WO2000008162A1 - A Pi-ta GENE CONFERRING DISEASE RESISTANCE TO PLANTS - Google Patents
A Pi-ta GENE CONFERRING DISEASE RESISTANCE TO PLANTS Download PDFInfo
- Publication number
- WO2000008162A1 WO2000008162A1 PCT/US1999/017706 US9917706W WO0008162A1 WO 2000008162 A1 WO2000008162 A1 WO 2000008162A1 US 9917706 W US9917706 W US 9917706W WO 0008162 A1 WO0008162 A1 WO 0008162A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- plant
- nucleic acid
- rice
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Definitions
- the invention relates to the preparation and use of an isolated nucleic acid fragment which confers a Pi-ta resistance gene-mediated defense response in plants against disease caused by fungal pathogens.
- Genes incorporating such nucleic acid fragments either alone or in combination with an A VR-Pita isolated nucleic acid fragment or functionally equivalent subfragments thereof and suitable regulatory sequences can be used to create transgenic plants which can produce a Pi-ta resistance gene-mediated defense response against a variety of fungal pathogens, in particular, the rice blast fungus.
- Plants can be damaged by a wide variety of pathogenic organisms including viruses, bacteria, fungi and nematodes.
- the invasion of a plant by a potential pathogen can result in a range of outcomes: the pathogen can successfully proliferate in the host, causing associated disease symptoms, or its growth can be halted by the host defenses.
- the visible hallmark of an active defense response is the so- called hypersensitive response (HR).
- HR hypersensitive response
- Pathogens which elicit an HR on a given host are said to be avirulent (AVR) on that host, the host is said to be resistant, and the plant-pathogen interaction is said to be incompatible.
- Strains which proliferate and cause disease on a particular host are said to be virulent, in this case the host is said to be susceptible, and the plant-pathogen interaction is said to be compatible.
- the first R-gene cloned was the Hml gene from corn (Zea mays), which confers resistance to specific races of the fungal pathogen Cochliobolus carbonum (Johal et al., 1992, Science 258:985-987). Hml encodes a reductase that detoxifies a toxin produced by the pathogen.
- Pto gene from tomato (Lycopersicon pimpinellifollium) (Martin et al., 1993, Science 262: 1432-1436; U.S. Patent No. 5,648,599).
- Pto encodes a serine-threonine protein kinase that confers resistance in tomato to strains of the bacterial pathogen Pseudomonas syringae pv. tomato that express the avrPto avirulence gene.
- R-genes that encode proteins containing leucine-rich- repeats (LRRs) (Jones and Jones, 1997, Adv. Bot. Res. Incorp. Adv. Plant Pathol. 24:89-167).
- LRRs leucine-rich- repeats
- One subclass includes R-gene products that lack a cytoplasmic serine/threonine kinase domain such as the tomato Cf-9 gene for resistance to the fungus Cladosporium fulvum (Jones et al., 1994, Science 266:789-793, WO95/18230), and the other subclass includes an R-gene product with a cytoplasmic serine/threonine kinase domain, the rice Xa-21 gene for resistance to the bacterial pathogen Xanthomonas oryzae (Song et al., 1995, Science 270:1804-1806; U.S. Patent No. 5,859,339).
- R-genes include those encoding proteins with cytoplasmic LRRs such as the Arabidopsis R-genes RPS2 (Bent et al., 1994, Science 265:1856-1860; Mindrinos et al., 1994, Cell 78:1089-1099) and RPM1 (Grant et al., 1995, Science 269:843-846). These R-proteins also possess a putative nucleotide binding site (NBS), and either a leucine zipper (LZ) motif or a sequence homologous to the Toll/Interleukin-1 receptor (TIR). Table 1 has been reproduced in part from Baker et al. (1997, Science 276:726-733) as a concise summary of classes of R-genes cloned to date and examples of cloned genes within each class.
- NSS putative nucleotide binding site
- LZ leucine zipper
- TIR Toll/Interleukin-1 receptor
- Nucleotide binding sites are found in many families of proteins that are critical for fundamental eukaryotic cellular functions such as cell growth, differentiation, cytoskeletal organization, vesicle transport, and defense.
- Key examples include the RAS group, adenosine triphosphatases, elongation factors, and heterotrimeric GTP binding proteins called G-proteins (Saraste et al., 1990, Trends in Biochem. Science 15:430). These proteins have in common the ability to bind ATP or GTP (Traut, 1994, Eur. J. Biochem. 229:9-19).
- grisea pathogens of other grasses have provided laboratory strains of the fungus with the level of sexual fertility required for identifying AVR-genes (Valent et al., 1991, Genetics 127:87-101). Rare fertile rice pathogens have since allowed demonstration of a one-to-one genetic or functional correspondence between blast fungus AVR-genes and particular rice R-genes (Silue et al., 1992, Phytopathology 82:577-580).
- the fungus M. grisea has a large host range including species of different tribes within the grass family, Triticeae (e.g., wheat), Oryzeae (e.g., rice), Clorideae (e.g., finger millet), Paniceae (e.g., pearl millet), Andropogoneae (e.g., Sorghum) and Maydeae (e.g., maize).
- Triticeae e.g., wheat
- Oryzeae e.g., rice
- Clorideae e.g., finger millet
- Paniceae e.g., pearl millet
- Andropogoneae e.g., Sorghum
- Maydeae e.g., maize
- rDNA ribosomal DNA
- RFLP Restriction Fragment Length Polymorphism
- ITS Internal Transcribed Spacer
- mtDNA types Ia-e The pathogens of rice, wheat, finger millet, barley and corn (mtDNA types Ia-e) appear closely related, while pathogens o ⁇ Digitaria spp. and Pennisetum spp. (mtDNA types II-IV) are highly divergent from the previous groups and from each other. However, M. grisea strains throughout this broad host range can cause significant crop damage.
- barley are infected by members of two or more subpopulations.
- R-genes have been defined through extensive genetic analysis worldwide, and many of these blast resistance genes have been mapped to rice chromosomes (See Refs. In Takahashi, 1965, The Rice Blast Disease, Johns Hopkins Press, Baltimore, 303-329; Causse et al., 1994, Genetics 138:1251-1274). These R-genes include 20 major resistance genes and 10 putative quantitative trait loci (QTLs).
- Kiyosawa has described 13 major resistance genes with 9 of these genes found as multiple alleles at 3 loci; 5 at the Pi-k locus on chromosome 11 , 2 at the Pi-z locus on chromosome 6 and 2 at the Pi-ta locus on chromosome 12 (Kiyosawa, 1984, Rice Genetics Newsletter 1 :95-97). Recent studies in Japan (Ise, 1992, International Rice Research Newsletter 17:8-9) and at the International Rice Research Institiute (IRRI) (Mackill et al, 1992, Phytopathology 82:746-749) have produced near isogenic rice lines (NILs) for use as "differential" rice varieties for determining which resistance genes are effective in controlling individual strains of the fungus.
- NILs near isogenic rice lines
- IRRI NILs which provide indica differentials for the blast fungus populations in tropical regions, have been analyzed for genetic relationships between their resistance genes and those present in Kiyosawa Differentials (Inukai et al., 1994, Phytopathology 84:1278-1283).
- Molecular markers (or "tags") tightly linked to R-genes have utility for efficient introgression and manipulation of those R-genes in breeding programs.
- Yu et al. (1987, Phytopathology 77:323-326) were able to identify five restriction fragment length polymorphic (RFLP) markers linked to three blast resistance genes and to map them to rice chromosomes using segregating populations.
- RFLP markers linked to the R-genes have been reported (Yu et al., 1991, Theor Appl Genet 81 :471-476).
- RFLP markers linked to the R-genes have been reported (Yu et al., 1991, Theor Appl Genet 81 :471-476).
- Molecular cloning of agronomically important R-genes represents a further advance to the ability of researchers to combine R-genes with other input and output traits in key crop varieties.
- Pseudomonas syringae RPS2 gene family primers, probes and detection methods.
- This published international application includes broad claims to genes encoding proteins with particular NH 2 -terminal motifs, NBS motifs and leucine rich repeats for protecting plants against pathogens. There are some unique features of the Pi-ta protein.
- the Pi-ta gene product has a unique amino terminus, lacking either the potential leucine zipper motif of the RPS2 gene-product subfamily (Bent et al., 1994, Science 265:1856-1860; Mindrinos et al., 1994, Cell 78:1089-1099) or the Toll/Interleukin-1 receptor homology encoded by the N gene subfamily (Whitman et al., 1994, Cell 78:1101-1115). Most importantly, the carboxy terminal portion of the Pi-ta gene product is leucine rich, but it does not fit the consensus sequences for leucine-rich repeats reported for R-gene products (Jones and Jones, 1997, Adv. Bot. Res. Incorp. Adv. Plant Pathol. 24:89-167).
- U.S. Patent No. 5,859,339, issued to Ronald et al. on January 12, 1999 describes the first resistance gene cloned from rice, Xa-21, which encodes an integral membrane protein with both LRR and serine/threonine kinase domains, and confers resistance in rice to bacterial blight.
- WO 91/15585 which published on October 17, 1991 and U.S. Patent No. 5,866,776 issued to de Wit et al. on February 2, 1999 describe a method for the protection of plants against pathogens using a combination of a pathogen avirulence gene and a corresponding plant resistance gene.
- This invention relates to an isolated nucleic acid fragment which confers a Pi-ta resistance gene-mediated defense response against diseases caused by fungal pathogens wherein said nucleic acid fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof.
- this invention concerns genes comprising isolated nucleic acid which confers a Pi-ta resistance gene-mediated defense response against diseases caused by fungal pathogens wherein said nucleic acid fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof wherein these fragments are operably linked to suitable regulatory sequences.
- this invention concerns a method of conferring Pi-ta resistance gene-mediated defense response in plants against disease caused by a fungal pathogen which comprises introducing into the plant a gene comprising isolated nucleic acid which confers a Pi-ta resistance gene-mediated defense response against diseases caused by fungal pathogens wherein said nucleic acid fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof wherein these fragments are operably linked to suitable regulatory sequences.
- this invention concerns a method of conferring a resistance gene-mediated defense response in plants at the site of infection by a fungal pathogen, comprising transforming the plant with a recombinant expression construct which comprises (1) an isolated nucleic acid fragment which confers a Pi-ta resistance gene- mediated defense response against diseases caused by fungal pathogens wherein said nucleic fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof and (2) an AVR-Pita isolated nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NO: 5 or 7 or a functionally equivalent subfragment thereof, wherein said nucleic acid fragments are operably linked to regulatory sequences and further wherein said construct confers a resistance gene-mediated defense response in plants against diseases caused by a fungal pathogen at the site of infection.
- This invention also concerns a recombinant expression construct which confers a resistance gene-mediated defense response in plants against diseases caused by a fungal pathogen at the site of infection which comprises (1) an isolated nucleic acid fragment which confers a Pi-ta resistance gene-mediated defense response against diseases caused by fungal pathogens wherein said gene fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof and (2) an AVR-Pita isolated nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NO: 5 or 7 or a functionally equivalent subfragment thereof, wherein said nucleic acid fragments are operably linked to regulatory sequences.
- the fungal strain O-137 has been deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209, and bears the following designation, accession number and date of deposit.
- ATCC American Type Culture Collection
- SEQ ID NO:l is the 5757 nucleotide sequence of the genomic clone of the Pi-ta gene from Oryza sativa variety Yashiro-mochi.
- SEQ ID NO:2 is the predicted protein sequence encoded by the Pi-ta gene set forth in SEQ ID NO: 1.
- SEQ ID NO:3 is the 5113 nucleotide sequence of the genomic clone of the pi-ta gene from susceptible Oryza sativa variety Tsuyuake.
- SEQ ID NO:4 is the predicted protein sequence encoded by the pi-ta gene set forth in SEQ ID NO:3.
- SEQ ID NO: 5 is the 672 nucleotide coding sequence of an AVR-Pita (formerly called AVR2-YAMO) cDNA from M. grisea rice pathogen O-137.
- SEQ ID NO:6 is the predicted protein sequence encoded by the sequence set forth in
- SEQ ID NO:7 is the 675 nucleotide coding sequence of an AVR-Pita cDNA from M. grisea pathogen G-213 that infects Digitaria species.
- SEQ ID NO: 8 is the predicted protein sequence encoded by the sequence set forth in SEQ ID NO:7.
- SEQ ID NOS:9-24 set forth the sequences of oligonucleotide (RAPD) primers used in the genetic mapping and cloning of the Pi-ta region.
- RAPD oligonucleotide
- SEQ ID NOS:25-31 are oligonucleotide primers used in PCR amplification of BAC insert ends.
- SEQ ID NOS:32 and 33 are PCR primers used to verify the location of RAPD marker
- SEQ ID NOS:34-36 are partial sequences obtained from BAC clone RB142E8 which contains a single copy of the Pi-ta candidate gene PRG2.
- SEQ ID NOS:37-64 are sequencing primers used in the full sequencing of the genomic clone for Pi-ta (PRG2) set forth in SEQ ID NO: 1.
- SEQ ID NO: 65 is an oligonucleotide primer used to obtain a Pi-ta nucleic acid fragment.
- SEQ ID NOS:66 and 67 are PCR primers used to amplify A VR-Pita 176 an A VR-Pita nucleic acid fragment that directly encodes the putative mature protease.
- SEQ ID NO:68 is the 5222 nucleotide sequence of an Ec RI-H dlll fragment that contains 2425 bp of the native Pi-ta promoter (nucleotides 1 to 2425) and Pi-ta cDNA (nucleotides 2426-5211).
- S ⁇ Q ID NOS:69 and 70 are oligonucleotide primers used to generate a linker fragment in constructing pML135.
- S ⁇ Q ID NOS:71 and 72 are PCR primers used to amplify the Adhl-6 intron from maize genomic DNA.
- S ⁇ Q ID NOS:73 and 74 are PCR primers used to amplify the AVR-Pita nucleic acid fragment (S ⁇ Q ID NO:5) in the process of constructing pAVR3.
- FIG. 1 A-B Molecular map of the chromosome region containing the R-gene.
- This Figure shows the linkage map produced using sixteen primers that identified polymorphic DNA fragments segregating with the R-gene in 119 members of the doubled-haploid (D ⁇ ) population. The most likely order of markers (as defined by the computer program Mapmaker, version2) is given, with the distance between markers shown in centimorgans (cM) on the left. Note that the map is not drawn to scale. Markers SP7C3, SP7 ⁇ 8 and SP8C6 showed no recombination with the R-gene in this population, while markers SP8B8 and SP3G6 mapped to distal ends of the linkage group.
- One step to the left identified one recombination border, that is BAC clones containing the marker SP4B9, which was separated from the R-gene by a recombination event in the F2 progeny line K25.
- Open boxes indicate locations of the BAC probes used to identify overlapping BAC clones, and black boxes indicate probes used to verify the overlaps.
- BAC clones that were analyzed by random genomic sequencing are indicated by the broken lines.
- the Pi-ta gene candidate (PRG2), as well as the DNA markers from 179G5R through 77D8-12 (shown above the line representing the genome region), failed to recombine with the marker SP7C3 and the phenotypically-defined R-gene (determined by infection assays) in members of the rice mapping population.
- Marker SP9F3 that defines the right border showed recombination with the R-gene in one DH line, YT171.
- FIG. 3 Restriction map of the R-gene showing the locations of the first three subclones obtained (dotted lines) through random genomic sequencing of BAC RB142E8. These were bacl42e8.pk0001.fl2 (fl2; SEQ ID NO:34), bacl42e8.pk0001.b7 (b7; SEQ ID NO:35), and bacl42e8.pk0001.f8 (f8; SEQ ID NO:36). Subsequent sequencing identified overlapping subclones bacl42e8.pk0001.el0 (elO), and bacl42e8.pk0005.cl0 (clO) from the "no hits class".
- FIG. 4 Construction of plasmids pCB1641 and pCB1645. Restriction sites included are BamHI (B), EcoRI (E), Hindlll (H), Sstll and Sail. Italicized restriction sites (E,Sall) are from the vector and not from the rice genomic sequence.
- Plasmid pCB1641 containing the genomic full length PRG2 coding sequence with 1255 bp of promoter sequence, a 1463 bp intron and 2 kb of 3' untranslated sequence, was constructed by ligating the 5.3 kb EcoRI rice genomic fragment from Clone #7 in place of the (201 bp) EcoRI fragment from the 2.2 kb rice DNA insert in bacl42e8.pk0001.f8.
- Plasmid pCB1645 containing the 3' 1028 bp of the PRG2 coding sequence (positions 4477-5505) was constructed by amplifying this region from plasmid pCB1641 by PCR using primers GB46 (SEQ ID NO: 63) and GB47 (SEQ ID NO: 64). These primers contained restriction sites for SaR and EcoRI respectively. The PCR fragment was digested with SaR and EcoRI and cloned into the corresponding sites of pGAL4-AD (Stratagene).
- FIG. 1 Relative primer locations in the PRG2 nucleic acid fragment contained in plasmid pCB1641. These primers were used to amplify genomic DNA fragments from resistant and sensitive rice varieties and for DNA sequencing.
- Figure 6. Deduced Pi-ta protein sequence. Five amino acid differences found in sensitive variants are indicated above the R-protein sequence. Features of the R-protein discussed in the text are underlined: the P-loop domain between amino acids 236 and 244, a kinase 2a domain between amino acids 314 and 323, a kinase 3a domain between amino acids 342 to 353, a hydrophobic domain between amino acids 407 to 415.
- Four potential N-glycosylation sites at positions 339, 556, 654 and 838 are marked with a double underline.
- Figure 7 Diagram of constructs in plasmids pCB1947, pML63 and pCB1926.
- A. pCB 1947 contains a construct of the A VR-Pita ioslated nucleic acid fragment (formerly called AVR2-YAMO) engineered to encode directly the putative mature protease for the transient expression experiments.
- This processed form of the isolated nucleic acid fragment designated A VR-Pita 7 , encodes a polypeptide comprised of amino acids 48 to 223 as set forth in SEQ ID NO:6.
- An initiation methionine was added to the construct through the Ncol site used in the cloning process.
- the A VR-Pita coding sequence was first amplified by PCR using primers YL30 (SEQ ID NO: 66) containing an in-frame Ncol site and YL37 (SEQ ID NO: 67) containing a Kpnl site, and cloned into the Ncol-Kpnl site of pML142, resulting in vector pCB1947.
- the maize Adhl-6 intron inserted downstream of the 35S promoter results in enhanced expression in monocots. This intron is described in Mascarenhas D. et al. (1990) Plant Mol Biol. 15:913-920.
- pML63 contains the uidA gene (which encodes the GUS enzyme) operably linked to the CaMV35S promoter and 3' NOS sequence. pML63 is modified from pMH40 to produce a minimal 3' NOS terminator fragment. pMH 40 is described in WO 98/16650 which published on April 23, 1998, the disclosure of which are hereby incorporated by reference. Using standard techniques familiar to those skilled in the art, the 770 base pair terminator sequence contained in pMH40 was replaced with a new 3' NOS terminator sequence comprising nucleotides 1277 to 1556 of the sequence published by Depicker et al. (1982, J. Appl. Genet. 1 :561-574).
- pCB1926 contains the Pi-ta cDNA construct that was created by first amplifying a 2.1 kb partial Pi-ta cDNA nucleic acid fragment from first strand cDNA using primers F12-1 (SEQ ID NO:44) and GB67 (SEQ ID NO:65). A synthetic full-length cDNA was generated by incorporating a 706 bp NcoI-BamHI fragment containing the 5' end of the genomic Pi-ta gene from pCB1641, resulting in plasmid pCB1906.
- GUS expression is indicated by the presence of dark spots in the leaf in the Figure, which are most prominent in the leftmost leaf. The absence of blue GUS staining was used as an indicator of the HR resistance response.
- the cloned PRG2 candidate nucleic acid fragment substitutes for the endogenous Pi-ta gene in this assay.
- YT14 and YT16 indicate the source of the rice leaves; both are DH rice lines, but YT14 contains an endogenous Pi-ta nucleic acid fragment while YT16 does not.
- Figure 9 DNA gel blot analysis on primary transformants to determine presence of the intact Pi-ta nucleic acid fragment.
- Genomic DNA was digested with EcoRI (left hand side of blot) or EcoRV (right hand side of blot) and probed with 1028 bp EcoRl-SaR 3' end fragment of the Pi-ta nucleic acid fragment cloned in plasmid pCB1645 ( Figure 4B).
- the bands corresponding to the endogenous susceptible pi-ta allele in the Nipponbare transformants and non-transformed Nipponbare parent are indicated. All additional bands represent copies of the Pi-ta nucleic acid fragment from plasmid pCB1641.
- Primary transformants 22-6-1-1, 22-6-3-1 and 22-6-11-4 are resistant while 22-2-7-2, 22-3-1-1 and 22-4-1-1 are intermediate resistant.
- FIG. 10 DNA gel blot analysis of 11 hygromycin resistant RI individuals from the intermediate resistant primary transformant 22-6-10-1 to determine presence of the intact Pi-ta nucleic acid fragment.
- Genomic DNA was digested with EcoRV and probed with 860 bp EcoRV-Hz ' odlll 3' end fragment of the Pi-ta nucleic acid fragment isolated from plasmid pCB1926.
- the band corresponding to the endogenous susceptible pi-ta allele in the Nipponbare transformants and non-transformed Nipponbare parent is indicated.
- the additional upper band represents a copy of the Pi-ta nucleic acid fragment from plasmid pCB1641.
- the R0 primary transformant 22-6-10-1 (lane 14) has the same RFLP as the 11 RI progeny (A-K).
- the poor DNA quality from this plant resulted in distorted and uneven bands in lane 14 on the Southern blot.
- All 11 RI progeny contain the same RFLP, and are intermediate disease resistant indicating stable inheritance of the Pi-ta nucleic acid fragment and the disease resistance phenotype.
- the term “disease resistance gene” means a gene encoding a polypeptide capable of triggering a defense response in a plant cell or plant tissue.
- the terms “disease resistance gene”, “resistance (R) gene” and “R” gene are used interchangeably herein.
- the resistance that results from a defense response can take several forms. For example, in some genetic backgrounds resistance may take the form of no visible symptoms on inoculated plant tissue, and in others resistance may include small brown spots from which the fungus does not sporulate and does not reinitiate infection. In both cases, the fungal pathogen does not complete its life cycle and disease development is stopped.
- a "defense response” is a specific defensive reaction produced by a host, e.g., a plant, to combat the presence of an infectious agent or pathogen.
- a "Pi-ta resistance gene” is a disease resistance gene encoding a polypeptide capable of triggering a defense response in a plant cell or plant tissue against a fungal pathogen such as Magnaporthe grisea.
- the term "Pi-ta resistance gene mediated defense response” means a defense response due to the production of the polypeptide encoded by the Pi-ta resistance gene and elicited by the presence of a fungal pathogen.
- An "AVR-Pita isolated nucleic acid fragment" is a nucleic acid fragment isolated from a pathogen wherein the nucleic acid fragment encodes a polypeptide whose direct or indirect interaction with the Pi-ta resistance protein is responsible for triggering the Pi-ta resistance gene mediated defense response.
- isolated nucleic acid fragment is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases.
- An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
- fragment that is functionally equivalent and “functionally equivalent subfragment” are used interchangeably herein. These terms refer to a portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme.
- the fragment or subfragment can be used in the design of chimeric genes to produce the desired phenotype in a transformed plant. Chimeric genes can be designed for use in co-suppression or antisense by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the appropropriate orientation relative to a plant promoter sequence.
- substantially similar and “corresponding substantially” as used herein refer to nucleic acid fragments wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences.
- substantially similar nucleic acid sequences encompassed by this invention are also defined by their ability to hybridize, under moderately stringent conditions (for example, 0.5 X SSC, 0.1% SDS, 60°C) with the . sequences exemplified herein, or to any portion of the nucleotide sequences reported herein and which are functionally equivalent to the promoter of the invention.
- Preferred substantially similar nucleic acid sequences encompassed by this invention are those sequences that are 80% identical to the nucleic acid fragments reported herein or which are 80% identical to any portion of the nucleotide sequences reported herein.
- nucleic acid fragments which are 90% identical to the nucleic acid sequences reported herein, or which are 90% identical to any portion of the nucleotide sequences reported herein. Most preferred are nucleic acid fragments which are 95% identical to the nucleic acid sequences reported herein, or which are 95% identical to any portion of the nucleotide sequences reported herein. Sequence alignments and percent similarity calculations may be determined using the Megalign program of the LASARGENE bioinformatics computing suite (DNASTAR Inc., Madison, WI). Multiple alignment of the sequences are performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS.
- a "substantial portion" of an amino acid or nucleotide sequence comprises enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to afford putative identification of that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F., et al., (1993; J. Mol. Biol. 275:403-410) and Gapped Blast (Altschul, S. F. et al., (1997) Nucleic Acids Res. 25:3389-3402); see also vvww.ncbi.nlm.nih.gov/BLAST/).
- Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
- Native gene refers to a gene as found in nature with its own regulatory sequences.
- Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- Endogenous gene refers to a native gene in its natural location in the genome of an organism.
- a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
- a “transgene” is a gene that has been introduced into the genome by a transformation procedure.
- Coding sequence refers to a DNA sequence that codes for a specific amino acid sequence.
- Regulatory sequences refer to nucleotide sequences located upstream (5' non- coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Such sequences can be native or non-native. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
- Phathogen refers to an organism or an infectious agent whose infection around or inside the cells of viable plant tissue elicits a disease response.
- Promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
- the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
- an “enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue- specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.
- promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by
- an "intron” is an intervening sequence in a gene that does not encode a portion of the protein sequence. Thus, such sequences are transcribed into RNA but are then excised and are not translated. The term is also used for the excised RNA sequences.
- An "exon” is a portion of the sequence of a gene that is transcribed and is found in the mature messenger RNA derived from the gene, but is not necessarily a part of the sequence that encodes the final gene product.
- the "translation leader sequence” refers to a DNA sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner, R. and Foster, G. D. (1995) Molecular Biotechnology 3:225).
- the "3' non-coding sequences” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
- the use of different 3' non-coding sequences is exemplified by Ingelbrecht et al., (1989) Plant Cell 7:671-680.
- RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA.
- Messenger RNA (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell.
- cDNA refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into the double-stranded form using the klenow fragment of DNA polymerase I.
- Sense RNA refers to RNA transcript that includes the mRNA and so can be translated into protein within a cell or in vitro.
- Antisense RNA refers to a RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Patent No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
- “Functional RNA” refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.
- operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
- a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
- Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
- expression refers to the production of a functional end- product. Expression or overexpression of a gene involves transcription of the gene and translation of the mRNA into a precursor or mature protein.
- Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein.
- Overexpression refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal or non-transformed organisms.
- Co-suppression refers to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Patent No. 5,231,020).
- altered expression refers to the production of gene product(s) in transgenic organisms in amounts or proportions that differ significantly from that activity in comparable tissue (organ and of developmental type) from wild-type organisms.
- “Mature” protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or propeptides present in the primary translation product have been removed.
- Precursor protein refers to the primary product of translation of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to intracellular localization signals.
- chloroplast transit peptide is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the chloroplast or other plastid types present in the cell in which the protein is made.
- Chloroplast transit sequence refers to a nucleotide sequence that encodes a chloroplast transit peptide.
- a “signal peptide” is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the secretory system (Chrispeels, J. J., (1991) Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21-53).
- a vacuolar targeting signal can further be added, or if to the endoplasmic reticulum, an endoplasmic reticulum retention signal (supra) may be added.
- an endoplasmic reticulum retention signal may be added.
- any signal peptide present should be removed and instead a nuclear localization signal included (Raikhel (1992) Plant Phys. 100:1627-1632).
- Transformation refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance.
- Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” organisms.
- the preferred method of cell transformation of rice, corn and other monocots is the use of particle- accelerated or “gene gun” transformation technology (Klein et al., (1987) Nature (London) 327:70-73; U.S. Patent No. 4,945,050), or an Agrobacterium-mediated method using an appropriate Ti plasmid containing the transgene (Ishida Y. et al., 1996, Nature Biotech. 14:745-750).
- Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook”).
- PCR or “Polymerase Chain Reaction” is a technique for the synthesis of large quantities of specific DNA segments, consists of a series of repetitive cycles (Perkin Elmer Cetus Instruments, Norwalk, CT). Typically, the double stranded DNA is heat denatured, the two primers complementary to the 3' boundaries of the the target segment are annealed at low temperature and then extended at an intermediate temperature. One set of these three consecutive steps comprises a cycle.
- an "expression construct" as used herein comprises any of the isolated nucleic acid fragments of the invention used either alone or in combination with each other as discussed herein and further may be used in conjunction with a vector or a subfragment thereof. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host plants as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the invention. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., (1985) EMBO J.
- the present invention concerns an isolated nucleic acid fragment which confers a Pi-ta resistance gene-mediated defense response against disease caused by a fungal pathogen wherein said nucleic acid fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof.
- Also of interest is a gene comprising these isolated nucleic acid fragment(s) operably linked to suitable regulatory sequences, plants comprising such genes in their genome, and seeds of such plants.
- a gene comprising these isolated nucleic acid fragment(s) operably linked to suitable regulatory sequences, plants comprising such genes in their genome, and seeds of such plants.
- a gene could be native or chimeric.
- this invention also concerns a method of conferring a Pi-ta resistance gene-mediated defense response against disease caused by a fungal pathogen in plants which comprises introducing into the genome of the plant any of the aforementioned genes.
- this invention concerns a method of conferring a resistance gene-mediated defense response in plants, comprising transforming a plant with a recombinant expression construct which comprises (1) an isolated nucleic acid fragment which confers a Pi-ta resistance gene mediated defense response against diseases caused by fungal pathogens wherein said nucleic acid fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof and (2) an AVR-Pita isolated nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NO: 5 or 7 or a functionally equivalent subfragment thereof, wherein said nucleic acid fragments are operably linked to regulatory sequences for expression at the site of infection and further wherein said construct confers
- this invention concerns a recombinant expression construct which confers a resistance gene-mediated defense response in plants against diseases caused by a fungal pathogen at the site of infection which comprises (1) an isolated nucleic acid fragment which confers a Pi-ta resistance gene mediated defense response against diseases caused by fungal pathogens wherein said nucleic acid fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS: l or 68 or a functionally equivalent subfragment thereof and (2) an AVR-Pita isolated nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NO: 5 or 7 or a functionally equivalent subfragment thereof, wherein said nucleic acid fragments are operably linked to regulatory sequences.
- Cloned R-genes can be used to facilitate the construction of crop plants that are resistant to pathogens.
- transformation technology can be used to stack multiple single genes into an agronomic germplasm without linked genomic sequences that accompany genes transferred by classical breeding techniques.
- Cloned R-genes also can be used to overcome the inability to transfer disease resistance genes between plant species by classical breeding.
- the present invention provides an isolated nucleic acid fragment that has utility in controlling rice blast disease, caused by the fungus Magnaporthe grisea, in rice.
- the isolated nucleic acid fragments of the invention are effective when the pathogen comprises an AVR-Pita isolated nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NOS: 5 or 7 or a functionally equivalent subfragment thereof.
- the isolated nucleic acid fragments of the invention which confer a Pi-ta resistance gene mediated defense response against diseases caused by fungal pathogens are effective when the A VR-Pita avirulence nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NOS: 5 or 7 or a functionally equivalent subfragment thereof, are introduced into the genome of a host plant as a foreign nucleic acid fragment operably linked to a promoter that expresses the A VR-Pita nucleic acid fragment at the site of infection.
- the isolated nucleic acid fragments of the invention will have utility in controlling diseases caused by M. grisea on other cereal crops including, but not limited to, wheat, barley, corn, finger millet, and pearl millet.
- the rice Pi-ta resistance nucleic acid fragment was cloned by a map-based cloning strategy that is familiar to those skilled in the art as is discussed below. It is shown that introduction of the cloned Pi-ta nucleic acid fragment into susceptible rice confers resistance to pathogen strains in a manner consistent with that expected for the Pi-ta resistance nucleic acid fragment.
- the Pi-ta resistance gene product has a novel structure compared to all known classes of resistance gene products.
- the Pi-ta protein bears no resemblance to the class of membrane anchored proteins with extracellular LRRs.
- the Pi-ta gene product has some features in common with R-gene products with cytoplasmic LRRs such as the Arabidopsis R-genes RPS2 (Bent et al., 1994, Science 265:1856-1860; Mindrinos et al,
- Pi-ta protein also lacks either a leucine zipper motif or a Toll/Interleukin-1 receptor motif that further subdivides the cytoplasmic LRR class of R-gene products (Jones and Jones, 1997, Adv. Bot. Res. Incorp. Adv. Plant Pathol. 24:89-167). Thus, the Pi-ta resistance gene product falls into a different class from any other R-gene product currently identified.
- Pi-ta 2 One other resistance gene derived from variety Tadukan, the Pi-ta 2 gene, appeared to be allelic or closely linked to Pi-ta, although the relationship between Pi-ta and Pi-ta 2 appears more complex than would be expected for a pair of independent allelic R-genes (Kiyosawa, 1967, Japan. J. Breeding 17:165-172; Kiyosawa, 1971, JARQ 6:73-80).
- the R-gene named Pi-4(t) in IRRI NIL differential rice varieties is closely linked to, and may indeed be the Pi-ta gene (Inukai et al., 1994, Phytopathology 84:1278-1283).
- the chromosome 12 centromeric region with Pi-ta appears to contain other resistance genes, the major R-gene Pi-6(t) (Abadassi et al., 1990, Rice Genetics II, IRRI, Los Banos, the major R-gene Pi-6(t) (Abadassi et
- a VR-Pita (formerly called AVR2-YAMO for Yashiro-mochi) was inherited from the parental strain, 4224-7-8, and was derived from the Chinese field isolate O-137 (collected in 1985 at the China National Rice Research Institute in Hangzhou).
- O-137 Chinese field isolate
- Yashiro-mochi rice showed structural changes in telomeric restriction fragments that mapped with the avirulence gene, suggesting the gene resided within 1 to 2 kb of the tip of the chromosome (Valent and Chumley, 1994, The Rice Blast Disease, edited by Zeigler, Leong and Teng, CAB International, Wallingford).
- Southern analysis of genomic DNA from wild type avirulent strains and from spontaneous mutants that had acquired deletions at the chromosome end identified the sizes of the terminal chromosome fragment produced by digestion of genomic DNA with various restriction enzymes. This analysis suggested that the AVR-gene resided within a telomeric 6.5 kb Bglll fragment that corresponded to the chromosome end.
- the A VR-Pita nucleic acid fragment of the invention was isolated from the Chinese rice pathogen O-137 encodes a protein with 223 amino acids (SEQ ID NO:5).
- Amino acids 173-182 form a characteristic motif of a neutral zinc metalloproteinase and natural or in vitro mutation of the motif residues destroys AVR-gene activity, that is, it no longer transforms virulent strains of the pathogen to avirulence on rice variety Yashiro-mochi.
- the predicted amino acid sequence has low levels of homology to other metalloproteinases characterized from fungi (Genbank Accession numbers L37524 and SI 6547).
- NpII secreted fungal metalloprotease
- Aspergillus oryzae contains a 175 amino acid prepro-region that precedes a 177 amino acid mature region (Tatsumi et al., 1991, Mol. Gen. Genet. 228:97-103).
- the predicted AVR-Pita amino acid sequence exhibits 35% homology and 29% identity with NpII, with the most significant homology confined to the mature 177 amino acid form of NpII.
- alignment of the amino acid sequences of AVR-Pita and NpII showed conservation of the cysteines involved in disulphide bonds in the mature NpII protein.
- AVR-Pita isolated nucleic acid fragment encodes a preproprotein that is processed to a mature metalloprotease containing 176 amino acids. Based on this prediction, an AVR-Pita 17 ⁇ expression construct was engineered to produce directly the putative mature protease for functional analyses.
- M. grisea rice pathogens do not appear to require an A VR-Pita gene for fitness in the laboratory or under field conditions.
- the well-characterized Chinese field isolate O-135 (Valent et al., 1991, Genetics 127:87-101), which was collected at the same time as the source strain O-137, lacks homology to this AVR-nucleic acid fragment.
- Rice pathogens such as O- 135 are not currently affected by the Pi-ta mediated defense response because they fail to elicit the response in Pi-ta containing rice.
- VR-Pita nucleic acid fragments have been cloned from M. grisea strains that infect host plants other than rice, and are distantly related to rice pathogens in subpopulation la, including a Digitaria pathogen (JP34, isolated in Japan) from subpopulation III, and a Pennisetum pathogen (BF 17, isolated in Burkina Faso) from subpopulation IV.
- JP34 Digitaria pathogen
- BF 17 isolated in Burkina Faso
- the A VR-Pita nucleic acid fragment cloned from the Digitaria pathogen corresponds to a translated amino acid sequence with 87.9%o similarity and 84.7% identity to the 0-137 AVR-Pita amino acid sequence when compared by the Bestfit algorithm of the University of Wisconsin Computer group package 9.1 (Devereux et al, 1984, Proc Natl Acad Sci USA 12:387-395).
- the G-213 A VR-Pita nucleic acid fragment cloned from the Digitaria pathogen corresponds to a translated amino acid sequence with 87.9%o similarity and 84.7% identity to the 0-137 AVR-Pita amino acid sequence when compared by the Bestfit algorithm of the University of Wisconsin Computer group package 9.1 (Devereux et al, 1984, Proc Natl Acad Sci USA 12:387-395).
- the present invention also concerns a gene comprising an isolated nucleic acid fragment which confers a Pi-ta resistance gene-mediated defense response against disease caused by a fungal pathogen wherein said nucleic acid fragment corresponds substantially to the nucleotide coding sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof wherein this fragment is operably linked to suitable regulatory sequences.
- a gene can be an isolated native gene or a chimeric gene.
- a chimeric gene can be constructed using techniques well known to those skilled in the art.
- a chimeric gene can be made which comprises the coding sequence of the nucleotide sequence of SEQ ID NO:68 operably linked to a native Pi-ta promoter fragment (nucleotides 1 to 2425) as set forth in SEQ ID NO:68.
- Transgenic plants can be made which are capable of mounting a Pi-ta resistance gene-mediated defense response against a fungal pathogen.
- Examples of plants which can be transformed with an isolated native gene or a chimeric gene as described herein include, but are not limited to, monocots.
- the monocot is a cereal.
- the monocot is rice, wheat, barley, corn, finger millet or pearl millet. Seeds of such transgenic plants are also of interest.
- this invention also concerns a method of conferring a Pi-ta resistance gene- mediated defense response against disease caused by a fungal pathogen in plants which comprises introducing into the plant any of the genes of the present invention as described herein.
- P/-t ⁇ -mediated defenses are generated in the crop plant in response to A VR-Pita avirulence gene expression, either the native AVR-gene as expressed by the fungal pathogen, or a chimeric AVR-transgene expressed by the plant in response to the pathogen.
- this invention also concerns a method of conferring a resistance gene-mediated defense response in plants, comprising transforming the plant with a recombinant expression construct which comprises (1) an isolated nucleic acid fragment which confers a Pi-ta resistance gene mediated defense response against diseases caused by fungal pathogens wherein said nucleic acid fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof and (2) an AVR-Pita isolated nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NOS: 5 or 7 or a functionally equivalent subfragment thereof, wherein said nucleic acid fragments are operably linked to regulatory sequences and further wherein said expression construct confers a resistance gene-mediated defense response in plants against diseases caused by a fungal pathogen at the site of infection.
- a recombinant expression construct which comprises (1) an isolated nucleic acid fragment which confers a Pi-ta resistance gene mediated defense response against diseases caused by
- this invention concerns a recombinant expression construct which confers a resistance gene-mediated defense response in plants against diseases caused by a fungal pathogen at the site of infection which comprises (1) an isolated nucleic acid fragment which confers a Pi-ta resistance gene-mediated defense response against diseases caused by fungal pathogens wherein said gene fragment corresponds substantially to the nucleotide sequence set forth in SEQ ID NOS:l or 68 or a functionally equivalent subfragment thereof and (2) a nucleic acid fragment corresponding substantially to the nucleotide sequence set forth in SEQ ID NO: 5 or 7 or a functionally equivalent subfragment thereof, wherein said nucleic acid fragments are operably linked to regulatory sequences.
- plants transformed with such a recombinant expression construct and seeds obtained from such plants are plants transformed with such a recombinant expression construct and seeds obtained from such plants.
- Such an expression construct can be prepared using techniques well known to those skilled in the art as is discussed above. Introduction of transgenes into plants, i.e., transformation is well known to those skilled in the art.
- a preferred method of plant cell transformation is the use of particle-accelerated or "gene gun" transformation technology (Klein et al. (1978) Nature (London) 327:70-73; U.S. Patent No. 4,945,050).
- Examples of plants that can be transformed with such recombinant expression constructs include, but are not limited to, monocots.
- the monocot is a cereal. Most preferably, the monocot is rice, wheat, barley, corn, finger millet or pearl millet.
- Pathogen Strain Development for Identification of the Corresponding R-Gene An avirulent isolate of the pathogen is necessary to identify a host resistance gene, and the use of new pathogen strains may identify resistance genes that have so far escaped detection. Two fungal strains that show virulence (that is, they fail to elicit an R-gene mediated defense response) toward a rice variety with a particular R-gene are considered to lack the corresponding functional AVR-gene.
- an avirulent strain of the fungus with a corresponding AVR-gene is necessary for identifying a host resistance gene
- two strains are avirulent toward a particular rice variety, they could have the same AVR-gene, or different AVR-genes triggering different R-gene mediated defense responses.
- Use of new or uncharacterized fungal strains may identify previously unidentified R-genes. This caution is especially required when working with field isolate rice pathogens such as O-137, the source of the AVR-Pita gene.
- rice blast infection assays are notoriously sensitive to environmental conditions, especially if the rice varieties have some level of general resistance to blast, or if the pathogens used are unstable in pathogenicity and morphology characteristics. Therefore, the use of thoroughly characterized pathogen strains is key to success. Multiple pathogen resources, including genetic populations segregating for the
- AVR-Pita gene facilitated cloning the R-gene.
- Progeny strains such as 4360-R-17, 4360-R-27, 4360-R-30, and subsequent generation strain 4375-R-26 (Sweigard et al., 1995, The Plant Cell 7:1221) had improved characteristics for these studies. Because the rice crosses in these experiments had at least two R-genes segregating, Pi-ta and Pi-km, and because pathogen cross 4360 was segregating for AVR-genes corresponding to both known R-genes, there was a need to obtain genetically characterized pathogen strains bearing single AVR-genes. Such strains were needed to identify the effects of individual R-gene/ AVR gene interactions on lesion development. There was also the need to maximize phenotypic differences between the resistant and susceptible interactions in order to assure accuracy of scoring the resistance phenotype among the rice progeny in the mapping population.
- a VR1-TSUY is the AVR-gene corresponding to the blast resistance gene Pi-km in the japonica variety Tsuyuake.
- M. grisea isolate 4360-R-62 was chosen as a test strain which contained only A VR-Pita.
- 4360-R-67 was chosen as an excellent pathogen that contains only AVR1-TSUY. Most of the R-gene mapping that is described below was done with these two fungal strains.
- mutants that have lost AVR-gene function are useful for comparison to the parental strain from which they were derived.
- strain CP987 was derived from strain 4360-R-17 by isolation of a spontaneous virulent mutant.
- the AVR-Pita gene in CP987 was inactivated by a small deletion.
- Virulent mutants can easily be obtained from avirulent field isolates or laboratory strains as described in Sweigard et al. (1995) 77ze Plant Cell 7:1221.
- field isolate Guyl 1 which is virulent on Yashiro-mochi, became avirulent on this host when it was transformed with a cloned A VR-Pita gene to produce strain CP3285.
- Fungal transformation in the rice blast system is routine, as described in Sweigard et al. (1995) The Plant Cell 7:1221.
- Plant Infection and Evaluation Infection assays were performed as previously described (Valent et al, 1991, Genetics 127:87). Conidia were collected from cultures grown on oatmeal agar plates by washing with a sterile 0.25% gelatin solution. Four to five individuals from each rice variety were sown in Metro-Mix® potting medium within plastic pots in a growth chamber. Plants were grown on a day cycle of 14 hours of light, 28 degrees and 70 to 85% relative humidity. Night conditions were 22 degrees and 85% relative humidity. Pots with two-week-old plants were placed into plastic bags in order to maintain 95-100% relative humidity required for pathogen penetration, and inoculated with pathogen strains such as 4360-R-62 or 4360-R-67 described in Example 1.
- haploid callus was obtained from the pollen of FI plants derived from reciprocal crosses between rice varieties Yashiro-mochi and Tsuyuake. Rice plants were then regenerated from this callus. Fertile plants derived from this procedure have undergone spontaneous diploidization of the haploid genome. Individual plants from reciprocal crosses were subjected to 7 selfing generations to produce a total of 429 independent DH lines. Of these, 119 lines were used as the initial mapping population in this study.
- Progeny in these four phenotypic classes fit an expected 1 : 1 : 1 : 1 ratio (X 2 2.20; P > 0.50), indicating, as expected, that Pi-ta and Pi-km were independently segregating R-genes.
- Infection assays for the F 2 population were essentially the same as described in Example 2 with exceptions that plants were sown in plastic trays, 60 plants per tray, and inoculum was reduced to 1 X 10 5 conidia per ml. About 30 ml of conidial suspension was applied to each tray. F 2 plants segregated as 541 resistant and 179 susceptible which nearly perfectly fit a 3:1 ratio (0.007; P > 0.90) indicating a single dominant gene. For use in fine structure mapping studies, the susceptible plants from this analysis were carefully trimmed to remove diseased tissue, and transplanted into fresh potting medium.
- RAPD Random Amplified Polymo ⁇ hic DNA
- RAPD reactions were carried out in volumes of 20 ⁇ l, containing 80 mM Tris-HCl (pH 9.0); 20 mM (NH 4 ) 2 SO 4; 3.5 mM MgCl 2; 100 ⁇ M each of dGTP, dATP, dCTP and dTTP; 0.2 ⁇ M primer; 10 ng of DNA; and 1 unit of Taq DNA polymerase (Perkin Elmer Cetus).
- the DNA fragments that were amplified with this procedure were separated on 2% agarose (New England BioLabs) gels in 1 X TAE buffer for 5 hours.
- Polymo ⁇ hic fragments either present or absent in resistant and susceptible pools, were further confirmed by using DNA templates from both parents, from the resistant and susceptible pools, and from each of the individuals forming the two pools.
- the pooled DNAs either from the resistant or from the susceptible lines, were used as templates to screen 1440 RAPD primers. More than 95 percent of the primers gave rise to one or more amplified products. The average number of discrete bands per primer was approximately 8.
- RAPD primers SP1B8, SP2C12, SP3F4, SP3G6, SP4A5, SP4B9, SP6C2, SP6G10, SP7C3, SP7H8, SP8B8, SP8C6, SP8E2, SP8F1, SP9F3 and SP15B12 identified polymo ⁇ hisms linked to the R-gene corresponding to A VR-Pita.
- SP1B8 5'-TCAGCGCCT-3' (SEQ ID NO:9)
- SP2C12 5'-CCAATCGGAC-3' (SEQ ID NO:10)
- SP3F4 5'-TAATGGGCGG-3' (SEQ ID NO:l 1)
- SP3G6 5'-GTCGCTACTG-3' (SEQ ID NO:12)
- SP4A5 5'-ACAGCGCCTT-3' (SEQ ID NO:13)
- SP4B9 5'-AGGCGTCTTC-3' (SEQ ID NO:14)
- SP6C2 5*-TAGCCAGACC-3' (SEQ ID NO:15)
- SP6G10 5'-TCTATGCCCC-3' (SEQ ID NO:16)
- SP7C3 5'-ATGGCAGATG-3' (SEQ ID NO:17)
- SP7H8 5'-CGAGTCAACT-3' (SEQ ID NO:18)
- SP8B8 5'-GTAGAAGCCT-3' (SEQIDNO:19)
- SP8C6 5'-TCATGCGGAG-3' (SEQ ID NO:20)
- SP8E2 5'-CCATTTCCGT-3' (SEQIDNO:21)
- SP8F1 5'-GGGAGGACTT-3' (SEQIDNO:22)
- SP9F3 5'-AAAGGCAGTG-3' (SEQIDNO:23)
- SP15B12 5'-TGTGCAACGG-3' (SEQIDNO:24)
- Two-point analysis revealed strong linkage among the identified RAPD markers, and between these markers and the R-gene in the DH population.
- the order of these markers relative to the R-gene was determined by multiple point analysis.
- SP7C3, SP7H8 and SP8C6 mapped closest to the R-gene with no recombination observed among the 119 progeny, while SP8B8 and SP3G6 mapped to distal ends of the mapping region, with genetic distances of 8.6 and 7.3 cM from the R-gene, respectively.
- the most probable order of these markers is presented in Figure 1 A. However, the order of a number of markers could not be determined unambiguously because the probability of any particular order was not greater than 100:1 relative to other alternative orders based on this population size.
- Fine Structure Mapping of the R-Gene Increased mapping resolution was accomplished by scoring the segregation of the R-gene and the linked markers in a larger mapping population. Additional DH rice lines were included to bring the total to 270 lines in the mapping population.
- 720 F2 progeny from the genetic cross between DH lines YT4 and YT10 were included in this analysis. As described, 720 F2 plants were inoculated with fungal strain 4360-R-62 (containing only AVR-Pita) to determine which contained the corresponding R-gene. The susceptible plants from this analysis were recovered by removal of diseased tissue and by transplanting to fresh potting medium.
- RAPD markers As is well understood, F2 segregation analysis of RAPD markers is complicated because the dominance of these markers prevents discrimination between heterozygous and homozygous progeny. This difficulty can be overcome in some cases by isolating codominant markers from the the RAPD markers. For example, isolation of RFLP markers from RAPD markers is described in Example 4. Additional differentiation of heterozygous versus homozygous F2 rice lines was accomplished by checking for segregation of the resistance phenotype in the F3 generation. The fine structure map produced in this study is shown in Figure IB.
- RAPD fragments were eluted from gels, cleaned using Geneclean II (Bio 101, San Diego, CA) and subcloned into the TA cloning vector (Invitrogen, San Diego, CA).
- the subcloned DNA inserts were amplified by using T7 (SEQ ID NO:27) and SP6 (SEQ ID NO: 28) promoter primers and used as probes to survey the two parents of the mapping population.
- Probes P4A5, P1B8 , P7C3 and P8C6 showed polymo ⁇ hisms with restriction enzymes Xbal, EcoRI, EcoRV and Dral, respectively. Allelic patterns for the four RFLP markers were scored for the RI population members and mapped using the MAPMAKER (version 2.0) program.
- the R-gene maps to the chromosomal region containing the Pi-ta resistance gene, it might still be an unknown gene or one of the other R-genes mapping to this same region.
- a series of pathogen strains was identified, including O-137, the Chinese field isolate that is the source of the AVR-Pita gene; 4360-R-17 and 4360-R-27, progeny of cross 4360 that contain the AVR-gene; 4360-R-30, a progeny of cross 4360 that does not contain the AVR-gene; and CP987 and CP983, mutants that have lost AVR-gene function.
- These isolates of the pathogen were used in infection assays on other rice varieties that contain the Pi-ta gene, specifically, Tadukan and KI.
- Size-selected DNA was then recovered from agarose by treating with GELase (Epicentre Tech) and ligated into the Hindill site of pBeloBACII vector (Shizuya et al., 1992, Proc. Natl. Acad. Sci. USA 89:8794). Transformation of E. coli DH10B cells was carried out by electroporation using Cell Porator Electroporation System I (BRL). BAC colonies were selected on LB plates with chloramphenicol at 12.5 ⁇ g/ml. A total of 20,160 independent colonies were picked and stored in 96-well microtiter plates containing 100 ⁇ l LB with chloramphenicol and 10% glycerol. The average insert size of clones in the library is 110 kb based on analysis of 28 randomly selected colonies. The library contains approximately 5 haploid genome equivalents of rice DNA.
- the BAC library contained in 210 microtiter plates, was spotted onto high density filters using a Biomek robot (Beckman Instruments). The entire library was arrayed onto 14 filters with a density of 16 plates spotted per filter. The set of filters was probed with the single copy RFLP probe, p7C3, obtained from the RAPD marker SP7C3 as described in Example 3. This marker cosegregated with the Pi-ta gene in the entire DH and F2 mapping populations. Four overlapping BAC clones were identified in this hybridization: 5C1, 22H9, 136F8 and 179G5 (See Figure 2).
- BAC DNAs were isolated using a midi-prep procedure based on standard alkaline lysis plasmid purification methods
- the method for isolating the insert border sequences for one side of the vector involved digestion of the DNA with either BamHI or Sphl to remove the majority of the insert DNA. The remaining vector was religated and the insert sequences were isolated by PCR with either the Ml 3-20 (SEQ ID NO:25) and reverse (SEQ ID NO:26) primers or the T7 (SEQ ID NO:27) and SP6 (SEQ ID NO:28) primers.
- M13-20 5'-GTAAAACGACGGCCAGT-3' (SEQ ID NO:25)
- T7 5'-GTAATACGACTCACTATAGGGC-3' (SEQ ID NO:27)
- SP6 5'-ATTTAGGTGACACTATAG-3' (SEQ ID NO:28)
- the opposite border fragment was isolated by one of two methods.
- BAC clones were digested with Seal which deleted the majority of the genomic insert DNA.
- the remaining BAC clone was religated and the remainder of the insert amplified by PCR using the T7 (SEQ ID NO:27) and Belo840 (SEQ ID NO:29) primers.
- the second method involved an inverse PCR technique (Sambrook; Ochman H. et al. (1988) Genetics 120:621- 623) after digestion of the BAC clone with BamHI and religation in which the opposite border fragment was amplified by PCR using primers IBAC1 (SEQ ID NO:30) and IBAC2 (SEQ ID NO:31).
- the border fragments obtained by PCR were subcloned from an agarose gel, and used as probes for isolating overlapping BAC clones.
- IBAC2 5'-CTGCAGGCATGCAAGCTT-3' (SEQ ID NO:31)
- the overlapping rice BAC clones 31H3, 107F10, 157A9, 70F1 and 147G7 were subsequently shown to contain the DNA sequence corresponding to the RAPD marker SP4B9 that defines one border of the R-gene region (Recombination has occurred between SP4B9 and the Pi-ta gene in one progeny rice line out of the entire mapping population tested).
- the SP4B9 sequence was shown to reside at this location in the BAC contig using specific PCR primers GB24 and
- GB25 (SEQ ID NO:32 and 33) produced by subcloning and sequencing the linked SP4B9
- DNA fragments in the size range of 1000-2000 bp were isolated from agarose gels using the QIAEX II Gel Extraction Kit (Qiagen, Chatsworth, CA) subcloned into the Smal site of pUC18, and transformed into DH10B by electroporation.
- Clones containing BAC DNA inserts were sequenced in one direction using the universal reverse primer. Approximately 300 to 400 clones were sequenced for each BAC in order to have a reasonable chance of obtaining sequence from and identifying all genes contained in the set of clones. Similarity searches were done using the BlastX program (Gish, W. and States, D.J. (1993) Nature Genetics 3:266-272).
- the P-value (probability) of observing a match of a sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST is reported herein as "pLog" values, which represent the negative of the logarithm of the reported P-value. Accordingly, the greater the pLog value, the greater the likelihood that the sequence and the BLAST "hit” represent similar proteins.
- PRG2 was identified by three sequences falling in the weakly significant hits category.
- the rice genomic fragment in bacl42e8.pk0001.f8 was 2 kb in size and contained 1255 bp of promoter sequence before the initiation codon ( Figure 3).
- Southern analyses of Yashiro-mochi genomic DNA and BAC 142E8 using agarose gel purified rice insert fragments from clones bacl42e8.pk0001.b7 and bacl42e8.pk0001 T12 showed that BAC RB142E8 contained a single copy of PRG2.
- This analysis also identified a 5.3 kb BamHI fragment from 142E8 that contained the remainder of the gene plus approximately 2 kb of 3' untranslated region.
- This 5.3 kb BamHI fragment was subcloned from the BAC DNA into the vector pBluescriptIISK+ (Stratagene) and was designated Clone #7 ( Figure 3). The entire gene was assembled by digesting both bacl42e8.pk0001.f8 and Clone #7 with EcoRI, and ligating the 5.3 kb EcoRI fragment from Clone #7 in place of the small EcoRI fragment in bacl42e8.pk0001.f8 ( Figure 4).
- the resulting vector, pCB1641 contained a 7.5 kb insert of rice DNA in the 2.7 kb vector.
- This rice clone included the full length PRG2 coding sequence along with 1255 bp of promoter sequence and approximately 2 kb of 3' untranslated sequence.
- the DNA sequence of 5757 bp of the genomic clone (S ⁇ Q ID NO:l, including the entire 5' sequence, the coding sequence and intron, and 246 bp past the termination codon) in pCB 1641 was determined for both strands by the primer walk method, with the use of DyeDeoxy terminator cycle sequencing and a model 377 A DNA sequencing system (Applied Biosystems, Foster City,
- F8-2 5'-CCATCGGTGACCATGGG-3* (S ⁇ Q ID NO:37)
- 1641-1 5'-CCCTCTCCGTTGTTCCCATGG-3' (S ⁇ Q ID NO:38)
- F8-4 5'-GGGTTGGAGAATGCATGG-3' (SEQ ID NO:39)
- F8-3 5'-CATGGATGGAGACCTCTGC-3' (SEQ ID NO:41)
- F8-5 5'-TCCTCAGAGGCGATCTCC-3' (SEQ ID NO:42)
- F8-1 5'-GAACAGGGTGACCTCGTCG-3' (SEQ ID NO:43)
- F12-1 5'-GTGGCTTCCATTGTTGGATC-3' (SEQ ID NO:44)
- F12-5 5'-CGAACGGCGCATCCAACC-3' (SEQ ID NO:45)
- F12-6 5*-GTGTCCTCTATTAGTAAATAC-3' (SEQ ID NO:46)
- F12-7 5'-GTATTTACTAATAGAGGACAC-3' (SEQ ID NO:47) 1641-3: 5'-GGGCCTCCCTTGTTCGG-3' (SEQ ID NO:48)
- F12-4 5'-CCTACAGATCTGTAGCCAGC-3' (SEQ ID NO:50
- F12-3 5'-GCTGGCTACAGATCTGTAGG-3' (SEQ ID NO:51
- F12-2 5'- GCTGGCTACAGATCTGTAGG -3' (SEQ ID NO:52
- B7-3 5'-GTGATTCCATTGCTGCATTCC-3' (SEQ ID NO:54
- B7-4 5'-CATGTGTAGTGCACCACATGG-3' (SEQ ID NO:55
- B7-2 5'-CTGTCGTCTGAGAATGATCC-3' (SEQ ID NO:56
- 173C12-5 5'-GCATCCCCAAATGGACTGG-3' (SEQ ID NO:58
- DNA sequence analysis of the rice genomic fragment (SEQ ID NO:l; 5757 nucleotides) subcloned in pCB1641 identified an open reading frame of 2784 nucleotides beginning at nucleotide 1256 and interrupted by one 1463 bp intron between nucleotides 2199 and 3663.
- the coding sequence corresponds to a deduced polypeptide with 928 amino acids ( Figure 6).
- the putative protein has a relative molecular weight of 105 kDa and a pi of 7.05.
- Four amino acid sequences matching the N-glycosylation consensus [NX(S/T) with X not being P] are present in the PRG2 protein.
- blots of total genomic rice DNA were probed using nucleic acid fragments encoding either the amino-terminal portion of the gene (639 bp fragment amplified by primers F8-5 and F12-5) or the carboxy-terminal portion (nucleotides 4477 to 5503, amplified by primers GB47 and GB46). Blots were washed at 50° to 55° in 2 x SSPE with 0.1% SDS, for low stringency hybridizations, and at 65° in 0.1 x SSPE with 0.1% SDS for high stringency hybridization.
- the N-terminal probe (nucleic acid fragment comprising bases 1401 to 2040) identified a single copy against a general smear of background hybridization. Probing the very same blots with the C-terminal nucleic acid fragment (subcloned as pCB1645, described below) identified one copy with no background smear. It was concluded that PRG2 is a single copy gene, but that there may be related genes in the rice genome. The single copy C-terminal probe was subcloned for use as a hybridization probe.
- Primer GB47 was synthesized based on the sequence of this region from nucleotides 4465 through 4497, except that residues between 4471 and 4476 were modified to inco ⁇ orate an EcoRI restriction site. Likewise, primer GB46 was the reverse-complement of nucleotides 5519 through 5484, except that the residues corresponding to nucleotides 5512 and 5506 were modified to inco ⁇ orate a SaR restriction site. Primers GB46 and GB47 were used to amplify the gene fragment.
- the nucleic acid fragment was subcloned into the EcoRllSaR sites of the vector pBD-GAL4 Cam (Stratagene) to produce plasmid pCB1645 ( Figure 4B). The subcloned fragment was sequenced to confirm its structure.
- a full-length Pi-ta cDNA fragment was cloned using reverse transcriptase (RT) PCR and subcloning.
- the approach involved isolating mRNA from transgenic Nipponbare line 27-4-8-1 which contained the transgene comprising a genomic Pi-ta nucleic acid fragment operably linked to the CaMV 35S promoter (Example 10, expression construct 3) and which was shown on a northern blot to overexpress Pi-ta.
- First strand cDNA was synthesized using the isolated mRNA fraction as template and the oligonucleotide GB67 (SEQ ID NO:65) as primer.
- a partial Pi-ta cDNA (2.1 kb) was amplified from first strand cDNA using primers F12-1 (SEQ ID NO:44) and GB67 (SEQ ID NO:65). It was then cloned into pSLl 180 (Pharmacia) using the BamHI (restriction site present in the Pi-ta nucleic acid fragment) and Hwdlll (restriction site present in GB67 sequence) cloning sites.
- a 706 bp Ncol-BamHl fragment containing the 5' end of the Pi-ta coding sequence was isolated from pCB1649 and cloned into the Ncol-BamHl site upstream of the 2090 bp if ⁇ mHI-HmdIII partial Pi-ta cDNA fragment to create a full-length promoter-less Pi-ta cDNA.
- DNA sequence analysis determined that there was a 2 bp deletion present at codon 796 (probably a PCR artifact) resulting in a frameshift mutation that would have truncated the predicted Pi-ta protein by 119 amino acids.
- Genomic DNA was prepared using a procedure described by Dellaporta et al., (1983) Plant Mol. Biology Reporter 7:19-27. The genomic DNA was subjected to partial digestion with the restriction enzyme 7 ⁇ 5091 (cuts at
- DNA fragments in the size range of 7 to 10 kb were purified from an agarose gel and subcloned into the EcoRI site of vector ⁇ ZapII (Stratagene). Screening the Tsuyuake library by hybridization with the DNA insert of pCB1641 identified 8 overlapping clones with sequences related to PRG2. Two clones that overlapped by 1 kb and included the entire coding sequence, T2-9 and T2-2, were sequenced using the primers in Figure 5. The sequence of the cloned genomic fragments from Tsuyuake were identical to sequences obtained from PCR-amplified genomic DNA of the susceptible D ⁇ rice line YT16.
- the functional Pi-ta coding sequence from resistant Yashiro-mochi rice differs by 7 nucleotides from the sequence of the nonfunctional coding sequence from sensitive Tsuyuake rice (contained in S ⁇ Q ID NO: 3).
- the 7 basepair substitutions in the coding region result in 5 amino acid differences between the two proteins ( Figure 6).
- Six additional basepair changes occur in the intron sequences.
- Most of the nucleotide differences in the coding region occur in the region preceding the P-loop motif.
- Both genes encode proteins with identical NBS motifs and with the 4 potential N-glycosylation sites at positions 339, 556, 654 and 838.
- RNA gel blot analysis As determined by RNA gel blot analysis with polyA + -RNA, both the Pi-ta gene from Yashiro-mochi and the susceptible allele from Tsuyuake are transcribed with an estimated transcript size of 3.3 kb. Further, RNA blot analysis demonstrates that both alleles are constitutively expressed. This analysis was done by probing polyA + -RNA blots with the C-terminal Pi-ta fragment that had been cloned in pCB1645. PolyA + -mRNA was prepared from 2 week old leaves of resistant rice variety YT14, or from susceptible rice variety YT16 by the method of Perry and Francki (1992, J. Gen. Virol. 73:2105-2114). RNA gel blot analysis was performed according to the method of Ausubel et al. (1987 Protocols in Molecular Biology, New York, John Wiley and Sons).
- sequences of genomic clones of Pi-ta nucleic acid fragments from additional varieties of rice were obtained in order to see if the differences in nucleic acid sequences were conserved in resistant versus susceptible forms of the Pi-ta gene.
- primers listed in Figure 5 PCR products of the T'z ' -t gene were sequenced from the resistant varieties Tadukan and KI . These varieties are believed to have acquired a Pi-ta resistance gene in a manner independent of that which resulted in the presence of the gene in Yashiro-mochi.
- the same PCR primers were used to sequence the nucleic acid fragment from an additional susceptible Japanese rice variety, Nipponbare, and from the unrelated susceptible variety, Sariceltik.
- the nucleic acid fragment was sequenced from the susceptible indica variety C101 A51.
- the result shows a strong correlation between nucleic acid sequence and resistance to strains of the rice blast pathogen containing A VR-Pita; over the region sequenced, Tadukan and KI have an identical sequence to Pi-ta from Yashiro-mochi (Table 4), and the genes from Nipponbare and Sariceltik have the identical sequence to the susceptible pi-ta gene from Tsuyuake.
- the nucleotide sequence of the indica C101A51 allele suggests that a single amino acid difference, alanine versus serine at position 918, determines the specificity of Pi-ta function.
- Such assays have demonstrated utility for identifying R-genes for bacterial pathogens because the corresponding AVR-gene required for triggering resistance responses can be supplied by uniform infiltration of the plant tissue with the bacterial pathogen (Mindrinos et al, 1994, Cell 78:1089-1099). Uniform pathogen infiltration is not possible with fungal pathogens such as M. grisea that directly penetrate through the plant cuticle and produce localized lesions at the point of penetration. In order to overcome the obstacle to uniform inco ⁇ oration of the fungal AVR-gene within the plant tissue, introduction of an A VR-Pita expression construct was tested by co-bombardment along with the GUS reporter gene.
- a construct was engineered that expresses the putative mature protease (AVR-Pita 17-5) under control of the 35S promoter for constitutive expression in plant cells.
- pML63 Figure 7B
- the GUS nucleic acid fragment was then removed by further digestion withv457J>718.
- a linker fragment generated with primers ML132 (SEQ ID: 69) and ML 133 (SEQ ID: 70) was cloned into the blunted Ncol and ⁇ 718 sites to produce pMLl 35.
- pML135 was digested with PmR and ⁇ sp718, and the Adhl-6 intron amplified by PCR from maize genomic DNA using primers MLl 11 (SEQ ID:71) and ML135 (SEQ ID:72) was cloned into pML135 to create pML141.
- MLl11 5'-CCCGGGGAATTCCTGCAGAAGGTG
- ML135 5'-TTTAAAGGTACCCCATGGCACGTGCCGGC
- pML142 was finally created by digested pML141 with BamHI and Ncol and the 1.9 kb fragment containing the 35S/Adhl-6 sequence from pML141 was cloned into the BamHllNcol sites of pML63.
- Plasmid pAVR3 contained nucleotides 139-672 of the AVR-Pita nucleic acid fragment (SEQ ID NO: 5) encoding the predicted mature protease plus one additional N- terminal amino acid (AVR-Pita 177 , beginning with Ile-47 of the preproprotein) and a start codon met fused to the 35S/Adhl-6 promoter in vector pML142.
- the A VR-Pita nucleic acid fragment (SEQ ID NO:5) was amplified by PCR from A VR-Pita cDNA using primers AVI (SEQ ID NO:73) and AV3 (SEQ ID NO:74), digested with PmR and Kpnl, blunted with Klenow polymerase and cloned into pML142 that had also been cut with Pmll and Kpnl and blunted with Klenow polymerase, resulting in pAVR3.
- the coding sequence for the predicted mature protease was obtained by PCR-amplification from the A VR-Pita nucleic acid fragment (SEQ ID NO:5) in plasmid pAVR3 using oligonucleotides YL30 containing an in-frame Ncol site (SEQ ID ⁇ O:66 ) and YL37 (SEQ ID NO:67).
- the PCR fragment was cloned NcollKpnl into pML142 resulting in vector pCB1947. This was done to eliminate the Ile-47 codon (att) in pAVR3 and generate AVR-Pitaj 7 g. Additional details are described in the Legend to Figure 7A.
- Typical leaves from this assay are shown in Figure 8. Decreased levels of GUS expression were observed in resistant (YT14) leaves whether or not the Pi-ta expression construct was co-bombarded with A VR-Pita 176 , and GUS. In susceptible (YT16) rice leaves, however, a marked decrease in GUS expression was noted only if the Pi-ta expression construct was co-bombarded with A VR-Pita j 76 , and GUS. Thus, PRG2 functions in place of the endogenous Pi-ta gene in recognizing AVR-Pita ⁇ 7 and inducing localized cell death.
- pCB1649 - plasmid containing an 8.4 kb Pi-ta nucleic acid fragment including a 3 kb native promoter This vector is identical to pCB1641 except that it contains a longer promoter region.
- pCB1641 was cut with Hmdlll/S ⁇ cII to excise a
- the bacterial hygromycin B phosphotransferase ( ⁇ pt II) gene from Streptomyces hygroscopicus that confers resistance to the antibiotic was used as the selectable marker for rice transformation.
- ⁇ pt II The bacterial hygromycin B phosphotransferase ( ⁇ pt II) gene from Streptomyces hygroscopicus that confers resistance to the antibiotic was used as the selectable marker for rice transformation.
- pMLl 8 the ⁇ pt II gene was engineered with the 35S promoter from Cauliflower Mosaic Virus and the termination and polyadenylation signals from the octopine synthase gene of Agrobacterium tumefaciens.
- pML18 is described in WO 97/47731, which was published on December 18, 1997, the disclosure of which is hereby inco ⁇ orated by reference.
- Embryogenic callus cultures derived from the scutellum of germinating Nipponbare seeds served as source material for transformation experiments. This material was generated by germinating sterile rice seeds on a callus initiation media (MS salts, Nitsch and Nitsch vitamins, 1.0 mg/1 2,4-D and 10 ⁇ M AgNO 3 ) in the dark at 27-28° C. Embryogenic callus proliferating from the scutellum of the embryos was the transferred to CM media (N6 salts, Nitsch and Nitsch vitamins, 1 mg/1 2,4-D, Chu et al., 1985, Sci. Sinica 18: 659-668). Callus cultures were maintained on CM by routine sub-culture at two week intervals and used for transformation within 10 weeks of initiation.
- Callus was prepared for transformation by subculturing 0.5-1.0 mm pieces approximately 1 mm apart, arranged in a circular area of about 4 cm in diameter, in the center of a circle of Whatman #541 paper placed on CM media. The plates with callus were incubated in the dark at 27-28° C for 3-5 days. Prior to bombardment, the filters with callus were transferred to CM supplemented with 0.25 M mannitol and 0.25 M sorbitol for 3 hr. in the dark. The petri dish lids were then left ajar for 20-45 minutes in a sterile hood to allow moisture on tissue to dissipate.
- Circular plasmid DNA from two different plasmids were co-precipitated onto the surface of gold particles.
- pML18 containing the selectable marker for rice transformation and pCB1641 containing the putative R-gene were co-precipitated onto the surface of gold particles.
- selectable marker DNAs were added to 50 ⁇ l aliquot of gold particles that had been resuspended at a concentration of 60 mg ml" 1 .
- Calcium chloride (50 ⁇ l of a 2.5 M solution) and spermidine (20 ⁇ l of a 0.1 M solution) were then added to the gold-DNA suspension as the tube was vortexing for 3 min.
- the gold particles were centrifuged in a microfuge for 1 sec and the supernatant removed. The gold particles were then washed twice with 1 ml of absolute ethanol and then resuspended in 50 ⁇ l of absolute ethanol and sonicated (bath sonicator) for one second to disperse the gold particles. The gold suspension was incubated at -70°C for five minutes and sonicated (bath sonicator) if needed to disperse the particles . Six ⁇ l of the DNA-coated gold particles were then loaded onto mylar macrocarrier disks and the ethanol was allowed to evaporate. At the end of the drying period, a petri dish containing the tissue was placed in the chamber of the PDS-1000/He.
- the air in the chamber was then evacuated to a vacuum of 28-29 inches Hg.
- the macrocarrier was accelerated with a helium shock wave using a rupture membrane that bursts when the He pressure in the shock tube reaches 1080-1100 psi.
- the tissue was placed approximately 8 cm from the stopping screen and the callus was bombarded two times. Five to seven plates of tissue were bombarded in this way with the DNA-coated gold particles. Following bombardment, the callus tissue was transferred to CM media without supplemental sorbitol or mannitol.
- SM media CM medium containing 50 mg/1 hygromycin.
- callus tissue was transferred from plates to sterile 50 ml conical tubes and weighed. Molten top-agar at 40° C was added using 2.5 ml of top agar/100 mg of callus. Callus clumps were broken into fragments of less than 2 mm diameter by repeated dispensing through a 10 ml pipet. Three ml aliquots of the callus suspension were plated onto fresh SM media and the plates were incubated in the dark for 4 weeks at 27-28°C. After 4 weeks, transgenic callus events were identified, transferred to fresh SM plates and grown for an additional 2 weeks in the dark at 27-28°C.
- Plants were transferred from RM3 to 4" pots containing Metro mix 350 after 2-3 weeks, when sufficient root and shoot growth had occurred. Plants were grown using a 12 hr/12 hr light/dark cycle using ⁇ 30/18°Cday/night temperature regimen.
- EXAMPLE 11 Identification of Pi-ta by Functional Complementation in Transgenic Rice Molecular Analysis of the Transformants. Allele specific PCR, as well as DNA gel blot analysis, was used to analyze transformants for the presence of R-gene sequences. High- stringency DNA gel blot analysis was performed, as described in Example 7, using the PRG2 DNA insert from pCB1645 as the hybridization probe. Figure 9 shows a typical result from analysis of transformants produced with the PRG2 isolated nucleic acid fragment in pCB 1641. Events ranged from insertion of single copies of the putative Pi-ta gene to complex multi-copy insertions.
- transgene can be inserted into a chromosomal region that is unfavourable for gene expression.
- a third possible factor may have been gene inactivation by small deletions or frameshift mutations in the transgene that could not be detected on a Southern blot.
- RI seedlings derived from a single RO transformant were divided into two sets and inoculated with either the avirulent stain O- 137 or a virulent mutant derived from O-137 (CP3337) in order to determine if the resistance phenotype was stable through meiosis and if the resistance had specificity characteristic of the Pi-ta resistance gene.
- DNA gel blot analysis ( Figure 10) of RI seedling family 22-6-10-1 shows stable inheritance of the transgene correlating with Pt-t ⁇ -specific resistance. Results of the RI analysis demonstrate that PRG2 confers resistance with specificity characteristic of the Pi-ta gene and that this resistance is stably inherited. Thus, it was concluded that SEQ ID NO: 1 corresponds to the Pi-ta resistance gene.
- Pi-ta gene product A prominent feature of the Pi-ta gene product is the NBS motif characteristic of numerous ATP- and GTP-binding proteins (Traut, 1994, Eur. J. Biochem. 229:9-19).
- Amino acids 236 to 244 match the generalized consensus GXGXXG(R/k)V for the phosphate binding (P) loop.
- the probable companion kinase domains are located at amino acids 314-323 (kinase domain 2a) and around amino acids 342 to 353 (kinase domain 3a).
- a conserved internal hydrophobic domain found in the two subclasses of cytoplasmic R-gene products (Jones and Jones, 1997, Adv. Bot. Res. Inco ⁇ . Adv. Plant Pathol.
- Pi-ta gene product has a unique amino terminus, lacking either the potential leucine zipper motif of the RPS2 gene-product subfamily (Bent et al., 1994, Science 265:1856-1860; Mindrinos et al., 1994, Cell 78:1089-1099) or the Toll/Interleukin-1 receptor homology encoded by the N gene subfamily (Whitman et al., 1994, Cell 78:1101-1115).
- the carboxy terminal portion of the Pi-ta gene product is leucine rich, but it does not fit any consensus sequence for leucine-rich repeats reported for R-gene products (Jones and Jones, 1997, Adv. Bot. Res. Inco ⁇ . Adv. Plant Pathol. 24:89-167).
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2000563786A JP2002525033A (ja) | 1998-08-04 | 1999-08-03 | 植物に疾患抵抗性を付与するPi−ta遺伝子 |
| AU55475/99A AU5547599A (en) | 1998-08-04 | 1999-08-03 | A (pi-ta) gene conferring disease resistance to plants |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US9522998P | 1998-08-04 | 1998-08-04 | |
| US60/095,229 | 1998-08-04 | ||
| US09/336,946 | 1999-06-21 | ||
| US09/336,946 US6479731B1 (en) | 1998-08-04 | 1999-06-21 | Pi-ta gene conferring fungal disease resistance to plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2000008162A1 true WO2000008162A1 (en) | 2000-02-17 |
Family
ID=26789979
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/017706 Ceased WO2000008162A1 (en) | 1998-08-04 | 1999-08-03 | A Pi-ta GENE CONFERRING DISEASE RESISTANCE TO PLANTS |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US6479731B1 (enExample) |
| JP (1) | JP2002525033A (enExample) |
| CN (1) | CN1321191A (enExample) |
| AU (1) | AU5547599A (enExample) |
| ID (1) | ID28279A (enExample) |
| UY (1) | UY25641A1 (enExample) |
| WO (1) | WO2000008162A1 (enExample) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6743969B2 (en) | 2000-11-14 | 2004-06-01 | E. I. Du Pont De Nemours And Company | Modification of PI-TA gene conferring fungal disease resistance to plants |
| WO2013127379A1 (de) * | 2012-02-29 | 2013-09-06 | Kws Saat Ag | Pathogenresistente transgene pflanze |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002218017A1 (en) * | 2000-10-20 | 2002-05-06 | The United States Of America, As Represented By The Secretary Of Agriculture | Plant genes that confer resistance to strains of magnaporthe grisea having avr1 co39 cultivar specificity gene |
| US7094951B2 (en) * | 2002-09-09 | 2006-08-22 | The Ohio State University | Cloning and characterization of the broad-spectrum resistance gene Pi2 |
| KR101317729B1 (ko) * | 2005-03-03 | 2013-10-15 | 리즈크 즈완 자드틸트 엔 자드한델 비.브이. | 후향 후대 맵핑 |
| CA2604351C (en) | 2005-04-04 | 2012-08-28 | E. I. Du Pont De Nemours And Company | Polynucleotides and methods for making plants resistant to fungal pathogens |
| US7750214B2 (en) * | 2007-01-25 | 2010-07-06 | Board Of Regents Of The University Of Nebraska | Pearl millet line 53-1-1 with PP3 gene and all derivatives produced by any method |
| CN102051368B (zh) * | 2010-02-02 | 2012-12-19 | 华南农业大学 | 稻瘟病抗性基因Pik及其应用 |
| CN103333887B (zh) * | 2013-06-17 | 2015-09-30 | 华南农业大学 | 一种利用DNA熔解温度分析水稻Pita基因的功能标记 |
| CN106480060B (zh) * | 2015-08-24 | 2020-06-19 | 中国种子集团有限公司 | 重组核酸片段RecCR01BC06及其检测方法 |
| CN105907884B (zh) * | 2016-07-04 | 2019-06-21 | 湖北省农业科学院粮食作物研究所 | 水稻抗稻瘟病基因Pita特异性分子标记引物及应用 |
| CN112442547A (zh) * | 2020-12-11 | 2021-03-05 | 华智生物技术有限公司 | 水稻稻瘟病抗性基因Pita的SNP分子标记的开发和应用 |
| CN117947094B (zh) * | 2024-03-26 | 2024-06-04 | 云南农业大学 | Pi-Pprs42基因提高水稻稻瘟病抗性的方法及应用 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991015585A1 (en) * | 1990-04-02 | 1991-10-17 | Rijkslandbouwuniversiteit Wageningen | Method for the protection of plants against pathogens |
| FR2708614A1 (fr) * | 1993-07-29 | 1995-02-10 | Nat Inst Agrobiologica | Acides nucléiques marqueurs pour les gènes de résistance à la rouille du riz et gènes de résistance à la rouille du riz Pi-ta et Pi-ta2, isolés au moyen de ces marqueurs. |
| US5674993A (en) * | 1993-07-29 | 1997-10-07 | National Institute Agrobiological Resources, Ministry Of Agriculture Forestry And Fisheries | Nucleic acid markers for rice blast resistance genes and rice blast resistance genes isolated by the use of these markers |
| JPH11100398A (ja) * | 1997-03-27 | 1999-04-13 | Mitsui Gyosai Shokubutsu Bio Kenkyusho:Kk | 耐病性植物 |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995005731A1 (en) | 1993-08-24 | 1995-03-02 | Cornell Research Foundation, Inc. | Gene conferring disease resistance to plants |
| NZ277834A (en) | 1993-12-24 | 1998-03-25 | Innes John Centre Innov Ltd | Plant pathogen resistance genes, dna isolates, recombinant vectors, host cells, method of conferring pathogen resistance on a plant, method of identifying plant pathogen resistance gene |
| US5859351A (en) | 1994-04-13 | 1999-01-12 | The Regents Of The University Of California | Prf protein and nucleic acid sequences: compositions and methods for plant pathogen resistance |
| US5981730A (en) | 1994-04-13 | 1999-11-09 | The General Hospital Corporation | RPS gene family, primers, probes, and detection methods |
| US5571706A (en) | 1994-06-17 | 1996-11-05 | The United States Of America As Represented By The Secretary Of Agriculture | Plant virus resistance gene and methods |
| US5859339A (en) | 1995-01-17 | 1999-01-12 | The Reagents Of The University Of California | Nucleic acids, from oryza sativa, which encode leucine-rich repeat polypeptides and enhance xanthomonas resistance in plants |
-
1999
- 1999-06-21 US US09/336,946 patent/US6479731B1/en not_active Expired - Fee Related
- 1999-08-03 JP JP2000563786A patent/JP2002525033A/ja active Pending
- 1999-08-03 CN CN99811644A patent/CN1321191A/zh active Pending
- 1999-08-03 AU AU55475/99A patent/AU5547599A/en not_active Abandoned
- 1999-08-03 WO PCT/US1999/017706 patent/WO2000008162A1/en not_active Ceased
- 1999-08-03 ID IDW20010263D patent/ID28279A/id unknown
- 1999-08-04 UY UY25641A patent/UY25641A1/es not_active Application Discontinuation
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991015585A1 (en) * | 1990-04-02 | 1991-10-17 | Rijkslandbouwuniversiteit Wageningen | Method for the protection of plants against pathogens |
| FR2708614A1 (fr) * | 1993-07-29 | 1995-02-10 | Nat Inst Agrobiologica | Acides nucléiques marqueurs pour les gènes de résistance à la rouille du riz et gènes de résistance à la rouille du riz Pi-ta et Pi-ta2, isolés au moyen de ces marqueurs. |
| US5674993A (en) * | 1993-07-29 | 1997-10-07 | National Institute Agrobiological Resources, Ministry Of Agriculture Forestry And Fisheries | Nucleic acid markers for rice blast resistance genes and rice blast resistance genes isolated by the use of these markers |
| JPH11100398A (ja) * | 1997-03-27 | 1999-04-13 | Mitsui Gyosai Shokubutsu Bio Kenkyusho:Kk | 耐病性植物 |
Non-Patent Citations (21)
| Title |
|---|
| DATABASE BIOSIS BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; RYBKA, K., ET AL.: "High resolution mapping of the rice indica-derived rice blast resistance genes II. Pi-ta-2 and Pi-ta and a consideration of their origin", XP002127704 * |
| DATABASE WPI Section Ch Week 199925, Derwent World Patents Index; Class C06, AN 1999-296527, XP002127706 * |
| FARMAN ET AL: "Chromosome walking to the AVR1-CO39 avirulence gene of Magnaporthe grisea: discrepancy between the physical and genetic maps", GENETICS,US,HILL, NC, vol. 150, no. 3, pages 1049-1058-1058, XP002107757 * |
| LEISTER, D., ET AL.: "Hordeum vulgare NBS-LRR type resistance protein (b) mRNA, partial cds", EMBL ACCESSION NO:AF0326686, 20 January 1998 (1998-01-20), XP002127698 * |
| LEISTER, D., ET AL.: "Oryza sativa NBS-LRR type resistance protein (r1) gene partial cds", EMBL ACCESSION NO:AF032688, 20 January 1998 (1998-01-20), XP002127697 * |
| LEISTER, D., ET AL.: "Rapid reorganization of resistance gene homologues in cereal genomes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA., vol. 95, January 1998 (1998-01-01), NATIONAL ACADEMY OF SCIENCE. WASHINGTON., US, pages 370 - 375, XP002127699, ISSN: 0027-8424 * |
| LEISTER, D., ET AL.: "Rapid reorganization of resistance gene homologues in cereal genomes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA., vol. 95, no. 1, January 1998 (1998-01-01), NATIONAL ACADEMY OF SCIENCE. WASHINGTON., US, pages 370 - 375, XP002127699, ISSN: 0027-8424 * |
| MOLECULAR PLANT-MICROBE INTERACTIONS, vol. 10, no. 4, 1997, pages 517 - 524 * |
| NAKAMURA, S., ET AL.: "Construction of an 800-kb contig in the near-centromeric region of the rice blast resistance gene Pi-ta2 using a highly representative rice BAC library", MOLECULAR AND GENERAL GENETICS, vol. 254, 1997, pages 611 - 620, XP002127696 * |
| RONALD ET AL: "The molecular basis of disease resistance in rice", PLANT MOLECULAR BIOLOGY,NL,NIJHOFF PUBLISHERS, DORDRECHT, no. 35, pages 179-186, XP002079544, ISSN: 0167-4412 * |
| SASAKI, T., ET AL.: "Oryza sativa gene for Pib, complete cds", EMBL ACCESSION NO:AB013448, 17 March 1999 (1999-03-17), XP002127700 * |
| SASAKI. T., ET AL.: "Oryza sativa cDNA, partial sequence (C53024_1A)", EMBL SEQUENCE ACCESSION NO:AU063103, 19 May 1999 (1999-05-19), XP002127694 * |
| SMITH ET AL: "Mapping of a Magnaporthe grisea locus affecting rice (Oryza sativa) cultivar specificity", THEORETICAL AND APPLIED GENETICS,DE,SPRINGER, BERLIN, vol. 88, no. 88, pages 901-908-908, XP002107755, ISSN: 0040-5752 * |
| SWEIGARD J A ET AL: "Identification, cloning, and characterization of PWL2, a gene for host species specificity in the rice blast fungus", PLANT CELL,US,AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD, vol. 7, pages 1221-1233, XP002091581, ISSN: 1040-4651 * |
| VALENT, B., ET AL.: "Avirulence genes and mechanisms of genetic instability in the rice blast fungus", RICE BLAST DISEASE, R.S. ZIEGLER, S.A. LEONG, AND P.S. TENG, EDS, CAB INTERNATIONAL, 1994, pages 111 - 134 * |
| WANG, Z.-X., ET AL.: "The Pib gene for rice blast resistance belongs to the nucleotide binding and leucin-rich repeat class of plant resistance genes", PLANT JOURNAL, vol. 19, no. 1, July 1999 (1999-07-01), pages 55 - 64, XP002127701 * |
| YU, Y., ET AL.: "mgxb0013B21r CUGI rice blast BAC library Magnaporthe grisea genomic clone mgbx0013B21r, genomic survey sequence", EMBL ACCESSION NO:AQ162565, 9 September 1998 (1998-09-09), XP002127702 * |
| YU, Y., ET AL.: "nbxb0002bG06f CUGI rice BAC library Oryza sativa genomic clone nbxb0002M12f, genomic survey sequence", EMBL ACCESSION NO:AQ051536, 17 July 1998 (1998-07-17), XP002127691 * |
| YU, Y., ET AL.: "nbxb0064M07r CUGI rice BAC library Oryza sativa genomic clone nbxb006M07r, genomic survey sequence", EMBL ACCESSION NO:AQ365625, 4 February 1999 (1999-02-04), XP002127692 * |
| YU, Y., ET AL.: "nbxb0091A12r CUGI rice BAC library Oryza sativa genomic clone nbxb0091A12r, genomic survey sequence", EMBL SEQUENCE ACCESSION NO:AQ577556, 3 June 1999 (1999-06-03), XP002127695 * |
| YU,Y., ET AL.: "nbxb0066B06f CUGI rice BAClibrary Oryza sativa genomic clone nbxb0066B06f, genomic survey sequence", EMBL ACCESSION NO:AQ395844, 15 March 1999 (1999-03-15), XP002127693 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6743969B2 (en) | 2000-11-14 | 2004-06-01 | E. I. Du Pont De Nemours And Company | Modification of PI-TA gene conferring fungal disease resistance to plants |
| WO2013127379A1 (de) * | 2012-02-29 | 2013-09-06 | Kws Saat Ag | Pathogenresistente transgene pflanze |
Also Published As
| Publication number | Publication date |
|---|---|
| UY25641A1 (es) | 2000-02-23 |
| JP2002525033A (ja) | 2002-08-13 |
| CN1321191A (zh) | 2001-11-07 |
| US6479731B1 (en) | 2002-11-12 |
| ID28279A (id) | 2001-05-10 |
| AU5547599A (en) | 2000-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5648599A (en) | Gene conferring disease resistance to plants by responding to an avirulence gene in plant pathogens | |
| US7816506B2 (en) | Methods and constructs for producing transgenic plants and methods of recovering expressed proteins | |
| WO1993019181A1 (en) | Biological material | |
| US20030152975A1 (en) | Method of identifying non-host plant disease resistance genes | |
| US6479731B1 (en) | Pi-ta gene conferring fungal disease resistance to plants | |
| US20100293670A1 (en) | Maize Genes For Controlling Plant Growth And Organ Size And Their Use In Improving Crop Plants | |
| AU722863B2 (en) | Resistance against wilt inducing fungi | |
| US7932434B2 (en) | Late blight resistance gene from wild potato | |
| US6225527B1 (en) | Plant pathogen resistance genes and uses thereof | |
| CN102471779A (zh) | 使用二聚化结构域组分堆叠以调节植株构造 | |
| EP2467472A2 (en) | Functional expression of yeast nitrate transporter (ynt1) in maize to improve nitrate uptake | |
| AU744673B2 (en) | Gene associated with disease resistance in plants | |
| WO2002040636A2 (en) | Modification of a plant disease resistance gene specificity and method for engineering altered specificity | |
| AU2001270611B2 (en) | Elicitor from cladosporium | |
| WO2011022597A1 (en) | Functional expression of shuffled yeast nitrate transporter (ynti) in maize to improve nitrate uptake under low nitrate environment | |
| WO2000008189A2 (en) | Plant resistance gene | |
| EP1078086A2 (en) | Plant-derived resistance gene | |
| US7256323B1 (en) | RPSk-1 gene family, nucleotide sequences and uses thereof | |
| WO2004099417A1 (en) | Genetic sequences of plant pathogen avirulence genes and uses therefor | |
| AU2001270611A1 (en) | Elicitor from cladosporium | |
| MX2011004216A (es) | Gen at1g67330 novedoso en la eficiencia de captacion de nitrato alterada. | |
| CA2572305A1 (en) | Cell number polynucleotides and polypeptides and methods of use thereof | |
| MX2011001933A (es) | Mejoramiento de responsividad de nitrogeno en plantas. | |
| AU2004236279A1 (en) | Genetic sequences of plant pathogen avirulence genes and uses therefor | |
| AU2008203365A1 (en) | Modification of plant defense, disease/pest resistance and protein storage (2) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 99811644.0 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AU BA BB BG BR CA CN CR CU CZ EE GD GE HR HU ID IL IN IS JP KP KR LC LK LR LT LV MG MK MN MX NO NZ PL RO SG SI SK SL TR TT UA US UZ VN YU ZA |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: IN/PCT/2001/00062/MU Country of ref document: IN |
|
| 122 | Ep: pct application non-entry in european phase |