EP1078086A2 - Plant-derived resistance gene - Google Patents

Abstract

Disclosed are nucleic acids encoding polypeptides which are capable of conferring extreme resistance (ER) against, and being triggered by, plant pathogens such as viruses (e.g. PVX and related isolates). Preferred nucleic acids encode the Rx polynucleotide from Solanum tuberosum, or a variety of homologues (naturally occurring or derivatives) thereof, such as 111h1; 221h2; Ac15; Ac64; K39.hom. Particular methods of activating resistance by using combinations of resistance gene and elicitor are also disclosed, which in certain cases lead to a hypersensitive response. Further aspects of the invention include specific primers, vectors, host cells, polypeptides, antibodies and transgenic plants, plus methods of producing and employing these, in particular for influencing a resistance trait in a plant.

Description

PLANT-DERIVED RESISTANCE GENE

TECHNICAL FIELD

The present invention relates to the Rx resistance gene from potato. It further relates to methods and materials employing the gene, and processes for identifying or producing other related genes. It also relates generally to methods for identifying novel genes or markers within clusters of repetitive DNA sequences.

PRIOR ART

Rx is a resistance gene from potato conferring extreme resistance against potato virus X (PVX) . Rx genes in potato are widely used in breeding programmes to confer resistance against PVX because :

1) Rx is highly durable with only one natural isolate able to overcome the resistance.

2) The resistance is extreme resistance according to the classification of Cooper (Cooper and Jones, 1983) .

Extreme resistance (ER) means that there is no visible indication of a resistance response on Rx plants inoculated with PVX and accumulation of PVX is suppressed, even in the inoculated cells.

In contrast, other types of disease resistance (including the virus resistance conferred by the previously cloned N gene in tobacco) are associated with a hypersensitive response (HR) which causes necrosis at the site of inoculation. Activation of these other types of resistance mechanisms is normally delayed so that the virus accumulates in the inoculated cell at the same rate in cells of the resistant and the susceptible plants (see WO 95/31564

(Gatsby Charitable Foundation) for a general discussion of HR) .

A further difference between Rx-mediated resistance and HR type resistance is that the Rx-mediated resistance is active in protoplasts wherein it suppresses viral replication or promotes degradation of the viral RNA. In contrast HR resistance is not expressed in protoplasts but is thought to be a tissue-related phenomenon requiring cell-to-cell contact (Adams et al , 1986) .

The Rx-mediated resistance against PVX is thought to conform to an elicitor-receptor model. According to the model there are two phases in the Rx resistance mechanism: a recognition phase that is believed to be highly specific for potato virus X and a response phase that prevents accumulation of a broad spectrum of plant viruses, including those taxonomically unrelated to PVX (Kόhm et al . , 1993) . Published work has also demonstrated that the PVX coat protein (CP) is the elicitor of Rx-mediated resistance (Bendahmane et al . , 1995; Goulden et al . , 1993).

Although the activity of the Rx phenotype has been studied, little is known about the gene responsible for it.

Ritter et al (1991) disclosed that there are two Rx loci, Rxl and Rx2 (on chromosomes XII and V respectively) . These loci function independently of each other and have the same specificity for the PVX CP. It has been suggested that Rx may have been introgressed into potato cultivars from a wild Solanum accession (see also Arntzen et al (1994)) .

Bendahmane et al (1997) disclosed flanking AFLP markers on Chromosome XII (IPM3 and IPM4) in the vicinity of Rx which span an interval of 0.23 cM. However no accurate estimate was made of the physical distance that this represents, and hence of whether or not a positional cloning approach based on these markers was plausible.

Indeed such a map based approach may be expected to be complicated by the tetraploid nature of the potato genome and the chromosomal duplication referred to above.

Additionally, the fact that Rx lies within an introgressed chromosomal segment would also be expected to hinder map based cloning efforts because recombination is believed to be suppressed in such regions (see Liharska et al (1996)).

Notably, there are no published reports of genes which have been cloned from potato using map-based approaches despite the high resolution mapping of several loci in the potato genome (Ballvora et al . , 1995; Brigneti et al . , 1997; De Jong et al . , 1997; Meksem et al . , 1995). In fact, although there have been some isolated examples of map-based cloning from crop plants (Buschges et al . , 1997; Dixon et al . , 1996; Martin, 1993) most plant applications of this technique have been in the model plant Arabidopsis thaliana .

DISCLOSURE OF THE INVENTION The present inventors have applied a number of innovative strategies to identify a bacterial artificial chromosome (BAC) clone that spans Rx. This approach was successful despite the suppression of recombination and depletion of AFLP and RFLP markers in the vicinity of Rx, and also various other complications arising from repetitive sequences in the Rx region and the highly polymorphic nature of the potato genome .

Briefly, in order to clone the Rx locus in potato they prepared a BAC library from a tetraploid plant carrying Rx in the duplex condition (Rx, Rx, rx, rx) . BAC clones isolated from either side of Rx including some in which there was a high frequency of recombination (approximately 180 kb cM^"1) . However, the closest markers to Rx in the cloned DNA were separated by single recombination events on either side of Rx. To bridge the gap they exploited the finding that the BAC clones on the right side of Rx appeared to contain resistance gene homologues. Anticipating that there may be duplicated resistance gene homologues in the vicinity of Rx they used low stringency PCR conditions to identify additional markers.

One of these markers was completely linked to Rx in the mapping population and was used to isolate a further BAC

(BAC77) which could not be identified with known, existing, Rx-flanking markers.

Two criteria suggested that BAC77 spanned Rx. There was a chromosomal recombination in one plant of the mapping population that separated the BAC77 right end from Rx. On the other side of Rx it was found that the BAC77 left end was outside the region of DNA carrying Rx that had been introgressed into potato cv Amaryl from Solanu tuberosu ssp. andigena CPC1673. The fact that BAC77 did indeed span Rx was shown using novel, transient expression assays, and by transgenic expression in Nicotiana tabacum, Nicotiana benthamiana, Lycopersicon esculentum and potato.

This is the first example of a gene capable of conferring ER being isolated. The Rx gene has been sequenced and the expression product shown to share some motifs with other, known, resistance proteins, as well as having some distinctive sequence regions. The inventors have demonstrated that it can be used to introduce PVX resistance into plants, including L. esculentum, N. tajbacum, N. Jbei-fcainiana and potato.

Interestingly, it has been demonstrated that constitutive co-expression of the Rx gene and the PVX elicitor can actually cause an HR. A demonstration of this came from constitutive expression of the PVX CP elicitor, under the control of a 35S promoter, in Rx plants. Such constitutive expression leads to cell death - production of elicitor can not be arrested by the action of Rx mediated resistance before it reaches a critical level. In contrast, when the coat protein is produced as a product of the PVX genome the early activation of the Rx-mediated resistance is thought to suppress the virus so that the coat protein would not attain the critical level required for elicitation of the HR. Other results herein show that the Rx ER response is epistatic to the HR response, whereby the traits can be manipulated independently. The HR observations have also been exploited in an innovative assay for PVX elicitors or Rx variants .

Thus portions of the Rx sequence can be used to identify Rx homologues, some of which may be closely-linked to the Rx locus.

Further, the Rx gene (or modifications or homologues thereof) can be used to engineer resistance traits, preferably broad spectrum ER, into plants using a variety of innovative formats.

It has also been discovered by the present inventors that Rx can be activated by certain non-PVX viruses, particularly those comprising coat proteins sharing sequence homology with that of PVX. Examples within this group include (but are not limited to) Narcissus mosaic virus (NMV) ; Nandina virus X (NVX) ; Viola mosaic virus (VMV) ; Cymbidium mosaic virus (CyMV) ; Poplar mosaic virus (PopMV) and White clover mosaic virus (WClMV) . Rx can be used to offer specific protection against this group.

These and other aspects of the present invention will now be discussed in more detail .

According to a first aspect of the present invention there is provided a nucleic acid molecule encoding a polypeptide which is capable of conferring extreme resistance against a pathogen, such as a plant virus, in a plant into which said polypeptide is expressed.

As discussed above, extreme resistance, implies the absence of a visible HR in the presence of the host pathogen. Nucleic acid molecules according to the present invention may be provided in recombinant form or free or substantially free of nucleic acid or genes of the species of interest or origin other than the sequence encoding a polypeptide with the required function. The nucleic acid molecules (and their encoded polypeptide products) may also be (i) isolated and/or purified from their natural environment (although not necessarily in pure form per se) , or (ii) in substantially pure or homogeneous form.

Nucleic acid according to the present invention may include cDNA, RNA, genomic DNA and may be wholly or partially synthetic ('constructs'). Where a DNA sequence is specified, e.g. with reference to a figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed.

Also encompassed is the complement of the various disclosed sequences, which may be used in probing experiments, or in down-regulation of the sequence.

A particular aspect of the invention is nucleic acid having the sequence all or part of the sequence shown in Annex 1 (Seq ID No 1) including (where appropriate) both coding and/or non-coding regions.

This sequence was taken from the BAC subclone which conferred Rx mediated resistance in the Examples below.

Within Seq ID No 1 there is apparently a large open reading frame (ORF) . Subsequent comparison of the genomic DNA sequence with the sequence of cDNAs revealed that the gene contains three exons and two introns in the 3 ' end (234 bp and 111 bp) . The introns are marked as shown in Annex 1. The final exon contains only two nucleotides of coding sequence plus the TAG stop codon and the 3 ' non-coding region of mRNA.

The putative Rx polypeptide sequence is shown in Fig 1 - designated Seq ID No 2) . Rx appears to contain 937 residues and have a molecular weight of 107.5 kD.

Particular nucleic acids of this aspect of the invention include those encoding the Rx protein product and cDNA, believed to be base 2249-5404 excluding the introns marked as shown (4945-5178 and 5290-5400 inclusive) . The Rx-coding (cDNA) nucleic acid sequence is designated Seq ID No 3. This is shown as Annex II.

Surprisingly the primary structure of Rx is similar to that of the NBS-LRR (Jones and Jones, 1997) class of R proteins, in which the resistance is associated with an HR. The highest degree of similarity is between Rx and a subclass of NBS-LRR resistance proteins represented by Rps2 , Rpml and Prf (Jones and Jones, 1997) . These Arabidopsis and tomato proteins contain a putative four to six heptad amphipathic leucine zipper (LZ) motif at the N-terminus (Jones and

Jones, 1997) . A putative leucine zipper is also present in the N-terminal region of Rx. However this does not fit the leucine zipper consensus was well as the corresponding motif in Rps2 (Mindrinos et al , 1994) .

Comparisons are shown in Fig 2. As in the other R gene products, the putative NBS domain (domain 11; Figure 1) of Rx comprises three motifs: kinase 1A or ' P-loop' (residues 168-180) , kinase 2 (residues 237-247) , and kinase 3a (residues 265-273) . In Rx, the putative NBS is followed by a domain with unknown function that includes GLPL, CFLY and the MHD motifs. These motifs are characteristic of all NBS- LRR R gene products thus far identified (Hammond-Kosack and Jones, 1997; van der Biezen and Jones, 1998) . The putative LRR domain of Rx (residues 473-868) comprises 14-16 imperfect copies of the LRR motif. This motif shows a good match to the cytoplasmic LRR consensus sequence motif (Jones and Jones, 1997) and most closely resembles the LRR domain of the tomato Prf protein (Salmeron et al . , 1996) .

The C-terminal part of Rx contains three unique motifs with unknown functions: an amide-rich region (residues 869-893), a short basic region (residues 894-902) and an 'acidic tail¹ region (residues 903-937) . The acidic tail is encoded entirely within the short second exon of Rx. This domain is rich in aspartic and glutamic acid residues and contains two copies of 10 amino acid residues in direct repeat. These features are not present in any previously described products of R genes.

Generally speaking, the sequence conservation between the Rx and other disease resistance genes cloned in other systems was found to be very low and was mostly in the NBS domain in the N terminal part of Rx. Referring to Fig 2, the sequence identity between Rx and PRF, RPS2 , RPM1 and I2C-1 was found to be 23.1, 15.2 ,15.3 and 17.8% respectively. In contrast, within the Rx class of disease resistance genes of the present invention (see Examples below) the conservation was very high. For instance the sequence identity shared by Rx and lllhl, 222h2, Acl5, Ac64 and k39.hom is 93, 84.9, 97.3, 97.3 and 92.1% respectively. This demonstrated similarity within the group allows the cloning of yet further Rx-type resistance genes using the sequences disclosed herein, either directly, or to design degenerate primers .

Thus in a further aspect of the invention there are disclosed active, homologous, variants of the Rx sequences provided, which may for instance be mutants or other derivatives, or naturally occurring

Rx homologues such as allelic variants, paralogues (from the same species, but at a different location e.g. pseudoalleles at linked loci) , or orthologues (related genes from different species) . Examples of these are shown below.

In each case the variant encodes a product which is homologous (similar) to Rx, which may be isolated or produced on the basis of that sequence, and is capable of conferring pathogen resistance against one or more pathogens .

Resistance gene activity can be tested by conventional methods known in the art, as appropriate to the nature of the resistance being investigated. Example methods can be found in the following publications: bacterial (Grant et al , 1995); fungal (Dixon et al , 1996; Jones, 1994; Thomas et al, 1997) ; nematode and viral (Whitham et al , 1994) .

Typically, activity is tested by complementation of trait in a plant. This can be achieved by coupling the putative active variant to a promoter and terminator for expression in plants and transforming it into a 'susceptible' plant that lacks a given resistance trait. The activity of the Rx variant is then confirmed by challenge with the appropriate pathogen.

Alternatively a transient expression assay can be used to test for activation of the Rx variant analogous to the assay described in the Examples below or that used by Mindrinos et al (1994) . Briefly, the putative active Rx variant is co- expressed from a plasmid with a pathogen-derived gene which is an elicitor of the resistance specified by the putative Rx homologue (in the case of Rx this can be PVX-CP) and a reporter gene (e.g. GUS or CP) . If the variant is activated by the continuous expression of the pathogen derived gene, then an HR would result and the reporter gene activity would be abolished. If no activity was initiated, then the reporter gene would be detectable.

Similarity or homology between the variant and Rx may be as defined and determined by the TBLASTN program, of Altschul et al . (1990) J. Mol . Biol . 215: 403-10, which is in standard use in the art, or, and this may be preferred, the standard program BestFit, which is part of the Wisconsin Package, Version 8, September 1994, (Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA, Wisconsin 53711) . Comparisons herein have used DNASTAR software using the CLUSTAL method with PAM250 residue weight table (gap penalty 10, gap length 10) .

Homology (or similarity, or identity) may be at the nucleotide sequence and/or the expressed amino acid sequence level. Preferably, the nucleic acid and/or amino acid sequence shares homology with the coding sequence or the sequence encoded by the nucleotide sequence of Annex I or other sequences set out herein, preferably at least about 50%, or 60%, or 70%, or 80% homology, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% homology.

Homology may be over the full-length of the relevant sequence shown herein, or may more preferably be over a contiguous sequence of about or greater than about e.g. 20, 100, 200, 300, 500, 600 or more amino acids or codons, compared with the relevant amino acid sequence or nucleotide sequence as the case may be .

There are believed to be more than 20 homologues of Rx in the potato genome. It is likely that one or more of these homologues are R genes against viruses, fungi, bacteria or nematodes .

Naturally occurring Rx variants may be isolated, in the light of the present disclosure, without burden from any suitable source (e.g. genomic or cDNA) . The putative resistance genes can be obtained using materials (e.g. primers or probes) based on regions peculiar to Rx, for instance designated Rx gene signature' in Fig 1. It should be noted that previously identified sequence motifs that characterise resistance genes (see e.g. Kanazin et al . , 1996; Leister et al . , 1996; Leister et al . , 1998) are not useful for identification of these Rx variants because they do not discriminate between the Rx variants and homologues of other resistance gene homologues in the genome.

Thus a further aspect of the present invention provides a method of identifying and/or cloning homologous Rx variants from a plant, which method employs all or part of a nucleotide sequences as described above.

Thus in one embodiment, nucleotide sequence information provided herein may be used in a data-base (e.g. of ESTs, or STSs, or other genomic sequence information) search to find homologous sequences, expression products of which can be tested for pathogen resistance activity e.g. using methods based on the transient assays of the present invention, or conventional phenotype assays in transgenic plants.

Alternatively, probes based on the sequence may be used e.g. in southern blotting. For instance DNA may be extracted from cells taken from plants displaying the appropriate resistance trait and digested with different restriction enzymes. Restriction fragments may then be separated (e.g. by electrophoresis on an agarose gel) before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined.

Preliminary experiments may be performed by hybridising under low stringency conditions. For probing, preferred conditions are those which are stringent enough for there to be a simple pattern with a small number of hybridisations identified as positive which can be investigated further.

For example, hybridizations may be performed, according to the method of Sambrook et al . (below) using a hybridization solution comprising: 5X SSC (wherein ^Λ SSC = 0.15 M sodium chloride; 0.15 M sodium citrate; pH 7), 5X Denhardt's reagent, 0.5-1.0% SDS, 100 μg/ml denatured, fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50% formamide. Hybridization is carried out at 37-42°C for at least six hours. Following hybridization, filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1% SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1% SDS; (3) 30 minutes - 1 hour at 37°C in IX SSC and 1% SDS; (4) 2 hours at 42-65°C in IX SSC and 1% SDS, changing the solution every 30 minutes.

One common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is (Sambrook et al. , 1989) : T_ra = 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex

As an illustration of the above formula, using [Na+] = [0.368] and 50-% formamide, with GC content of 42% and an average probe size of 200 bases, the T_ra is 57°C. The T_m of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C. Such a sequence would be considered substantially homologous to the nucleic acid sequence of the present invention.

It is well known in the art to increase stringency of hybridisation gradually until only a few positive clones remain. Other suitable conditions include, e.g. for detection of sequences that are about 80-90% identical, hybridization overnight at 42°C in 0.25M Na₂HP0₄, pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 55°C in 0.1X SSC, 0.1% SDS. For detection of sequences that are greater than about 90% identical, suitable conditions include hybridization overnight at 65°C in 0.25M Na₂HP0₄, pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 60°C in 0.1X SSC, 0.1% SDS.

Binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art. For instance, probes may be radioactively, fluorescently or enzymatically labelled. Other methods not employing labelling of probe include amplification using PCR (including, where appropriate, RACE PCR), RN'ase protection and allele specific oligonucleotide probing.

The identification of successful hybridisation is followed by isolation of the nucleic acid which has hybridised, which may involve one or more steps of PCR or amplification by cloning in a vector that replicates in a suitable host.

In each case, if need be clones (e.g. lambda, cosmid, plasmid, BACs, biBACS) or fragments identified in the search can be extended or supplemented. For instance if it is suspected that they are incomplete, the original DNA source (e.g. a clone library, mRNA preparation etc.) can be revisited to isolate missing portions e.g. using sequences, probes or primers based on that portion which has already been obtained to identify other clones containing overlapping sequence (see e.g. "Principles of Genome Analysis" by S B Primrose (1995) Pub. Blackwell Science Ltd, Oxford, UK) . The genes are then tested for functionality as described above. Thus one scheme for isolating Rx homologues is as follows :

I) produce a population in which a resistance trait is segregating.

II) PCR amplify DNA from individual members of the population with primers based on the sequence of Rx (but not from the R gene conserved motifs) .

III) test the PCR products (either by direct sequence analysis or restriction enzyme digestion) for sequence polymorphism that cosegregates with the R trait. Identify an appropriate polymorphic marker sequence.

IV) Isolate the complete coding sequence of the polymorphic gene. This could be done from an appropriate cloned library or by amplifying it using primers from the 5 ' and 3 ' extremes of Rx. In each case the identified polymorphic PCR product, or sequence information provided by it, is used to identify the gene.

Resistance gene coding activity is then tested as described above. A variation on this procedure would employ bulked segregants in an intermediate stage, as described previously (Michelmore et al . , 1991).

A more specific approach is based on the understanding that homologous Rx-genes may be linked in clusters. Clustering of R-genes in potato has already been reported (Leister et al . 1996; De Jong et al . 1997) . One of the large R-gene clusters is on the short arm of potato chromosome 5. This cluster comprises of at least four R loci : Rl conferring resistance to Phytophthora infestans, Nb conferring HR type resistance to potato virus X (PVX) and Gpa and Grpl conferring resistance to the potato cyst nematode.

It is now clear that a number of the genes and DΝA sequences linked to Rx represent Rx-homologues . It is likely that one or more of these homologues are R genes against viruses, fungi, bacteria or nematodes . For instance, Gpa2 (which bestows a specific resistance response to a small set of populations of the potato cyst nematode Globodera pallida) is believed to be tightly linked to the Rx locus on chromosome 12.

As set out in the Examples below, a functional homologue has been isolated from Solanum acuale, using primers based on the sequence of the cloned Rx.

The S. acaule Rx-homologue is likely to be on chromosome V linked to Rx2 and, using the agrobacterium infiltration assay, has been shown to function as a resistance gene against PVX. This result shows that the sequence of Rx can be used to isolate other resistance genes without reference to the conserved motifs that have been used previously to define resistance gene homologues (Leister et al . , 1996).

Other, linked, Rx variants (providing different R traits) may be isolated essentially as set out above, but wherein the DΝA used for the initial amplification step is taken from members of the population in which the required R trait co-segregates with Rx itself (or a previously identified Rx variant) .

It has been noted by the present inventors that the sequence of Rx is similar to the sequence of the otherwise unrelated Rps2 that confers resistance in Arabidopsis against a bacterial pathogen. In the light of this information it appears that the sequence of Rx could be modified e.g. by site-directed or random mutation, to produce Rx mutants or other derivatives which can confer resistance against (i.e. is switched on by) pathogens that are quite different from PVX. This can be achieved as described below, with Rx mutants being tested with the transient expression assay methods described above .

Preferably the nucleic acid molecule which is the mutant or other derivative is generated either directly or indirectly (e.g. via one or amplification or replication steps) from an original nucleic acid corresponding to all or part of the sequence shown in Seq ID No 1 or other sequences disclosed herein.

Thus a further aspect of the present invention is a method of producing a nucleic acid encoding an Rx derivative comprising the step of modifying a nucleic acid encoding Rx.

The derivative may include changes to the nucleic acid which make no difference to the encoded amino acid sequence (i.e. 'degeneratively equivalent') .

Changes to a sequence, to produce a mutant or derivative, may be by one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more amino acids in the encoded polypeptide.

In addition to one or more changes within the Rx sequence, a variant nucleic acid may encode an amino acid sequence including additional amino acids at the C-terminus and/or N- terminus .

Specifically included are parts or fragments (however produced) corresponding to portions of the sequences provided, and which encode polypeptides having biological activity - for instance pathogen resistance or the ability to raise Rx-binding antibodies .

Generally speaking, changes may be desirable for a number of reasons, including introducing or removing the following features: restriction endonuclease sequences; codon usage; other sites which are required for post translation modification; cleavage sites in the encoded polypeptide; motifs in the encoded polypeptide for glycosylation, lipoylation etc. Leader or other targeting sequences may be added to the expressed protein to determine its location following expression. All of these may assist in efficiently cloning and expressing an active polypeptide in recombinant form (as described below) .

Other desirable mutation may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide.

As is well-understood, homology at the amino acid level is determined in terms of amino acid similarity or identity. Similarity allows for conservative variation, i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine . As is well known to those skilled in the art, altering the primary structure of a polypeptide by a conservative substitution may not significantly alter the activity of that peptide because the side-chain of the amino acid which is inserted into the sequence may be able to form similar bonds and contacts as the side chain of the amino acid which has been substituted out. This is so even when the substitution is in a region which is critical in determining the peptides conformation.

Also included are homologues having non-conservative substitutions. As is well known to those skilled in the art, substitutions to regions of a peptide which are not critical in determining its conformation may not greatly affect its activity because they do not greatly alter the peptide ' s three dimensional structure. In regions which are critical in determining the peptides conformation or activity such changes may alter the properties of the polypeptide. Indeed, changes such as those described above may confer slightly advantageous properties on the peptide e.g. altered stability or specificity, in particular broader specificity. Mutants having these properties can then be selected as described above .

Other methods may include mixing or incorporating sequences from related resistance genes into the Rx sequence. For example restriction enzyme fragments of Rx could be ligated together with fragments of an Rx homologue or even of an unrelated gene to generate recombinant versions of Rx. An alternative strategy for modifying Rx would employ PCR as described above (Ho et al . , 1989) or DNA shuffling (Crameri et al. , 1998) .

Thus the methods of the invention, described above, may include hybridisation of one or more (e.g. two) probes or primers based on the Rx sequence either to screen for Rx homologues or to produce Rx derivatives. Such probes or primers form a further part of the present invention.

An oligonucleotide for use in probing or PCR may be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24) . Generally specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers of 16-24 nucleotides in length may be preferred. Those skilled in the art are well versed in the design of primers for use processes such as PCR. If required, probing can be done with entire restriction fragments of the gene disclosed herein which may be 100' s or even 1000 's of nucleotides in length.

In one aspect of the present invention, the nucleic acid described above is in the form of a recombinant and preferably replicable vector.

"Vector" is defined to include, inter alia, any plasmid, cosmid, phage or Agrojbacteriu_τι binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication) .

Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eucaryotic (e.g. higher plant, mammalian, yeast or fungal cells) .

A vector including nucleic acid according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome .

Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. bacterial, or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.

By "promoter" is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA) . "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.

Thus this aspect of the invention provides a gene construct, preferably a replicable vector, comprising a promoter operatively linked to a nucleotide sequence provided by the present invention, such as the Rx gene, or a variant (e.g mutant, derivative or allele) thereof.

Generally speaking, those skilled in the art are well able to construct vectors and design protocols for recombinant gene expression. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual : 2nd edition, Sambrook et al , 1989, Cold Spring Harbor Laboratory Press .

Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis (see above), sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992. The disclosures of

Sambrook et al . and Ausubel et al . are incorporated herein by reference . In one embodiment of this aspect of the present invention provides a gene construct, preferably a replicable vector, comprising an inducible promoter operatively linked to a nucleotide sequence provided by the present invention.

The term "inducible" as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on" or increased in response to an applied stimulus. The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus. The preferable situation is where the level of expression increases upon application of the relevant stimulus by an amount effective to alter a phenotypic characteristic. Thus an inducible (or "switchable" ) promoter may be used which causes a basic level of expression in the absence of the stimulus which level is too low to bring about a desired phenotype (and may in fact be zero) . Upon application of the stimulus, expression is increased (or switched on) to a level which brings about the desired phenotype .

Particularly of interest in the present context are plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Bevan (Nucl . Acids Res. 12, 8711-8721 (1984)) and Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148) .

Since the natural in vivo activation of Rx is believed to be post-transcriptional , it may be preferred that a constitutive promoter is used.

Suitable promoters which operate in plants include the Cauliflower Mosaic Virus 35S (CaMV 35S) gene promoter that is expressed at a high level in virtually all plant tissues (Benfey et al, 1990a and 1990b); the cauliflower meri 5 promoter that is expressed in the vegetative apical meristem as well as several well localised positions in the plant body, e.g. inner phloem, flower primordia, branching points in root and shoot (Medford, 1992; Medford et al , 1991) and the Arabidopsis thaliana LEAFY promoter that is expressed very early in flower development (Weigel et al , 1992) . Other promoters include the rice actin promoter.

Alternatively an inducible promoter may be used. For instance the GST-II -27 gene promoter, which has been shown to be induced by certain chemical compounds which can be applied to growing plants. The promoter is functional in both monocotyledons and dicotyledons. It can therefore be used to control gene expression in a variety of genetically modified plants, including field crops such as canola, sunflower, tobacco, sugarbeet, cotton; cereals such as wheat, barley, rice, maize, sorghum; fruit such as tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, and melons; and vegetables such as carrot, lettuce, cabbage and onion. The GST-II-27 promoter is also suitable for use in a variety of tissues, including roots, leaves, stems and reproductive tissues. Other promoters include the patatin promoter (tubers) , ubiquitin promoter (wheat embryos) .

The promoter may include one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression.

Thus the vectors of the present invention may include the Rx gene or a variant thereof, in addition to various sequences required to give them replicative, integrative and/or expression functionality. Such vectors can be used, for instance, to make plants into which they are introduced resistant to PVX or other viruses.

If it is desired to induce broader-spectrum resistance, various further options are available in the light of the present disclosure:

(a) Modify the Rx sequence, to produce mutants or other derivatives as discussed above, such that its effect can be initiated by elicitors or pathogens other than PVX alone or the other natural elicitors discussed herein.

(b) Co-express Rx directly with an appropriate elicitor

(e.g. PVX CP from an avirulent strain) . This approach has already been demonstrated by the inventors in the course of the isolation of the gene (to demonstrate complementation of the Rx trait) . It was noted, however, that in certain cases in which both genes are constitutively co-expressed, an HR was produced within 48 hours. Thus if it desired to avoid a widespread HR, one of the following approaches may be preferred:

(c) Co-express Rx and an elicitor gene, the transcription or translation of which is suppressed by the activation of Rx. This would recouple Rx to its elicitor, and better mimic the natural response to PVX infection which results in broad specificity silencing. This could be achieved, for instance, by expressing the PVX CP within an amplicon construct such as that described in Angell & Ballcombe (1997) The EMBO Journal 16,12:3675-3684. In this embodiment the suppression of the PVX/CP accumulation may preempt the HR.

(d) Co-express Rx with an elicitor gene, the translation of which is only switched on in the presence of pathogen (s) .

This could be achieved, for instance, by co-expressing Rx with a post-transcriptionally silenced elicitor (e.g. PVX CP) which will be unsilenced, possibly locally, in the presence of pathogen. In the absence of pathogen there would be no activation of the Rx mechanism. In the presence of pathogens which suppress gene silencing (which may, for instance be PVY or related viruses - see Pruss et al . , 1997) the PVX CP would be unsilenced in the region infiltrated by PVY, and the HR would be limited to that region.

(e) Co-express Rx with an elicitor gene, whereby one or both are inactivated, and reactivate the gene(s) in a variegated manner, such that the HR is limited only to certain sectors of the plant (e.g. somatically defined sectors) but whereas the defensive response extends beyond these sectors. This could be achieved, for instance, by analogy with the methods disclosed in WO 95/31564 (GATSBY CHARITABLE FOUNDATION) , wherein, following a backcross between a plant carrying a transposon tagged resistance gene (in that case cf-9) plus intact elicitor (Avr-9) and a plant carrying an activator transposase, the progeny exhibited a somatic reactivation of the cf-9, leading to a localised necrotic response but widespread resistance.

In addition to the vectors and constructs above, the present invention also provides methods comprising introduction of the Rx constructs discussed above (such as vectors) into a host cell and/or induction of expression of a construct within a plant cell, by application of a suitable stimulus, an effective exogenous inducer.

The vectors described above may be introduced into hosts by any appropriate method e.g. conjugation, mobilisation, transformation, transfection, transduction or electroporation, as described in further detail below.

In a further aspect of the invention, there is disclosed a host cell containing nucleic acid or a vector according to the present invention, especially a plant or a microbial cell.

Thus DNA can be transformed into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transfer ability (EP-A-270355, EP-A-0116718 , NAR 12(22) 8711 - 87215 1984) , particle or microprojectile bombardment (US 5100792, EP-A-444882, EP-A-434616) microinjection (WO

92/09696, WO 94/00583, EP 331083, EP 175966, Green et al . (1987) Plant Tissue and Cell Cul ture, Academic Press) , electroporation (EP 290395, WO 8706614 Gelvin Debeyser) other forms of direct DNA uptake (DE 4005152, WO 9012096, US 4684611), liposome mediated DNA uptake (e.g. Freeman et al . Plant Cell Physiol . 29: 1353 (1984)), or the vortexing method (e.g. Kindle, PNAS U. S.A . 87: 1228 (1990d) Physical methods for the transformation of plant cells are reviewed in Oard, 1991, Biotech . Adv. 9: 1-11.

Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama, et al . (1988) Bio/Technology 6, 1072-1074; Zhang, et al . (1988) Plant Cell Rep . 1 , 379-384; Zhang, et al . (1988) Theor Appl Genet 76, 835-840; Shimamoto, et al . (1989) Nature 338, 274- 276; Datta, et al . (1990) Bio/Technology 8, 736-740; Christou, et al . (1991) Bio/Technology 9 , 957-962; Peng, et al . (1991) International Rice Research Institute, Manila, Philippines 563-574; Cao, et al . (1992) Plant Cell Rep . 11, 585-591; Li, et al . (1993) Plant Cell Rep . 12, 250-255; Rathore, et al . (1993) Plant Molecular Biology 21, 871-884; Fromm, et al . (1990) Bio/Technology 8, 833-839; Gordon-Kamm, et al. (1990) Plant Cell 2, 603-618; D'Halluin, et al . (1992) Plant Cell 4, 1495-1505; Walters, et al . (1992) Plant Molecular Biology 18, 189-200; Koziel, et al . (1993) Biotechnology 11, 194-200; Vasil, I. K. (1994) Plant Molecular Biology 25, 925-937; Weeks, et al . (1993) Plant Physiology 102, 1077-1084; Somers, et al . (1992) Bio /Technology 10, 1589-1594; W092/14828) . In particular, Agrobacterium mediated transformation is now emerging also as an highly efficient alternative transformation method in monocots (Hiei et al . (1994) The Plant Journal 6, 271-282) .

Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, eg bombardment with Agrobacterium coated microparticles (EP-A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233) .

The particular choice of a transformation technology will be determined by its efficiency to transform certain plant species as well as the experience and preference of the person practising the invention with a particular methodology of choice. It will be apparent to the skilled person that the particular choice of a transformation system to introduce nucleic acid into plant cells is not essential to or a limitation of the invention, nor is the choice of technique for plant regeneration.

If desired, selectable genetic markers may be used consisting of chimaeric genes that confer selectable phenotypes such as resistance to antibiotics such as kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate .

Thus a further aspect of the present invention provides a method of transforming a plant cell involving introduction of a vector comprising a nucleic acid of the present invention (e.g. Rx or Rx variant) into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce the sequence of nucleotides into the genome .

The invention further encompasses a host cell transformed with nucleic acid or a vector according to the present invention, especially a plant or a microbial cell. In the transgenic plant cell (i.e. transgenic for the nucleic acid in question) the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome .

The term "heterologous" is used broadly in this aspect to indicate that the gene/sequence of nucleotides in question have been introduced into said cells of the plant or an ancestor thereof, using genetic engineering, i.e. by human intervention. A heterologous gene may be additional to a corresponding endogenous gene. Nucleic acid heterologous, or exogenous or foreign, to a plant cell may be non-naturally occurring in cells of that type, variety or species. Thus the heterologous nucleic acid may comprise a coding sequence of or derived from a particular type of plant cell or species or variety of plant, placed within the context of a plant cell of a different type or species or variety of plant .

Following transformation, a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewed in Vasil et al . , Cell Culture and Somatic Cell Genetics of Plants, Vol I, II and III, Laboratory Procedures and Their Applications, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989.

The generation of fertile transgenic plants has been achieved in the cereals rice, maize, wheat, oat, and barley (reviewed in Shimamoto, K. (1994) Current Opinion in Biotechnology 5 , 158-162.; Vasil, et al . (1992) Bio/Technology 10, 667-674; Vain et al . , 1995, Biotechnology Advances 13 (4): 653-671; Vasil, 1996, Nature Biotechnology 14 page 702) .

Plants which include a plant cell according to the invention are also provided, along with any part or propagule thereof, seed, selfed or hybrid progeny and descendants. A plant according to the present invention may be one which does not breed true in one or more properties. Plant varieties may be excluded, particularly registrable plant varieties according to Plant Breeders' Rights. It is noted that a plant need not be considered a "plant variety" simply because it contains stably within its genome a transgene, introduced into a cell of the plant or an ancestor thereof.

In addition to the regenerated plant, the present invention embraces all of the following: a clone of such a plant, seed, selfed or hybrid progeny and descendants (e.g. FI and F2 descendants) and any part of any of these, such as cuttings, seed. The invention also provides a plant propagule from such a plant, that is any part which may be used in reproduction or propagation, sexual or asexual, including cuttings, seed and so on. As an alternative to the molecular-biology based methods of introducing Rx (or variants thereof) into plants, the sequences disclosed herein may be used to facilitate selection of plants into which it is desired to introduce the resistance trait using conventional plant breeding methods. Progeny from crosses which carry the gene may be readily identified by screening on the basis of the Rx sequence, particularly the Rx signature sequence.

The methods disclosed herein for identifying proximal markers to the Rx locus may be generally applicable to other genes found in clusters (e.g. plant derived resistance genes) . Such methods are characterised in that they employ a step using low stringency PCR with non-degenerate primers which avoid conserved sequence motifs. The general approach may be summarised as follows :

(a) Prepare a population in which the gene of interest is segregating,

(b) Identify resistance gene homologue (s) linked to the locus of interest on the basis of highly conserved (resistance gene) motifs and highly degenerate primers (Leister et al . , 1996), (c) Identify further markers corresponding to homologous genes, which are within the (resistance) locus and that are closer to the gene, using low stringency PCR with non- degenerate primers which avoid conserved sequence motifs, (d) Use said further markers to identify a clone carrying the (resistance) gene of interest genomic library from a resistant plant, optionally in conjunction with transient assays for activity (Mindrinos et al (1994) or as described above) ,

(e) Optionally, confirm the identity of the cloned gene on the basis of phenotype in transgenic plants.

The present invention also encompasses the expression product of any of the Rx or variant nucleic acid sequences disclosed above, and methods of making the expression product by expression from encoding nucleic acid therefor under suitable conditions, which may be in suitable host cells.

Antibodies may be raised to a purified Rx/variant polypeptide or peptide by any method known in the art (for an overview see e.g. "Immunology - 5th Edition" by Roitt, Brostoff, Male: Pub 1998 - Mosby Press, London).

Such antibodies, or fragments or derivatives thereof, can be used to bind Rx, or in the identification and/or isolation of proteins homologous to Rx (i.e. which share epitopes therewith) , which in turn can provide the basis of an alternative method to those described above to isolate their encoding genes .

The invention further provides a method of influencing or affecting a resistance trait (preferably ER trait) in a plant, whereby the method includes the step of causing or allowing expression of a heterologous nucleic acid sequence as discussed above (e.g. Rx or Rx variant, in each case plus an optional elicitor) within cells of the plant.

As an alternative, it may be desirable to down-regulate Rx activity. This may be achieved, for instance used antisense technology (which is reviewed in Bourque, (1995) , Plant Science 105, 125-149, and Flavell, (1994) PNAS USA 91, 3490-3496) . An alternative to anti-sense is to use a copy of all or part of the target gene inserted in sense, that is the same,_orientation as the target gene, to achieve reduction in expression of the target gene by co- suppression. See, for example, van der Krol et al . , (1990) The Plant Cell 2, 291-299; Napoli et al . , (1990) The Plant Cell 2 , 279-289; Zhang et al . , (1992) The Plant Cell 4, 1575-1588, and US-A-5 , 231 , 020.

Preferably, though, the invention provides a method which includes expressing Seq ID No 3 or a variant thereof within the cells of a plant (thereby producing the encoded polypeptide) , following an earlier step of introduction of the nucleic acid into a cell of the plant or an ancestor thereof

Generally such a method may be used to introduce viral resistance into the plant whereby an Rx-mediated resistance (ER or HR) is triggered by contact with an appropriate viral elicitor or other initiator or inducer. Certain methodologies are set out in the Examples below. Broadly speaking the elicitor or other trigger may be encoded directly by the invading virus (such as the coat proteins of PVX or certain other Potex- and Carlaviruses) . Alternatively it may be expressed by a separate construct or transgene which is itself triggered or upregulated by the viral infection. Additionally, in both of these cases, modification of the Rx (variant) sequence may allow triggering by a non-natural elicitor, if this is preferred. The formats described above, to assess Rx or Rx-derivative function with respect to a putative or known elicitor, themselves form a further aspect of the present invention. In particular the methods, for establishing gene for gene compatibility between elicitor and resistance gene, are characterised in that they include the steps of:

(a) causing or permitting the co-expression in cell of Rx or an Rx derivative with the elicitor,

(b) observing said cell for an HR, (c) correlating the result of the observation made in (b) with the specificity of the Rx or the Rx derivative for the elicitor.

Preferably the expression of the elicitor is decoupled from that of the Rx e.g. by use of a strong, constitutive promoter .

SEQUENCE ANNEXES

Annex I: shows the sequence derived from BAC77 (designated Seq ID No 1) and containing the Rx gene. Putative initiation codon (ATG) of Rx gene is given in bold and underlined. Two introns in the 3 ' -end of the Rx gene are underlined.

Annex II: shows a partial nucleotide sequence of the Rx cDNA including the Rx-coding nucleic acid sequence (designated Seq ID No 3) .

FIGURES

Fig 1: shows the putative Rx polypeptide sequence (designated Seq ID No 2) . Regions corresponding to characterised domains are given in bold and underlined. Conserved aliphatic residues (L, V, I, F, M) in the LRR region are underlined. Two duplicated acidic fragments in the C-terminus of Rx are indicated by arrows.

Fig 2 : shows a sequence alignment between Rx and products of four R genes encoding proteins containing putative leucine zipper/nucleotide binding site/leucine-rich (LZ-NBS-LRR) repeat motifs. The protein sequences aligned with DNASTAR software using the CLUSTAL method with PAM250 residue weight table. Highly conserved residues are indicated by black boxes. Dashes designate gaps introduced to improve the alignments. Abbreviations: Rx - Rx protein of the present invention; PRF fragment - C-terminal fragment (residues 841 - the end) of the Lycopersicon esculentum Prf protein (SPTREMBL accession Q96485) ; RPS2 - Arabidopsis thaliana Rps2 protein (PIR accession A54809) ; RPM1 - A. thaliana Rpml protein (PIR accession A57072) ; I2C-1 - L. esculentum resistance complex I2C-1 protein (SPTREMBL accession 024015; Ori et al (1997) Plant Cell, 9: 521-532.).

Fig 3 : High resolution map of the Rx locus based on the Experiments disclosed herein (not drawn to scale) .

The top panel shows a simplified genetic map of potato chromosome XII (denoted by a horizontal line) in which the area left of the arrow is reversed in the potato and tomato genetic maps (Tanksley et al . , 1992). Vertical lines indicate positions of previously mapped RFLP markers

(Bendahmane et al . , 1997; Tanksley et al . , 1992). The filled rectangle denotes a genetic interval between markers GP34 and 218L, which is magnified in the panels below.

The middle panel shows the genetic map of the GP34—218L interval (denoted by a horizontal line) . Positions of the RFLP marker GP34 and the AFLP markers IPM3, IPM4-a and IPM5 are indicated by vertical lines. The positions of BAC end- derived markers are indicated by arrows. The positions of markers enclosed in parentheses (e.g. 45L-b) have not been determined precisely. The numbers in square brackets indicate the numbers of SI Cara individuals containing recombination events in each marker interval . The predicted position of Rx is indicated by ^v«' symbol.

The bottom panel shows positions of BAC clones in GP34—218L interval. Each open rectangle represents one BAC insert DNA. Inside of each rectangle is the name of the BAC clone, the estimated insert size in kb (except for the BAC29) and a symbol 'L' or ^χR' denoting the BAC ends that had been mapped relative to Rx.

Fig 4: Alignments of putative peptide sequences derived from Rx-linked markers.

(a) The aligned putative peptide sequence of the IPM4 marker with homologous region of Prf (Salmeron et al . , 1996), and (b) the putative peptide sequences of 73L marker aligned with homologous regions of Cf-2 and Cf-9 proteins (Dixon et al., 1996; Jones et al . , 1994). Sequences were aligned using BLAST (Altschul et al . , 1990). Identical residues are indicated in bold, similar residues are in black, and different residues are in grey.

Fig 5: Introgressed DNA in the vicinity of Rx. The diagrams show chromosomal DNA in the IPM3—IPM5 interval from potato cv Cara and clone SH83 and from individuals in our SI Cara mapping population (identified in left hand column) . These plants were either Rx (R) or rx (S) genotypes and the chromosomal region introgressed from S . tuberosum spp. andigena is shown as a close rectangle. The S. tuberosum spp. tuJberosum DNA is shown as a thin line. DNA markers used to map the introgressed DNA are identified over the vertical lines, and the region containing Rx is delineated by the horizontal arrow.

Fig 6 : shows regions of the BAC77 clone which were used in transient assay experiments (A) and also a construct (PVX- TK) used in the experiments (B) .

Fig 7: shows a sequence alignment between Rx (from S . andigena) , Rx2 (from S . acaule) and other Rx homologues. Rxl indicates sequence from Rx from S. andigena. Acl5 and Ac64 indicate two sequences from two independent colonies carrying Rx2 from S . acaule . lllhl and 221h2 indicate two Rx homologous sequences from BAC111 and BAC221 respectively.

K39.hom indicate an Rx homologous sequence from the natural potato hybrid S. X juzepczukii carrying Rx_juz (A) is a DNA sequence alignment,

(B) is a protein sequence alignment.

Fig 8 : shows a comparison between the sequence of the coat protein of PVX and the coat protein of other viruses of the Potex- and Carlaviruses groups. As shown in the Figure, there are certain regions of sequence conservation within the coat proteins (solid black shade = residues that match consensus exactly) .

EXAMPLES

Example 1- Assessment of BAC library

The description below sets out how the present inventors cloned Rx.

A BAC library of 160000 clones from plant SC-781, which is a progeny of selfed cv Cara carrying Rx in the duplex condition (Rx, Rx, rx, rx) , was prepared. Based on the average insert size of 100 kb in the BAC clones (data not shown) , a haploid genome size of 900000 kb in potato (Arumuganathan and Early, 1991) and taking into account the presence of Rx in the duplex condition we estimated that there was more than a 99% probability that this library carried the DNA of the Rx (or any other) locus. The estimate was based on the formula: N=Ln (1-P)/Ln (1-l/G) , where I is the size of the average cloned fragment in base pairs, and G is the size of the genome, in base pairs (Clark and Carbon, 1976) . According to this formula, for any gene carried in the duplex condition, there would need to be <80000 BAC clones of 100 kb to have a 99% probability of representation in a library.

To confirm the genome representation in this potato BAC library we screened for the clones containing single copy co-dominant cleaved amplified polymorphic sequences (CAPS; Konieczny and Ausubel, 1993) markers: GP34, PM3 , CT99 and CT129 that are linked to Rx (Bendahmane et al . , 1997) . In each instance we obtained between 1 and 8 positive clones (data not shown) . At least one clone identified with each marker tested contained an allele linked in cis to Rx. Therefore, the BAC library represents a large part of the potato genome and could be used to identify BAC clones spanning many regions of interest in the potato genome .

Screening of the potato BAC library wi th markers closely linked to and flanking Rx locus

Bendahmane et al . , 1997 discloses CAPS markers, IPM3 and IPM4, that flank Rx and span an interval of 0.23 centiMorgans (cM) . Using the IPM3 marker to screen the BAC library we identified three BAC clones: BAC167, BAC191 and BAC117, with potato DNA inserts ranging from 100 to 120 kb. Ddel digestion of the IPM3 DNA in these BACs and in potato DNA samples revealed that BAC117 carried the IPM3 allele that was linked in cis to Rx. The other two BACs, BAC167 and BAC191, contained alleles from a corresponding region of the rx chromosomes .

To identify the relative genome positions of these BACs we designed pairs of PCR primers based on the sequence of the right and left ends of the insert (see Experimental procedures) . PCR tests using the BAC DNAs as templates showed that these BACs overlapped in the order BAC167,

BAC117, BAC191, Rx. The 191L marker was separated from Rx by only a single chromosomal recombination event (in plant #1146) in a mapping population of 1720 plants. In the same population, 117L and IPM3 markers were separated from Rx by two and three recombination events respectively whereas the GP34 marker, present in BAC167, was separated from Rx by thirteen recombinations (Figure 3) . The BAC library did not contain additional BACs extending further towards Rx from the 191L marker.

Characterization of the BAC clones linked to the IPM4 CAPS marker

The IPM4 marker was previously mapped at 0.06 cM from Rx on the side away from IPM3 (Bendahmane et al . , 1997). Screening of the BAC library with IPM4 identified two clones: BAC73 and BAClll, with inserts of -70 kb each. The Tagl digestion of the IPM4 CAPS marker in these clones suggested that BAClll was linked in cis to the Rx locus whereas BAC73 carries DNA insert from the rx chromosome (data not shown) .

To determine the relative genome position of BAClll and

BAC73 we performed PCR tests using end sequence primers of these BAC clones . These are shown in Table 1 :

Table 1. PCR-based markers linked to Rx locus.

* These markers are allele-specific (i.e. marker primers are able to amplify only an allele linked in cis to Rx) . These markers do not require restriction enzyme digestion.

These tests suggested that BAC73 overlaps with BAClll and that 73L and 111L represent opposite ends of this set of overlapping BACs. Both, 73L and 111L, co-segregated with IPM4. In our mapping population of 1720 individuals these markers were separated from Rx by one recombination event (in individual #761) and it was not possible to determine directly which of these markers was physically closer to Rx. Hence, to orientate these BACs relative to Rx we screened the BAC library with CAPS markers 111L and 73L. We also screened the BAC library with the IPM5 CAPS marker which is on the same side of Rx as IPM4, but further from Rx (Bendahmane et al . , 1997) . It was hoped that BACs containing IPM5 would allow us to orientate the 111L and 73L markers relative to Rx (Figure 3) . These analyses identified BAC218, carrying an allele of IPM5 identified by Pstl digestion as being linked in cis to Rx (data not shown) . The end sequences of BAC218 insert DNA were converted into the CAPS markers, 218L and 218R, and mapped genetically to the recombination events between GP34 and IPM5. Marker 218L was positioned at 8 recombination events (0.48 cM) from Rx, between IPM5 and CT129. The 218R marker was positioned between IPM4 and IPM5 at five recombination events (0.30 cM) from Rx. We also identified a single BAC pool #29 which contains three markers: 218R, 73L and 111R. CAPS analysis revealed that each of these markers in the BAC pool #29 is represented by the allele linked in cis to Rx (data not shown) . Hence, we conclude that BAC pool #29 contains a single BAC clone, BAC29, with DNA insert linked in cis to Rx. Therefore, BAC29 provided a link between BAC218 and the IPM4 BAC contig and allowed us to orientate the markers from the IPM4 contig in the following order: Rx, 111L, IPM4, 73L (Figure 3).

By screening the BAC library with 111L allele-specific primers we identified BAC221 which carries an insert DNA of 50 kb and is linked in cis to Rx (data not shown) . The left end sequence of BAC221 is located inside of BAClll whereas the right end sequence of BAC221 extends further towards Rx (Figure 3) . However the marker 221R co-segregated with IPM4 (Figure 3) in our mapping population and was separated from Rx by the recombination event in plant #761.

To extend the IPM4 contig further towards Rx we screened the BAC library with 221R allele-specific primers and identified BAC45 which has an insert DNA of 50 kb and is linked in cis to Rx (data not shown) . The right end sequence of BAC45 is located inside of BAC221, whereas the left end sequence of BAC45, 45L, extends further towards Rx (Figure 3) .

However, BAC45 does not contain Rx as the CAPS marker 45L is genetically separated from Rx by the recombination event in plant #761. Additional PCR screening of the BAC library with the 45L marker failed to identify any new BAC clones therefore leaving a gap between the IPM3 and IPM4 BAC contigs (Figure 3) .

Analysis and utilization of duplicated DNA sequences for mapping of Rx

Comparison using the BLAST search (Altschul et al . , 1990) of the translated version of CAPS marker sequences with the PDB, SWISS-PROT, PIR(R), GenPept , and GenPept databases revealed that several BAC-derived markers from IPM4 contig are similar to cloned disease resistance genes (Figure 8) . The marker IPM4 was similar to the tomato Prf gene required for the resistance to Pseudomonas syringae pv. tomato (Salmeron et al . , 1996), and the marker 73L showed a significant degree of homology to the Cf-2 and Cf-9 resistance genes of tomato (Dixon et al . , 1996; Jones et al . , 1994) (Figure 4) . These data indicated that Rx may be in a cluster of disease resistance-like genes.

Disease resistance loci in plants are often highly complex with small families of resistance genes clustered within several dozen kilobases (Ellis et al . , 1995; Hulbert and Bennetzen, 1991; Jones et al . , 1994; Martin et al . , 1993; Witham et al . , 1994). These clusters are due to structural duplications of different sizes within the disease resistance loci which may reflect a mechanism of evolution of disease resistance loci (Anderson et al . , 1996; Song et al . , 1997) . Taking into account our results, we tested for the presence of the duplicated sequences related to CAPS markers from the vicinity of Rx (IPM3—IPM5 interval) . In these tests we used pools of DNA from 20 resistant plants (R pool) and 20 susceptible plants (S pool) and the individual BAC clones from the IPM4 contig as templates for PCR amplifications. The primer annealing temperature in PCR reactions was 5 to 10°C lower than in conditions originally developed for each CAPS primer pair (Table 1) so that there would be amplification of the original marker and related homologues . The PCR products obtained with a number of tested CAPS primer pairs were the same size as the products produced under high stringency conditions (data not shown) . However, digestion of these low stringency PCR products with either Taql , Alul or Ddel restriction enzymes revealed several new DNA fragments that were not identified previously. These included fragments that were nonpolymorphic as well as fragments polymorphic between the R and S pools. However, we allocated most of these new fragments to BAC clones from the Rx locus.

The low stringency PCR products obtained with 45L primers and digested with Ddel produced two new fragments from the R pool DNA template in addition to those produced from the S pool and from BAC45. These fragments were also obtained after Ddel digestion of the BAClll-derived PCR product (data not shown) . The previously identified 45L marker is referred to as 45L-a and the newly identified locus in BAClll as 45L- b (Figure 3) . The Cos98 primers were based on a sequence in the BAC221 insert DNA (A.B., K.K. and D.C.B., unpublished data). They primed a PCR product from potato DNA of Rx plants that could be identified by Alul digestion as the original locus in BAC221 (this locus is designated as Cos98-b) . Under the low stringency conditions they also identified alleles or new loci present in the adjacent BAC45 (Cos98-a) and BAClll (Cos98-c) (Figure 3) .

Digestion of the low stringency IPM4 products from the R pool with Tagl identified the original IPM4 locus (IPM4-a) in BAClll. There were also IPM4 restriction fragments that had not previously been detected (data not shown) . One of these fragments was nonpolymorphic in the R and S pools. This fragment must have originated from BAC221 as the Tagl restriction fragment of similar size was also detectable after digestion of IPM4-b allele derived from this BAC (data not shown) . However, second new DNA fragment was polymorphic between R and S pools and was not detected after digestion of either IMP4-a or IPM4-b alleles derived from BAClll and

BAC221 correspondingly (data not shown) . This fragment segregated with Rx in all plants of our mapping population, including plant #761 and others with recombination events between GP34 and IPM5 (data not shown) . This new IPM4 marker allele co-segregating with Rx was designated IPM4-C.

The potato BAC library was screened by PCR with IPM4 primers using conditions for detection of the IPM4-C allele. One new BAC clone with DNA insert of -50 kb, BAC77, carrying the IPM4-C locus was identified (data not shown) . The end fragments of BAC77 DNA insert were cloned, sequenced and converted into the CAPS markers, 77L and 77R. The marker 77L co-segregated with both IPM4-C and Rx whereas 77R was separated from Rx by one recombination event in the recombinant individual #761 (based on analysis of 1720 segregants; see Figure 3 and Figure 5) .

BAC77 spans Rx

To ascertain whether BAC77 spans Rx, an additional 1438 individuals from the SI Cara population were screened with markers 77L, IPM4-C and the flanking markers 191L and 77R (data not shown) . There were no plants with recombination events between Rx and markers 77L and/or IPM4-C. However, three individuals B#232, B#934 and B#1393 were found with recombination events in the 191L—77L interval. All of these plants contained rx-linked alleles of 191L but were resistant to PVX and contained the Rx-linked allele of 77L. These data suggest a tight linkage between Rx and the marker 77L (Figure 3) but did not allow Rx to be conclusively positioned in the 191L—77R interval.

Further data supporting the conclusion that BAC77 spanned Rx was provided by ^Λ introgression mapping' experiments carried out on Globodera pallida resistance gene Gpa2 (data not shown) . Like Rx, this gene resides on the short arm of the potato chromosome XII (Rouppe van der Voort et al . , 1997) . Both Gpa2 and Rx were introgressed into cultivars Cara and Amaryl from the Solanum tuberosum ssp . andigena breeding line CPC1673. A dihaploid potato clone SH83-92-488 (referred to hereafter as ^XSH83') derived from the cultivar Amaryl carries both Rx and Gpa2. To map the CPC1673 -introgressed DNA in cv Cara, cv Amaryl and clone SH83 the DNA of these potato genotypes was subjected to PCR using a number of CAPS markers in the GP34—IPM5 genetic interval. This analysis provided evidence that all these potato genotypes contain DNA introgressions from the line CPC1673 within the GP34—IPM5 interval. However, the size of introgressed DNA segments varied between these genotypes (Figure 5) . Line CPC1673 and cv Cara contain Rx-linked alleles of each CAPS marker within the GP34—IPM5 interval. However, in cv Amaryl and clone SH83, the alleles originated from the CPC1673 clone and linked in cis to Rx could be identified only for markers in the IPM4-C—IPM5 interval (Figures 5 and 3, and data not shown) . Therefore, the introgression mapping data together with the recombination data strongly suggest that Rx is located between markers 77L and 77R (Figure 5) in the vicinity of IPM4-C.

Example 2 - Confirmation in plant cells that BAC77 contained coding sequence for Rx

Confirmation was carried out by transient assays based on the use of BAC77 DNA, an appropriate initiator (PVX or PVX CP) and a reporter gene.

The BAC77 DNA was combined in a single plasmid, with a PVX-GUS cDNA, under the control of a CaMV 35S promoter. In the experiments, an avirulent (PVX-TK) or a virulent (PVX- KR) strain of PVX under the control of 35S promoter was cloned into Srfl unique site of BAC77 to obtain BAC77 (PVX- TK) and BAC77 (PVX-KR) respectively. To monitor virus replication the GUS gene was expressed from duplicated PVX coat protein promoter - expression of GUS requires efficient accumulation of PVX-GUS in infected cells. A mutation within the PVX ORF (encoding the 25-kD movement protein) ensured that GUS expression would only report virus replication in cells also expressing the candidate Rx.

The BAC77 regions used in the assays, and an Example construct (PVX-TK) are shown in Fig 6(A) and (B) respectively.

It was predicted that because BAC77 carries Rx function, bombardment of N. benthamiana leaves with gold particles coated with DΝA from BAC77 (PVX-TK) or BAC77 (PVX-KR) would lead to GUS expression only with the latter.

The BAC77/PVX-GUS plasmid was introduced into tobacco cells and susceptible potato cells by biolistic transformation using coated gold particles. Results showed that there were approximately ten fold more GUS+ cells if the PVX-GUS was based on an Rx-breaking strain of PVX-KR than with a common, Rx-avirulent, strain of PVX-TK. This is consistent with activation of Rx resistance by expression of the avirulent

PVX-TK virus, leading to suppression of the PVX-GUS activity. The result confirmed the gene-for-gene relationship between BAC77 and virulent inducer (PVX-KR) .

This system was used for fine mapping of Rx locus within the 50 kb BAC77. Five sub-clones of BAC77 were prepared using overlapping DΝA fragments. These were cloned into the 'virulent' and 'avirulent' plasmids and tested as above. Results showed that functional Rx was present both in an 18 kb fragment of DΝA in BAC9 (designated FR9) and, within this, in a 11 kb PvuII DΝA fragment present in BAC6. The sequence of these regions (see Annex I) indicated that there is a single gene in the regions of BAC77 that is linked to the Rx phenotype. This gene was accordingly designated Rx and its product as Rx.

Example 3 - Rx is active in transient expression studies in plants which are not PVX hosts

Rx/PVX-GUS constructs were assembled in which Rx was under control of the 35S promoter. These constructs were bombarded into leaves of Arabidopsis plants. As with the experiments described above there were approximately ten fold more GUS+ cells if the PVX-GUS was based on an Rx-breaking strain of PVX than with a common strain of PVX. This result shows that the cloned Rx was active in Arabidopsis which is not a normal host of PVX.

Example 4 - Transiently expressed Rx can suppress PVX

The Rx/PVX GUS constructs were also introduced into

N. tabacum, N. benthamiana, L . esculentum and potato cells using Agrobacterium-mediated transformation. Briefly, the BAC77 DNAs were transferred into a binary Ti plasmid vector in Agrobacterium tu efaciens . The Agrobacterium cells were then infiltrated into leaves of the test plants. The Ti plasmid constructs had different regions of BAC77 and in some instances, as in the biolistic experiments, included PVX-GUS cDNA from common strain or Rx-breaking strain PVX. When the PVX-GUS in these constructs was from a resistance breaking strain of PVX there was abundant GUS expression in all samples tested, indicating that the infiltration method was an efficient procedure for inoculation of PVX. In contrast, if the PVX-GUS was from a common strain of PVX and if the BAC77 DNA was from the region most closely linked to Rx, there was less GUS . This result indicated that the transient expression of Rx in the cells of the infiltrated part of the leaf suppressed PVX accumulation in the same way as the native Rx gene.

Example 5 - Stable transformation of Rx and ER in susceptible potato plants

In order to confirm the earlier transient-expression experiments, transgenic plants of Solanum tuberosum cultivar Maris Bard with FR9 were produced.

Rx in plants

The plant transformation was carried out using SLJ7292 binary vector (Jones et al , 1992) . The larger 18 kb FR9 Rx fragment was used in order to ensure that the sequence encoded all of the required regulatory sequence.

Infectivity assays were performed using mechanical inoculation of PVX strains. Seven of eight independent transgenic lines carrying the FR9 insert were resistant to Rx-avirulent PVX-TK and susceptible to Rx-virulent PVX-KR. This resistance was manifested as the absence of PVX-TK symptoms and complete lack of PVX-TK accumulation in inoculated and systemic leaves. This resistance reaction is phenotypically similar to that observed in the wild type potato cultivar CARA.

Rx in protoplasts PVX accumulation in protoplasts from two of the transgenic lines, M4 and M7 , was assessed. For comparison protoplasts from Cara (Rx) and Maris Bard (rx) were also tested. The protoplasts were inoculated with PVX-TK and PVX-KR and the RNA was sampled 24 hr after inoculation. Gel blot analysis confirmed that there was no accumulation of PVX-TK in protoplasts of cultivar Cara and in the two transgenic lines. By contrast, PVX-TK did accumulate in Maris Bard. PVX-KR accumulated in all lines. This confirmed that transgenic Rx-mediated resistance is consistent with the Rx- phenotype in Cara.

Example 6 - The Rx transgene also confers resistance in heterologous plants species

The transient-expression experiments described in earlier examples established Rx function in Arabidopsis, L . esculentum, N. tabacum and N. Jbent-a_τuana. To demonstrate that actual ER could be introduced into at least some of these species, transgenic plants were produced using the FR9 Rx DΝA.

Plants of 18 transgenic lines (six each of L. esculentum, N. taJbacum and N. jben .ha_τuana) were rub inoculated with Rx- virulent and Rx-avirulent strains of PVX. RΝA analysis of inoculated and systemic leaves two weeks later revealed that PVX accumulated only when the breaking strain was used as an inoculum.

In order to establish whether of not any HR response (and corresponding cell death) was occurring in the transgenic plant, a more rigorous test (graft inoculation) was used. All graft inoculations described below were reproduced in two independent experiments. Scions (upper part) of N. benthamiana carrying Rx were grafted to a stock (lower part) of a nontransgenic N. Jbenthamiana that had been preinoculated with PVX-TK (ten independent grafts) . As a control, we used N. Jbe hamiana plants carrying the TMV resistance gene N. These plants were resistant against a TMV vector expressing the jellyfish green fluorescence protein (TMV-GFP) . This Ν-mediated resistance was manifested at 4 days after inoculation as localized HR in TMV-GFP inoculated leaves (data not shown) . We never observed systemic symptoms in these plants indicating that the Ν mediated resistance restricted TMV to the inoculated leaf. In TMV-GFP graft inoculated plants (ten independent grafts) from 10 days after grafting, the HR was manifested as a systemic HR. Eventually this HR spread to cause death of the scion. The spreading HR was not observed in TMV-GFP graft inoculated scions that did not carry Ν. These controls demonstrated how the HR of graft inoculated plants was no longer restricted to local necrotic lesions as occurs in rub inoculated leaves. Thus, the graft inoculation exaggerates the HR.

In the graft inoculated scions of a nontransgenic N. Jbent a-Tiiana, there were high levels and mosaic symptoms of

PVX-TK, indicating that PVX could cross the graft union.

However, the scions of transgenic Rx plants were symptomless, even after several weeks. There was no evidence of HR even by examination of leaves of the Rx scions under a dissecting microscope or after trypan blue staining (Parker et al . , 1993) for cell death (data not shown), and there was no accumulation of PVX-TK. We also carried out a double graft experiment in which a scion of N. jbenthamiana (transgenic Rx genotype) was grafted between a healthy scion and a preinoculated with PVX-TK stock of nontransgenic N. benthamiana. We wanted to determine whether PVX-TK was able to cross a graft union and to pass through the vascular tissue of an Rx genotype plant. In ten independent double grafts RΝA gel blot analysis showed PVX-TK accumulation in the inoculated stock and in the upper (nontransgenic) scion but not in the intermediate scion. From these results, we conclude that Rx-mediated resistance did not suppress PVX-TK translocation through the phloem. These results also confirm that, in the single grafted plants, there would have been translocation of PVX- TK into the transgenic Rx scion and the potential for activation of an Rx-mediated HR. From the absence of an HR in these graft inoculated plants, we conclude that there is no cell death associated with Rx-mediated resistance in Nicotiana species.

Example 7 - Over-expression of Rx causes cell death

One of the common features of a number of R genes in plants (and apoptotic genes in animals) is a conserved structure that is characterized by a series of motifs that include the nucleotide binding site (ΝBS) , GLPL, CFLY, and the MHD motifs (van der Biezen and Jones, 1998) . In C. elegans it was shown that over-expression of CED-4, an apoptotic gene of similar structure to plant R genes, leads to cell death. Similarly, the functional homologue of CED-4 in human, Apaf- 1, lead to cell death in an over-expression experiment (Perkins et al, 1998) . To test whether plant R genes can also lead to cell death when over-expressed in plant cell, we expressed Rx cDNA under the control of the CaMV 35S constitutive promoter in N. taJbacum. As control we prepared a second construct in which Rx cDΝA was expressed from its weak wild type promoter. To deliver these Rx constructs into plants, they were introduced into binary pBinl9 plasmid vector (Bevan, 1984) and transformed into A . tumefaciens . The A . tumefaciens cultures were then infiltrated into leaves of wild type N. taJbacum via agroinfiltration (see general methods below) .

When constructs encoding Rx under the 35S promoter (pBIΝ35- Rx) were agroinfiltrated into N. tajbacum HR was observed. The necrosis first appeared within 48 hr post- infiltration and caused complete death of the infiltrated region by 72 hr. In contrast when Rx was expressed from its native weak promoter (pBl-Rx) the elicitation of the HR was dependent on the elicitor (PVX-CP) .

Example 8 - Co-expression of Rx and the PVX-CP: relationship between ER and HR

In further experiments employing the agroinfiltration procedure and the binary pBinl9 plasmid vector, the constructs also had regions of BAC77 but, instead of the PVX-GUS insert there was a 35S-PVX coat protein (CP) construct. This uncoupled the CP expression from PVX replication.

Infiltration of these constructs, carrying the cloned Rx, into Rx transgenic N. JBent ajmiana (line B18) leaves produced no visible effect within 3d- if the coat protein construct was derived from the resistance breaking strain PVX-KR, or non-transgenic plants were used. However if the coat protein construct was from the common strain PVX-TK there was a clear hypersensitive response produced within 48 hr, and complete cell death of the infiltrated region by 72 hr.

Other experiments with Rx-transgenic potatoes, and nontransgenic Cara (Rx) potatoes confirmed these results. This experiment confirms that there is a potential for Rx- mediated HR. However this potential is not realized when the PVX CP is expressed from the PVX genome during the viral infection cycle.

To further explore the relationship of ER and HR, we analyzed the effect of Rx-mediated resistance on the N gene- mediated, HR type resistance against TMV. These experiments employed tobacco plants carrying the N gene either alone or in combination with transgenic Rx. The plants were challenged with recombinant isolates of TMV expressing the CP gene from either the Rx-virulent (PVX-KR) or the avirulent (PVX-TK) strain of PVX (Bendahmane et al . , 1995). The TMV-TK construct encodes the elicitors of both N- and Rx-mediated resistance (Padgett and Beachy, 1993; Padgett et al . , 1997), whereas TMV-KR does not encode the elicitor of Rx-mediated resistance. Transcripts of the TMVTK and TMV-KR cDNAs were initially inoculated onto N. benthamiana and sap extracts were produced from the inoculated leaves at 8 days after inoculation. Tobacco plants carrying the N gene either alone or in combination with Rx were inoculated with these extracts containing high concentration of virus, without dilution. After 3 to 4 days the TMV-KR and TMV-TK induced HR on N. taJbacum expressing the N gene. There was also an HR when TMV-KR was inoculated onto plants of the N, Rx- genotype. However, when these plants were inoculated with TMV-TK there was no HR. These data indicate that the Rx-- mediated ER was activated prior to the N-mediated resistance and, therefore, that extreme resistance is epistatic to an HR.

Conclusions from Examples 1 to 8

Isolation of Rx

The above Examples demonstrate the isolation of a BAC clone from potato that, according to genetic mapping criteria, spans the Rx locus in cv Cara. This was achieved notwithstanding a considerable variation in the frequency of recombination in the region of DNA introgressed into Cara from S. tuberosum ssp. andigena . In certain regions, including the region containing Rx from 77L to 73R, recombination was extremely rare. Thus in our mapping populations of 3150 progeny we detected only 2 recombination events in that interval of more then 170 kb.

Initially the presence of repeated DNA sequences around the Rx locus complicated characterization of BAC clones and construction of BAC contigs. For instance we isolated several BAC clones from our library that were not from the Rx chromosome although they had been initially screened with allele-specific PCR or CAPS markers (A.B., K.K. and D.C.B., unpublished) . We now know that this anomaly is due to differential PCR in genomic and cloned DNA. Repeated DNA loci that do not get PCR-amplified from a genomic DNA template may get amplified from cloned DNA because the primer-complementary sequences are more abundant in the cloned DNA than in genomic DNA and because there is no potential for competition for the primers between similar loci.

The complications associated with repeated sequences were compounded by the tetraploid nature of the potato genome and the high degree of polymorphism in the constituent genomes. At some loci there were four different alleles (A.B., K.K. and D.C.B., unpublished) . There may be an additional complication with the Rx locus in that it is duplicated on chromosomes V and XII (Ritter et al . , 1991) . However, despite these complications, we were able to actually exploit the presence of repeated sequences in and around the Rx locus in isolating the sequence itself.

Rx and the HR response

In Example 7, overexpression of the Rx gene led to cell death in susceptible species. Thus the modulation of the level of Rx expression may be used as a strategy to engineer disease resistance into plants. For example, in planta, overexpression of the Rx gene in susceptible species may be advantageous because:

(i) it could give rise to disease resistance against viruses related to PVX isolates which elicit weakly Rx-mediated resistance in wild type Rx-plant. (ii) it could give rise to spontaneous induction of cell death in some cells of the leaves and thus lead to systemic acquired resistance against different pathogens . Such an approach has been demonstrated by the HR which resulted from expressing Rx cDNA under a 35S promoter in an agroinfiltration assay in tobacco.

Effect of the elici tor on Rx and the HR response

Our interpretation of the results in Example 8 is based on a "hair trigger" hypothesis. We envisage that in PVX infected cells, and in the experiments described in the Examples above, the production of PVX CP from the viral genome would have activated Rx-mediated resistance at an early stage in the infection cycle because Rx is so sensitive to the presence of the coat protein elicitor. Virus accumulation would have been arrested before CP accumulation had reached a high level. Other work (data not shown) has confirmed that the induction of the resistance mechanism by CP does not require de novo transcription, and that the Rx-mediated resistance includes a mechanism that prevents growth or differentiation in cells.

In contrast, Rx mediated resistance would have no effect on elicitor production in cells infiltrated with the 35S CP construct. There would be continuous, decoupled, activation of the Rx mediated resistance rather as if the "hair trigger" of a repeating gun was held in place with a rubber band. This continuous activation of the resistance mechanism would expose secondary resistance responses (eg HR induced necrosis) that would not normally be evident in resistant plants after inoculation owing to the effectiveness of the primary ER.

Because Rx shares sequence similarity to many disease resistance genes, it is likely that variations of this model are relevant to other disease resistance interactions in plants .

Example 9 - Cloning and sequencing Rx homologues and paralogues

Cloning and sequencing of Rx2.

There are two Rx loci mapped in potato conferring strain- specific resistance to PVX (Cockerham, 1970) . These loci are on chromosome V (Rx2) and chromosome XII (Rxl) (Ritter et al, 1992; Bendahmane et al , 1997) but are functionally identical : both confer extreme resistance which is only overcome by the same natural or mutant isolates of PVX (Querci et al . , 1995) . Rxl originates from S andigena and is the same as Rx in potato cultivar CARA. Rx2 originates from S acaule. In this section we describe the isolation of Rx2 using primers based on Rx sequence (cloned from potato cultivar CARA) following the strategy described earlier. The basic scheme was as follows:

I-Production of Rx2 segregating population.

II-PCR amplification of Rx homologues using primers flanking

Rx gene and using DNA from bulked segregant as template. III-Cloning of the PCR products in BIN19 binary vector.

IV-Screening for Rx2 function using agroinfiltration transient assay described above .

V-Mapping of the candidate Rx2 on potato genome.

VI-sequence analysis . VII-Transgenic expression of Rx2 in N. benthamiana and N. taJbacum. The S . Acaule homologue was cloned and sequenced as described in more detail in the Methods section below. The sequence is shown in Fig 7. Rxl indicates sequence from Rx from Ξ. andigena. Acl5 and Ac64 indicate two sequences from two independent colonies carrying Rx2 from S. acaule which are virtually identical.

The Rx2 paralogue contains acidic and amide motifs in the C- terminal domains which are also present in the Rx gene and other paralogues on potato chromosome V as well as on chromosome XII. The Rx2 paralogue is functionally identical to, but independent of, the Rx gene described in the Examples above.

Fig 7 also shows sequences lllhl and 221h2; these are two Rx homologous sequences from BAClll and BAC221 respectively.

Cloning and sequencing of extreme resistance genes from different potato species .

There are reports of extreme resistance to PVX not only in S. andigena and S. acaule but also in other potato species. These examples include Rx^, { S. vernei ) , Rx_juz (S. X juzepczukii , natural hybrid) , R ^_r ( S. X curtilobum, natural hybrid), Rx_cha (S. X chaucha, natural hybrid) and Rx_suc ( S. Sucrense) . The isolation of Xym £x_7UZ P^cu_r, ^Rxc a ^and PXsuc is achieved using methods analogous to those described above for the cloning of Rx2 from S. acaule . Fig 7 shows K39.hom, which indicates an Rx homologous sequence from the natural potato hybrid S. X juzepczukii carrying Rx_juz

Example 10 - Modification of Rx to give broad specificity This can be achieved as follows. A plasmid is assembled based on the Rx information disclosed herein, a pathogen-derived gene (selected in accordance with the desired specificity) and a reporter gene (GUS or GFP) .

In controls the pathogen-derived gene may be the PVX CP . If the CP is from an avirulent isolate of PVX the Rx hair trigger will be activated leading to an HR. As a result of the HR there would be no GUS or GFP activity (the cells would be dead) . In contrast if the CP is from a virulent strain there would be no HR and there would be a high level of GUS or GFP. However, a mutant Rx would recognize the virulent CP and there would be an HR and loss of GFP or GUS. To identify a mutant Rx that can recognize the virulent CP, Rx is mutagenised using PCR. The mutant forms of Rx will be inserted into the transient expression plasmid and expressed in plant cells and those capable of recognising the virulent CP will be diagnosed by the absence of GUS or GFP.

In the actual experiments, mutant forms of Rx are tested in an analogous manner for the ability to recognize proteins or molecules that are completely unrelated to the PVX CP.

Example 11 - Controlled activation of Rx-mediated broad specificity resistance

This may be achieved by any of the following methods: (i) Expression of elicitor protein under the control of an inducible promoter in a plant carrying Rx. The activation of Rx mediated can be regulated by the extent to which the promoter is induced. The dex inducible promoter may be particularly suitable. (ii) Expression of the elicitor coat protein from a replicating potato virus genome ('amplicon') (Angel1 and Baulcombe, 1997) in the background of Rx. Due to the Rx- mediated resistance the accumulation of the coat protein will be below the level required for elicitation of the HR but high enough to activate the resistance mechanism, as in infected plants.

(iii) Introduction of Rx into plants carrying a transgene that specifies the elicitor CP but in which the protein does not accumulate due to post transcriptional gene silencing (Baulcombe, 1996) . In these plants the Rx-mediated resistance could be activated by any agent, for example a potyvirus, that is able to suppress post transcriptional gene silencing (Pruss et al . , 1997). Thus following inoculation of these plants with a potyvirus the gene silencing would be suppressed, the Rx-mediated resistance would be activated and the continued accumulation and spread of the potyvirus would cease .

Examples 12 - the Rx locus in transgenic tobacco confers resistance not only to PVX but also to other Potex and Carlaviruses

By looking for homology between the coat protein of PVX and the coat protein of other viruses of the Potex- and

Carlaviruses groups, we found sequence conservation within the coat protein (see Fig 8) . To test whether Rx recognises a conserved elicitor domain we tested a series of viruses for their avirulence on transgenic N. benthamiana carrying the potato Rx gene. From this screen we found out that

Narcissus mosaic virus (NMV) , Nandina virus X (NVX) , Viola mosaic virus (VMV) , Cymbidium mosaic virus (CyMV) , Poplar mosaic virus (PopMV) and White clover mosaic virus (WCIMV) were able to elicit Rx-mediated resistance. In these tests there were extreme resistance against NMV, NVX and WCIMV and HR type resistance against VMV. Against CyMV and PopMV there was a weak elicitation of Rx-mediated resistance. These weak elicitation was not able to block the systemic mouvment of CyMV and PoMV. Their was no resistance against Foxtaim mosaic virus (FoMV) . The implication of this finding is not only important at the fundamental level (identification of the conserved elicitor motif) but also at the applied level. Based on this study, it will be possible to create or select for a resistance gene that targets not only a single virus but also a class of viruses (example Rx) .

GENERAL MATERIALS AND METHODS

1 Plant material

FI seeds from the cross between potato cv Cara (Rx, rx, rx, rx) and cv Huinkel (rx, rx, rx, rx) were obtained from the Plant Breeding Institute, Cambridge. The progeny of this cross (370 individuals) were used initial experiments (Bendahmane et al . , 1997) to identify the chromosomal position of Rx, and to assign RFLP markers linked to Rx. The selfed (SI) progeny of cv Cara (1350 plants) were used as a mapping population to position Rx with respect to RFLP, AFLP and BAC-derived PCR markers. An additional 1438 plants of SI cv Cara were used to ascertain whether BAC77 spans Rx. A dihaploid potato clone SH83-92-488 (Rouppe van der Voort et al . , 1997) derived from the cv Amaryl {RxGpa2 , rxgpa2 ) , cv Amaryl and selfed offspring of S . tuberosum spp. andigena breeding line CPC1673 (obtained from the Plant Breeding Institute, Cambridge) were used for ^x introgression mapping'.

2 Construction of the potato BAC library

High molecular weight DNA was prepared in agarose plugs from potato protoplasts essentially as described in Bendahmane et al . (1997) . The agarose plugs were dialysed three times for 30 min against TE buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA) , once at room temperature and twice at 4°C. The plugs were then equilibrated in HindiII buffer (10 mM Tris-HCl, 10 mM MgCl₂, 50 mM NaCl , 1 mM DTT, pH 7.9) twice on ice for 1 h. Half of each plug (-5 μg of DNA) was transferred to a test tube containing 360 μl of HindiII buffer and 10-15 units of HindiII restriction enzyme. The enzyme was allowed to diffuse into a plug at 4°C for 1 h and the digestion was carried out at 37°C for 30 min. The reaction was stopped by adding 1 ml of 0.5 M EDTA and plugs were immediately loaded into an 1% low melting point agarose gel and subjected to contour-clamped homogeneous electric fields (CHEF; Chu, 1989) electrophoresis in CHEF DR II system (Bio-Rad

Laboratories, USA) in 0.5 X TBE buffer (45 mM Tris-borate pH 8.0, 1 mM EDTA) at 150 volts for 10 h at 4°C and constant pulse time of 5 sec or 8 sec. Compression zones containing the DNA fragments of ..100 kb or -.150 kb were excised from the gel and dialysed against 30 ml TE in a 15 cm Petri dish for 2 h at 4°C. Dialysed agarose slices then were transferred to an 1.5 ml test tube, melted at 65°C for 10 min and digested with 1 unit of GELASE (Epicentre Technologies, USA) per 100 μg of an agarose gel for 1 h at 45°C.

The size selected potato DNA (25-50 ng) was ligated to 25-50 ng of Hindlll -digested and dephosphorylated pBeloBACll vector kindly provided by Dr H.Shizuya (University of Southern California, Los Angeles; Shizuya et al . , 1992) using 400 to 800 units of T4 DNA LIGASE (New England BioLabs, USA) at 16°C for 24 hours in a total volume of 50 μl . The ligation products were dialysed against 1 X TE using 0.025 μM MF-MILLIPORE MEMBRANE FILTER (Millipore, UK) at 4°C for 2 h and 30 min at room temperature using the "drop dialysis" method of Maruzyk and Sergeant (1980) .

Transformation of E. coli DH10B cells was carried out by electroporation using a BRL CELL-PORATOR SYSTEM (Life Technologies Ltd, UK) . To 20 μl of electro-competent cells, 0.5-3 μl of ligation mixture was added. After electroporation, E. coli cells were mixed with 1 ml SOC medium (0.5% yeast extract, 2% tryptone, 10 mM NaCl , 2.5 mM KC1, 10 mM MgCl₂, 10 mM MgS0₄, 20 mM glucose) and incubated at 37°C for 1 h with gentle shaking (80 rpm) . The cells were spread on Luria broth (LB) agar plates containing chloramphenicol (12.5 μg/ml), 5-bromo-4-chloro-3-indolyl-β- D-galactoside (Xgal) (40 μg/ml) and isopropyl-1-thio-β-D- galactoside (IPTG) (0.12 mg/ml) . Plates were incubated at 37°C for 24 hours.

DNA from the compression zones of 100 and 150 kb led to clones with an average insert size of 100 kb and a transformation efficiency of approximately 1000 and 150 white colonies per μl ligation, respectively. Approximately 92000 white colonies from these ligations were picked individually into 384 well microtiter plates (Genetix, UK) containing LB freezing buffer (36 mM K₂HP0₄, 13.2 mM KH₂P0₄, 1.7 mM citrate, 0.4 mM MgS0₄, 6.8 mM (NH₄)₂S0₄, 4.4 % V/V glycerol , 12.5 μg/ml chloramphenicol in LB medium) , grown overnight at 37°C and stored at -80°C. We have also prepared 100 bacterial pools containing -500-1000 white colonies each (these pools also contained approximately 500-1500 blue bacterial colonies with an empty pBeloBACll) by scraping the colonies from agar plates into the LB medium containing 18% glycerol and 12.5 μg/ml chloramphenicol using a sterile glass spreader. These pools were also stored at -80°C.

3 Screening of the potato BAC library

The potato BAC library was screened with IPM3, IPM4 and IPM5 CAPS markers corresponding to the AFLP markers PM3 , PM4 and PM5 flanking the Rx locus (Bendahmane et al . , 1997). The IPM4F primer turned out to correspond to a portion of the C terminal part of the protein in a non-conserved part of the leucine rich repeat (bases 2522-2545 on Figure 3) . The IMP4R primer corresponded to a region immediately downstream of the stop codon (base 2875 on Figure 3) , extending into the intron immediately 5' of that codon. The protocol was as follows .

For the first part of the library of 92160 clones stored in 384 well microtiter plates the plasmid DNA was isolated using the standard alkaline lysis protocol (Heilig et al . , 1997) from pooled bacteria of each plate to produce 240 plate pools. Aliquots of these plate pools were combined to prepare 26 'superpools' each of which contains DNA from 9 plate pools, and one superpool containing DNA from 6 plate pools. To identify individual BAC clones carrying the CAPS markers the superpools and then the corresponding plate pools were screened. Once an individual plate had been identified the clones corresponding to each of the 24 columns of the positive plate were grown for 3-4 h at 37°C in LB medium and PCR was carried out on 3 μl of bacteria. After identification of a positive column a colony PCR on each of the corresponding 16 colonies of this column was carried out leading to identification of a single positive BAC clone.

The second part of the library was stored as one hundred pools of approximately 1000 clones. The plasmid DNA was isolated from each pool of clones using standard alkaline lysis protocol and PCR was carried out to identify the positive pool. The bacteria corresponding to the positive pool were diluted, plated on LB agar plates and then colony hybridisation was carried out as described in Sambrook et al . (1989) using ³²P-labelled DNA probes corresponding to CAPS markers . PCR with the corresponding CAPS primers was used to distinguish hybridising colonies carrying the markers that had been previously mapped from the homologues located elsewhere in the genome.

4 Analysis of the BAC library

BACs containing potato DNA were isolated from 5 ml overnight cultures (LB medium supplemented with 12.5 mg/ml chloramphenicol) using the standard alkaline lysis miniprep protocol (Engebrecht et al . , 1997) and resuspended in 50 μl TE. Plasmid DNA (10 μl) was digested with Notl for 3 h at 37°C to free the genomic DΝA from the pBeloBACll vector. The digested DΝA was separated by CHEF electrophoresis in a 1% agarose gel in 0.5 X TBE at 4°C using a BIO-RAD CHEF DR II system (Bio-Rad Laboratories, USA) at 150 volts with a constant pulse time of 14 sec for 16 h.

5 Isolation of BAC ends

Inverse polymerase chain reaction (IPCR; Ochman et al . , 1990) was used to isolate the right and left end sequences of insert DNAs. BAC DNA was isolated and digested separately with Nlalll , Hpall, Λfsel , HinPlI, PvuII, Haelll (for isolation of a left end sequence) or with Rsal , Sacl , EcoRI , Haelll, Maell, Msel , PvuII, HinPlI (for isolation of a right end sequence) for 4 h at 37°C and recircularised by self ligation for 2 h at 20°C. Ligations were carried out using 5-50 ng of digested DΝA and 5-10 units of T4 DΝA LIGASE (Boehringer Mannheim, Germany) in a total volume of 100 μl . PCR amplification of the recircularised DΝA was carried out using 3 μl of self-ligated DΝA as the template. AB1 (5'- CCTAAATAGCTTGGCGTAATCATG-3' ) and AB2 (5'- TGACACTATAGAATACTCAAGCTT-3' ) primers were used for PCR amplification of the left end sequence of insert DΝA, AB3 (5 ' -CGACCTGCAGGCATGCAAGCTT-3 ' ) and AB4 (5 ' -

ACTCTAGAGGATCCCCGGGTAC-3' ) primers were used for PCR amplification of the right end sequence of insert DΝA. PCR conditions were as follows: 94°C for 15 sec, 60°C for 15 sec, 72 °C for 90 sec - for 35 cycles. PCR products were digested simultaneously with Hindlll and the restriction enzyme used in the preparation of IPCR DΝA template. The released insert ends were gel purified and cloned into pGEM- 3Z(f+) (Promega, USA). Sequences of the clones containing -1-2 kb inserts were determined using a 377 or 373 DΝA SEQUENCING SYSTEM (Applied Biosystems, UK) , and these sequences were used to design PCR primers for amplification of the BAC end region in potato genomic DNA. The sequences of primers and PCR conditions used in the amplification of each BAC end sequence are summarised in Table 1. The BAC end sequences were named according to the name of the BAC, followed by the letter L for the left end or by the letter R for the right end sequence. For example, the left and the right end sequences of BAC218 are 218L and 218R, respectively.

Viral cDNA clones and in vi tro transcription

The PVX-TK and PVX-KR constructs are cDΝAs of potato virus X (PVX) isolate CP4. PVX-TK has codons ACA (specifying T) and MA (specifying K) at positions 121 and 127 of the coat protein (CP) gene and is the same as wild-type CP4. The construct PVX-KR has MA (K) and AGG (R) at the coat protein codons 121 and 127, respectively. These constructs were described previously (Goulden et al . , 1993). The tobacco mosaic virus (TMV) constructs were derived from the TMV vector (TMV/odontoglossum ringspot virus; construct TB2) described previously (Donson et al . , 1991). The TMV-TK and TMV-KR were made by cloning PVX CP from PVX-TK and PVX-KR, respectively, in the Xhol site of TB2. Schematic structure of these constructs is described in Fig 6. The TMV-GFP was made by cloning the green fluorescent protein (GFP) open reading frame in the Xhol site of TB2.

7 Plasmid constructs for biolistic transient expression assay

PVX-TK/BAC77 and PVX-KR/BAC77 were made by digestion of the unique Srfl site in BAC77 and ligation with the cDΝAs of the Rx-avirulent or the fix-virulent strain of PVX expressed under the control of the cauliflower mosaic vinus (CaMV) 35S promoter. PVX in these constructs was defective in cell-to- cell movement and modified to express a 13-glucuronidase (GUS) reporter gene. The cell-to-cell movement defect was due to a sequence deletion between nucleotides 4588 and 4945 of the 25-kD protein open reading frame (Angel1 et al . , 1 996) . All the clones derived from PVX-TK/BAC77 and PVX- KR/BAC77 were designated PVX-TK/BAC* and PVX-KR/BAC* where the asterisks is used depending on the insert derivatives of BAC77 (see Figure 6) .

8 Biolistic transient expression assay

Bacterial artificial chromosome (BAC) plasmid DNAs were isolated using an alkaline lysis method (Leonardo and Sedivy, 1990) and purified on cesium chloride gradients (Sambrook et al . , 1989). One hundred micrograms of plasmid DNA was precipitated onto 10 mg of 0.95-lim diameter gold particles as described previously (McCabe et al . , 1988). Leaf discs from 6-week-old plants, placed onto Murashige and Skoog medium (Imperial, UK) containing 3% (w/v) sucrose were bombarded with the gold particles coated with plasmid DNAs as described previously (McCabe et al . , 1988). The leaf discs were incubated at room temperature in the dark for 48 hr and then stained for GUS activity as described previously (Angell and Baulcombe, 1997) .

9 Agrobacterium tumefaciens -mediated transient expression (agroinf il tration)

The CP genes from the avirulent or the virulent strain of PVX were inserted between the 35S promoter and the transcriptional terminator of CaMV and transferred into the binary vector pBinl9 (Bevan, 1984) to create pBIN35S-TK and pBIN35S-KR, respectively. These constructs were transformed into Agrobacterium strain C58C1 carrying the virulence helper plasmid pCH32 (Hamilton et al . , 1996). pCH32 expresses VirG and VirE and was used to enhance T-DNA transfer. Agrobacterium cells were inoculated into 5 mL L broth medium supplemented with 50 μg/mL kanamycin and 5 μg/mL tetracycline and grown at 28°C overnight. L broth medium (50 mL) supplemented with 50 μg/mL kanamycin, 5 μg/mL tetracycline, 10 mM MES pH 5.6, and 20 μM acetosyringone was then inoculated with the 5-mL overnight cultures and grown at 28°C for 1 day. Cells were precipitated and resuspended to a final concentration of 0.5 OD₆₀₀ in a solution containing 10 mM MgCI2, 10 mM MES pH 5.6, and 10 μM acetosyringone. The cultures were incubated at room temperature for 2 hr before agroinfiltration. The agroinfiltration into Nicotiana benthamiana leaves was carried out as described previously (Scofield et al . , 1996; Tang et al . , 1996).

10 Protoplasts assay

Infectious viral RNA were electroporated into potato protoplasts and RNA gel blot analysis was used to measure the accumulation of viral RNA as described previously (Kohm et al., 1993) . The probe used to detect PVX RNA was antisense RNA probe transcribed from the T7 promoter of pHB- RP plasmid linearized with Apal and was described previously (Kohm et al. , 1993) .

11 Graft Inoculation Graft inoculations involved the grafting of healthy scions to infected stocks. First, seedlings of N. Jbenthamiana were sap inoculated with PVX strains. Later, when the plants exhibited symptoms on the systemic leaves, the apex of a healthy plant to be tested was grafted onto the infected stock. A diagonal cut was made in the stem of the third internode to insert the infected scion. The 2 to 6 cm scions were given a V shape at the end that would be inserted into the cut on the stock plant to ensure good contact between vascular systems. The graft was secured with Parafilm M (Sigma) and the whole plant was covered with a thin transparent plastic bag to avoid dehydration of the scion. The bag was removed 7 days after grafting. The presence of virus in the stock and the scion was determined 4 weeks after grafting by using RΝA gel blot analysis. All graft inoculation experiments were repeated at least twice.

12 Plant transformation wi th Rx

The Fspl-Pvull fragment of BAC9 (18,285 bp) was cloned into pSLJ7292 binary vector (Jones et al . , 1992) digested with Ecll3611 to create pSLJ9. This clone was introduced into Agrobacterium strain LBA4404. Transformation of N. Jbenthamiana and N. tabacum were carried out by Agrobacteriummediated leaf disc transformation (Horsch et al., 1985) . Transformation of potato cultivar Maris Bard was carried out as described previously (Gilbert et al . , 1998). The transformation of N. benthamiana with the N disease resistance gene was carried out using the Agrobacterium strain AGLl which carries the binary vector pTG34, and was kindly provided by B. Baker (University of California, Berkeley, CA; Whitham et al . , 1994). 13 DNA sequencing and analysis

A shotgun cloning strategy was used for sequencing BAC9. Three aliquots of 15 μg of CsCI purified DNA were sonicated for 30, 60 and 120 sec respectively by using Soniprep 150 (MSE, UK) . DNA fragments in the range of 1-kb and 4-kb were gel purified, blunt ended by T4 DNA polymerase and cloned into pGEM3Zf+ (Promega) digested with Small Clones carrying potato insert DNA were selected by colony hybridization using insert DNA from BAC9 as probe. The sequencing reactions were performed using a dye terminator cycle sequencing reaction kit (Perkin-Elmer) and M13 universal forward and reverse primers. The sequence reactions were resolved on ABI377 automated sequencer (Applied Biosystems ABI, La Jolla, CA) . Sequence contigs were assembled using UNIX versions of the Staden programs package (R. Staden, Medical Research Councel, Cambridge, UK). Homology searches were done using the BLAST software. The genomic DNA sequence has EMBL accession number AJ011801.

For the Rx homologues shown in Fig 7, the following primers were used for sequencing:

Rx specific primers used in the DNA sequencing:

K14: GCT ACC TCT ACG ATT TCA ACT TCC A Rχ5: GTA AAC TGA CAA GCG AGC TAG TT Rχ21: GAC ATA TGG ACT ACA GAA GCT TGG

Rx6 TAC CTG AAC TAG CAT ATT CAG CCA K26 GTA GTA AAT TCC AAC TTT CG

K27 ACG AAA GTT GGA ATT TAC TAC

K2: ACC GAA CTT ACA TTT TCC CCA ATT C Rxl6: GCA TGA GAG TGT TGG CTT TGA GTT Rx7: TTC AAA AAT CCC TCT ACA GGC CAT Rχ22: GTT CAC GGG TCA CAT CAT GCA TTC C K29: GAG GGA AGC TCG AAA CAT G Rxl5: GTG ATC AAA ATT CAT GTG CAC AAT C Rx8: AAT TGG CCA TGT ATT CAA ACC AAG K20: TCA CAC TGG AAT TGT CTT TCA AGC Rx23 : TGA GCC TAC AGA GAA CAG ATT GGT Rx24: ACC AAT CTG TTC TCT GTA GGC TCA Rx9: TTT ACT CTT ACC TCC TCC GGA TGC T K19: CTT CCA TGC CAC AGA GAA TTC TCC K3 : ACT CGA GGT CCT TAT ACT ATC ATG GA K4: GAA CGA GTT ATT CTT AGA GAT TGC C K17: GCT TGG CGG AAT TCA CAA CAG ATT

14 Rapid Amplification of cDNA Ends

The 5 ' and 3 ' ends of the RxcDNA were determined by rapid amplification of cDNA ends (RACE) using the MARATHON cDNA amplification kit (Clontech Laboratories, Palo Alto, CA) . To obtain specific RACE products, two consecutive rounds of amplification (35 cycles each) were necessary. Conditions for the first round of polymerase chain reaction (PCR) were as recommended by the manufacturer. PCR samples of the first amplification round were diluted 1:10 with distilled water, and a 1-11L aliquot was used as a template for the second round of PCR (15 sec at 94°C, 15 sec at 65°C, and 1 min at 72 °C) . Two sets of oligonucleotides were used in combination with the adapter primers (API and AP2) of the kit: K3 (5'- ACTCGAGGTCCTTATACTATCATGG-3 ' ) and K4 (5'-

GAACGAGTTATTCTTAGATTGCCG-3 ' ) for the 3 ' end Of RX and oligonucleotides K14 (5 ' -GCTACCTCTACGATTTCAACTTCCA-3 ' ) and K15 (5'GCAGGATTTCTCCAGAATAGCTCTCA-3' ) for the 5' end of Rx. RACE products were subcloned irto the pGEM-T plasmid (Promega) and sequences of 10 independent 3' and 5' end clones were determined asgiven above . Sequences of 5 ' and 3 ' RACE PCR products overlapped with the sequence of the PCR product corresponding to the central region of the Rx cDNA amplified using primers asK4 (5 ' -GAGAGCTATTCTGGAGAAATCCTGC- 3') and asK15 (5 ' -GGCAATCTCTAAGAATAACTCGTTCA-3 ' ) .

MATERIALS AND METHODS FOR CLONING RX HOMOLOGUES

15 Construction of pBl binary vector

pBl binary vector is a modified pBIN19 binary vector that carries a transcription cassette having an Rx promoter and Rx terminator. To construct the pBl binary vector, first, the Rx promoter was PCR-amplified using the primers RxP4 (TCG GGG TAC CTC TAT TGA AGA ATT GAG ATC CAA G) and RxP2 (CTC AGT ATC TAG ATG AAC AAA TTG CC) and the PCR product was digested with Xbal . Second, the Rx terminator was PCR- amplified with primers RxTl (CAG CTG TAA GCT CGT TGA TAT AGA GG) and RxT2 (GGT GTT CTA GAG ACT AGC CAG AGC TCT GAA AT) and the PCR product was digested with Xbal and Kpnl . BAC77 DNA (Bendahmane et al 1999) was used as template for both PCR reactions. Third, the digested PCR products were ligated to a modified pBIN19 plasmid vector digested with Kpnl and Ecll36 to create pBl . The modified pBIN19 plasmid is identical to the one published previously except the unique Xbal site was deleted.

16 Construction of a library of Rx homologues in pBl binary vector for cloning Rx2 Rx homologues in S. acaule were PCR amplified using the primers Rx-1 (GGC AAT TTG TTC ATC TAG ATA CTG AGA GA) and Rxac-4 (TAT TTC AGA GCT CTG GCT AGT CCT CAG AAC ACC) that flank Rx gene . The PCR product was digested with Xbal and ligated to pBl binary vector digested with Xbal and Ecll36. The library was made in A . tumefaciens strain C58C1 carrying the virulence helper plasmid pCH32 (Bendahmane et al 1999) . Independent colonies were agroinfiltrated into tobacco leaves that express transgenically PVX coat protein (Spillane et al 1997) and screened for elicitation of hypersensitive response. We screened 200 colonies and 6 led to HR. Two positive clones pBAC15 and pBAC65 were sequenced and were found to carry the same insert DNA. There was only one amino acid polymorphic between pBAC15 and pBAC65, which may well have been introduced by the PCR.

17 Transgenic expression of the Rx2 candidate gene in Nicotiana species

The Smal-Pvu II fragment of pBAC15 was cloned into pSLJ7292 binary vector (Jones et al . , 1992) digested with Eel 136II to create pSLJAC15. This clone was introduced into Agrobacterium tumefaciens strain LBA4404. Transformation of N. benthamiana and N. taJbacum were carried out by A . tumefaciens-mediated leaf disc transformation (Horsch et al . , 1985) . The transgenic plants were tested for resistance to virulent and avirulent strain of PVX by mechanical inoculation. Four independent transgenic lines of Ν. tabacum and two independent transgenic lines of Ν. benthamiana carrying the Smal-Pvu II fragment of pBAC15 regenerated were resistant to Rx-avirulent PVX-TK and susceptible to virulent PVX-KR. This resistance was manifested as the absence of PVX-TK accumulation in the inoculated and systemic leaves.

MATERIALS AND METHODS FOR OVEREXPRESSING RX

18 Construction of pBIN35-Rx binary vector for Rx overexpression assay

The Construction of pBIN35-Rx binary vector was carried out using pBIN61 binary vector (see 15 above) . Rx cDNA was PCR amplified with the primers Rxl (GGC AAT TTG TTC ATC TAG ATA CTG AGA GA) and Rxac4 (TAT TTC AGA GCT CTG GCT AGT CCT CAG AAC ACC) . The PCR product was digested with Xbal and ligated with pBIN61 digested with Xbal and Smal to create pBIN35-Rx.

19 Construction of pBl -Rx binary vector

The Construction of pBl-Rx binary vector was carried out using pBl binary vector. pBl binary vector is a modified pBIN19 binary vector that carry a tanscriprion cassette constituted of Rx promoter and Rx terminator. To Construct pBl binary vector, first, the Rx promoter was PCR-amplified using the primers RxP4 (TCG GGG TAC CTC TAT TGA AGA ATT GAG ATC CAA G) and RxP2 (CTC AGT ATC TAG ATG AAC AAA TTG CC) and the PCR product was digested with Xbal. Second, the Rx terminator was PCR-amplified with primers RxTl (CAG CTG TAA GCT CGT TGA TAT AGA GG) and RxT2 (GGT GTT CTA GAG ACT AGC CAG AGC TCT GAA AT) and the PCR product was digested with Xbal and Kpnl. BAC77 DNA (Bendahmane et al 1999) was used as template for both PCR. Third, the digested PCR products were ligated to a modified pBIN19 plasmid vector digested with

Kpnl and Ecll36 to create pBl . The modified pBIN19 plasmid is identical to the one published previuosely except the unique Xbal site was deleted.

To construct pBl-Rx, Rx cDNA was PCR amplified with the primers Rxl (GGC AAT TTG TTC ATC TAG ATA CTG AGA GA) and Rxac4 (TAT TTC AGA GCT CTG GCT AGT CCT CAG AAC ACC) . The PCR product was digested with Xbal and Sad and ligated with pBl digested with Xbal and Sad to create pBl-Rx.

20 Agrobacterium-mediated transient expression (agroinf il tration)

The constructs pBIN35-Rx and pBl-Rx were transformed into A . tumefaciens strain C58C1 carrying the virulence helper plasmid pCH32 (Hamilton et al . , 1996). pCH32 expresses VirG and VirE and was used to enhance T-DNA transfer. Agrobacterium cells were inoculated into 5 ml L-broth medium supplemented with 50 μg/ml kanamycin and 5 μg/ml tetracycline and grown at 28°C overnight. The Cells were then precipitated and resuspended to a final concentration of 0.5 OD₆₀₀ in a solution containing 10 mM MgCl₂, 10 mM MES pH 5.6 and 150 μM acetosyringone. The cultures were incubated at room temperature for 2 hr before agroinfiltration into N. taJbacum leaves.

21 Challenge of transgenic plants with Potex- and Carlaviruses

All the viruses used in this experiment were maintaned in wild type N. Jbenthamiana. To carry out the resistance test, for each virus, one leaf of an infected N. benthamiana plant was ground in a pestle and mortar in presence of 1 ml of 10 mM phosphate buffer and sand. The solution was centrifuged for 2 min at 2000 g and the supernatant was used as inoculum to infect Rx transgenic N. Jbenthamiana. As a control we also inoculated wild type N. Jbenthamiana. The infected plants were scored for resistance 3 weaks post-inoculation. The plant were considered resistant if there were no symptoms and no virus accumulation in the inoculated and the systemic leaves of infected Rx transgenic plants and symptoms and systemic movement of the virus in the control plant (infected wild type N. Jbenthamiana) .

Annex I - Rx DNA sequence - nt 1-5820 - rows of 80

ACTACTTACACTTATACATGGTATAAGAATTTTGCACAATTACTTACATATATACAATAT

TATCAATTAAACAATATACA AATCGTATAACTTATATATACAGTAAAATTACAACAACAACAACAAAAATTATCAAATTA

AAGCACACCGTTGTTGTCGA

ATCATATACACTTCATATATAAAAATTGTGTCATTCAATTTTTCGAACAAAAAATTAGAA

TTGAATTGGTAATAAAAAAT

TTATCTAATCTTGTATAAACAAAATTAAATTATTGCAAACCATTAGAATGAAAAAAACAA AAATAATCCGTTTTCCAAAA

TTTCAATTATATACTATACAAATCAATTGTATACTTTCTTGCTGTTCAAAACATGAAGTT

TCCTTGAAAGAAACGCTTAC

CTAGCGTTGAATATACAAGAATATTGATTAATCTTATGCTTCAGTCGTTTGAGGAACCCA

GTTGTTATGGTGTTTCTATT GCTATAGAACTCCTTTTTGGAAAAATATTTGATTTTGGACGATTAGCTTGAACATTGGGA

CTATATAAATTTTTTATTAC

CGTATTTAGCACTCATGTATCCATTTATTAAAAAAAAATGTATAAATTATATTTTTAAAA

GAAAATATACAAAATTAATG

CTTCATAGCAAACTAAACTATGCCCATTGAATGTAATTACTAAACTATACCTATAGAGCG TTATTTCATTAAATACGTTT

ATCATATATGAAATTTTCCCTTAAGAGATCCTACACCTTATATATAGCTTCTCAAATGTG

GAAATTCAATCTCACACCCA

ACAATCTTTCCCTCAGACTAAGTTTCATGGCCCAATATCACAATGATCCACGAGTCAATT

CATGAGATTCACTATGTGCA TCACCCACATCGTCTAAGTATTTTATGGCAATCAAGCCCTACAACTAGCTTCTTCTTTAT

ATATATATGTGTGTGTATAT

GTGCGCGCGCGCGCATCTCTAATTAATCTCGTAAAGGGATTAAGGGGCCAATTTCAAAGA

ATTAGGCGATTTTCTTAGTT

TTTCGTGTGTGTTAACCCATAAATATTTTGGTGATATGGTTTTCGGACGATTTCTTTTGT GCAACTTATATGGAACCCTT

CGTAGGGAGTTAGTCTCACACTTTTTAGAGTCCATTTTGGGCACTCAGGGGCTAATTTAT

AGGAAATAGGTGATCTTCTC AGTCCGTCTGTATTAGCCCATGAATATTTTGGTGATATGTCTTCCGAATAATTTCTTTGT

AAAATCTTTACGGGACCCTC

CATAGGGAGTTAATGGAGCAGTACGTATAGTCTCACAATTTTAGAGTTCATTTTGGGCAT

TTAGGGGCCAATTTACAGGA ATTAGGTGACTTTCTCAGTGTTTTGTGTGTGTTAGCCCATTAATATTTGGTGATATGACT

TTCAGACGATTTCTTTGCTA

CACATTTACGAAACCCTCTGTAGGGAGTCGGGGGAGCAGTACGTACAATCTCACAATTTT

AGAGTCCATTTTAGACATTT

AGGGGCCAATTTAAAGAAATTGGACAATTTTCTCAGTTTTTCGTGTCTGTTAGCCATTAA TATATTGGTGAATATGACCT

ACGGATGATTTCTAATAGAAATCTTTACGAAACCTTCAATAGGGAGTTGGGGGAGCAATA

CGTACCGTCTGACAATTTTT

AGAGTCCATTTTGGGCATTTAAGGGCCAATTTACAGGAATTAGACAATTTTCTCAGTATT

TTTCCATGTGTTAGCCCATA AATATTTTGTTGCTTTGACTTTTAGAGTCTAAACTTCTCATGTATATTAAGAGATATTTA

TGCTTGGTTAATTGAATCGA

ACTAGGAATAGAGAAATTCCTACTTGGATCTTAATATTTCTCTCTCTTTGATTTGGAAAA

TTCTACGAAGTTGCTTTCAA

TGGAATTAAAATCATAAATCTATTGTATGTAAGAAACATACTTATATTCATGAATAGATA TGTGTAGGGTCTAATAATGA

ATTATCACAATTTTTTCTACTTTTTCCTGTCAGAGTCCTGCTTTTTCTTTTTCTTTTTCT

TTTTTAACTTTGGTCTCTGC

TTTTGTCTACATGATGATAAGGTTGGTGGACCTAGCTGGAAATGTGATGGAAATAGCTAG

TAAAAGAAAGAACTTTGCAT TTTCTGTTTTCTTAAAAACTGAAAAATTACATAACTTGTGGCAATTTGTTCATTTTCATA

CTGAGAGATATTTCTATTTT

TTGGATATATGGCTTATGCTGCTGTTACTTCCCTTATGAGAACCATACATCAATCAATGG

AACTTACTGGATGTGATTTG

CAACCGTTTTATGAAAAGCTCAAATCTTTGAGAGCTATTCTGGAGAAATCCTGCAATATA ATGGGCGATCATGAGGGGTT

AACAATCTTGGAAGTTGAAATCGTAGAGGTAGCATACACAACAGAAGATATGGTTGACTC

GGAATCAAGAAATGTTTTTT TAGCACAGAATTTGGAGGAAAGAAGCAGGGCTATGTGGGAGATTTTTTTCGTCCTGGAAC

AAGCACTAGAATGCATTGAT

TCCACCGTGAAACAGTGGATGGCAACATCGGACAGCATGAAAGATCTAAAACCACAAACT

AGCTCGCTTGTCAGTTTACC TGAACATGATGTTGAGCAGCCCGAGAATATAATGGTTGGCCGTGAAAATGAATTTGAGAT

GATGCTGGATCAACTTGCTA

GAGGAGGAAGGGAACTAGAAGTTGTCTCAATCGTAGGGATGGGAGGCATCGGGAAAACAA

CTTTGGCTACAAAACTCTAT

AGTGATCCGTGCATTATGTCTCGATTTGATATTCGTGCAAAAGCAACTGTTTCACAAGAG TATTGTGTGAGAAATGTACT

CCTAGGCCTTCTTTCTTTGACAAGTGATGAACCTGATGATCAGCTAGCGGACCGACTGCA

AAAGCATCTGAAAGGCAGGA

GATACTTGGTAGTCATTGATGACATATGGACTACAGAAGCTTGGGATGATATAAAACTAT

GTTTCCCAGACTGTTATAAT GGAAGCAGAATACTCCTGACTACTCGGAATGTGGAAGTGGCTGAATATGCTAGTTCAGGT

AAGCCTCCTCATCACATGCG

CCTCATGAATTTTGACGAAAGTTGGAATTTACTACACAAAAAGATCTTTGAAAAAGAAGG

TTCTTATTCTCCTGAATTTG

AAAATATTGGGAAACAAATTGCATTAAAATGTGGAGGATTACCTCTAGCAATTACTGTGA TTGCTGGACTTCTCTCCAAA

ATGGGTCAAAGATTAGATGAGTGGCAAAGAATTGGGGAAAATGTAAGTTCGGTCGTTAGC

ACAGATCCTGAAGCACAATG

CATGAGAGTGTTGGCTTTGAGTTACCATCACTTGCCTTCTCACCTAAAACCGTGTTTTCT

GTATTTTGCAATTTTCACAG AGGATGAACAGATTTCTGTAAATGAACTTGTTGAGTTATGGCCTGTAGAGGGATTTTTGA

ATGAAGAAGAGGGAAAAAGC

ATAGAAGAGGTGGCAACAACATGTATAAACGAACTTATAGATAGAAGCTTAATTTTCATC CACAATTTTAGTTTTCGTGG AACAATAGAAAGTTGTGGAATGCATGATGTGACCCGTGAACTCTGTTTGAGGGAAGCTCG AAACATGAATTTTGTGAATG

TTATCAGAGGAAAGAGTGATCAAAATTCATGTGCACAATCCATGCAGCGTTCCTTTAAGA GTCGAAGTCGGATCAGAATC CATAAGGTGGAAGAATTGGCTTGGTGTCGTAACAGTGAGGCTCATTCTATTATCATGTTG

GGTGGATTCGAATGCGTCAC

ACTGGAATTGTCTTTCAAGCTAGTAAGAGTACTAGATCTTGGTTTGAATACATGGCCAAT

TTTTCCCAGTGGAGTACTTT CTCTAATTCATTTGAGATACCTATCTTTGCGTTTTAATCCTTGCTTACAGCAGTATCAAG

GATCGAAAGAAGCTGTTCCC

TCATCAATAATAGACATTCCTCTATCGATATCAAGCCTATGCTATCTGCAAACTTTTAAA

CTTAACCTTCCATTTCCCAG

TTATTATCCTTTCATATTACCATCGGAAATTTTGACGATGCCACAATTGAGGACGCTGTG TATGGGCTGGAATTACTTGC

GGAGTCATGAGCCTACAGAGAACAGATTGGTTTTGAAAAATTTGCAATGCCTCAATCAAT

TGAACCCTCGGTATTGTACA

GGGTCTTTTTTTAGACTATTTCCCAATTTAAAGAAGTTGCAAGTATTTGGCGTCCCAGAA

GACTTTCGCAATAGCCAGGA CCTGTATGATTTTCGCTACTTATATCAGCTCGAAGAATTGACATTTCGTTTATATTATCC

ATATGCTGCTTGCTTTCTAA

AAAACACTGCACCTTCAGGTTCTACGCAAGATCCTCTGAGGTTTCAGACGGAAATATTGC

ACAAAGAGATTGATTTCGGG

GGAACTGCACCTCCAACTTTACTCTTACCTCCTCCGGATGCTTTTCCACAAAACCTTAAG AGTTTAACTTTTAGGGGAGA

ATTCTCTGTGGCATGGAAGGATTTGAGCATTGTTGGTAAATTACCCAAACTCGAGGTCCT

TATACTATCATGGAATGCCT

TCATAGGCAAGGAGTGGGAAGTAGTTGAGGAAGGGTTTCCTCACTTGAAGTTCTTGTTTC

TGGATGATGTATACATTCGA TACTGGAGAGCTAGTAGTGATCACTTTCCGTACCTTGAACGAGTTATTCTTAGAGATTGC

CGTAATTTGGATTCAATCCC

TCGAGATTTTGCAGATATAACCACACTAGCTCTTATTGATATAGATTACTGTCAACAATC

TGTTGTGAATTCCGCCAAGC

AAATTCAACAGGACATTCAAGACAACTATGGAAGCTCTATCGAGGTCCATACTCGTCATC TTTTGTAAGACATCTTCTTC

CTTGCTTTACAACAATAATTAACTCATCATCATAGTAAACTCGATAATAATCTGGATAAT

AGCCTTAGTAAGTCAAATTG CACCAATTCAACAAAAGTTCTTGATGCTGTCATTGTGTTTGATTTGAATCCTTCCAATAT

TGTGTAACTTGTTATACTTG

CATGTTCATTCTTGATTTTGGGAAGTGTAACATTTCATTTTTCATCTTTTGTGGCTAGCA

TTCCCAAGAGTGTGACAACA GTTGAAGATGATGATGATAGTGTGACAACAGATGAAGATGATGATGATGATGACTTTGAG

AAAGAAGTTGCTTCTTGCCG

CAATAATGTGTAAGTTCTTATACCTGCATGCTCATTCTTGCTATAATGTTCTCTTGTTCC

TTAATTATGGGACATCTGAC

ATATTATTTTCCATGTTTTGCGTCTTTTATTTTTCTGCAGCGAGTAGTTAAGGTGTTCTG AGGACTAGCCAGTTCTCTGA

AATAAATGTCAAATCAGAAGCCAAATGTGTGAGTGTTTGTTTTGTTCGTTTTCATTTTTT

CTGCATAAGGTGGCAGGATG

ATTGCAAATGGCTTGTAATTTAATTGTATATGATCTTTCGTATAGCCATTTGTCAGTGGT

TCTTAAGATACTCCAAATTT TATGCACATACATACATACTGTACAGGCCAGAACAGACTCCAGTAACGTGTGTTTCCTTT

CTTGGGAGTCCTCAATCTAC

CTCGCAAAGGCTAAATCCAGTGGCACCAGCTTTATTACTAAAACATTCACACGGGAACAG

TTGAGAAAAACTAGGCCTCC

ATACCAAACACACCCTTAAACTTGAGCTGGTTGATAGAGACTAGAGAGTAGAGAGCACTA

Annex II - Rx cDNA sequence - nt 1-3066

TGGCAATTTGTTCATTTTCATACTGAGAGATATTTCTATTTT TTGGATATATGGCTTATGCTGCTGTTACTTCCCTTATGAGAACCATACATCAATCAATGG

AACTTACTGGATGTGATTTG

CAACCGTTTTATGAAAAGCTCAAATCTTTGAGAGCTATTCTGGAGAAATCCTGCAATATA ATGGGCGATCATGAGGGGTT AACAATCTTGGAAGTTGAAATCGTAGAGGTAGCATACACAACAGAAGATATGGTTGACTC GGAATCAAGAAATGTTTTTT

TAGCACAGAATTTGGAGGAAAGAAGCAGGGCTATGTGGGAGATTTTTTTCGTCCTGGAAC AAGCACTAGAATGCATTGAT TCCACCGTGAAACAGTGGATGGCAACATCGGACAGCATGAAAGATCTAAAACCACAAACT

AGCTCGCTTGTCAGTTTACC

TGAACATGATGTTGAGCAGCCCGAGAATATAATGGTTGGCCGTGAAAATGAATTTGAGAT

GATGCTGGATCAACTTGCTA GAGGAGGAAGGGAACTAGAAGTTGTCTCAATCGTAGGGATGGGAGGCATCGGGAAAACAA

CTTTGGCTACAAAACTCTAT

AGTGATCCGTGCATTATGTCTCGATTTGATATTCGTGCAAAAGCAACTGTTTCACAAGAG

TATTGTGTGAGAAATGTACT

CCTAGGCCTTCTTTCTTTGACAAGTGATGAACCTGATGATCAGCTAGCGGACCGACTGCA AAAGCATCTGAAAGGCAGGA

GATACTTGGTAGTCATTGATGACATATGGACTACAGAAGCTTGGGATGATATAAAACTAT

GTTTCCCAGACTGTTATAAT

GGAAGCAGAATACTCCTGACTACTCGGAATGTGGAAGTGGCTGAATATGCTAGTTCAGGT

AAGCCTCCTCATCACATGCG CCTCATGAATTTTGACGAAAGTTGGAATTTACTACACAAAAAGATCTTTGAAAAAGAAGG

TTCTTATTCTCCTGAATTTG

AAAATATTGGGAAACAAATTGCATTAAAATGTGGAGGATTACCTCTAGCAATTACTGTGA

TTGCTGGACTTCTCTCCAAA

ATGGGTCAAAGATTAGATGAGTGGCAAAGAATTGGGGAAAATGTAAGTTCGGTCGTTAGC ACAGATCCTGAAGCACAATG

CATGAGAGTGTTGGCTTTGAGTTACCATCACTTGCCTTCTCACCTAAAACCGTGTTTTCT

GTATTTTGCAATTTTCACAG

AGGATGAACAGATTTCTGTAAATGAACTTGTTGAGTTATGGCCTGTAGAGGGATTTTTGA

ATGAAGAAGAGGGAAAAAGC ATAGAAGAGGTGGCAACAACATGTATAAACGAACTTATAGATAGAAGCTTAATTTTCATC

CACAATTTTAGTTTTCGTGG

AACAATAGAAAGTTGTGGAATGCATGATGTGACCCGTGAACTCTGTTTGAGGGAAGCTCG

AAACATGAATTTTGTGAATG

TTATCAGAGGAAAGAGTGATCAAAATTCATGTGCACAATCCATGCAGCGTTCCTTTAAGA GTCGAAGTCGGATCAGAATC

CATAAGGTGGAAGAATTGGCTTGGTGTCGTAACAGTGAGGCTCATTCTATTATCATGTTG

GGTGGATTCGAATGCGTCAC ACTGGAATTGTCTTTCAAGCTAGTAAGAGTACTAGATCTTGGTTTGAATACATGGCCAAT

TTTTCCCAGTGGAGTACTTT

CTCTAATTCATTTGAGATACCTATCTTTGCGTTTTAATCCTTGCTTACAGCAGTATCAAG

GATCGAAAGAAGCTGTTCCC TCATCAATAATAGACATTCCTCTATCGATATCAAGCCTATGCTATCTGCAAACTTTTAAA

CTTAACCTTCCATTTCCCAG

TTATTATCCTTTCATATTACCATCGGAAATTTTGACGATGCCACAATTGAGGACGCTGTG

TATGGGCTGGAATTACTTGC

GGAGTCATGAGCCTACAGAGAACAGATTGGTTTTGAAAAATTTGCAATGCCTCAATCAAT TGAACCCTCGGTATTGTACA

GGGTCTTTTTTTAGACTATTTCCCAATTTAAAGAAGTTGCAAGTATTTGGCGTCCCAGAA

GACTTTCGCAATAGCCAGGA

CCTGTATGATTTTCGCTACTTATATCAGCTCGAAGAATTGACATTTCGTTTATATTATCC

ATATGCTGCTTGCTTTCTAA AAAACACTGCACCTTCAGGTTCTACGCAAGATCCTCTGAGGTTTCAGACGGAAATATTGC

ACAAAGAGATTGATTTCGGG

GGAACTGCACCTCCAACTTTACTCTTACCTCCTCCGGATGCTTTTCCACAAAACCTTAAG

AGTTTAACTTTTAGGGGAGA

ATTCTCTGTGGCATGGAAGGATTTGAGCATTGTTGGTAAATTACCCAAACTCGAGGTCCT TATACTATCATGGAATGCCT

TCATAGGCAAGGAGTGGGAAGTAGTTGAGGAAGGGTTTCCTCACTTGAAGTTCTTGTTTC

TGGATGATGTATACATTCGA

TACTGGAGAGCTAGTAGTGATCACTTTCCGTACCTTGAACGAGTTATTCTTAGAGATTGC

CGTAATTTGGATTCAATCCC TCGAGATTTTGCAGATATAACCACACTAGCTCTTATTGATATAGATTACTGTCAACAATC

TGTTGTGAATTCCGCCAAGC

AAATTCAACAGGACATTCAAGACAACTATGGAAGCTCTATCGAGGTCCATACTCGTCATC

TTTT

CATTCCCAAGAGTGTGACAACA GTTGAAGATGATGATGATAGTGTGACAACAGATGAAGATGATGATGATGATGACTTTGAG

AAAGAAGTTGCTTCTTGCCG CAATAATGT CGAGTAGTTAAGGTGTTCTGAGGACTAGCCAGTTCTCTGA AATAAATGTCAAATCAGAAGCCAAATGTGTGAGTGTTTGTTTTGTTCGTTTTCATTTTTT CTGCATAAGGTGGCAGGATG

ATTGCAAATGGCTTGTAATTTAATTGTATATGATCTTTCGTATAGCCATTTGTCAGTGGT TCTTAAGATACTCCAAATTT TATGCACAT

References

Adams et al (1985) J. Gen. Virol. 66, 1341-1346.

Adams et al (1986) J. Gen. Virol. 67, 2341-2345. Altschul et al (1990) J. Mol . Biol . 215, 403-410.

Alvarez et al (1998) Cell 92, 773-784.

Anderson et al (1996) Mol . Gen Genet . 251, 316-325.

Angell et al (1996) Virology 215, 1 97-201.

Angell and Baulcombe (1997) EMBO Journal . 16, 3675-3684. Aoyama and Chua (1997) Plant Journal 11, 605-612.

Arumuganathan and Earle (1991) Plant Mol . Biol . Rep . 9 , 208-

218.

Ballvora et al (1995) Mol . Gen . Genet . 249, 82-90.

Baulcombe (1996) Plant Molecular Biology 32, 79-88. Baulcombe et al (1994) Biochem. Soc. Symp. 60, 207-218.

Bendahmane et al (1995) Plant J. 8, 933-941.

Bendahmane et al (1997) Theor. Appl . Genet . 95, 153-162.

Bent et al (1994) Science 265, 1856-1860.

Bevan (1984) Nucleic Acids Res. 12, 8711 -8721. Brigneti et al (1997) Theor. Appl . Genet . 94, 198-203.

Busch et al (1996) Mol . Gen . Genet . 6, 681-691.

Bύschges et al (1997) Cell 88, 695-705.

Chu (1989) Electrophoresis 10, 290-295.

Clark and Carbon (1976) Cell 9, 91-99. Cockerham (1970) Heredity 25, 309-348.

Cooper and Jones (1983) Phytopathol . 73, 127-128.

Crameri et al (1998) Nature 391.

Da Graca and Martin (1976) Physiol . Plant Pathol . 8, 215-

219. Dahlbeck et al (1994) Science 265, 1856-1860.

Dangl et al (1996) Plant Cell 8, 1793-1807.

De Jong et al (1997) Theor. Appl . Genet . 95, 246-252. Delledonne et al (1998) Nature 394, 585-588.

Dinesh-Kumar et al (1995) Proc . Natl . Acad . Sci . USA . 92,

4175-4180.

Dixon et al (1996) Cell 84, 451-459. Doke and Ohashi (1988) Plant Pathol . 32, 163175.

Donson et al (1991) Proc. Natl. Acad. Sci. USA 88, 7204-

7208.

Ellis et al (1995) Proc . Natl . Acad . Sci . USA 92, 4185-4188.

Engebrecht et al (1997) Large-scale preparation of plasmid DNA. In Current Protocols in Molecular Biology, Volume 1 (Ausubel et al eds) . John Wiley & Sons, Inc, pp. 1.6.1-

1.6.2.

Flor (1971) A nu. Rev. Phytopathol . 9, 275-298.

Gilbert et al (1998) Mol. Plant-Microbe Interact. 8, 833- 835.

Giraudat et al (1992) Plant Cell 4, 1251-1261.

Goulden et al (1993) Virology 197, 293-302.

Goulden and Baulcombe (1993) Plant Cell 5, 921-930.

Grant et al (1995) Science 269, 843-846. Hamilton et al (1996) Proc. Natl. Acad. Sci. USA 93, 9975-

9979.

Hamilton (1997) Gene 200, 107-116.

Hammond-Kosack et al (1995) Mol. PlantMicrobe Interact. 8,

181-185. Hammond-Kosack et al (1996) Plant Physiol. 110, 1381 -1394.

Hammond-Kosack and Jones (1997) Annul Rev. Plant Physiol.

Plant Mol. Biol. 48, 575-607.

Heilig et al (1997) Large-scale preparation of plasmid DNA.

In Current Protocols in Molecular Biology, Volume 1 (Ausubel et al eds). John Wiley & Sons, Inc, pp. 1.7.1-1.7.3.

Ho et al (1989) Gene 11 , 51-59.

Horsch et al (1985) Science 227, 1229-1231. Hulbert and Bennetzen (1991) Mol . Gen . Genet . 226, 377-382.

Jabs et al (1996) Science 273, 1853-1856.

Jones et al (1994) Science 266, 789-793.

Jones and Jones (1997) Adv. Bot . Res. 24, 89-167. Jones et al (1992) Transgenic Research 1, 285-297.

Kanazin et al (1996) Proc . Natl .Acad . Sci . USA . 93, 11746-

11750.

Keen (1990) Annu. Rev. Genet. 24, 447-463.

Kohm et al (1993) Plant Cell 5, 913-920. Kohm et al (1993) Plant Cell 5, 913-920.

Konieczny and Ausubel (1993) Plant J. 4, 403-410.

Lamb and Dixon (1997) /Annul Rev. Plant Physiol. Plant Mol.

Biol. 48, 251-275.

Leister et al (1998) Proc . Natl . Acad. Sci . USA 95, 370-375. Leister et al (1996) Nature Genet. 14, 421-428

Leonardo and Sedivy (1990) Biotechnology 8, 841-845.

Levine et al (1994) Cell 79, 583-593.

Liharska et al (1996) Genome 39, 485-491.

Lukowitz et al (1996) Cell 84, 61-71. Martin et al (1993) Science 262, 1432-1436.

Maruzyk and Sergeant (1980) Anal. Biochem. 105, 403-404.

McCabe et al (1988) Biotechnology 6, 923-926.

Meksem et al (1995) Mol . Gen . Genet . 249, 74-81.

Michelmore et al (1991) Proc . Natl . Acad. Sci . USA 88, 9828- 9832.

Milligan et al (1998) Plant Cell 10, 1307-1319.

Mindrinos et al (1994) Cell 78, 1089-1099.

Ochman et al (1990) Amplification of flanking sequences by inverse PCR. In PCR Protocols (Innis et al eds) . San Diego: Academic Press, pp.219-227.

Otsuki et al (1972) Virology 50, 45-50.

Padgett et al (1997) Mol. Plant-Microbe Interact. 10, 709-71 5 .

Padgett and Beachy (1993) Plant Cell 5, 577-586.

Parker et al (1993) Plant J. 4, 821-831.

Pruss et al (1997) Plant Cell 9, 859-868. Querci et al (1995) Phytopathology 85, 1003-1010.

Ritter et al (1991) Mol . Gen . Genet . 227, 81-85.

Rossi et al 1998) Proc. Natl. Acad. Sci. USA 95, 9750-9754.

Rouppe et al (1997) Theor. Appl . Genet : 95, 874-880.

Ryals et al (1997) Plant Cell 9, 425-439. Ryals et al (1996) Plant Cell 8, 1809-1819.

Salmeron et al (1996) Cell 86, 123-133.

Sambrook et al (1989) Molecular Cloning: a Laboratory

Manual , 2d edn . New York: Cold Spring Harbour Laboratory

Press . Schmidt and Walter (1994) Cell 78, 919-925.

Scofield et al (1996) Science 274, 2063-2065.

Shizuya et al (1992) Proc . Natl . Acad . Sci . USA 89, 8794-

8797.

Song et al (1997) Plant Cell 9, 1279-1287. Staskawicz et al (1995) Science 268, 661-667.

Tang et al (1996) Science 274, 2060-2063.

Tanksley et al (1992) Genetics 132, 1141-1160.

Thomas et al (1997) The Plant Cell 9, 2209-2224. van der Biezen and Jones (1998) Curr. Biol. 8, 226-227. Vaucheret (1994) C. R. Acad. Sci. Paris. 317, 310-323.

Vos et al (1995) Nucleic Acids Res . 23, 4407-4414.

Warren et al (1998) Plant Cell 10, 1439-1452.

Whitham et al (1996) Proc. Natl. Acad. Sci. USA 93, 8776-

8781. Whitham et al (1994) Cell 78, 1101-1115.

Yu et al (1998) Proc. Natl. Acad. Sci. USA 95, 7819-7824.

Claims

Claims

1. An isolated nucleic acid encoding a polypeptide which is capable of conferring extreme resistance against a pathogen in a plant in which said polypeptide is expressed.

2. A nucleic acid as claimed in claim 1 wherein the pathogen is a plant virus.

3. A nucleic acid as claimed in claim 1 or claim 2 comprising an Rx polynucleotide sequence from Solanum tuberosum .

4. A nucleic acid as claimed in claim 3comprising a nucleotide sequence identical to Seq ID No 1 or Seq ID No 3 or being degeneratively equivalent thereto.

5. A nucleic acid as claimed in claim 3 or claim 4 wherein the nucleotide sequence encodes the Rx polypeptide of Seq ID No 2.

6. An isolated nucleic acid encoding a homologous variant of a nucleotide sequence of any one of claims 3 to 5 having about 50% or more sequence identity therewith and encoding a polypeptide capable of conferring resistance against a pathogen in a plant .

7. A nucleic acid as claimed in claim 6 wherein the resistance conferred is extreme resistance.

8. A nucleic acid as claimed in claim 6 or claim 7 wherein the variant is selected from, or degeneratively equivalent to: an Rx homologue; an Rx allelic variant; an Rx orthologue; or an Rx paralogue, which is in each case obtainable from a plant species .

9. A nucleic acid as claimed in claim 8 wherein the variant is an Rx-linked homologue from a Solanum species.

10. A nucleic acid as claimed in claim 8 or claim 9 wherein the variant is selected from: lllhl; 221h2; Acl5; Ac64;

K39.hom as shown in Fig 7.

11. A nucleic acid as claimed in claim 6 or claim 7 wherein the variant is a homologous resistance gene obtainable from a plant other than Solanum spp.

12. A nucleic acid as claimed in claim 6 or claim 7 wherein the variant is a derivative of a nucleotide sequence of any one of claims 3 to 5 obtainable therefrom by way of nucleotide addition, insertion, or substitution.

13. A nucleic acid as claimed in claim 12 which encodes a resistance polypeptide which is modified with respect to its activated by an elicitor

14. A nucleic acid which is complementary to the nucleic acid of any one of claims 1 to 13.

15. An isolated nucleic acid molecule for use as a probe or primer, said molecule having a nucleotide sequence at least 14, 18, 21, or 24 nucleotides in length, which sequence is present in, or complementary to, a nucleic acid as claimed in any one of claims 3 to 5 , or claim 10.

16. A nucleic acid as claimed in claim 15 which is a primer consisting of 30 or fewer nucleotides.

17. A nucleic acid as claimed in claim 15 or claim 16 which does not encode all or part of the following motifs of the Rx polypeptide of Seq ID No 2 in Fig 1: a leucine zipper; a nucleotide binding site (NBS) ; a leucine rich repeat (LRR) .

18. A nucleic acid as claimed in any one of claims 15 to 17 which encodes all or part of the any of the following motifs of the Rx of Seq ID No 2 in Fig 1: the amide-rich region; the short basic region; the acidic tail region; an Rx gene signature region.

19. A nucleic acid as claimed in any one of claims 15 to 18 which is selected from the following primers:

K14: GCT ACC TCT ACG ATT TCA ACT TCC A Rx5: GTA AAC TGA CAA GCG AGC TAG TT Rx21: GAC ATA TGG ACT ACA GAA GCT TGG Rx6: TAC CTG AAC TAG CAT ATT CAG CCA K26: GTA GTA AAT TCC AAC TTT CG K27: ACG AAA GTT GGA ATT TAC TAC K2: ACC GAA CTT ACA TTT TCC CCA ATT C Rxl6: GCA TGA GAG TGT TGG CTT TGA GTT Rx7: TTC AAA AAT CCC TCT ACA GGC CAT Rx22: GTT CAC GGG TCA CAT CAT GCA TTC C K29: GAG GGA AGC TCG AAA CAT G Rxl5: GTG ATC AAA ATT CAT GTG CAC AAT C Rx8: AAT TGG CCA TGT ATT CAA ACC AAG K20: TCA CAC TGG AAT TGT CTT TCA AGC Rx23 : TGA GCC TAC AGA GAA CAG ATT GGT Rx24: ACC AAT CTG TTC TCT GTA GGC TCA Rx9: TTT ACT CTT ACC TCC TCC GGA TGC T K19: CTT CCA TGC CAC AGA GAA TTC TCC K3 : ACT CGA GGT CCT TAT ACT ATC ATG GA K4: GAA CGA GTT ATT CTT AGA GAT TGC C K17: GCT TGG CGG AAT TCA CAA CAG ATT

Rx-1: GGC AAT TTG TTC ATC TAG ATA CTG AGA GA Rxac-4: TAT TTC AGA GCT CTG GCT AGT CCT CAG AAC ACC

20. A method for selecting a plant comprising a pathogen resistance gene from a plant, which method employs a probe or primer as claimed in any one of claims 15 to 19.

21. A method for identifying or cloning a pathogen resistance gene from a plant, which method employs a probe or primer as claimed in any one of claims 15 to 19.

22. A method as claimed in claim 21 for isolating a homologue as claimed in any one of claims 8 to 11, comprising the steps of : i) producing a plant population in which a resistance trait is segregating. ii) amplifying DNA from individual members of the population with one or more primers as claimed in any one of claims 15 to 19. iii) testing the PCR products for sequence polymorphism that co-segregates with the resistance trait.

23. A method for producing a nucleic acid encoding an Rx derivative comprising the step of modifying a nucleic acid as claimed in any one of claims 1 to 11.

24. A recombinant vector comprising a nucleic acid of any one of claims 1 to 13 , which nucleic acid encodes a resistance polypeptide.

25. A vector as claimed in claim 24 which is capable of replicating in a suitable host.

26. A vector as claimed in claim 24 or claim 25 wherein the nucleic acid is operably linked to a promoter or other regulatory element for transcription in a host cell .

27. A vector as claimed in claim 26 further comprising any one or more of the following: a terminator sequence; a polyadenylation sequence; an enhancer sequence; a marker gene .

28. A vector as claimed in claim 26 or claim 27 wherein the promoter is an inducible promoter.

29. A vector as claimed in any one of claims 25 to 28 which is a plant vector.

30. A vector as claimed in any one of claims 24 to 29 further comprising a sequence encoding an elicitor for the encoded resistance polypeptide.

31. A vector as claimed in claim 30, wherein the elicitor sequence encodes all or part of the coat protein of a virus selected from: Potato Virus X (PVX) ; Narcissus mosaic virus (NMV) ; Nandina virus X (NVX) ; Viola mosaic virus (VMV) ; Cymbidium mosaic virus (CyMV) ; Poplar mosaic virus (PopMV) and White clover mosaic virus (WCIMV) .

32. A vector as claimed in claim 30 or claim 31 wherein transcription or translation of the elicitor is suppressed by the activation of the resistance polypeptide.

33. A vector as claimed in claim 30 or claim 31 wherein transcription or translation of the elicitor is activated in the presence of the pathogen against which the resistance polypeptide confers resistance.

34. A vector as claimed in claim 30 or claim 31 wherein transcription or translation of the elicitor or the resistance polypeptide is activated in a variegated manner.

35. A method comprising the step of introducing a vector as claimed in any one of claims 25 to 34 into a cell.

36. A method for transforming a plant cell, comprising a method as claimed in claim 35, and further comprising the step of causing or allowing recombination between the vector and the plant cell genome to introduce the nucleic acid into the genome .

37. A host cell comprising a vector as claimed in any one of claims 24 to 34.

38. A host cell transformed with a vector as claimed in any one of claims 24 to 34.

39. A host cell as claimed in claim 37 or claim 38 which is a plant cell.

40. A host cell as claimed in claim 39 which is in a plant. O 99/54490

101

41. A method for producing a transgenic plant comprising a method as claimed in claim 36 and further comprising the step of regenerating a plant from the transformed cell .

42. A plant obtainable by the method of claim 41, which plant comprises the cell of claim 39 or claim 40.

43. A plant which is the progeny of a plant as claimed in claim 42, which plant comprises the cell of claim 39 or claim 40.

44. A part or propagule of the plant of claim 42 or claim 43, which part or propagule comprises the cell of claim 39 or claim 40.

45. A resistance polypeptide encoded by the nucleic acid of any one of claims 1 to 13.

46. A method of producing a polypeptide comprising the step of causing or allowing the expression from a nucleic acid of any one of claims 1 to 13 in a suitable host cell.

47. A composition comprising the polypeptide of claim 46.

48. An antibody or fragment thereof, or a polypeptide comprising the antigen-binding domain of the antibody, capable of specifically binding the polypeptide of claim 46.

49. A method for influencing or affecting a resistance trait in a plant, the method comprising use of any one or more of the following: all or part of the nucleic acid of any one of claims 1 to 14; the polypeptide of claim 46; the antibody or fragment or polypeptide comprising the antigen- binding site thereof of claim 48.

50. A method as claimed in claim 49 comprising the step of causing or allowing expression of a nucleic acid according to any one of claims 1 to 13 , which nucleic acid encodes a resistance polypeptide, within a cell of that plant.

51. A method as claimed in claim 50 comprising constitutively over-expressing the resistance polypeptide in the plant .

52. A method as claimed in claim 50 or claim 51 wherein the resistance polypeptide is triggered by contact with an appropriate elicitor or inducer.

53. A method as claimed in claim 52 wherein the expression of the elicitor is under the control of an inducible promoter whereby the activation of the resistance polypeptide can be regulated by the extent to which the promoter is induced.

54. A method as claimed in claim 52 wherein the elicitor post transcriptionally gene silenced whereby the activation of the resistance polypeptide can be regulated by suppressing the post transcriptional gene silencing.

55. A method for establishing gene for gene compatibility between an elicitor and a resistance polypeptide encoded by a nucleic acid as claimed in any one of claims 1 to 13 , which method includes the steps of : (a) causing or permitting the co-expression in cell of the resistance polypeptide with the elicitor,

(b) observing said cell for an HR,

(c) correlating the result of the observation made in (b) with the compatibility of the elicitor and the resistance polypeptide .

56. An isolated nucleic acid comprising a nucleotide sequence encoding the promoter region of the gene encoding the resistance polypeptide of claim 1 or claim 10.