-mouse IgM mAb (clone X54, BD Biosciences, San Jose, CA), rat anti-mouse IgGl mAb (clone X56, BD Biosciences) and rat anti-mouse IgG2 mAb (clone X57, BD Biosciences).
- PE conjugated rat anti-mouse IgM mAb clone X54, BD Biosciences, San Jose, CA
- rat anti-mouse IgGl mAb clone X56, BD Biosciences
- the mixture was then washed twice with PBS/EDTA/BSA, and stained with PE-conjugated rat anti-mouse IgM mAb, rat anti-mouse IgGl mAb, and rat anti-mouse IgG2 mAb to detect binding of mouse IgM, IgGl, IgG2a and IgG2b from the supematants to the beads and the enriched blood DC.
- HLA-DR + DC from HLA-DR- cells was washed once, free binding sites of the PE-conjugated rat anti-mouse IgG2 mAb and the bead-conjugated rat anti -mouse K mAb were saturated by incubation with 100 ⁇ g/ml mouse IgG2a for 5 min at room temperature, and the mixture was counter-stained with anti-HLA- DR-FTTC (cloneAC122, IgG2a).
- Selected hybridoma cells were expanded in culture, stocks were frozen in liquid nitrogen, subclones were established by limiting dilution, and series of positive subclones were also frozen in liquid nitrogen.
- the isotype of the mAb was determined by the ISOTYPE Ab-STAT Kit (SangStat Medical Corp., Palo Alto, CA).
- hybridoma cells were either grown as an ascites tumor in Balb/c mice, with collection of mAb-rich ascites fluid, or in cell culture (roller culture or hollow- fiber culture), with collection of mAb-rich culture supernatant.
- Pure IgG mAb was prepared from ascites fluid or cell culture supernatant by Protein A affinity chromatography followed in some cases by hydrophobic interaction chromatography and stored in PBS with 5 mmol/L EDTA and 0.05% sodium azide at 4°C.
- Purified mAb were conjugated to FTTC (Sigma, St.
- PBMC Buffy coats from normal healthy volunteers were obtained from the Institute for Transfusionmedicine, Hospital Merheim, Cologne, Germany. PBMC were prepared from buffy coats by standard Ficoll-Paque (Pharmacia, Uppsala, Sweden) density gradient centrifugation.
- Peripheral blood leukocytes were prepared from buffy coats by lysis of erythrocytes in isotonic ammonium chloride buffer (155 mmol/L NH 4 CI, 10 mmol/L KHCO 3 and 0.1 mM EDTA). Hansel et al. (1991) J. Immunol. Met. 145:105-110. CD4 + lin ⁇ blood DC were isolated from PBMC by two-step immunomagnetic cell sorting (MACS) as described in detail elsewhere. Robert et al. (1999); and Miltenyi et al. (1999) High gradient magnetic cell sorting. In, Flow cytometry and cell sorting. Ed., Radbruch. Springer- Verlag, Berlin, pp.
- MCS immunomagnetic cell sorting
- monocytes, T cells, and NK cells were depleted using mAb against CD3 (Clone BW264/56), CDllb (clone Ml/70.15.11.5), CD16 (Clone VEP-13) and in a few experiments a poorly defined antigen expressed on B cells and monocytes (clone L179).
- CD3 CD3
- CDllb clone Ml/70.15.11.5
- CD16 CD16
- clone L179 a poorly defined antigen expressed on B cells and monocytes
- blood DC were then enriched to high purity using an antibody against CD4 (M-T321).
- M-T321 an antibody against CD4
- blood DC were merely partially enriched by immunomagnetic depletion of T cells, B cells and monocytes based on CD3 and L179 antigen expression.
- CDlc-, BDCA-2-, and BDCA-3 -expressing cells were isolated from PBMC or tonsils by indirect magnetic labeling with PE- or FTTC-conjugated mAb (AD5-8E7, AC144 and AD6-5E8, respectively) as primary reagent and anti-PE or anti-FITC mAb-conjugated microbeads (Miltenyi Biotec GmbH) as secondary reagent, and enrichment of labeled cells by MACS.
- BDCA-3 "1" cells were isolated based on direct magnetic labeling with anti-BDCA-3 mAb (AD5-5E8)-conjugated microbeads.
- CDlc + blood DC without contaminating CDlc "1" B cells were obtained by immunomagnetic depletion of CD18+ B cells using CD19 mAb-conjugated microbeads (Miltenyi Biotec GmbH) followed by immunomagnetic enrichment of CDlc + cells.
- Basophils were purified from PBMC by immunomagnetic depletion of non-basophils based on indirect magnetic labeling of CD3-, CD7-,CD14-, CD15-, CD36-, CD45RA-, and HLA-DR-expressing cells with a magnetic labeling kit (Miltenyi Biotec).
- CD14 + monocytes, CD34 + hematopoietic progenitor cells and CD3 + T cells were immunomagnetically purified based on direct magnetic labeling with CD 14, CD34 and CD3 mAb-conjugated microbeads (Miltenyi Biotec GmbH), respectively. Cell culturing
- CD14 + monocytes were cultured at a cell density of 5 x 10 5 to 1 x 10 6 cells/ml in medium [RPMI 1640 (Gibco/BRL) supplemented with 2mmol/L L-glutamine, 10% FCS (Sigma), 100 mmol/L sodium pyruvate (Gibco/BRL), 100 U/ml penicillin (Gibco/BRL), and 100 ⁇ g/ml streptomycin (Gibco/BRL)] at 37°C in a humidified 5% C0 2 -containing atmosphere in the presence of 500-1000 U/ml rIL-4 (PeproTech, Rocky Hill, NJ) and 100 ng ml rGM-CSF (PeproTech) for 7 d.
- medium RPMI 1640 (Gibco/BRL) supplemented with 2mmol/L L-glutamine, 10% FCS (Sigma), 100 mmol/L sodium pyruvate (Gibco/BRL
- CD34 + hematopoietic progenitor cell-derived DC CD34-DC
- purified CD34+ cells were cultured at a cell density of 5 xlO 4 cells/ml in medium in the presence of 100 ng/ml rFlt3-Ligand (PeproTech), 0.5 ng/mL rTGF- ⁇ l (PeproTech), 10 ng/ml rTNF- ⁇ , 20 ng/ml rSCF (PeproTech) and 100 ng/ml rGM-CSF for 11 d.
- Freshly isolated CD4 + lin " blood DC were cultured at a cell density of 5 x 10 5 to 1 x 10 6 cells/ml in medium in the presence of 10 ng/ml rIL-3 (PeproTech) for up to 48 h.
- Isolated CDlc-, BDCA-2-, and BDCA-3- expressing DC were cultured at a cell density of 5 x 10 5 to 1 x 10 6 cells/ml in medium without any cytokines or in the presence of 10 ng/ml rLL-3, 20 ng/ml LL-4 (PeproTech) and 100 ng/ml GM-CSF for up to 48 h.
- Example 2 Example 2
- Example 3 Cross-inhibition, co-capping and co-internalization analysis To analyze whether two different mAb clones recognize the same (or a closely related) antigen epitope, cross-inhibition binding assays were performed. Between 1 x 10 6 and 2 x 10 6 cells were pre-incubated with one of the two mAb clones at a concentration of about 100 ⁇ g/ml for 10 min at 4°C, and then stained with a PE-conjugate of the other mAb clone at its optimal titer for another 5 min at 4°C.
- PBMC peripheral blood mononuclear cells
- MOLT-4 cells were used to analyze cross-inhibition of CDlc-specific mAb clones.
- Cell staining was analyzed by flow cytometry.
- AD5-5E8 and AD5-14H12 recognize the same antigen (or the same antigen-complex)
- BDCA-3-expressing cells were isolated from PBMC by indirect magnetic labeling with PE-conjugated AD5- 14HL2 mAb and anti-PE mAb-conjugated microbeads, and isolated cells were incubated for 30 min at 37°C to induce capping of the mAb-antigen complex.
- a co-intemalization assay was used to investigate whether AC 144 and AD5-17F6 recognize the same antigen (or the same antigen-complex). Briefly, 1 x 10 6 PBMC were incubated with 50 ⁇ g/ml AC 144 mAb for 15 min at room temperature in PBS/BSA, washed twice in PBS/BSA, and then incubated in cell culture medium at 37°C for 30 min. To analyze whether AC 144 mAb is internalized upon culturing, aliquots of the cells were stained before and after the culture period with rat anti-mouse IgGl-PE.
- Endocytosis assay To assess endocytosis of blood DC subsets, purified CDlc + , BDCA-2 + and BDCA-3 + blood DC, and (as control) purified CD3 + T cells were incubated at 37°C in medium with 1 mg/ml Lucifer yellow (LY) for 0, 15, 45, and 75min. Afterwards, cells were washed three times in ice cold PBS EDTA/BSA and analyzed by flow cytometry.
- LY Lucifer yellow
- Example 5 Reactivity of isolated blood DCs with non-cultured blood cells According to their reactivity with blood cells, the mAb listed in Table 1 could be divided into four groups: (1) AC144, AD5-13A11 and ADB-4B8; (2) AD5-17F6; (3) AD5- 5E8 and AD5-14H12; and (4) AD5-8E7.
- the mAb of the first group, AC144, AD5-13A11 and ADB-4B8, stain approximately 0.41 ⁇ 0.17% (n 10) of all PBMC ( Figure 1A).
- these rare cells constitute a homogeneous cell population that is located between small resting lymphocytes and monocytes ( Figure IB). Accordingly, these rare cells do not express the ⁇ T cell receptor (TCR ⁇ ), CD14, CD19 and CD56 ( Figure 1A), lineage markers which are expressed on T cells, monocytes, B cells and NK cells, respectively.
- the mAb of the second group AD5-17F6, recognizes the same cells among PBMC as AC 144, one of the BDCA-2-specific mAb of the first group. Nevertheless, AD5-17F6 stains an antigen which is different from BDCA-2. This was unequivocally demonstrated by co-intemalization experiments, where AD5-17F6 showed surface staining with equal intensity before and after anti-BDCA-2 mAb-mediated intemalization of BDCA-2, and by staining of DC after culture, where AC144 mAb and AD5-17F6 mAb showed entirely different staining patterns (Figure 4).
- the antigen recognized by AD5-17F6 was named BDCA-4 and is identical to neuropilin-1. He et al. (1997).
- the fourth group, mAb AD5-8E7, reacts with up to 2.39 ⁇ 0.96% (n 10) of unfractionated PBMC ( Figure 1 A).
- Staining of purified DC shows that AD5-8E7, in addition to B cells, stains a third subset of blood DC distinct from those subsets recognized by the mAb of the first and the second group, namely CDl lc bright CD123 dim blood DC.
- AD5-8E7 is not reactive to purified NK cells.
- the antigen recognized by AD5-8E7 was initially named BDCA-1 as it appeared to be a new antigen. However, it later transpired that AD5-8E7 completely blocks binding of the CDlc mAb M241 to MOLT-4 cells ( Figure 6). Thus, the antigen recognized by AD5-8E7 is CDlc. None of the mAb listed in Table 1 is reactive with granulocytes, platelets, erythrocytes, purified basophils and purified CD34 + hematopoietic progenitor cells.
- CDl lc + blood DC Freshly isolated plasmacytoid CDl lc — blood DC depend on IL-3 for survival and maturation, whereas survival and maturation of CDl lc + blood DC is far less cytokine- • dependent.
- Expression of BDCA-2, BDCA-3 and BDCA-4 on CD 1 lc- and CD 1 lc + blood DC was analyzed after 0 h, 1 h, 3 h, 6 h, 9 h, 12 h, 18 h, 24 h, 36 h, and 48 h of culture of total blood DC in the presence of rLL-3. The results are shown in Figure 4. Expression of BDCA-2 is completely down-regulated within 48 h on CDllc- blood DC.
- BDCA-4 is even further up-regulated on CDllc- blood DC and, unlike BDCA-2, is also expressed to a high level on most, if not all, CDllc + DC.
- Expression of BDCA-3 is rapidly induced on CDl lc — blood DC, reaching the highest expression level after 24 h. Thereafter, BDCA-3 expression appears to be down-regulated again. Analyzing the expression of BDCA-3 on CDllc + blood DC is complicated by the fact that BDCA-3 ⁇ CDllc bri8ht and BDCA-3 + CDl lc d ⁇ m subsets are present at the onset of the culture.
- BDCA-3 remains unchanged at least until 6 h of culture on the BDCA-3 + CDllc d ⁇ m blood DC population, and is induced within 3 h on at least some cells of the BDCA-3- CDl lc b ⁇ ght blood DC subset.
- CDla + DC were generated ex vivo from monocytes and from CD34 + hematopoietic progenitor cells.
- Figure 7 shows that Mo-DC, which were generated by culturing monocytes for 7 d in the presence of rGM-CSF and LL-4 and CD34-DC, generated by culturing CD34+ hematopoietic progenitor cells for 11 d in the presence of rFlt3-Ligand, rTGF- ⁇ l, rTNF- ⁇ , rSCF and rGM-CSF, express CDla, CDlc and BDCA-4, but neither BDCA-2 nor BDCA-3.
- Example 7 Intemalization of BDCA-2 upon anti-BDCA-2 mAb-mediated cross-linking
- the possibility that 37°C incubation of anti-DCA-2 Ab-labeled BDCA-2 "1" cells results in mAb intemalization was addressed by staining of PBMC with FTTC-conjugated AC144 mAb (IgGl). Then, following incubation at 37°C, remaining cell surface associated mAb was detected by staining with PE-conjugated rat anti-mouse IgGl mAb. As shown in Figure 8, when cells were incubated at 37°C, the intensity of the rat anti-mouse IgGl-PE staining decreases extremely rapidly to background levels.
- BDCA-2 + and BDCA-3 + blood DC CDlc + , BDCA-2 + and BDCA-3 + cells were isolated from PBMC by indirect magnetic labeling with PE-conjugated primary mAb and anti-PE Ab-conjugated microbeads and enrichment of labeled cells by MACS ( Figure 9). On May Grunwald/Giemsa staining of cytocentrifuge slides ( Figure 9), freshly isolated BDCA-2-expressing cells display the typical lymphoplasmacytoid morphology of CDllc " ⁇ CD4 + lin — DC from blood and tonsils: that is, medium-sized round cells with oval or indented nuclei.
- both freshly isolated CDlc + blood DC as well as freshly isolated BDCA-3 + blood DC display the typical morphological characteristics of CDl lc + CD4 + lin — DC from blood or tonsils: that is, less rounded cells with short cell processes and more hyperlobulated nuclei.
- CDlc + BDC CDlc + B cells with the typical morphology of small resting lymphocytes can be seen on the cytocentrifuge slides of isolated CDlc + PBMC.
- Highly pure CDlc + BDC are obtained if, prior to the enrichment of CDlc "1" cells, CD19 + B cells are magnetically depleted from PBMC.
- Example 9 Surface phenotype of CDlc+. BDCA-2* and BDCA-3* blood DC The phenotype of BDCA-2* and BDCA-3* blood DC was analyzed by two-color immunofluorescence with PE- and FTTC-conjugated mAb. For analysis of CDlc* blood DC, three-color stainings were performed using CD19-Cy5 for exclusion of B cells.
- BDCA-2* blood DC differ from the other two subsets in that they do not express CD13, CD40, CD45RO, CD56, but CD45RA and little amounts of CD10, and in that they express lower levels of CD18, CD38, CD58, CD98, CDl 16 and CLA, but higher levels of CD4.
- CDlc* blood DC differ from the other two subsets in that they express CD2, higher levels of MHC classll molecules, but lower levels of CD62L, and in that they express the Fc receptors CD32, CD64 and Fc ⁇ Rl. Probably due to the Fc receptor-expression, CDlc* blood DC are also positive for IgG, kappa and lambda.
- CDlc* DC are positive for CD14 and CDl lb, whereby the level of expression inversely correlates with the level of both CDlc and CD2 expression.
- BDCA-3* blood DC differ from the other two subsets in that they express CD36 at a much lower level and in that they appear to express low levels of CD5.
- CD33 is useful for discrimination of all three subsets: CD33 is expressed at low levels on BDCA-2* DC, at intermediate levels on BDCA-3* DC and at high levels on CDlc* DC.
- Example 10 Expression of MHC class II, CD83 and co-stimulatory Molecules on CDlc*.
- BDCA-2* AND BDCA-3* blood DC after culture Freshly isolated CDlc* blood DC and BDCA-3* blood DC were cultured for 1 d in medium without any supplemented cytokines and freshly isolated BDCA-2* blood DC were cultured for 2 d in medium supplemented with IL-3 and CD40 mAb on CD32-transfected fibroblasts. After the culture period, cells were analyzed for the expression of CDla, CD80, CD83, CD86 and HLA-DR.
- HLA-DR molecules are up-regulated upon culturing on all three blood DC subsets to a similar level as compared to mature Mo-DC.
- the results were not significantly different in another experiment in which all three blood DC subsets were cultured for 2 d in medium supplemented with TL-3, IL-4 and GM-CSF.
- BDCA-2* blood DC rapidly die when cultured in medium without TL-3.
- Example 11 Endocytic capacity of freshly isolated CDlc*. BDCA-2* and BDCA-3* blood DC
- the endocytic capacity of purified CDlc*, BDCA-2* and BDCA-3* blood DC, and, as a control, of purified CD3* T cells was examined by culturing the cells at 37°C in the presence of LY and analyzing the uptake of LY after various periods of time by flow ' cytometry.
- purified CDlc* blood DC, BDCA-3* blood DC, and to some extent also BDCA-2* blood DC have the ability to endocytose LY. Similar results were obtained using FITC-Dextran.
- the endocytic capacities of all blood DC populations are much lower if compared with Mo-DC.
- the amino acid sequence of BDCA-4 was obtained by purifying the antigen with
- AD5-17F6 mAb AD5-17F6 affinity column
- MALDI TOF mass spectrometry BDCA-4 is identical to neuropilin-1. He et al. (1997).
- BDCA-2*BDCA-4* BDC and BDCA-2- transfected or non-transfected U937 cells were loaded with Indo-1 AM (Sigma, St. Louis, MO) as described by Valitutti et al. (1993) Eur. J. Immunol. 23:790-795.
- Anti-BDCA-2 (AC144, IgGl) or anti-BDCA-4 (AD5-17F6, IgGl) mAb were added to freshly isolated BDCA-2*BDCA-4* BDC and BDCA-2-transfected or non-transfected U937 cells, respectively, followed or not followed by rat anti-mouse IgGl mAb (X56) as cross-linker.
- Cells were analyzed on a flow cytofluorimeter to detect Ca 2 * fluxes. Only live (based on scatter criteria) and Indo-1 -labeled cells (based on 405 nm versus 525 nm emission spectra) were included in the analysis.
- Figure 13 shows intracellular mobilization is induced in immunomagnetically purified BDCA-2*BDCA-4* BDC (A, B) and BDCA-2-transfected U937 cells (D), but not in non- transfected U937 cells (E) via anti-BDCA-2 mAb alone (A) and or anti-BDCA-2 plus crosslinking secondary mAb (B, D, E).
- BDCA-4* BDC in response to viral stimulation is inhibited by triggering of BDCA-2 with anti-BDCA-2 mAb
- CD4*CD123 bright CDllc plasmacytoid DC were shown to be the chief type I interferon producers in response to enveloped viruses, bacteria, and tumor cells. Fitgerald- Bocarsly et al. (1993) Pharmacol. Ther. 60:39-62; Siegal et al. (1999) Science 284:1835- 1837; Cella et al. (1999) Nature Med. 5:919-923. For this reason, they have also been called natural type I interferon producing cells (NIPC). Plasmacytoid DC express BDCA-2 and BDCA-4.
- ligation of surface BDCA-2 on plasmacytoid DC with a specific mAb followed by a secondary cross-linking mAb inhibits secretion of type I interferon by immunomagnetically purified plasmacytoid BDCA- 2*BDCA-4* DC from blood or tonsils in response to stimulation with influenza virus strain PR8 (5 HAU/ml).
- ligation of surface BDCA-4 on plasmacytoid DC with a specific mAb followed by a secondary cross-linking mAb does not inhibit secretion of type I interferon by immunomagnetically purified plasmacytoid BDCA- 2*BDCA-4* DC from blood or tonsils in response to stimulation with influenza vims strain PR8 (5 HAU/ml).
- BDCA-2- and BDCA-4-expressing plasmacytoid DC were isolated from PBMC ( Figure 14A) or tonsillar cells ( Figure 14B) by direct magnetic labeling with anti-BDCA-4 (AD5-17F6)-conjugated microbeads and enrichment of labeled cells by MACS.
- Isolated BDCA-2- and BDCA-4-expressing plasmacytoid DC were cultured for 24 hours in medium in the presence of: a) TL-3 alone ( Figure 14, Control); b) IL-3, anti-BDCA-2 mAb (AC 144, IgGl) and rat anti-mouse IgGl mAb ( Figure 14, AC144+RamGl); c) IL-3, anti-BDCA-2 mAb (AC144, IgGl), rat anti-mouse IgGl mAb, and influenza vims strain PR8 ( Figure 14, AC144+RamGl+FLU); d) TL-3 and influenza virus strain PR8 ( Figure 14, FLU); e) IL-3, anti-cytokeratin mAb (CK3-11D5, IgGl), rat anti-mouse IgGl mAb, and influenza vims strain PR8 ( Figure 14, CK3+RamGl+FLU); and f) TL-3, anti-BDCA-4
- NIPC plasmacytoid DC
- the invention thus further encompasses in vivo, in vitro and ex vivo depletion of NIPC. Such depletion is suitable for use in treatment or prophylaxis of autoimmune diseases.
- Figure 14 shows ligation of BDCA-2 but not of BDCA-4 with a specific mAb followed by a secondary cross-linking mAb inhibits secretion of type I interferon by plasmacytoid BDCA-2*BDCA-4* DC from blood or tonsils in response to stimulation with influenza virus strain PR8.
- Plasmacytoid BDCA-2*BDCA-4* DC from blood (A) or tonsils -(B) were cultured for 24 hours in the presence of TL-3 alone (control); IL-3, anti-BDCA-2 mAb and rat anti-mouse IgGl mAb (AC144+RamGl); TL-3, anti-BDCA-2 mAb, rat anti- mouse IgGl mAb, and influenza vims strain PR8 (AC144+RamGl+FLU); IL-3 and influenza virus strain PR8 (FLU); TL-3, anti-cytokeratin mAb, rat anti-mouse IgGl mAb, and influenza vims strain PR8 (CK3+RamGl+FLU); TL-3, anti-BDCA-4 mAb, rat anti-mouse IgGl mAb, and influenza vims strain PR8 (17F6+RamGl+FLU).
- Example 14 BDCA-2 is not only able to endocytose a ligand, but also to deliver it to an antigen- processing and loading compartment, and to present it to CD 4 * class II-restricted T cells. Materials and Methods:
- BDCA-2- and BDCA-4-expressing plasmacytoid DC were isolated from PBMC by direct magnetic labeling with anti-BDCA-4 (AD5-17F6)-conjugated microbeads and enrichment of labeled cells by MACS.
- Isolated BDCA-2- and BDCA-4-expressing plasmacytoid DC were co-cultured with 4xl0 4 cells /well of the B13 T cell clone (Lanzavecchia et al. (1988) J. Exp. Med. 167:345-352) in 96-well flat-bottom microplates in the presence of IgGl mAbs (0.2 ⁇ g/ml).
- mAbs used in the assay were the following: AC 144 (anti-BDCA-2, IgGl), ZM3.8 (anti- ⁇ LT3, IgGl) and CK3-11D5 (anti-cytokeratin, IgGl).
- AC 144 anti-BDCA-2, IgGl
- ZM3.8 anti- ⁇ LT3, IgGl
- CK3-11D5 anti-cytokeratin, IgGl.
- 3H)Thymidine uptake (cpm) was plotted against the number of isolated BDCA-2- and BDCA-4-expressing plasmacytoid DC in the cultures ( Figure 15).
- Figure 15 shows presentation of anti-BDCA-2 mAb (AC 144, IgGl) to a T cell clone specific for mouse IgGl by isolated BDCA-2- and BDCA-4-expressing plasmacytoid DC.
- BDCA-2*BDCA-4* plasmacytoid DC present anti-BDCA-2 mAb (AC 144, IgGl, ⁇ ) to T cells much more efficiently than anti-ILT-3 mAb (ZM3.8, IgGl, ) and anti-cytokeratin mAb (CK3-11D5, IgGl, •).
- the presentation of the anti- BDCA-2 mAb was compared to that of an IgGl mAb that binds to a receptor (ILT3) known to be capable of targeting its ligand(s) into processing and peptide-loading compartments, and to that of an IgGl mAb that does not bind to a cell-surface molecule on BDCA-2*BDCA-4* plasmacytoid DC (anti-cytokeratin mAb CK3-11D5, IgGl), but can be taken up in the fluid phase.
- BDCA-2*BDCA-4* plasmacytoid DC presented anti-BDCA-2 mAb (AC144) to T cells much more efficiently than the anti-ILT-3 mAb and the anti- cytokeratin mAb.
- Example 15 In tonsillar cells, expression of BDCA-2 is restricted to
- FIG. 16 shows expression of BDCA-2 and BDCA-4 on tonsillar plasmacytoid CD 123* DC. Shown are two-color stainings of tonsillar cells with a FTTC-conjugated mAb against BDCA-2 (AC144) and a PE-conjugated mAb against CD123 and BDCA-4 (AD5- 17F6), respectively. Note that expression of BDCA-2 is restricted to CD123bright plasmacytoid DC, whereas BDCA-4 is also expressed at low levels on a few other cells.
- Example 16 BDCA-4 mAb recognizes neuropilin-1
- Neuropilin-1 is a receptor for the collapsin/semaphorin family that mediates neuronal cell guidance.
- Neuropilin-1 is also expressed by endothelial and tumor cells as an isoform- specific receptor for vascular endothelial growth factor.
- neuropilin-1 is expressed on plasmacytoid DC in blood and tonsils and that it represents an excellent marker for plasmacytoid DC at least in fresh non-cultured blood.
- Neuropilin-1 was immunoprecipitated from cell lysates of non-transfected PAE cells (P) and neuropilin-1-transfected PEA cells (NP) (Soker et al. (1998) Cell 92:735-745) using the anti-BDCA-4 mAb AD5-17F6 (anti-NRP-1 (ML)). Precipitated proteins were analyzed by SDS-PAGE and Western blotting with the BDCA-4-specific mAb AD5-17F6 (ML) or a neuropilin-1-specific mAb from Shay Soker, Children's Hospital, Boston, MA (S).
- Figure 17 shows that neuropilin-1 was immunoprecipitated from cell lysates of neuropilin-1 -transfected PEA cells (NP) but not of non-transfected PAE cells (P) with the anti-BDCA-4 mAb AD5-17F6 (anti-NRP-1 (ML)). Precipitated proteins were analyzed by SDS-PAGE and Western blotting with the BDCA-4-specific mAb AD5-17F6 (ML) or a neuropilin-1-specific mAb from Shay Soker, Children's Hospital, Boston, MA (S).
- the BDCA-4-specific mAb AD5-17F6 immunoprecipitates a specific band of about 130-140 kDa from neuropilin-1-transfected PEA cells (NP), but not from non- transfected PAE cells (P).
- the band can be detected with the neuropilin-1 -specific mAb from Shay Soker (S) but not with the anti-BDCA-4 mAb AD5-17F6 (ML).
- our anti- BDCA-4 mAb AD5-17F6 recognizes the native form of neuropilin-1 in standard immunoprecipitation experiments, but fails to detect the denatured form of neuropilin-1 when used in SDS-PAGE ⁇ Vestern blotting experiments.
- VEGF vascular endothelial growth factor
- Example 17 Production of type I interferon (IFN- ⁇ ) by purified BDCA-2*BDCA-4* BDC in response to stimulation with poly I:C is inhibited by triggering of BDCA-2 with anti-BDCA-2 mAb CD4*CD123 bright CDllc- plasmacytoid DC were shown to be the chief type I interferon producers in response to enveloped viruses, bacteria, and tumor cells.
- NIPC natural type I interferon producing cells
- Plasmacytoid DC express BDCA-2 and BDCA-4. As shown in Figure 19, ligation of surface BDCA-2 on plasmacytoid DC with a specific mAb followed by a secondary cross-linking mAb (goat anti-mouse IgG), inhibits secretion of IFN- ⁇ by immunomagnetically purified plasmacytoid BDCA-2*BDCA-4* DC from blood or tonsils in response to stimulation with polyLC.
- a specific mAb followed by a secondary cross-linking mAb (goat anti-mouse IgG)
- CDl lc " CD123 b ⁇ ght plasmacytoid DC were separated from human peripheral blood mononuclear cells using BDCA-4 microbeads.
- CDl lc " C123 bright plasmacytoid DC (lxlO 6 cells/ml) were incubated with lO ⁇ g/ml of AC144 mAb or mouse IgGl mAb (CF6B, anti- TPO) in RPMI, 10% FCS, lOmM HEPES, 50 ⁇ M 2-ME, 20 ⁇ g/ml gentamicin at 37°C for 30 min.
- 20 ⁇ g/ml of goat anti-mouse IgG (Chemicon International) were added and cells were again incubated at 37°C for 30 min.
- Figure 18 shows ligation of BDCA-2 but not of BDCA-4 with a specific mAb followed by a secondary cross-linking mAb inhibits secretion of IFN- ⁇ by plasmacytoid BDCA-2*BDCA-4* DC from blood or tonsils in response to stimulation with poly I:C.
- Plasmacytoid BDCA-2+ BDCA-4+ DC from blood were cultured with lO ⁇ g/ml of AC 144 mAb (2 and 4) or mouse IgGl mAb (CF6B, anti-TPO, 1 and 3) at 37°C for 30 min. 20 ⁇ g/ml of goat anti-mouse IgG were added and the cells were again incubated at 37°C for 30 min. These cells were cultured with (3 and 4) or without (1 and 2) 20 ⁇ g of poly I:C at 37°C for 24 hours. Culture supematants were harvested and IFN- ⁇ concentrations were determined by ELISA.
- BDCA-2 The cDNA encoding BDCA-2 was obtained by expression cloning in COS cells.
- Figure 5 shows the amino acid sequence of BDCA-2 (the isoform with all six exons expressed).
- BDCA-2 is a novel C-type lectin type ⁇ membrane protein. Such lectins are described, for instance in Bates et al. (1999) J. Immunol. 163:1973-1983. Comparison of BDCA-2 to known C-type lectins is shown in Example 20.
- Figure 19 shows on analysis of human multiple tissue cDNA panels from Clonetech (lane 1: heart; lane 2: brain; lane 3: placenta; lane 4: lung; lane 5: liver; lane 6: skeletal muscle; lane 7: kidney; lane 8: pancreas; lane 9: spleen; lane 10: thymus; lane 11: testis; lane 12: ovary; lane 13: small intestine; lane 14: lymph node; lane 15: bone marrow; lane 16: fetal liver; lane 17: tonsil) and on analysis of cDNAs prepared from different populations of blood leukocytes (lane 18: T cells; lane 19: B cells; lane 20: NK cells; lane 21: monocytes; lane 22: CDl lc brisht CD123 l0W DC; lane23: CDl lc-CD123 bright plasmacytoid BDC) for the presence of BDCA-2 cDNA.
- lane 18 T
- cDNAs were normalized to the mRNA expression level of several different housekeeping genes (glyceraldehyde-3-phosphate dehydrogenase, phospholipase A2, ⁇ - tubulin, and ⁇ -actin). Normalization ensures an accurate assessment of tissue specificity and relative abundance of target mRNAs. The same amount of cDNA (about 50pg) was used for each RT-PCR reaction.
- RT-PCR reactions were performed with specific primers for BDCA- 2 (forward: 5 -TTGAAAGAACCACACCCCGAAAGT (SEQ JD NO: ) and reverse: 5 - TAGCTTTCTACAACGGTGGATGCC (SEQ ID NO: )) and primers for the four housekeeping genes (CLONTECH) mentioned above using AdvanTaq Plus DNA Polymerase (CLONTECH).
- Cycle conditions were as follows: 94°C for 30 sec and 68°C for 2 min. 34 cycles were used for BDCA-2 and 38 cycles for glyceraldehyde-3-phosphate dehydrogenase (G3PDH). Note that BDCA-2 mRNA signals are only detected in CDllc " CD123 right plasmacytoid DC. If four more PCR cycles were used for amplification of BDCA-2 cDNA (38 cycles instead of 34 cycles), weak signals were also detected in pancreas, testis, ovary, bone marrow and tonsil.
- G3PDH glyceraldehyde-3-phosphate dehydrogenase
- the information on the splice variants of BDCA-2 was obtained by RT-PCR amplification of mRNA from plasmacytoid DC with primers complementary to mRNA sequences in front of the start codon (forward primer:
- the positions of the introns are based on Homo sapiens Chromosome 12 Clone RP11- 277J24, Working Draft Sequence, 21 unordered pieces (GenBank Accession Number AC006517) and the mles for splicing of transcripts.
- the intron/exon makeup of BDCA-2 is similar to that of Dectin-2.
- At least four splice variants of BDCA-2 are produced. These are an mRNA encoding a protein with all six exons; an mRNA encoding a protein containing exons 1, 3, 4, 5, and 6; an mRNA encoding a protein containing exons 1, 2, 4, 5, and 6 and an mRNA encoding a protein containing exons 1, 2, 3, 5, and 6.
- Human DCIR (GenBank Accession Number AJ 133532) is the molecule with the highest homology to BDCA-2 among human molecules (see Bates et al. (1999) J. Immunol. 163:1973) with about 51% of the aa being identical over a stretch of 191 aa.
- Mouse Dectin-2 (GenBank Accession Number AF240357) is most likely the murine homolog of human BDCA-2 (see Ariizumi et al. (2000) J. Biol. Chem. 16:11957; WO 98/28332; PCT/US97/23761; and United States Patent 6,046,158) with about 51% of the aa being identical over a stretch of 211 aa.
- BDCA-2 (213 aa), DCIR (237 aa) and Dectin-2 (209 aa) are all type II membrane glycoproteins of the calcium-dependent (C-type) lectin family.
- Each of the molecules contains a putative cytoplasmic domain (BDCA-2: aa 1-21; DCIR: aa 1-44; Dectin-2: aa 1- 17), a putative transmembrane domain (BDCA-2: aa 22-41; DCIR: 44-69; Dectin-2: 18-40), and a putative extracellular domain (BDCA-2: aa 42-213; DCIR: 70-237; Dectin-2: 40-209).
- each of the molecules contains a single carbohydrate recognition domain (CRD) at the COOH-terminal end (BDCA-2: aa 83-206; DCTR: 106-230; Dectin-2: 79-202).
- Figure 23 shows the alignment of human BDCA-2, human DCTR and mouse Dectin-2.
- BDCA-2 contains three putative N-glycosylation sites (aa 110-113 NCSV; aa 137-140 NSSY; aa 164-167 NVTF), whereas Dectin-2 (aa 131-134 NESL) and DCIR (aa 185-188 NESS) contain only one putative N-glycosylation site. All of the putative phosphorylation sites of BDCA-2 and Dectin-2 are located in the putative extracellular domain. Thus, it is rather unlikely that they become phosphorylated by intracellular kinases. Like many C-type lectins (e.g.
- DCTR contains the consensus immunoreceptor tyrosine-based inhibitory motif (TTIM motif; (I/V)XYXX(L/V)) in the cytoplasmic domain (aa 5-10 TTYAEV).
- TTIM motif is not found in the relatively short cytoplasmic tail of BDCA-2 and Dectin-2 (BDCA-2: 21 aa; Dectin-2: 17 aa).
- Example 21 BDCA-3 protein analysis BDCA-3-expressing HD-MY-Z cells were stimulated for 24 hours with 10 ng/ml PMA (Sigma) and 0.5 mg/ml Ionomycin to up-regulate BDCA-3-expression. 3 X 10 7
- PMA/Ionomycin stimulated HD-MY-Z cells were surface biotinylated by incubation for 15 minutes at 4°C with 1 mg/ml Sulfo-NHS-LC-Biotin (Pierce), and washed twice.
- Cells were resuspended in 50 mM Tris-HCl pH 8.0 supplemented with 10% sucrose and proteinase inhibitors (Phenylmethylsulfonylfluoride, Pepstatin A, Leupeptin, and Aprotinin from Serva) and at 0°C ultrasonified (5 x 4 seconds, 70% output). Sonified cells were centrifuged at 900 x g at 4°C for 10 minutes to remove nuclei and intact cells.
- the supernatant was centrifuged at 30,000 x g at 4°C for 2 hours to obtain purified cell membranes.
- Membranes were lysed by incubation in 50 mM Tris-HCl pH 8.0, 150 mM NaCl supplemented with proteinase inhibitors and 1% NP-40 for 1 hour at 0°C.
- Non-solubilized membrane fragments were removed by centrifugation at 30,000 x g at 4°C.
- MnCl 2 and CaCl 2 were added to a final concentration of ImM each.
- the lysate was adsorbed onto a ConA Sepharose column (1 ml), and bound proteins were eluted with 10 ml elution buffer (0.5 M D(+) Mannose, 20 mM Tris-HCl pH 7.4, 0.5 M NaCl, 1% NP-40) and concentrated to a volume of 1 ml using Cetriprep-10 centrifugal concentrators (Amicon).
- 10 ml elution buffer 0.5 M D(+) Mannose, 20 mM Tris-HCl pH 7.4, 0.5 M NaCl, 1% NP-40
- proteins were pre-cleared by incubation with 150 ⁇ l anti-NIP mAb-conjugated MicroBeads (Miltenyi Biotec) for 30 minutes at 4°C and ⁇ MACS column separation.
- anti-NIP mAb-conjugated MicroBeads (Miltenyi Biotec) for 30 minutes at 4°C and ⁇ MACS column separation.
- proteins were either incubated with 2 ⁇ g of the NJP-conjugated BDCA-3-specific mAb AD5-14H12 (IgGl) or for control of specificity with 2 ⁇ g of the NIP -conjugated CD19-specific mAb SJ25-C1 (IgGl) as primary reagent for 14 hours at 4°C, and with anti-NIP mAb-conjugated MicroBeads as secondary reagent for 3 hours at 4°C.
- Precipitated proteins were isolated by ⁇ MACS column separation. Retained proteins were eluted with 70 ⁇ l SDS-PAGE buffer containing DTT. Precipitated proteins were analyzed by SDS-PAGE (4-12%) and Western blotting with streptavidin-peroxidase.
- the results in Figure 24 show that the BDCA-3-specific mAb AD5-14H12 specifically immunoprecipitates a cell surface protein of about 100 kD from HD-MY-Z cells. Thus, BDCA-3 has an apparent molecular weight of 100 kD.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pulmonology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- Dermatology (AREA)
- Toxicology (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Rheumatology (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020027006247A KR100868235B1 (ko) | 1999-11-15 | 2000-11-15 | 수지상 세포에 특이적인 항원-결합 단편, 단편을 사용한조성물 및 방법, 그것에 의해 인식된 항원, 및 그것에의해 얻어진 세포 |
| DE60033062T DE60033062T2 (de) | 1999-11-15 | 2000-11-15 | Antikörper spezifisch für dendritische zellen, zusammensetzungen und verfahren, die diese antikörper verwenden, das durch die antikörper detektierte antigen und die dadurch erhaltenen zellen |
| DK00979855T DK1301539T3 (da) | 1999-11-15 | 2000-11-15 | Antigenbindende fragmenter, der er specifikke for dendristiske celler, sammensætninger og fremgangsmåder til anvendelse deraf, antigener, der genkendes deraf, og celler opnået derved |
| ES00979855T ES2280264T3 (es) | 1999-11-15 | 2000-11-15 | Fragmentos de union a antigeno especificos de celulas dendriticas, composiciones y metodos de uso de los mismos, antigenos reconocidos y celulas asi obtenidas. |
| EP00979855A EP1301539B1 (en) | 1999-11-15 | 2000-11-15 | Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognized thereby and cells obtained thereby |
| CN008198098A CN1454215B (zh) | 1999-11-15 | 2000-11-15 | 树突状细胞特异的抗原结合片段、组合物及其使用方法、被其识别的抗原及由其获得的细胞 |
| CA2396428A CA2396428C (en) | 1999-11-15 | 2000-11-15 | Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognized thereby and cells obtained thereby |
| JP2001538976A JP5007007B2 (ja) | 1999-11-15 | 2000-11-15 | 樹状細胞に特異的な抗原結合フラグメント、その組成物および使用方法、それによって認識される抗原およびそれによって得られる細胞 |
| AU17233/01A AU785198B2 (en) | 1999-11-15 | 2000-11-15 | Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognised thereby and cells obtained thereby |
Applications Claiming Priority (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16555599P | 1999-11-15 | 1999-11-15 | |
| US60/165,555 | 1999-11-15 | ||
| US16707699P | 1999-11-23 | 1999-11-23 | |
| US60/167,076 | 1999-11-23 | ||
| US17900300P | 2000-01-28 | 2000-01-28 | |
| US60/179,003 | 2000-01-28 | ||
| US18077500P | 2000-02-07 | 2000-02-07 | |
| US60/180,775 | 2000-02-07 | ||
| US19682400P | 2000-04-11 | 2000-04-11 | |
| US60/196,824 | 2000-04-11 | ||
| US19720500P | 2000-04-13 | 2000-04-13 | |
| US60/197,205 | 2000-04-13 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2001036487A2 true WO2001036487A2 (en) | 2001-05-25 |
| WO2001036487A3 WO2001036487A3 (en) | 2002-05-10 |
Family
ID=27558547
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2000/001832 Ceased WO2001036487A2 (en) | 1999-11-15 | 2000-11-15 | Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognized thereby and cells obtained thereby |
Country Status (11)
| Country | Link |
|---|---|
| EP (3) | EP1301539B1 (https=) |
| JP (4) | JP5007007B2 (https=) |
| KR (1) | KR100868235B1 (https=) |
| CN (1) | CN1454215B (https=) |
| AU (1) | AU785198B2 (https=) |
| CA (2) | CA2396428C (https=) |
| DE (1) | DE60033062T2 (https=) |
| DK (1) | DK1301539T3 (https=) |
| ES (1) | ES2280264T3 (https=) |
| PT (1) | PT1301539E (https=) |
| WO (1) | WO2001036487A2 (https=) |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002072603A3 (en) * | 2001-03-12 | 2002-11-14 | Lexicon Genetics Inc | Novel human dectin proteins and polynucleotides encoding the same |
| WO2002032958A3 (en) * | 2000-10-16 | 2003-02-13 | Bayer Ag | Polynucleotide and polypeptide sequences of human dendritic cell immunoreceptors |
| WO2004047849A1 (en) * | 2002-11-28 | 2004-06-10 | Binex Co., Ltd. | Clinical application of dendritic cell-based cancer immunotherapy |
| EP1395826A4 (en) * | 2001-05-17 | 2005-11-09 | Miltenyi Biotec Gmbh | ANTIGEN-BINDING FRAGMENTS FOR A SUB-GROUP OF DENDRITIC CELLS AND USE THEREOF |
| WO2006037247A1 (en) * | 2004-10-07 | 2006-04-13 | Universität Zürich | Type i interferon blocking agents for prevention and treatment of psoriasis |
| US8080638B2 (en) | 2005-02-10 | 2011-12-20 | Baylor Research Institute | Anti-interferon alpha monoclonal antibodies and methods for use |
| US8163885B2 (en) | 2008-05-07 | 2012-04-24 | Argos Therapeutics, Inc. | Humanized antibodies against human interferon-alpha |
| FR2968561A1 (fr) * | 2010-12-13 | 2012-06-15 | Lfb Biotechnologies | Utilisation d'un anticorps dirige contre une proteine membranaire |
| WO2014047124A1 (en) * | 2012-09-18 | 2014-03-27 | University Of Washington Through Its Center For Commercialization | Compositions and methods for delivery of antigens to plasmacytoid dendritic cells |
| WO2014093396A1 (en) * | 2012-12-10 | 2014-06-19 | Biogen Idec Ma Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
| WO2015095143A1 (en) * | 2013-12-16 | 2015-06-25 | The University Of North Carolina At Chapel Hill | Depletion of plasmacytoid dendritic cells |
| WO2015098813A1 (ja) | 2013-12-24 | 2015-07-02 | アステラス製薬株式会社 | 新規抗ヒトbdca-2抗体 |
| WO2016038168A1 (en) * | 2014-09-10 | 2016-03-17 | Miltenyi Biotec Gmbh | A cell population for use in treting cancer |
| WO2016156450A1 (fr) * | 2015-03-31 | 2016-10-06 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anticorps monoclonaux anti-cd303 |
| WO2017103521A1 (fr) * | 2015-12-16 | 2017-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Nouvelle utilisation d'un anticorps dirige contre la proteine membranaire cd303 |
| WO2018109209A1 (fr) * | 2016-12-16 | 2018-06-21 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Combinaison d'anticorps anti-cd303 et anti-amhrii |
| WO2018109210A1 (fr) * | 2016-12-16 | 2018-06-21 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Combinaison d'anticorps anti-cd303 et anti-her2 |
| US10364289B2 (en) | 2014-12-03 | 2019-07-30 | Samsung Life Public Welfare Foundation | Antibody binding to neuropilin 1 and use thereof |
| WO2020227595A1 (en) * | 2019-05-09 | 2020-11-12 | Atara Biotherapeutics, Inc. | Clec4-targeted car-t-cells |
| WO2022120144A1 (en) * | 2020-12-03 | 2022-06-09 | Biogen Ma Inc. | Methods of treating cutaneous lupus erythematosus and systemic lupus erythematosus |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU785198B2 (en) * | 1999-11-15 | 2006-11-02 | Miltenyi Biotec B.V. & Co. KG | Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognised thereby and cells obtained thereby |
| NZ601733A (en) * | 2009-01-06 | 2013-05-31 | Functional Genetics Inc | Antibody with binding specificity for Robo1 protein for inhibiting the infectivity of HIV |
| CN106659774A (zh) * | 2014-05-16 | 2017-05-10 | 贝勒研究院 | 用于治疗自身免疫和炎性病症的方法和组合物 |
| ES2883678T3 (es) * | 2016-10-21 | 2021-12-09 | Inst Nat Sante Rech Med | Métodos para promover la respuesta de linfocitos T |
| JP7158642B2 (ja) * | 2018-01-16 | 2022-10-24 | 国立大学法人山梨大学 | 質量分析装置及び質量分析システム |
| CN114264825B (zh) * | 2021-12-22 | 2023-08-15 | 重庆医科大学附属儿童医院 | 一种b淋巴细胞发育亚群免疫分型的方法和试剂盒 |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0760102A1 (en) * | 1995-03-15 | 1997-03-05 | Miltenyi Biotech, Inc. | Isolation of hematopoietic dendritic cells by high gradient magnetic cell sorting |
| US5871728A (en) * | 1995-03-31 | 1999-02-16 | University Of Pittsburgh | Method of regulating dendritic cell maturation |
| US5788963A (en) * | 1995-07-31 | 1998-08-04 | Pacific Northwest Cancer Foundation | Isolation and/or preservation of dendritic cells for prostate cancer immunotherapy |
| US6046158A (en) * | 1996-12-20 | 2000-04-04 | Board Of Regents The University Of Texas Systems | Unique dendritic cell-associated C-type lectins, dectin-1 and dectin-2; compositions and uses thereof |
| AR014891A1 (es) * | 1997-07-09 | 2001-04-11 | Schering Corp | Genes aislados de proteinas de membranas de mamiferos; reactivos relacionados |
| FI973762A0 (fi) * | 1997-09-23 | 1997-09-23 | Krohn Kai | Ny gen |
| CA2307014A1 (en) * | 1997-10-28 | 1999-05-06 | Immunex Corporation | Viral encoded semaphorin protein receptor dna and polypeptides |
| JP2002506645A (ja) * | 1998-03-17 | 2002-03-05 | シェーリング コーポレイション | 単離された哺乳動物膜タンパク質遺伝子および関連試薬 |
| AU785198B2 (en) * | 1999-11-15 | 2006-11-02 | Miltenyi Biotec B.V. & Co. KG | Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognised thereby and cells obtained thereby |
-
2000
- 2000-11-15 AU AU17233/01A patent/AU785198B2/en not_active Expired
- 2000-11-15 EP EP00979855A patent/EP1301539B1/en not_active Expired - Lifetime
- 2000-11-15 ES ES00979855T patent/ES2280264T3/es not_active Expired - Lifetime
- 2000-11-15 DK DK00979855T patent/DK1301539T3/da active
- 2000-11-15 JP JP2001538976A patent/JP5007007B2/ja not_active Expired - Lifetime
- 2000-11-15 CA CA2396428A patent/CA2396428C/en not_active Expired - Lifetime
- 2000-11-15 CN CN008198098A patent/CN1454215B/zh not_active Expired - Lifetime
- 2000-11-15 WO PCT/IB2000/001832 patent/WO2001036487A2/en not_active Ceased
- 2000-11-15 EP EP07000097A patent/EP1783141A1/en not_active Ceased
- 2000-11-15 KR KR1020027006247A patent/KR100868235B1/ko not_active Expired - Lifetime
- 2000-11-15 EP EP06023310.3A patent/EP1813626B1/en not_active Expired - Lifetime
- 2000-11-15 DE DE60033062T patent/DE60033062T2/de not_active Expired - Lifetime
- 2000-11-15 PT PT00979855T patent/PT1301539E/pt unknown
- 2000-11-15 CA CA2664137A patent/CA2664137C/en not_active Expired - Lifetime
-
2007
- 2007-12-18 JP JP2007325800A patent/JP2008148700A/ja not_active Withdrawn
-
2011
- 2011-01-27 JP JP2011015018A patent/JP5355602B2/ja not_active Expired - Lifetime
-
2012
- 2012-03-01 JP JP2012045127A patent/JP5599834B2/ja not_active Expired - Fee Related
Cited By (53)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002032958A3 (en) * | 2000-10-16 | 2003-02-13 | Bayer Ag | Polynucleotide and polypeptide sequences of human dendritic cell immunoreceptors |
| US7252990B2 (en) | 2001-03-12 | 2007-08-07 | Lexicon Genetics Incorporated | Human dectin proteins and polynucleotides encoding the same |
| WO2002072603A3 (en) * | 2001-03-12 | 2002-11-14 | Lexicon Genetics Inc | Novel human dectin proteins and polynucleotides encoding the same |
| EP1395826A4 (en) * | 2001-05-17 | 2005-11-09 | Miltenyi Biotec Gmbh | ANTIGEN-BINDING FRAGMENTS FOR A SUB-GROUP OF DENDRITIC CELLS AND USE THEREOF |
| WO2004047849A1 (en) * | 2002-11-28 | 2004-06-10 | Binex Co., Ltd. | Clinical application of dendritic cell-based cancer immunotherapy |
| WO2006037247A1 (en) * | 2004-10-07 | 2006-04-13 | Universität Zürich | Type i interferon blocking agents for prevention and treatment of psoriasis |
| EP2286835A1 (en) * | 2004-10-07 | 2011-02-23 | Universität Zürich Prorektorat Forschung | Type I interferon blocking agents for prevention and treatment of psoriasis |
| US8333965B2 (en) | 2005-02-10 | 2012-12-18 | Baylor Research Institute | Anti-inteferon alpha monoclonal antibodies and methods for use |
| US8080638B2 (en) | 2005-02-10 | 2011-12-20 | Baylor Research Institute | Anti-interferon alpha monoclonal antibodies and methods for use |
| US8163885B2 (en) | 2008-05-07 | 2012-04-24 | Argos Therapeutics, Inc. | Humanized antibodies against human interferon-alpha |
| US8361463B2 (en) | 2008-05-07 | 2013-01-29 | Argos Therapeutics, Inc. | Humanized antibodies against human interferon-alpha |
| US8658771B2 (en) | 2008-05-07 | 2014-02-25 | Argos Therapeutics, Inc. | Humanized antibodies against human interferon-alpha |
| WO2012080642A1 (fr) | 2010-12-13 | 2012-06-21 | Lfb Biotechnologies | Utilisation d'un anticorps dirige contre une proteine membranaire |
| FR2968561A1 (fr) * | 2010-12-13 | 2012-06-15 | Lfb Biotechnologies | Utilisation d'un anticorps dirige contre une proteine membranaire |
| EP3190127A1 (fr) | 2010-12-13 | 2017-07-12 | Laboratoire Français du Fractionnement et des Biotechnologies | Utilisation d'un anticorps dirige contre bdca-2 pour traiter des maladies auto-immunes ou inflammatoires |
| EP3438129A1 (fr) * | 2010-12-13 | 2019-02-06 | Laboratoire Français du Fractionnement et des Biotechnologies | Composition d'anticorps monoclonaux diriges contre bdca-2 |
| WO2014047124A1 (en) * | 2012-09-18 | 2014-03-27 | University Of Washington Through Its Center For Commercialization | Compositions and methods for delivery of antigens to plasmacytoid dendritic cells |
| EA034757B1 (ru) * | 2012-12-10 | 2020-03-17 | Байоджен Ма Инк. | Антитела против антигена 2 дендритных клеток крови и их применение |
| EP2928923A1 (en) | 2012-12-10 | 2015-10-14 | Biogen MA Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
| KR20200130468A (ko) * | 2012-12-10 | 2020-11-18 | 바이오젠 엠에이 인코포레이티드 | 항-혈액 수지상 세포 항원 2 항체 및 이의 용도 |
| CN105452295A (zh) * | 2012-12-10 | 2016-03-30 | 比奥根Ma公司 | 抗血液树突细胞抗原2抗体及其用途 |
| EP3686218A1 (en) * | 2012-12-10 | 2020-07-29 | Biogen MA Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
| WO2014093396A1 (en) * | 2012-12-10 | 2014-06-19 | Biogen Idec Ma Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
| EP2928923B1 (en) * | 2012-12-10 | 2020-01-22 | Biogen MA Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
| KR102344907B1 (ko) | 2012-12-10 | 2021-12-28 | 바이오젠 엠에이 인코포레이티드 | 항-혈액 수지상 세포 항원 2 항체 및 이의 용도 |
| US9902775B2 (en) | 2012-12-10 | 2018-02-27 | Biogen Ma Inc. | Anti-blood dendritic cell antigen 2 antibodies and uses thereof |
| US9914780B2 (en) | 2013-12-16 | 2018-03-13 | The University Of North Carolina At Chapel Hill | Depletion of plasmacytoid dendritic cells |
| EP3083946B1 (en) * | 2013-12-16 | 2024-08-07 | The University of North Carolina at Chapel Hill | Depletion of plasmacytoid dendritic cells |
| AU2014365838B2 (en) * | 2013-12-16 | 2021-01-14 | The University Of North Carolina At Chapel Hill | Depletion of plasmacytoid dendritic cells |
| US9670283B2 (en) | 2013-12-16 | 2017-06-06 | The University Of North Carolina At Chapel Hill | Depletion of plasmacytoid dendritic cells |
| US11028175B2 (en) | 2013-12-16 | 2021-06-08 | The University Of North Carolina At Chapel Hill | Depletion of plasmacytoid dendritic cells |
| WO2015095143A1 (en) * | 2013-12-16 | 2015-06-25 | The University Of North Carolina At Chapel Hill | Depletion of plasmacytoid dendritic cells |
| US10214587B2 (en) | 2013-12-16 | 2019-02-26 | The University Of North Carolina At Chapel Hill | Depletion of plasmacytoid dendritic cells |
| KR20160099083A (ko) | 2013-12-24 | 2016-08-19 | 아스테라스 세이야쿠 가부시키가이샤 | 신규 항인간 bdca-2 항체 |
| EP3088519A4 (en) * | 2013-12-24 | 2017-09-13 | Astellas Pharma Inc. | Novel anti-human bdca-2 antibody |
| WO2015098813A1 (ja) | 2013-12-24 | 2015-07-02 | アステラス製薬株式会社 | 新規抗ヒトbdca-2抗体 |
| US11046770B2 (en) | 2013-12-24 | 2021-06-29 | Astellas Pharma Inc. | Anti-human BDCA-2 antibody |
| US10294301B2 (en) | 2013-12-24 | 2019-05-21 | Astellas Pharma Inc. | Anti-human BDCA-2 antibody |
| US11612644B2 (en) | 2014-09-10 | 2023-03-28 | Miltenyi Biotec B.V. & Co. KG | Cell population for use in treating cancer |
| US10925944B2 (en) | 2014-09-10 | 2021-02-23 | Miltenyi Biotec B.V. & Co. KG | Cell population for use in treating cancer |
| WO2016038168A1 (en) * | 2014-09-10 | 2016-03-17 | Miltenyi Biotec Gmbh | A cell population for use in treting cancer |
| US10364289B2 (en) | 2014-12-03 | 2019-07-30 | Samsung Life Public Welfare Foundation | Antibody binding to neuropilin 1 and use thereof |
| FR3034420A1 (fr) * | 2015-03-31 | 2016-10-07 | Lab Francais Du Fractionnement | Anticorps monoclonaux anti-cd303 |
| WO2016156450A1 (fr) * | 2015-03-31 | 2016-10-06 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anticorps monoclonaux anti-cd303 |
| US10611843B2 (en) | 2015-03-31 | 2020-04-07 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anti-CD303 monoclonal antibodies |
| FR3045386A1 (fr) * | 2015-12-16 | 2017-06-23 | Lab Francais Du Fractionnement | Nouvelle utilisation d'un anticorps dirige contre une proteine membranaire |
| WO2017103521A1 (fr) * | 2015-12-16 | 2017-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Nouvelle utilisation d'un anticorps dirige contre la proteine membranaire cd303 |
| FR3060395A1 (fr) * | 2016-12-16 | 2018-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Combinaison d'anticorps anti-cd303 et anti-her2 |
| FR3060394A1 (fr) * | 2016-12-16 | 2018-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Combinaison d'anticorps anti-cd303 et anti-amhrii |
| WO2018109210A1 (fr) * | 2016-12-16 | 2018-06-21 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Combinaison d'anticorps anti-cd303 et anti-her2 |
| WO2018109209A1 (fr) * | 2016-12-16 | 2018-06-21 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Combinaison d'anticorps anti-cd303 et anti-amhrii |
| WO2020227595A1 (en) * | 2019-05-09 | 2020-11-12 | Atara Biotherapeutics, Inc. | Clec4-targeted car-t-cells |
| WO2022120144A1 (en) * | 2020-12-03 | 2022-06-09 | Biogen Ma Inc. | Methods of treating cutaneous lupus erythematosus and systemic lupus erythematosus |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1813626B1 (en) | 2015-02-18 |
| CA2664137A1 (en) | 2009-07-16 |
| CA2396428C (en) | 2014-03-11 |
| DE60033062T2 (de) | 2007-08-23 |
| JP2011092210A (ja) | 2011-05-12 |
| JP5355602B2 (ja) | 2013-11-27 |
| JP5007007B2 (ja) | 2012-08-22 |
| ES2280264T3 (es) | 2007-09-16 |
| KR20030032904A (ko) | 2003-04-26 |
| JP2012152215A (ja) | 2012-08-16 |
| WO2001036487A3 (en) | 2002-05-10 |
| EP1301539B1 (en) | 2007-01-17 |
| JP5599834B2 (ja) | 2014-10-01 |
| JP2008148700A (ja) | 2008-07-03 |
| CN1454215B (zh) | 2013-01-02 |
| JP2004512006A (ja) | 2004-04-22 |
| CA2396428A1 (en) | 2001-05-25 |
| EP1813626A1 (en) | 2007-08-01 |
| DE60033062D1 (de) | 2007-03-08 |
| PT1301539E (pt) | 2007-04-30 |
| CN1454215A (zh) | 2003-11-05 |
| AU1723301A (en) | 2001-05-30 |
| KR100868235B1 (ko) | 2008-11-12 |
| EP1301539A2 (en) | 2003-04-16 |
| CA2664137C (en) | 2012-09-25 |
| AU785198B2 (en) | 2006-11-02 |
| EP1783141A1 (en) | 2007-05-09 |
| DK1301539T3 (da) | 2007-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200283499A1 (en) | Use of an antibody specific for BDCA 2 for ligation and removal of dendritic cells in the treatment systemic lupus erythematosis | |
| JP5599834B2 (ja) | 樹状細胞に特異的な抗原結合フラグメント、その組成物および使用方法、それによって認識される抗原およびそれによって得られる細胞 | |
| Lee et al. | Indirect recognition by helper cells can induce donor-specific cytotoxic T lymphocytes in vivo. | |
| JP5560301B2 (ja) | 4ig−b7−h3およびその対応するnk細胞受容体を標的化する治療および診断方法ならびに組成物 | |
| JP2002186486A (ja) | B細胞上のcd28レセプターに対するリガンドおよび該リガンドを用いた細胞間相互作用の調節方法 | |
| JP4198990B2 (ja) | 造血細胞のe−セレクチン/l−セレクチンリガンドポリペプチドおよびその使用法 | |
| AU2024267110A1 (en) | Lymphocytes expressing heterologous targeting constructs | |
| Matsuoka et al. | A novel type of cell death of lymphocytes induced by a monoclonal antibody without participation of complement. | |
| US20030022249A1 (en) | Antigen-binding fragments that recognize a subset of dendritic cells and methods of use thereof | |
| CA2794123A1 (en) | Antigen-binding fragments specific for dendritic cells, compositions and methods of use thereof antigens recognized thereby and cells obtained thereby | |
| Yoshida et al. | Leukocyte integrin‐dependent and antibody‐independent cytotoxicity of macrophage against allografts | |
| WO2008014035A2 (en) | Modulation of nkg2d and method for treating or preventing solid organ allograft rejection | |
| Graham et al. | Surface carbohydrate epitopes of Thy‐1.1 and Thy‐1.2 thymocytes are distinguished by a monoclonal antibody with a specificity common to peanut agglutinin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2001 538976 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020027006247 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000979855 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 17233/01 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 008198098 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2396428 Country of ref document: CA |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWP | Wipo information: published in national office |
Ref document number: 2000979855 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020027006247 Country of ref document: KR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2000979855 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 17233/01 Country of ref document: AU |