AU2004236279A1 - Genetic sequences of plant pathogen avirulence genes and uses therefor - Google Patents

Description

WO 2004/099417 PCT/AU2004/000602 -1 GENETIC SEQUENCES OF PLANT PATHOGEN AVIRULENTCE G-ENES AND USES THEREFOR 5 FIELD OF THE INVENTION The present invention relates generally to genetic sequences, and more particularly to genetic sequences of avirulence genes of plant pathogens such as rust. The present invention also extends to uses of these genetic sequences to induce disease resistance in plants. The present 10 invention further provides for transgenic plants carrying the subject genetic sequences enabling the generation of disease resistant plants. The present invention is particularly useful for developing disease resistance, particularly rust resistance, in crop or cereal plants. GENERAL 15 Those skilled in the art will be aware that the invention described herein is subject to variations and modifications other than those specifically described. It is to be understood that the invention described herein includes all such variations and modifications. The invention also includes all such steps, features, compositions and compounds referred to or 20 indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. Throughout this specification, unless the context requires otherwise the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the 25 inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein. 30 WO 2004/099417 PCT/AU2004/000602 -2 Bibliographic details of the publications referred to by author in this specification are collected at the end of the description. The references mentioned herein are hereby incorporated by reference in their entirety. Reference herein to prior art, including any one or more prior art documents, is not to be taken as an acknowledgment, or suggestion, that 5 said prior art is common general knowledge in Australia or forms a part of the common general knowledge in Australia. As used herein, the term "derived from" shall be taken to indicate that a particular integer or group of integers has originated from the species specified, but has not necessarily been 10 obtained directly from the specified source. This specification contains nucleotide sequence information prepared using the program PatentIn Version 3.1. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (e.g. <210>1, <210>2, etc). 15 The length, type of sequence (DNA) and source organism for each nucleotide sequence are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the specification are defined by the term "SEQ ID NO:", followed by the sequence identifier (e.g. SEQ ID NO: 1 refers to the sequence in the sequence listing designated as <400>1). 20 The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents Thymidine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K 25 represents Guanine or Thymidine, S represents Guanine or Cytosine, W represents Adenine or Thymidine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymidine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.

WO 2004/099417 PCT/AU2004/000602 -3 BACKGROUND TO THE INVENTION The rapidly increasing sophistication of recombinant DNA technology is greatly facilitating the efficacy of commercially important agricultural processes. Of particular concern is the 5 effect of plant diseases on the efficacy of these agricultural processes. Plant diseases represent a major contributing factor in crop losses capable of causing economically significant down turn in productivity. The development, therefore, of disease resistant plants is an important goal in agricultural and horticultural research. 10 Genetically determined disease resistance is very important for protection of crop plants from disease, and genes conditioning resistance to plant diseases have been investigated extensively in agriculture. Of particular economic importance are genes controlling resistance to rust and mildew. Rust is an especially significant problem amongst broad acre crops such as wheat, barley and cereal grains and is caused by infection with a class of fungi 15 known as the Basidiomycetes. Although rust resistance genes are a potentially invaluable genetic resource in agriculture, the molecular basis of major gene resistance to rusts and many other fungi is still not well known, with only a very few exceptions. Genetic analysis indicates that rust resistance genes control specific recognition of the 20 products of rust avirulence genes. This may occur by a direct protein-protein interaction between the products of the resistance gene and the avirulence gene, or it may be indirect. For example, the expressed avirulence protein may act as an enzyme in the formation of a product that is recognized by the resistance gene product. In developing disease resistant varieties using disease resistance genes, plant -breeders deploy resistance genes that match 25 the avirulence genes present in the local strains of the pathogens. The pathogen populations are dynamic and frequently new pathogenic strains arise by any number of means such as by mutation, recombination or accidental or natural introduction of new pathogenic strains. The existing disease resistant varieties then become susceptible to the new pathogenic strains. Plant breeders are then forced to develop new disease resistant varieties. At present, 30 breeders generally use resistance genes that exist in any one plant species or its relatives as their pool of new resistance genes for that species.

WO 2004/099417 PCT/AU2004/000602 -4 Many instances of genetic disease resistance in plants are characterized by a "gene-for-gene" interaction, in which a plant resistance (R) gene provides resistance to only those pathogen strains carrying a corresponding avirulence (Avr) gene. This relationship was first elucidated 5 in the flax-flax rust system (Flor 1971), but has been observed in many other disease systems. A simple model to explain the "gene-for-gene" observation is that resistance genes encode receptors that recognise the direct or indirect products of pathogen avirulence genes (van der Biezen and Jones, 1998). Specific recognition of invading pathogens results in the subsequent triggering of diverse defense responses, any or all of which combine to provide 10 resistance to multiplication or spread of the pathogen or amelioration of the damage caused by the pathogen. Many examples of cloned plant resistance (R) genes have now been reported, and many encode proteins with leucine-rich repeat regions and a nucleotide triphosphate-binding domain. 15 In some instances, expression of cloned avirulence genes in plants has been shown to induce the plant defense responses when the appropriate resistance gene is also present in the plant. (Orbach et al, 2000; Gopalan et al, 1996; Scofield et al, 1996; van den Ackerveken et al, 1996). Where the expression is sufficient to cause cell death, such response can be considered a receptor mediated programmed cell death which kills infected cells and can 20 limit the pathogen. Thus it is possible that this "gene-for-gene type" recognition could be used to engineer disease resistance in crop plants if the expression of an R/Avr gene pair can be induced during the infection process. Several avirulence genes have been isolated and characterized from ftungal pathogens. The 25 avirulence genes Avr2, Avr4 and Avr9 were isolated from Cladosporium fulvum and shown to encode small secreted peptides of approximately 23 amino acid residues. These products are recognized by the products of the tomato resistance genes Cf-2, Cf-4 and Cf-9 respectively (van den Ackerveken et al., 1992; Joosten et al., 1994; Luderer et al., 2002). The race-specific elicitor NIP 1, a small protein of 60 residues secreted by the barley 30 pathogen Rhynchosporium secalis, is encoded by the nipl gene of the fungus. The NIP1 protein elicits defense responses in barley cultivars carrying the resistance gene Rrsl (Rohe WO 2004/099417 PCT/AU2004/000602 -5 et al., 1995). The rice blast avirulence gene AVR-Pita was isolated from the pathogenic fungus Magnaporthe grisea. The protein product of this gene has features typical of metalloproteases, in particular neutral zinc metalloproteases (Orbach et al., 2000). There is some evidence that the AVR-Pita avirulence product interacts directly with the 5 corresponding gene product encoded by the resistance gene, Pi-ta from rice (Jia et al., 2000). None of these avirulence genes are from rust fmungi. Furthermore, the avirulence gene products are generally thought to be secreted from the fungus and act in the apoplast, outside of the plant cell membrane. 10 International Patent Publication WO91/15585 describes protection of plants by expressing an avirulence gene and a resistance gene in a regulated manner, and describes the isolation of the avr9 gene. International Patent Publication WO99/43823 describes a similar concept. However, neither describes the use of avirulence genes obtained from rust fungi, or of fungal avirulence genes whose protein products act predominantly in the cytoplasm of the host 15 plant cells. Resistance genes at the L, M, N and P loci of flax (Linum usitatisimum), which recognize avirulence products from the flax rust fungus (Melampsora lini) have previously been identified (Anderson et al, 1997; Lawrence et al, 1996; Ellis et al 1999; Luck et al, 2000; 20 Dodds et al, 2001a; Dodds et al, 2001b; see also International Patent Application No. PCT/AU95/00240). The cloning of the avirulence gene sequences of the present invention from rust fungi provides the means of generating transgenic plants with de novo, increased or otherwise 25 enhanced rust resistance. In addition, it has been demonstrated that these genes induce defence responses if expressed in flax or tobacco along with the corresponding resistance genes. Accordingly, the present invention extends to the use of these avirulence (Avr) and corresponding resistance (R) genes in combination to induce disease resistance responses in plants. The present invention also permits the screening through genetic means to identify 30 similar avirulence genes in other plant pathogens for use in developing or enhancing rust resistance in commercially and economically important plant species. Furthermore, the WO 2004/099417 PCT/AU2004/000602 -6 application of knowledge of the molecular basis behind Avr and R gene action, and the specificity thereof, offers the potential of a new source of genes produced by a variety of recombinant techniques. 5 SUMMARY OF THE INVENTION In one aspect, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence of nucleotides encoding an avirulence product of a plant rust fungus. 10 In another aspect, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence of nucleotides encoding an avirulence product of a plant rust fungus which is capable of being recognised by a disease resistance gene product in a plant, particularly a disease resistance 15 gene product in a crop or cereal plant. In a specific aspect, the invention also provides an isolated nucleic acid molecule comprising a sequence of nucleotides selected from: 20 (i) a nucleotide sequence selected from the group consisting of the coding regions of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; (ii) a nucleotide sequence having at least 45% identity overall to a sequence selected from the group consisting of the coding regions of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 25 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; (iii) a nucleotide sequence capable of hybridising under at least low stringency conditions to at least about 20 contiguous nucleotides complementary to a sequence selected from the group consisting of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; 30 (iv) a nucleotide sequence encoding a 2F2 protein; and (v) a nucleotide sequence that is complementary to any one of (i) to (iv).

WO 2004/099417 PCT/AU2004/000602 -7 In a further aspect, the present invention provides a gene construct comprising a nucleic acid molecule as described above, for example, an expression gene construct produced for expression of the avirulence product of a plant rust fungus in a bacterial, insect, yeast, plant, 5 fungal or animal cell. A further aspect of the invention contemplates an isolated cell comprising a non-endogenous nucleic acid molecule as described above, preferably wherein said nucleic acid molecule is present in said cell in an expressible format. 10 A further aspect of the invention contemplates a transformed plant comprising a nucleic acid molecule as described above introduced into its genome in an expressible format, particularly a plant which has increased disease resistance compared to an isogenic non transformed plant. The nucleic acid molecule may be co-expressed with a corresponding 15 disease resistance gene in the plant. This aspect of the invention clearly extends to any plant cells, tissues, organs or other plant parts, plant seeds, or progeny plants, cells, tissues, organs or other parts, that are derived from the primary transformed plant. The present invention also provides a method of identifying a nucleic acid sequence which 20 encodes an avirulence product of a plant rust fungus, which comprises (i) hybridising a probe or primer to nucleic acid of a plant rust fungus; and either (ii) detecting said hybridisation; or (iii) performing an amplification reaction and detecting the amplified product; wherein said probe or primer comprises at least about 20 contiguous nucleotides of (a) a 25 nucleotide sequence encoding an avirulence product of a plant rust fungus, particularly flax rust fungus, or a degenerate or complementary nucleotide sequence thereto, or (b) a nucleotide sequence which is genetically linked to a gene encoding an avirulence product of a plant rust fungus. Optionally, the method may further comprise the step of isolating the hybridised or amplified nucleic acid sequence. 30 WO 2004/099417 PCT/AU2004/000602 -8 This invention further contemplates a method of inducing a disease resistance response in a plant, which comprises the step of transforming the plant, or a cell, tissue, organ or other part thereof, with a nucleic acid molecule as described above to obtain expression of an avirulence product of a plant rust fungus in the plant. The nucleic acid molecule may be co 5 expressed with a corresponding disease resistance gene in the plant. The corresponding disease resistance gene may be either endogenous or non-endogenous in the plant. DETAILED DESCRIPTION OF THE INVENTION 10 In one aspect, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence of nucleotides encoding an avirulence product of a plant rust fungus. In a preferred embodiment of the invention, the plant rust fungus is a pathogen of flax. 15 In another aspect, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence of nucleotides encoding an avirulence product of a plant rust fungus which is capable of being recognised by a disease resistance gene product in a plant, particularly a disease resistance gene product in a crop or cereal plant. In a preferred embodiment, the avirulence product is 20 capable of being recognised by a product of one or more of the disease resistance genes L, M, N or P which control host resistance to rust in flax, including the L5, L6, L7, L2 or L10 alleles. As used herein, "flax" includes any species of Linum, particularly cultivated flax, L. 25 usitatisimum. The avirulence product encoded by the isolated nucleic acid molecule preferably functions predominantly in the cytoplasm of a plant cell. Alternatively, it may function predominantly in the apoplast , i.e. be predominantly secreted from the cell or be located partly or entirely 30 outside of the plant cell membrane. The avirulence product encoded by the isolated nucleic acid molecule preferably comprises a signal sequence which functions for secretion of the WO 2004/099417 PCT/AU2004/000602 -9 protein, however the signal sequence may be removed to provide a truncated avirulence product designed for expression in the cytoplasm. The present invention also provides an isolated nucleic acid molecule comprising a sequence 5 of nucleotides selected from: (i) a nucleotide sequence selected from the group consisting of the coding regions of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; 10 (ii) a nucleotide sequence having at least 45% identity overall to a sequence selected from the group consisting of the coding regions of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; (iii) a nucleotide sequence capable of hybridising under at least low stringency conditions to at least about 20 contiguous nucleotides complementary to a sequence selected 15 from the group consisting of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; (iv) a nucleotide sequence encoding a 2F2 protein; and (v) a nucleotide sequence that is complementary to any one of (i) to (iv). 20 An isolated nucleic acid molecule as described above is at times hereinafter referred to as "an avirulence gene" according to the invention. An "avirulence gene" more generally refers to a gene which, when present in a cell of a pathogen, functions to decrease the virulence or pathogenicity or ability to proliferate of the pathogen cell in or on at least one host cell or host plant or a part thereof, relative to the absence of the avirulence gene from the cell of the 25 pathogen. An "avirulence product" is the RNA and/or protein product encoded by an avirulence gene, particularly a protein product encoded by the gene. The gene would ordinarily, but not necessarily, be expressed to produce a protein product by transcription and translation of the gene. In this context, the cell of the pathogen is commonly a fungal pathogen and particularly a rust fungus. It is thought that the avirulence gene may directly 30 or indirectly produce a product that triggers a defence response in the host cell, particularly in the presence of a corresponding resistance gene in the host cell. However, the avirulence WO 2004/099417 PCT/AU2004/000602 -10 gene may also function heterologously in a host cell such as a plant cell to increase the level of resistance to the pathogen cell, even in the absence of a specific corresponding resistance gene. In the context of this application, "avirulence genes" include "avirulence-like genes" which are genes that encode proteins that are homologous to known avirulence proteins, but 5 where the resistance gene product that corresponds to or interacts with the "avirulence-like protein" that is the product of the "avirulence-like gene" has not been identified. It will be readily understood that an avirulence gene may function to decrease the virulence of the cell of the pathogen in or on one host but not necessarily on all hosts or in all circumstances. 10 Specific nucleotide sequences encoding an avirulence product of the flax rust fungus in accordance with the present invention correspond with the genomic sequences of SEQ ID NOs: 1, 2 and 3 as follows: 2F2-A : nucleotides 12084-12116, 12202-12268 and 12484-12984 of SEQ ID NO: 1 2F2-B : nucleotides 19427-19460, 19546-19612 and 19828-20328 of SEQ ID NO: 1 15 2F2-C : nucleotides 9256-9558, 9644-9710 and 9926-12426 of SEQ ID NO: 2 2F2-D : nucleotides 3600-3632, 3718-3784 and 4000-4500 of SEQ ID NO: 3. The nucleotide sequence of the 2F2-A cDNA clone is set out in Figure 5, together with the predicted amino acid sequence of the 2F2-A transcript. Figure 6A is an amino acid sequence 20 alignment of the predicted products of the flax rust 2F2-A, 2F2-B, 2F2-C and 2F2-D avirulence genes. Figure 10 is a eDNA alignment of the flax rust 2F2-A, 2F2-B, 2F2-C and 2F2-D avirulence genes. Specific nucleotide sequences which have been identified as encoding avirulence products 25 are set out in the accompanying Sequence Listing, as follows: 2F2-A (SEQ ID NO: 4) 2F2-B (SEQ ID NO: 5) 2F2-C (SEQ ID NO: 6) 2F2-D (SEQ ID NO: 7) 30 2D2-E (SEQ ID NO: 8) 2F2-F (SEQ ID NO: 9) WO 2004/099417 PCT/AU2004/000602 -11 2F2-G (SEQ ID NO: 10) 2F2-H (SEQ ID NO: 11) 2F2-I (SEQ ID NO: 12) 2F2-J (SEQ ID NO: 13) S2F2-K (SEQ ID NO: 14) 2F2-L (SEQ ID NO: 15) [Note: the 2F2-A to 2F2-D sequences are eDNA sequences (no introns), and include primer sequences at each end. The coding sequence is from 104 to 553. Sequences 2F2-E and 2F2 10 F are RT-PCR (i.e. cDNA) sequences. The 5' UTR (82bp) is underlined and the coding sequence is from 83 to 532. Sequences 2F2-G to 2F2-L were amplified from genomic DNA and therefore include the intron sequences (bp 13-97 and 165-379; underlined in sequence 2F2-G). The coding sequence is from 383-832.] 15 Predicted amino acid sequences for these avirulence products are also set out in the accompanying Sequence Listing, as follows: 2F2-A (SEQ ID NO: 16) 2F2-B (SEQ ID NO: 17) 2F2-C (SEQ ID NO: 18) 20 2F2-D (SEQ ID NO: 19) 2F2-E (SEQ ID NO: 20) 2F2-F (SEQ ID NO: 21) 2F2-G (SEQ ID NO: 22) 2F2-H (SEQ ID NO: 23) 25 2F2-I (SEQ ID NO: 24) 2F2-J (SEQ ID NO: 25) 2F2-K (SEQ ID NO: 26) 2F2-L (SEQ ID NO: 27) 30 As used herein, the term "avirulence product" is used to refer to both the full-length amino acid product encoded by an avirulenee gene, as well as to fragments thereof which have WO 2004/099417 PCT/AU2004/000602 -12 avirulence activity. This term also encompasses truncated avirulence products, particularly truncated products in which the signal peptide sequence (see Figure 6A) is removed. As used herein, the term "2F2 protein" includes products comprising an amino acid sequence 5 selected from the sequences , 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L above, as well as products having at least 45% identity overall to such sequences. Preferably, the percentage identity is at least 50% or 60% more preferably at least about 70% or about 80%, and even more preferably at least about 90%. 10 Preferably, the percentage identity overall of a nucleotide sequence to the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-1, 2F2-J, 2F2-K and 2F2-L sequences is at least 50%, more preferably at least about 60%, or at least about 70%. Even more preferably, the percentage identity is at least about 80%, or at least about 90%. 15 For the purposes of defining the level of stringency, reference can conveniently be made to Sambrook et al. (1989), which is herein incorporated by reference, where the washing steps at pages 9.52-9.57 are considered high stringency. A "low" stringency wash is defined herein as being in approximately 1 x SSC, 0.1-0.5% (w/v) SDS at 37-45 0 C for 2-3 hours. Depending on the source and concentration of nucleic acid involved in the hybridisation, 20 alternative conditions of stringency may be employed such as "medium" stringent conditions which are considered herein to be a wash in about 1 x SSC, 0.25-0.5% (w/v) SDS at > 45 0 C for 2-3 hours or "high" stringent conditions as disclosed by Sambrook et al. (1989). In addition to nucleic acid molecules comprising sequences encoding an avirulence product 25 of the flax rust fungus, the present invention also extends in particular to nucleic acid molecules comprising sequences encoding avirulence products of other rust fungi of plants as set out, by way of example, in Table 2 (see also: Diseases of Field Crops, Dickson JG; Mc-Graw-Hill Book Company, New York, 1956. The Cereal Rusts, Volume II. Diseases, distribution, epidemiology and control. Edited by Roelfs AP and Bushnell WR. Academic 30 Press, Orlando, US, 1985). Such nucleic acid molecules comprising sequences encoding avirulence products of other rust fungi of plants can be identified by the genetic screening WO 2004/099417 PCT/AU2004/000602 - 13 method described herein, using appropriate gene libraries and hybridisation probes or primers derived from the flax rust avirulence gene sequences or genetic markers linked thereto as disclosed hereinafter. 5 According to a further aspect of the present invention, there is provided a gene construct comprising a nucleic acid molecule as described above, for example, an expression gene construct produced for expression of the avirulence product of a plant rust fungus in a bacterial, insect, yeast, plant, fungal or animal cell. 10 Reference herein to "genes" is to be taken in its broadest context and includes a classical genomic gene as well as mRNA or eDNA corresponding to the coding regions (i.e. exons) of the gene. The term "gene" is also used to describe synthetic or fusion molecules encoding all or part of a functional product. Preferred avirulence genes are derived from a naturally occurring avirulence gene by standard recombinant techniques. Generally, an avirulence 15 gene may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or additions. Nucleotide insertional derivatives of the avirulence gene of the present invention include 5' and 3' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides. Insertional nucleotide sequence variants are those in which one or more nucleotides are introduced into a predetermined site in the nucleotide sequence 20 although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterised by the removal of one or more nucleotides from the sequence. Substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide inserted in its place. Such a substitution may be "silent" in that the substitution does not change the amino acid defined 25 by the codon. Alternatively, substituents are designed to alter one amino acid for another similar acting amino acid. Typical substitutions are those made in accordance with the following: WO 2004/099417 PCT/AU2004/000602 -14 Suitable residues for amino acid substitutions Original Residue Exemplary Substitutions Ala Ser 5 Arg Lys Asn Gin; His Asp Glu Cys Ser Gln Asn 10 Glu Asp Gly Ala His Asn; Gin Ile Leu; Val Leu Ile; Val 15 Lys Arg; Gln; Glu Met Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser 20 Trp Tyr Tyr Trp; Phe Val Ile; Leu Those skilled in the art will be aware that expression of an avirulence gene, or a 25 complementary sequence thereto, in a cell, requires said gene to be placed in operable connection with a promoter sequence. The choice of promoter for the present purpose may vary depending upon the level of expression required and/or the tissue, organ and species in which expression is to occur. 30 Placing a nucleic acid molecule under the regulatory control of a promoter sequence means positioning said molecule such that expression is controlled by the promoter sequence. A promoter is usually, but not necessarily, positioned upstream, or at the 5'-end, of the nucleic acid molecule it regulates. Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene. In the 35 construction of heterologous promoter/structural gene combinations, it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting (i.e., the gene from which the promoter is derived). As is known in the art, WO 2004/099417 PCT/AU2004/000602 -15 some variation in this distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting (i.e., the gene from which it is derived). Again, as is known in the art, 5 some variation in this distance can also occur. Examples of promoters suitable for use in gene constructs of the present invention include promoters derived from the genes of viruses, yeast, moulds, bacteria, insects, birds, mammals and plants, preferably those capable of functioning in isolated yeast or plant cells. 10 The promoter may regulate expression constitutively, or differentially, with respect to the tissue in which expression occurs. Alternatively, expression may be differential with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, or temperature, or the presence of a pathogen. The nature of the promoter depends on the desired outcome. For certain applications, it is preferable to 15 express the avirulence gene of the invention specifically, in particular tissues of a plant, such as, for example, to avoid any pleiotropic effects that may be associated with expressing said gene throughout the plant. As will be known to the skilled artisan, tissue-specific or cell specific promoter sequences may be required for such applications. For expression in particular plant tissues, reference is made to the publicly available or readily available 20 sources of promoter sequences known to those skilled in the art. In a preferred embodiment, the promoter is an inducible promoter that is preferentially expressed in the presence of a plant pathogen on the plant, for example only in the presence of plant disease. The inducible promoter may need to be tightly regulated to prevent 25 unnecessary cell death and yet be expressed in the presence of the pathogen. A low level of expression in the absence of the pathogen may be acceptable, indeed may even pre-induce resistance in the plant. The pathogen-inducible promoter may be any of those known in the art, for example the promoters from rust-induced genes such as the promoters offisl from flax (Roberts et al 1995) and its maize and barley homologues (misl and bisl, Ayliffe et al 30 2002). Homologues have also been described in wheat and Arabidopsis and are present in many other plants (Ayliffe et al 2002). Other characterized pathogen-inducible promoters WO 2004/099417 PCT/AU2004/000602 -16 include those from: the tobacco gene TobRB7 (Opperman et al 1994), which is induced during nematode infection; the tomato gene CEVI-1 (Mayda et al 2000) which is induced during infection by ToMV or citrus exocortis viroid; the potato prpl-1 gene (Martini et al 1993), which is induced during infection by Phytophthora infestans, Globodera spp 5 (nematode and Glomus spp (mycorrhizae). Other examples of pathogen-inducible promoters are generally those from the Pathogenesis Related (PR) genes which are highly induced during incompatible interactions or in systemic acquired resistance (SAR), but are often also induced more weakly during compatible infections. Some examples of these promoters which have been characterized include those from: the PRB-lb gene of tobacco (Eyal et al 10 1993) which is induced by various pathogens; AtPRBl, from Arabidopsis (Santamaria et al 2001) induced by ethylene and jasmonate signalling; bean chitinase (Roby et al 1990), which is induced during various fungal infections in transgenic tobacco; bean chalcone synthase (Stermer et al 1990) which is induced during Pseudomonas syringae infection in transgenic tobacco; a tobacco sesquiterpene cyclase gene (Yin et al 1997) induced by 15 microbial pathogens; and tobacco HSR203J (Pontier et al 2001) which is induced during incompatible plant-pathogen interactions. Many other PR class genes are induced in various infections/defense responses (Somssich and Hahlbrook, 1998). In addition, genome-wide expression studies are now identifying new pathogen responsive genes (Wan et al., 2002) and the promoters of some of these genes may prove useful for controlling expression of 20 rust-derived Avr genes. The promoter may be expressed locally at or near the site of pathogen infection. Alternatively, the promoter may be wound inducible. The promoter may be a weak promoter or modified to alter, particularly weaken, the expression level. One particular way to modify 25 a promoter is to delete 5' portions such as enhancer elements. Examples of promoters which are generally useful for expression in plants include the CaMV 35S promoter, NOS promoter, octopine synthase (OCS) promoter, Arabidopsis thaliana SSU gene promoter, the meristem-specific promoter (meril), napin seed-specific 30 promoter, actin promoter sequence, sub-clover stunt virus promoters (International Patent Application No. PCT/AU95/00552), and the like. In addition to the specific promoters WO 2004/099417 PCT/AU2004/000602 -17 identified herein, cellular promoters for so-called housekeeping genes are useful. Promoters derived from genomic gene sequences described herein are particularly contemplated for regulating expression of avirulence genes, or complementary sequences thereto, in plants. Inducible promoters, such as, for example, a heat shock-inducible promoter, heavy metal 5 inducible promoter (e.g. metallotheinin gene promoter), ethanol-inducible promoter, or stress-inducible promoter, may also be used to regulate expression of the introduced nucleic acid of the invention under specific environmental conditions. For expression in yeast or bacterial cells, it is preferred that the promoter is selected from the 10 group consisting of: GALl, GALIO, CYC1, CUPI, PGKl, ADH2, PHO5, PRB1, GUTI, SP013, ADH1, CMV, SV40, LACZ, T3, SP6, TS, and T7 promoter sequences. The gene construct may further comprise a terminator sequence and be introduced into a suitable host cell where it is capable of being expressed to produce a recombinant dominant 15 negative polypeptide gene product or alternatively, a co-suppression molecule, a ribozyme, gene silencing or antisense molecule. The term "terminator" refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Eukaryotic terminators are 3'-non-translated DNA 20 sequences containing a polyadenylation signal, which facilitates the addition of poly(A) sequences to the 3'-end of a primary transcript. Terminators active in cells derived from viruses, yeast, moulds, bacteria, insects, birds, mammals and plants are known and described in the literature. They may be isolated from 25 bacteria, fungi, viruses, animals and/or plants. Examples of terminators particularly suitable for use in the gene constructs of the present invention include the nopaline synthase (NOS) gene terminator of Agrobacterium tumefaciens, the terminator of the Cauliflower mosaic virus (CaMV) 35S gene, the zein gene 30 terminator from Zea mays, the Rubisco small subunit (SSU) gene terminator sequences, subclover stunt virus (SCSV) gene sequence terminators (International Patent Application WO 2004/099417 PCT/AU2004/000602 - 18 No. PCT/AU95/00552), and the terminator of the Flaveria bidentis malic enzyme gene meA3 (International Patent Application No. PCT/AU95/00552). Those skilled in the art will be aware of additional promoter sequences and terminator 5 sequences suitable for use in performing the invention. Such sequences may readily be used without any undue experimentation. The gene constructs of the invention may further include an origin of replication sequence which is required for replication in a specific cell type, for example a bacterial cell, when 10 said gene construct is required to be maintained as an episomal genetic element (e.g. plasmid or cosmid molecule) in said cell. Preferred origins of replication for use in bacterial cells include, but are not limited to, thefl ori and colE1 origins of replication. The 2-micron origin of replication may be used in gene 15 constructs for use in yeast cells. The gene construct may further comprise a selectable marker gene or genes that are functional in a cell into which said gene construct is introduced. As used herein, the term "selectable marker gene" includes any gene which confers a phenotype on a cell in which it 20 is expressed to facilitate the identification and/or selection of cells which are transfected or transformed with a gene construct of the invention or a derivative thereof. Suitable selectable marker genes contemplated herein include the ampicillin resistance (Ampr), tetracycline resistance gene (Tcr), bacterial kanamycin resistance gene (Kanr), 25 phosphinothricin resistance gene, neomycin phosphotransferase gene (nptll), hygromycin resistance gene, 13-glucuronidase (GUS) gene, chloramphenicol acetyltransferase (CAT) gene and luciferase gene, amongst others. In a preferred embodiment of the invention, the gene construct is a binary gene construct, 30 more preferably a binary gene construct comprising a selectable marker gene selected from the group consisting of: bar, nptII and spectinomycin resistance genes. Those skilled in the WO 2004/099417 PCT/AU2004/000602 -19 art will be aware of the chemical compounds to which such selectable marker genes confer resistance. In an even more preferred embodiment, the binary construct comprises the Streptomnyces 5 hygroscopicus bar gene, placed operably in connection with the CaMV 35S promoter sequence. Still more preferably, the binary construct comprises the Streptomyces hygroscopicus bar gene, placed operably in connection with the CaMV 35S promoter sequence and upstream of the terminator sequence of the octopine synthase (ocs) gene. 10 A further aspect of the invention contemplates an isolated cell comprising a non-endogenous nucleic acid molecule as described above, preferably wherein said nucleic acid molecule is present in said cell in an expressible format. As used herein, the word "cell" shall be taken to include an isolated cell, or a cell contained 15 within organised tissue, a plant organ, or whole plant. Preferably the cell is a bacterial cell, such as, for example, E.coli or A. tumefaciens, or cell of a plant, which may be monocotyledonous or dicotyledonous, such as flax or other species of Linum, or a grain crop or cereal plant such as wheat, barley, maize, rye, lupin or rice, or wild 20 varieties of such plants. Even more preferably, the cell is an Agrobacteriumn tumefaciens strain carrying a disarmed Ti plasmid, such as, for example, the Agrobacterium tumefaciens strain designated AGL1. However, as will be understood by those skilled in the art, the isolated nucleic acid of the present invention may be introduced to any cell and maintained or replicated therein, for the purposes of generating probes or primers, or to produce 25 recombinant avirulence product, or a peptide derivative thereof. Accordingly, the present invention is not limited by the nature of the cell. Those skilled in the art will be aware that whole plants may be regenerated from individual transformed cells. Accordingly, the present invention also extends to any plant material 30 which comprises a gene construct according to any of the foregoing embodiments or WO 2004/099417 PCT/AU2004/000602 - 20 expresses a sense, antisense, ribozyme, PTGS or co-suppression molecule, and to any cell, tissue, organ, plantlet or whole plant derived from said material. A further aspect of the invention contemplates a transformed plant comprising a nucleic acid 5 molecule as described above introduced into its genome in an expressible format, particularly a plant which has increased disease resistance compared to an isogenic non transformed plant. The nucleic acid molecule may be co-expressed with a corresponding disease resistance gene in the plant. This aspect of the invention clearly extends to any plant cells, tissues, organs or other plant parts, plant seeds, or progeny plants, cells, tissues, organs 10 or other parts, that are derived from the primary transformed plant. The term "endogenous" as used herein refers to the normal complement of a stated integer which occurs in an organism in its natural setting or native context (i.e. in the absence of any human intervention, in particular any genetic manipulation). 15 The term "non-endogenous" as used herein shall be taken to indicate that the stated integer is derived from a source which is different to the plant material, plant cell, tissue, organ, plantlet or whole plant into which it has been introduced. The term "non-endogenous" shall also be taken to include a situation where genetic material from a particular species is 20 introduced, in any form, into an organism belonging to the same species as an addition to the normal complement of genetic material of that organism. Preferably, the plant material, plant cell, tissue, organ, plantlet or whole plant comprises or is derived from a crop or cereal plant as described herein, or a tissue, cell or organ culture of 25 any of said plants or the seeds of any of said plants. The present invention extends to the progeny and clonal derivatives of a plant according to any one of the embodiments described herein. As will be known to those skilled in the art, transformed plants are generally produced by 30 introducing a gene construct, or vector, into a plant cell, by transformation or transfection means. The isolated nucleic acid molecule of the invention, especially the avirulence gene of WO 2004/099417 PCT/AU2004/000602 -21 the invention, or a gene construct comprising same, is introduced into a cell using any known method for the transfection or transformation of a plant cell. Wherein a cell is transformed by the gene construct of the invention, a whole plant may be regenerated from a single transformed cell, using methods known to those skilled in the art. 5 By "transfect" is meant that the avirulence gene or an antisense molecule, co-suppression molecule, PTGS, or ribozyme comprising sequences derived from the avirulence gene, is introduced into a cell without integration into the cell's genome. Alternatively, a gene construct comprising said gene, said molecule, or said ribozyme, placed operably under the 10 control of a suitable promoter sequence, can be used. By "transform" is meant the avirulence gene or an antisense molecule, co-suppression molecule, PTGS, or ribozyme comprising sequences derived from the avirulence gene, is introduced into a cell and integrated into the genome of the cell. Alternatively, a gene 15 construct comprising said gene, said molecule, or said ribozyme, placed operably under the control of a suitable promoter sequence, can be used. Means for introducing recombinant DNA into plant cells or tissue include, but are not limited to, direct DNA uptake into protoplasts, PEG-mediated uptake to protoplasts, 20 electroporation, microinjection of DNA, microparticle bombardment of tissue explants or cells, vacuum-infiltration of tissue with nucleic acid, and T-DNA-mediated transfer from Agrobacterium to the plant tissue. For example, transformed plants can be produced by the method of in planta transformation 25 method using Agrobacterium tumefaciens, wherein A. tumnefaciens is applied to the outside of the developing flower bud and the binary vector DNA is then introduced to the developing microspore and/or macrospore and/or the developing seed, so as to produce a transformed seed. Those skilled in the art will be aware that the selection of tissue for use in such a procedure may vary, however it is preferable generally to use plant material at the 30 zygote formation stage for in planta transformation procedures.

WO 2004/099417 PCT/AU2004/000602 - 22 Alternatively, microparticle bombardment of cells or tissues may be used, particularly in cases where plant cells are not amenable to transformation mediated by A. tumefaciens. In such procedures, micropartiele is propelled into a cell to produce a transformed cell. Any suitable biolistic cell transformation methodology and apparatus can be used in performing 5 the present invention. Stomp et al. (U.S. Patent No. 5,122,466) or Sanford and Wolf (U.S. Patent No. 4,945,050) discloses exemplary apparatus and procedures. When using biolistic transformation procedures, the genetic construct may incorporate a plasmid capable of replicating in the cell to be transformed. Exemplary microparticles suitable for use in such systems include 1 to 5 micron gold spheres. The DNA construct may be deposited on the 10 microparticle by any suitable technique, such as by precipitation. A whole plant may be regenerated from the transformed or transfected cell, in accordance with procedures well known in the art. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a gene construct of 15 the present invention and a whole plant regenerated therefrom. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue 20 (e.g., cotyledon meristem and hypocotyl meristem). The term "organogenesis", as used herein means a process by which shoots and roots are developed sequentially from a meristematic centre. 25 The term "embryogenesis", as used herein, means a process by which shoots and roots develop together in a concerted fashion (not sequentially), whether from somatic cells or gametes. The generated transformed plants may be propagated by a variety of means, such as by 30 clonal propagation or classical breeding techniques. For example, a first generation (or Tl) WO 2004/099417 PCT/AU2004/000602 - 23 transformed plant may be selfed to give homozygous second generation (or T2) transformant and the T2 plants further propagated through classical breeding techniques. The avirulence gene of the present invention may be used to induce a disease resistance 5 response in plants by co-expression with the corresponding resistance genes. Alternatively, the avirulence gene of the invention may be used by itself to trigger a generalized defence response in a host plant in the absence of an added resistance gene, relying on one or more endogenous resistance genes in the plant which have some ability to recognize the avirulence product. Such responses are similar to the systemic acquired resistance (SAR) response and 10 are well known to those skilled in the art. Accordingly, in a further aspect the present invention provides a method of inducing a disease resistance response in a plant, which comprises the step of transforming the plant, or a cell, organ or other part thereof, with a nucleic acid molecule as described above to obtain 15 expression of an avirulence product of a plant rust fungus in the plant. The nucleic acid molecule may be co-expressed with a corresponding disease resistance gene in the plant. As used herein, the expression "inducing a disease resistance response" is used to include de novo, increased or otherwise enhanced disease resistance in a plant. 20 As described above, the corresponding disease resistance gene may be either endogenous or non-endogenous in the plant. In a particular embodiment, the transformed plant co-expresses a flax rust avirulence gene 25 with a corresponding flax resistance gene so as to induce a rust resistance response in the plant. As previously described, the transformed plant is preferably flax or other species of Linum, or a grain crop or cereal plant such as wheat, barley, maize, rye, lupin or rice, or wild 30 varieties of such plant. This aspect of the invention also extends to any plant cells, tissues, organs or other parts, or progeny plants, cells, tissues, organs or other parts, that are derived WO 2004/099417 PCT/AU2004/000602 -24 from the primary transformed plant. In yet another aspect, the present invention provides a method of screening to identify avirulence genes in plant pathogens other than the flax rust fungus (Melampsora lini), by 5 homology based methods using a probe or primer derived from the avirulence genes of the flax rust fungus disclosed herein, or alternatively a probe or primer derived from the highly conserved flax rust secl4 homolog as a genetic marker for linked avirulence loci. Alternatively, the present invention clearly encompasses within its scope, isolated nucleic acid molecules from plant pathogens, particularly rust fungi, other than flax rust fungus as 10 specifically described herein, that encode avirulence products of those other plant pathogens, for example, nucleic acid molecules encoding avirulence products of other rust fungus diseases of plants as set out in Table 2. In this aspect, the present invention provides a method of identifying a nucleic acid sequence 15 which encodes an avirulence product of a plant rust fungus, which comprises (i) hybridising a probe or primer to nucleic acid of a plant rust fungus, and either (ii) detecting said hybridisation, or (iii) performing an amplification reaction and detecting the amplified product; wherein said probe or primer comprises at least about 20 contiguous nucleotides of (a) a 20 nucleotide sequence encoding an avirulence product of a plant rust fungus, particularly flax rust fungus, or a degenerate or complementary nucleotide sequence thereto, or (b) a nucleotide sequence which is genetically linked to a gene encoding an avirulence product of a plant rust fungus. The method may further comprise the step of isolating the hybridised or amplified nucleic acid sequence. 25 Preferably, the probe or primer comprises at least about 20 contiguous nucleotides of a nucleotide sequence selected from the group consisting of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences. Alternatively, the probe or primer may be based on the nucleotide sequence of the highly conserved sec14 30 homolog, particularly a flax rust secl4 homolog.

WO 2004/099417 PCT/AU2004/000602 -25 The plant pathogen sequence being identified may be present in a gene library, such as, for example, a eDNA or genomic gene library. The library may be any library, such as, for example, a BAC library, YAC library, cosmid library, bacteriophage library, genomic gene library, or a eDNA library. Methods for the production, maintenance, and screening of such 5 libraries with nucleic acid probes or primers, are well known to those skilled in the art. The sequences of the library are usually in a recombinant form, such as, for example, a cDNA contained in a virus vector, bacteriophage vector, yeast vector, baculovirus vector, or bacterial vector. Furthermore, such vectors are generally maintained in appropriate cellular contents of virus hosts. 10 In particular, cDNA or genomic DNA may be contacted, under at least low stringency hybridisation conditions or equivalent, with a hybridisation-effective amount of a probe or primer derived from a nucleotide sequence selected from the group consisting of 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L 15 sequences, or a complementary sequence thereto, or alternatively, with a probe or primer comprising a nucleotide sequence derived from a flax rust secl4 homolog, and the hybridisation detected using a detection means. In one embodiment, the detection means is a reporter molecule capable of giving an 20 identifiable signal (e.g. a radioisotope such as 32p or 35S or a biotinylated molecule) covalently linked to the isolated nucleic acid molecule of the invention. Conventional nucleic acid hybridisation reactions are encompassed by the use of such detection means. In an alternative method, the detection means is any known format of the polymerase chain 25 reaction (PCR). According to this method, degenerate pools of nucleic acid "primer molecules" of about 20-50 nucleotides in length are designed based upon any one or more of the nucleotide sequences disclosed herein, or a complementary sequence thereto. In one approach related sequences (i.e. the "template molecule") are hybridised to two of said primer molecules, such that a first primer hybridises to a region on one strand of the double 30 stranded template molecule and a second primer hybridises to the other strand of said WO 2004/099417 PCT/AU2004/000602 - 26 template, wherein the first and second primers are not hybridised within the same or overlapping regions of the template molecule and wherein each primer is positioned in a 5' to 3'- orientation relative to the position at which the other primer is hybridised on the opposite strand. Specific nucleic acid molecule copies of the template molecule are 5 amplified enzymatically, in a polymerase chain reaction (PCR), a technique that is well known to persons skilled in the art. Although the screening method of the present invention extends to use of probes or primers of only about 20 nucleotides in length, those skilled in the art will recognise that the 10 specificity of hybridisation increases using longer probes, or primers, to detect genes in standard hybridisation and PCR protocols. Accordingly, preferred nucleotide sequences for probes or primers according to this embodiment of the invention will hybridise to at least about 30 contiguous nucleotides, more preferably at least about 50 contiguous nucleotides, even more preferably at least about 100 contiguous nucleotides, and still even more 15 preferably at least about 500 contiguous nucleotides, derived from the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences or a degenerate or complementary sequence thereto, or a flax rust secl 4 homolog sequence. The present invention is further described in the following non-limiting Examples. The 20 Examples herein are provided only for the purposes of exemplification of the invention, and are not intended to limit the subject invention as broadly described herein. BRIEF DESCRIPTION OF THE DRAWINGS 25 Figure 1. A rust mapping family in which sixteen avirulence genes segregate at ten loci. The rusts C and H were crossed together to create the F1 hybrid CH5 which was then selfed to generate an F2 family of 81 individuals (Lawrence et al., 1981). The avirulence genes (A-L1 etc) that segregate in the F2 family are listed against the parent from which they were inherited. Where multiple avirulence specificities co 30 segregate at a single locus they are listed together (eg A-L5/L6/L7). The A-N avirulence gene is present in both parents and it is not known which parent is the WO 2004/099417 PCT/AU2004/000602 - 27 source of the allele that segregates in the F2 family. The A-P and A-P1/P2/P3 specificities segregate as alternative alleles of a single locus. Figure 2. Differential expression screen by microarray hybridisation. 5 Figure 2A. The log transformed signal intensity of the Cy-3 labelled rust H eDNA probe is plotted against the log transformed signal intensity of the Cy-5 labelled rust C eDNA probe Cy-5 (X axis). Each point represents the average of two replicated hybridisations to two duplicated printed spots on the glass slides. Points that lie above the median y=x line show higher expression in rust H infected leaves, while 10 points below this line show higher expression in rust C infected leaves. Figure 2B. A list of eDNA clones (identified by their positions on the 96 well stock plate arrays) that were selected for further analysis based on a relative expression ratio of about threefold difference between the two probes. The IU2F2 15 entry which is derived from the A-L5/L6/L7 locus is shaded. Figure 3. Schematic diagram of the genomic DNA regions sequenced from the A L5/A-L6/A-L7 avirulence locus in flax rust. Two sequence contigs of 26.5 and 17.5 kbp come from rust strain H, which is avirulent on flax containing the -L5, L6 or L7 20 resistance genes. The relative positions of lambda clones used for sequence analysis are indicated. A 11.5 kbp sequence contig from the virulent allele was derived by PCR-amplified DNA fragments as described in the text. The relative positions of the genes encoding the 2F2-A, -B, -C, and -D cDNAs and the Secl4 homologs are shown, as is a retrotransposon-like sequence (retro-element). The complete sequence 25 of these regions is given in the accompanying Sequence Listing (SEQ ID NOs: 1, 2 and 3). Figure 4. Amino acid alignment of the predicted coding sequences of the flax rust secl 14 homolog (Secl 14M1) with known Secl 14 proteins from the fungi Saccharamnyces 30 cerevisiae (Sc; Accession No. P24280), Candida albicans (Ca; AAB41491), Kluyveromyces lactis (K1; P24859), C. glabrata (Cg; P53989), Yarrowia lipolytica WO 2004/099417 PCT/AU2004/000602 -28 (Y1; P45816) and Schizosaccharamycespombe (Sp; NP_593003). The position of a conservative E to D substitution in the B and D copies is indicated by an asterisk. Figure 5. Nucleotide and predicted amino acid sequence of the 2F2-A transcript. The 5 positions of two introns in the corresponding genomic sequence are indicated by numbered arrowheads. The underlined region is the sequence that was present in the IU2F2 cDNA clone. The positions of the 10-1.15 and 10-1.16 oligonucleotide primers (arrows) and the BamHI and XbaI restriction sites (shaded boxes) used for preparation of the expression constructs are also shown. 10 Figure 6. Figure 6A. Amino acid sequence alignment of the predicted products of the flax rust 2F2-A, -B, -C and -D avirulence genes. Only those amino acids that differ from the consensus (upper line) are shown, with identical residues indicated by a ".". The 15 position of the predicted signal peptide is also shown. Figure 6B. The rates of nucleotide substitution at non-synonymous (amino acid changing, Ka) and synonymous (neutral, Ks) sites was determined using the Molecular Evolutionary Genetics Analysis software version 1.02 (Kumar et al., 20 1993; http://evolgen.biol.metro-u.ac.ip/MEGA/). The Ka/Ks ratio greater than 1.0 indicates an excess of non-synonymous nucleotide substitutions, which is indicative of diversifying selection. Figure 7. Transient expression of avirulence genes in flax. Agrobacterium cultures 25 containing T-DNA vectors with 35-S-driven avirulence gene constructs were infiltrated into leaves of 4 week old flax plants. The flax line Bison contains the L9 resistance gene, while the near isogenic lines B6xL5, B12xL6 and B6xL7 contain the L5, L6 or L7 resistance genes which have been backerossed into Bison for 6, 12 or 6 generations respectively. Plant cell death was assayed 11 days post-infiltration. 2F2 30 A induced cell death in conjunction with L5 and L6, but only weakly with L7; 2F2-B induced cell death on L5 only; and 2F2-C expression induced cell death with L6 and WO 2004/099417 PCT/AU2004/000602 - 29 weakly with L7, but not L5. An empty vector produced no response on any of the flax lines. Figure 8. Transient co-expression assays with the L6 resistance gene and 2F2-A rust 5 avirulence gene. Co-infiltration of these two constructs into the rust susceptible cultivar, Hoshangabad, resulted in cell death of the infiltrated tissue, but either gene alone did not cause obvious cell death in Hoshangabad. Figure 9. Transient expression of avirulence genes in tobacco. Agrobacterium cultures 10 containing T-DNA vectors with 35S-driven avirulence gene constructs or the L6 resistance gene from flax driven by its own promoter were infiltrated into leaves of tobacco plants. Plant cell death was assayed 11 days post-infiltration. Both 2F2-A and 2F2-C induced cell death when expressed in conjunction with the L6 resistance gene, but neither produced a response in the absence of L6. Expression of L6 alone 15 also did not induce any response. Figure 10 A cDNA alignment of the 2F2-A, 2F2-B, 2F2-C and 2F2-D sequences. The 2F2-A and 2F2-B sequences are from rust H (see SEQ ID NO: 1), the 2F2-C sequence is from rust H (see SEQ ID NO: 2), and the 2F2-D sequence is from rust C 20 (see SEQ ID NO: 3). The start (nt 104) and stop (nt 554) codons are indicated in bold. Figure 11 Flax rust avirulence gene homologs occur in wheat leaf rust (Puccinia recondita). Probes from 2F2-A (left panel) or Sec14 (right panel) were hybridised to 25 DNA gel blots of genomic DNA isolated from rust-infected wheat plants digested with either HindlI or XbaI restriction enzymes. Both probes hybridise to similar fragments indicating that homologs of both genes are present in leaf rust, and are located on a small contiguous DNA segment. 30 Figure 12 The 2F2 gene variants (A to L) present at each allele in various rust strains are shown. Rust strains 228 and are homozygous for avirulence on L6, L6 and L7 WO 2004/099417 PCT/AU2004/000602 - 30 (A/A), while rust C is homozygous for virulence (a/a) on these resistance genes and rust strains CH5 and 271 are heterozygous (A/a). Rust 339 is avirulent on L5, L6 and L7, but its genotype is not known and the AvrL567 genes in this strain have not been assigned to alleles. Rust strain WA was isolated from a native Australian L. 5 marginale population. Figure 13. Alignment of polymorphic amino acids in the AvrL567 homologs. The consensus amino acid at each position is shown above the sequences, and amino acids identical to the consensus are indicated by dots. Numbers above the alignment 10 identify the amino acid position relative to the first methionine. The final columns indicate whether a necrotic response (+) was observed when these proteins were expressed in flax lines containing L5 L6 or L7. A ++ indicates a very strong necrotic response, while +/- indicates a weak response. 15 Figure 14. RNA gel blot analysis of infiltrated flax leaves. RNA extracted from flax leaves six days after infiltration with Agrobacterium strains containing the 35S-2F2 A, B, etc expression constructs (lanes A to L) was separated on an agarose gel and hybridized to a 3 2 P-labeled 2F2-derived DNA probe. 20 Figure 15. A RNA samples (5 tg) from uninfected flax leaves (F), rust CH5-infected flax leaves 5-8 days post-infection (Sd-8d) and in vitro germinated CH5 rust spores (Sp) were separated on a 1.5% agarose gel, transferred to nylon membranes and hybridised with probes for the 2F2, Secl4, and tubulin genes of flax rust. The 25 infected leaf samples contained largely flax RNA with an increasing proportion of rust RNA as the fungal biomass increased during infection. The 2F2 probe was also hybridised to RNA from leaves infected with rust strain CH5-F2-89 (homozygous for the avirulence allele) or CH5-F2-112 (homozygous for the virulence allele). RNA extracted from 50 mg of haustoria purified from flax leaves 6 days after infection 30 with rust CH5 (Haus) was run alongside 2.5 p[g RNA from rust CH5 infected leaves (6 days) and hybridised to the 2F2 probe. RNA filters were stained with methylene WO 2004/099417 PCT/AU2004/000602 -31 blue to detect rRNA loading (top panel). Given the low amount of haustorial RNA, the 2F2 avirulence gene signal in haustoria reflected a considerable enrichment compared to the infected leaf RNA. 5 B RNA from in vitro germinated rust spores (Sp) and infected flax leaves after 1-5 days (1ld-5d) was reversed transcribed and amplified by PCR using primers specific for the 2F2, Secl4 or tubulin genes. RT-PCR products were separated on a 2% low melting point agarose gel and visualised by ethidium bromide staining and UV irradiation. 10 EXAMPLES Example 1. Materials and Methods. Isolation ofpolyA RNA. 15 Strains of flax rust (Melampsora lini) were separately inoculated onto flax plants of the rust susceptible variety Hoshangabad and infected leaf tissue was collected 6 days after infection, when the rust was firmly established. Leaves were also collected from mock-inoculated uninfected plants. Total RNA was extracted from the rust-infected plant tissue and the mock inoculated control plants. Tissues were ground in liquid nitrogen in 1-2 gram batches and 20 placed in 4 ml Urea buffer, which contains 7 M urea, 1% (w/v) sodium dodecylsulfate (SDS), 100 mM Tris-HC1, 10 mM ethylenediaminetetraacetic acid (EDTA), and 100 mM P3 mercaptoethanol (Sigma). These samples were extracted once with 4 ml of PCI, which is a 25:24:1 v/v mixture of phenol (Sigma) : chloroform (BDH chemicals) : isoamyl alcohol (BDH chemicals). After spinning at 8000g (10 min, 4oC), the aqueous phase was collected 25 and nucleic acids were precipitated by the addition of 0.1 volumes of 3 M Na-acetate (pH5.5, BDH chemicals) and 1.0 volume cold ethanol and incubation at -20 0 C for 30 minutes. Nucleic acids were collected by centrifugation at 8000g, resuspended in 1.0 ml water and transferred to a 1.5 ml centrifuge tube. RNA was selectively precipitated by the addition of 1/3 volumes of 8 M LiCi (Sigma), incubation on ice for 2 hrs and collected by centrifugation 30 at 180OOg (15 min, 4 0 C) in a benchtop microcentrifuge and then resuspended in 0.5 ml water. Carbohydrate was precipitated by the addition of 7[d 3 M Na-acetate and 250ptl WO 2004/099417 PCT/AU2004/000602 -32 ethanol. After spinning (18000g, 5 minutes, room temperature) the supernatant was collected and the purified RNA precipitated by the addition of 43 d 3 M Na-acetate and 750pl ethanol, incubation at -20'C (20 minutes) and a final spin at 14,000g (15 min, 4'C). Yields of RNA were approximately 0.5 mg/g tissue. PolyA RNA was isolated from total RNA using the 5 PolyAtract kit (Promega, Madison WI) according to the manufacturer's instructions. Five to 10 pg of polyA RNA was isolated from 1.0 mg total RNA for each sample, precipitated with 0.1 volumes 3 M Na-acetate and 2.0 volumes ethanol as described above, and re-dissolved in water to a final concentration of 250-300 gg/ml. 10 cDNA synthesis. Double stranded cDNA was synthesized using reagents from the Superscript Choice eDNA synthesis kit (Gibco BRL, Rockville MD). Two pg polyA RNA was mixed with 10 pmol of oligonucleotide primer Prl6 (5'-TTTTGTACAAGCT-3' (SEQ ID NO: 28), prepared on an Applied Biosystems 391 DNA synthesizer) in a volume of 1 1 1, denatured at 70 0 C for 10 15 min and placed on ice. The following components were added; 4pl SuperseriptlI 5 x First Strand buffer, 2pl 0.1 M dithiothreitol (DTT) and Il1 10 mM dNTPs (10 mM each of deoxyadenosinetriphosphate, dATP, deoxycytidinetriphosphate, dCTP, deoxyguanosinetriphosphate, dGTP and deoxythymidinetriphosphate, dTTP). The solution was placed at 37 0 C for 2 minutes before the addition of the SuperscriptII reverse 20 transcriptase enzyme (21l, 400 units). After incubation at 37 0 C for 1 hour, the mix was placed on ice and the following components added: 5x 2 nd strand buffer (30[d), E. coli DNA polymerase I (41l, 40 units), RNaseH (1.il, 2 units), 3pl dNTPs (10 mM) and 92gl water. This mixture was incubated at 16 0 C for 2 hours and then T4 DNA polymerase (241tl, 10 units) was added followed by a further 5 minutes at 16 0 C before transfer to ice and addition of 5[1 25 0.5 M EDTA. After extraction with 150gl PCI, the double stranded eDNA was precipitated by the addition of 70pl NH 4 -acetate (7.5 M, BDH chemicals) and 500tl ethanol, collected by immediate centrifugation at 18000g for 20 minutes at room temperature. After washing in 70% ethanol and air drying for 10 minutes at room temperature, the eDNA was re-dissolved in 50pl water. 30 WO 2004/099417 PCT/AU2004/000602 -33 Preparation of driver and tester cDNAs. For subtractive hybridisations, driver and tester cDNA samples were prepared by restriction digestion of the double stranded cDNA. The cDNAs (44V1) were digested with the four-base blunt-end restriction enzyme RsaI (20 units, MBI Fermentas), then extracted with PCI and 5 precipitated as described above and resuspended in 6.5[l water. This sample constituted the driver cDNA. Two tester cDNA samples were prepared from this cDNA by the addition of one of two double stranded oligonucleotide adaptors; Adaptor 1: upper strand 5' GTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3' (SEQ ID NO: 29); lower strand 5'-CCCGTCCA-3' (SEQ ID NO: 30); or Adaptor 2: (upper strand 5' 10 TGTAGCGTGAAGACGACAGAAAGGGCGTGGTGCGGAGGGCGGT-3' (SEQ ID NO: 31), lower strand 5'-ACCGCCCTCCG-3' (SEQ ID NO: 32). 191 of the driver cDNA was 'diluted with 5p1 water. Then 2 1 diluted cDNA, was incubated at 16 0 C for 16 hours with 1 unit T4 DNA ligase (MBI Fermentas) in 10pl volume of lx buffer (MBI Fermentas) with 20 pMol of either Adaptor 1 or Adaptor 2. The reaction was stopped by the addition of 0.5gl of 15 0.5 M EDTA and incubation at 70 0 C for 5 minutes. cDNA hybridisation For hybridisation, two tubes were set up with 1.5p'1 driver eDNA, 1p1 4 x buffer (200 mM HEPES (Sigma), 2 M NaC1, 0.8 mM EDTA, pH 8.0) and 1.5p l of tester cDNA with either 20 adaptor 1 or adaptor 2. This was overlaid with mineral oil, denatured at 980C for 1.5 minutes and incubated at 68 0 C for 9.5 hours in a Hybaid PCRExpress thermocycler. A third tube containing 1 p1 driver eDNA, 2pl water, 1 l 4 x buffer and mineral oil was incubated at 98,C for 2 minutes and then cooled to 68 0 C. The contents of all three tubes were then mixed and incubated for a further 16 hours at 68 0 C to allow complete re-hybridisation of the eDNA 25 samples. The renatured eDNA samples were diluted with 100pl dilution buffer (20 mM HEPES, 50 mM NaC1, 0.2 mM EDTA, pH 8.3). Selective amplification of differentially expressed cDNAs. In the first round of PCR, 1 pl of the diluted eDNA was amplified in a 25pl volume (lx 30 Advantage buffer, 0.2mM dNTPs, lx Advantage polymerase mix) with 10 pmol of primer WO 2004/099417 PCT/AU2004/000602 - 34 P1 5'-GTATACGACTCACTATAGGGC-3' (SEQ ID NO: 33); and P2 5' TGTAGCGTGAAGACGACAGAA-3' (SEQ ID NO: 34). The PCR cycling conditions were: 750C 5 minutes, 94°C 30 seconds, followed by 30 cycles of 940C 20 seconds, 660C 30 seconds and 720C 1.5 minutes. Products of the first PCR round were diluted 1 in 10 in water 5 and then 1pl was re-amplified as above but using the primers PNI: 5' TCGAGCGGCCGCTCGGGCAGGT-3' (SEQ ID NO: 35) and PN2: 5' AGGGCGTGGTGCGGAGGGCGGT-3' (SEQ ID NO: 36) and the following cycling conditions: 15 cycles of 940C 20 seconds, 660C 30 seconds and 720C 1.5 minutes. This reaction product constituted the subtracted cDNA samples. 10 Construction of librariesfrom subtracted cDNAs The selectively amplified cDNAs were cloned using the pGEMT-Easy PCR cloning kit (Promega). A 3p1l sample of the second round PCR reaction was mixed with 5p1 2 x ligase buffer, 50 ng pGEMT-Easy plasmid and 2 units T4 DNA ligase and incubated at room 15 temperature for 1-2 hours. The ligated cDNA/plasmid solutions were precipitated with Na acetate/ethanol, resuspended in 10p 1 water and then 1 pl was transformed into E. coli DH10B cells by electroporation using a Gene Pulser with the following parameters: resistance 200 0, capacitance 25mF, voltage 2500 volts. Electrocompetent cells were prepared from a 500ml liquid 2xYT culture (16 g/1 Tryptone, Merck, 10 g/1 yeast extract, DIFCO, 5 g/l NaC1) 20 grown to OD600 of 0.3-0.5. The culture was chilled on ice and centrifuged at 5000 rpm for 15 minutes at 40C, resuspended in 500 ml sterile water, spun again and resuspended again in 250 ml water. After a third spin, the cell were resuspended in 10 ml 10% (v/v) sterile glycerol, spun again and resuspended in 1.5 ml 10% glycerol and dispensed into 40p1 aliquots stored at -700C. After electroporation, 500p1 liquid LB medium (10 g/1 Tryptone, 5 25 g/1 yeast extract, 10 g/l NaC1) was added and 10-50p1 aliquots were spread on LB agar plates (LB plus 15g/l Agar, DIFCO) containing 100Rg/ml ampicillin (Sigma) to select for transformed cells. Prior to plating bacteria, 50p1l X-Gal (BioVectra, 2% w/v in Dimethylformamide, BDH chemicals) and 40pl IPTG (2% w/v, Progen) was spread on the LB plates. 30 Screening for differential expressed clones by filter hybridisation.

WO 2004/099417 PCT/AU2004/000602 -35 The eDNA inserts in the 1056 selected subtracted eDNA clones were amplified by PCR using the PN1 and PN2 primers. The PCR conditions were: 50 l volume, 1 1 E. coli culture as template, 10 pmol each primer, 0.1 mM dNTPs (Amersham), 2 mM MgCl 2 , 0.05% w/v Tween-20 (Sigma), 50mM KC1, 1 unit Taq polymerase; cycle parameters: 94 0 C 2 minutes, 5 followed by 30 cycles of 94 0 C 20 seconds, 68 0 C 30 seconds and 72 0 C 1 minute. Then 10 l of each PCR product was mixed with 10li 0.6 N NaOH and 1 gl was spotted in duplicate onto Hybond N+ nylon membranes (Amersham). The membranes were placed on filter paper soaked in neutralization buffer (1.5 M NaCI, 0.5 M Tris-HC1 pH 7.0) for 5 minutes and then rinsed in 2 x SSC. 1 x SSC contains 0.15 M NaCl, 15 mM Na-citrate at pH 7.0. 10 DNA was fixed to the filters by UV irradiation (120mJ/cm2) using a CL-1000 ultraviolet crosslinker (PathTech). The H-C or C-H subtracted eDNA samples (described above) were labeled with 32 P-dCTP as follows. Five tl of the subtracted cDNA was first digested with RsaI to remove the PN1 and PN2 ends. Then 6pl of random 9mer oligonucleotides (0.1 mg/ml) and water was added 15 to a final volume of 18pl and the DNA denatured by placing in a boiling water bath for 2 minutes. Then 6ptl of 5 x buffer (1.0 M HEPES, 0.25 M Tris, 25 mM DTT (Sigma), 25 mM MgCl 2 , 0.1 mg/ml Bovine serum albumin (BSA, Sigma) and 1.0 mM each dATP, dGTP and dTTP (Amersham), lII Klenow (2 units; MBI Fermentas ) and 5ptl ca- 2 p-dCTP (>1 mCurie/ml; Amersham) were added and the mixture incubated at 37 0 C for 1-2 hours. 20 Unincorporated nucleotides were removed by gel filtration through Sephadex G-50 (Amersham) equilibrated in TE (10 mM Tris, 1 mM EDTA pH 8.0). Filters were incubated in 25 ml hybridisation buffer containing 7% (w/v) SDS, 1% (w/v) BSA, 0.5 M sodium phosphate pH 7.2 and 1 mM EDTA at 70 0 C for 2-5 hours in a Hybaid oven. The 32 P-dCTP labeled DNA probes were denatured by boiling for 2 minutes and then added to the filters 25 and hybridisation performed at 70'C for 16 hours. After removal of the hybridisation solution, filters were washed at 68 0 C twice for 15 minutes in 1 x SSC, 0.1% SDS and twice in 0.2 x SSC, 0.1% SDS. Washed filters were exposed to X-ray film (Fuji) at -70 0 C with an intensifying screen for 24 hours. 30 Screening for differential expressed clones by slide hybridisation.

WO 2004/099417 PCT/AU2004/000602 -36 PCR amplified inserts from the 1056 clones (amplified as above except that the universal ml 3 forward and reverse primers were used with 35 cycles and a 560C annealing step) were precipitated with Na-acetate/ethanol, resuspended in 6[l 50% dimethylsulfoxide (DMSO, Sigma) and printed in duplicate onto CMT-GAPS coated glass slides (Coming) using a 5 robotic printing arm with 16 pins. Slides were baked at 80 0 C for 3 hours to fix the DNA to the glass. Fluorescently labeled eDNA probes were prepared from the rust H and rust C infected tissue RNA samples (described above). PolyA RNA (250 ng) or total RNA (25 pg) was mixed with 1 tg of an oligodT23 primer with an A/C/G degenerate 3' nucleotide in a 23 ptl volume and denatured at 700C for 10 minutes then transferred to ice. First strand cDNA 10 was synthesized using the Superscriptll system by adding 8ttl 1 st strand buffer, 4pl 0.1 M DTT, 2p l 10 mM dNTPs, 2pl water and 191 superscriptlI RT (200 units) and incubating at 421C for 1 hour. Then 2 units of RNase H (4 units) was added followed by a 30 minute incubation at 37oC. Then 160p1 TE was added and the cDNA purified and concentrated using a Microcon YM-30 filter (Millipore) by spinning at 13000rpm for 5 minutes, adding a 15 further 200pl TE, spinning again and adjusting the final volume to 8p l by the addition of TE. To this was added 5.5pl water, 2 1 10 x Klenow buffer (USB), 1l1 random 6mer oligonucleotides (USB) and the mixture was denatured at 95 0 C for 3 minutes and re annealed at room temperature for 5 minutes. Then 0.5tl of the fluorescent labels Cy3-dUTP or Cy5-dUTP were added (25 nmol, Amersham Pharmacia) along with 2l dNTP mix (0.25 20 mM dATP, dGTP, dCTP and 0.09mM dTTP) and 1p1 Klenow polymerase (10 units, USB) followed by incubation at 370C for 3 hours. The two probes were mixed and concentrated on a YM30 filter as above and then dried down under vacuum. The labeled probes were resuspended in 20pl hybridisation mix - 5 x SSC, 0.1% SDS, 25% formamide (BDH chemicals), 1.5 mg/ml ssDNA (Sigma) - and denatured for 5 minutes at 95C. Slides were 25 prehybridised in 5 x SSC, 0.1% SDS, 25% formamide, 10 mg/ml BSA at 420C for 1 hour, rinsed in water and then spun dry at 1000rpm for 2 minutes. The probe solution was then added and a cover slip placed over the printed area and the slides were sealed inside a hybridisation chamber and incubated in a 420C water bath for 16 hours. After hybridisation the slides were washed in the following solutions: a brief rinse in 2 x SSC, 0.1%SDS to 30 remove the cover slips; 10 minutes at 421C in 2 x SSC, 0.1%SDS; 10 minutes at room WO 2004/099417 PCT/AU2004/000602 -37 temperature in 0.1 x SSC, 0.1% SDS; 4 washes of 2 minutes each at room temperature in 0.1 x SSC. The slides were then spun dry (2 minutes, 1000 rpm) and read using a fluorescence laser scanner. The scanned images were analysed using Genepix software 5 Plasmid isolation. Plasmids were isolated from 1.5 ml E. coli cultures, grown in LB medium, as follows. After 16 hours growth at 37 0 C, cells were collected by centrifugation at 18000g and resuspended in 100pl GTE (50 mM glucose, 10 mM Tris, 1 mM EDTA, pH 8.0) and lysed by the addition of 200l 0.2 N NaOH, 1% SDS (room temperature 5 minutes). Cell debris was 10 precipitated by adding 150pl 5 M K-acetate followed by incubation on ice for 10 minutes and 10 minutes spin at 18000g, 4°C.Plasmid DNA was precipitated from the supernatant by the addition of 350pl isopropanol and collected by centrifugation. The DNA was resuspended in 50pl water and then further purified by precipitation with 12p1 5 M NaCl and 60ptl 13% (w/v) polyethylene glycol (PEG8000, Sigma) on ice for 1 hour. After collection 15 by centrifugation, washing in 70% ethanol and drying under vacuum, the purified plasmid DNA was resuspended in 50tl water. Samples (1jL1) were sequenced using the m13 forward: 5'-GTAAAACGACGGCCAGT-3' (SEQ ID NO: 37); or reverse 5'-GGAAACAGCTATGACCATG-3' (SEQ ID NO: 38) 20 primers with the ABI BigDye version 3.0 system and analyzed on an ABI 377 DNA Sequencer (Applied Biosystems, Foster City, CA). Sequences were analyzed using Sequencher software (Gene Codes Corporation, Ann Arbor, MI). DNA gel blot analysis. Five micrograms of DNA prepared from uninfected flax plants or 25 flax leaves infected with rusts C or H was digested with 20 units of the restriction enzyme HindIII (MBI Fermentas) in 20ptl volumes of lxR+ buffer (MBI Fermentas) at 37 0 C for 5 hours, separated by electrophoresis on 1% agarose (Progen) gels in SEB buffer (40 mM Tris, I mM EDTA, 40 mM Na-acetate pH 7.8) and transferred to Hybond N+ nylon membranes (Amersham, Buckinghamshire, UK) in 0.4 N NaOH blotting solution. The cDNA inserts 30 were amplified by PCR with the PN1/PN2 primers as described above and purified using the QiaQuick PCR purification kit (QIAGEN). These fragments were labeled with 2 p-dCTP WO 2004/099417 PCT/AU2004/000602 -38 and hybridised to nylon filters as described above (except that hybridisation was at 65 0 C and the final wash was in 1 x SCC, 0.1% SDS at 65 0 C). Filters were exposed to either Kodak BiomaxMS or Fuji X-ray film at -70'C with appropriate intensifying screens. 5 RFLP analysis. Genomic DNA (5 pg) from rust C or rust H infected tissue was digested with the restriction enzymes HindIIl, BamHI, EcoRI, EcoRV, PstI, or XbaI (MBI Fermentas) as described above with the appropriate buffers recommended for each enzyme. Digested DNA fragments were separated by agarose gel electrophoresis and then blotted onto Hybond nylon filters and hybridised to probes as described above. 10 Genomic library of flax rust and isolation of clones. This library was prepared from DNA isolated from germinated spores of rust CH5, digested with the enzyme Sau3AI and size selected by passage through a stepped sucrose gradient containing 10-50% sucrose. DNA fragments of 15-20 kbp in size were ligated into the BamHI site of a lambda EMBL3 cloning 15 vector and packaged into lambda particles using a Packagene lambda packaging extract (Promega). A primary titre of 2x105 plaque forming units (pfu) was obtained and the library was then amplified and stored at -80'C. A total of 250,000 pfu was plated onto ten 135 mm LB agar plates using agarose overlays. For each plate, 25000pfu were used to infect 400 d E. coli K803 cells (grown overnight in 20 LB medium with 2% w/v maltose and 10 mM MgSO 4 and then centrifuged at 5000rpm for 10 minutes and re-suspended in an equal volume of 10 mM MgSO 4 ). After growth at 37 0 C for 16 hours, plaques were lifted onto Hybond N+ filters (Amersham) and screened by hybridisation with a 3 2 P-dCTP-labelled probes as described above. Hybridising clones were extracted into Iml ) dilution buffer (10 mM Tris; 10 mM MgSO 4 ) and screened again at low 25 density on 100 mm LB agar plates with agarose overlays to isolate pure lambda clones. High titre samples were obtained by elution of phage from confluently lysed 100 mm plates in 3ml X dilution buffer. Then 3x106 pfu was used to infect 400pl K803 cells (37 0 C, 15 minutes) 15ml LB was added followed by incubation at 37 0 C shaking (200 rpm) for 6-9 hours for DNA preparation. Lysed cultures were treated with RNaseA (10mg, Sigma) and DNaseI 30 (2mg, Sigma) at 37 0 C for 15min and then precipitated by adding 1 volume of 20% (w/v) WO 2004/099417 PCT/AU2004/000602 -39 PEG8000, 2 M NaC1 and incubating on ice for 1 hour. Phage particles were recovered by centrifugation at 10,000g for 10 minutes at 4 0 C and resuspended in 0.5ml TE (10 mM Tris HCI, 1 mM EDTA, pH 8.0). Particles were disrupted by adding 5 ml of 10% (w/v) SDS and incubating at 65 0 C for 5-10 minutes and then proteins were removed by PCI extraction. 5 DNA was precipitated with Na-acetate/ethanol and resuspended in 1 00pl TE. Ten microlitre samples were digested with the restriction enzymes HindIII, BamHI, EcoRI, XbaI or PstI and then precipitated with Na-acetate/ethanol and re-suspended in 10 l water. Fragments were ligated into plasmid vectors using standard conditions. 10 Long PCR. The Perkin Elmer/Applied Biosystems GeneAmp XL PCR kit was used (Roche Molecular Systems Inc., Branchburg, New Jersey) to generate long PCR products with modification of the reaction mix to give more reproducible amplification. For the bottom mix we combined 6p1Al 3.3 x bufferII, 8 d Mg-acetate (25 mM), 4 1l dNTPs (10 mM each), 2pl each primer 15 (10 OM) and 3p1 water. An Ampliwax PCR gem wax bead (Roche Molecular Systems) was placed over this mix and the tube heated to 70 0 C for 2 minutes to melt the bead. After cooling to room temperature, the following components were added above the wax: 9pLl 3.3x bufferll, 1 d rTth polymerase (2 units), 50 ng rust DNA template and water to a final volume of 25 l. The thermal cycling conditions were: 94°C 2 minutes, 40 cycles of 94 0 C 20 20 seconds, 55 0 C 30 seconds, 72 0 C 5 minutes, then a final 10 minutes at 72 0 C. Inverse PCR. Five microgram of genomic DNA from the rust CH5F2-78 (homozygous for the virulent allele) was digested with BamnHI or EcoRV at 37 0 C for 16 hours in a 10[l volume. Then 5 pl 25 of digested DNA was religated in a 5041 volume with T4 DNA ligase (2 units, MBI Fermnentas) in lx ligase buffer for 3 hours at 37 0 C (EcoRV) or 12 0 C (BamHI) and then a further 3 hours at room temperature to generate circularized DNA fragments. These samples were then amplified by PCR (5pl template in 50pl reaction volume, conditions as described above with the following thermal cycling parameters: 94 0 C 2 minutes; 40 cycles 94 0 C 20 30 seconds, 55 0 C 30 seconds, 72 0 C 2 minutes; 72°C 10 minutes) with the primer pairs 10- WO 2004/099417 PCT/AU2004/000602 - 40 1.41/10-1.39 (on BamHI digested sample) or 10-1.16/10-1.40 (EcoRV digested sample). The 10-1.16/10-1.40 PCR was re-amplified (Spl of 1/100 diluted template in 50pl reaction volume, as described above) in a nested PCR with the primers 10-1.6/10-1.39. Amplified fragments of about 700bp and 800bp were obtained for the 10-1.41/10-1.39 (BamHI) and 5 10-1.6/10-1.39 (EcoRV nested) reactions and these were cloned into pGEMT-Easy and sequenced as described above. Preparation and use of Agrobacteriumni strains. Equal volumes of overnight LB culture of the three strains were mixed and inoculated onto a sterile Millipore nylon filter on an LB 10 plate and incubated at 28 0 C for 16 hours. The filter was then placed into 10 ml sterile water and vortexed to dislodge the bacterial cells. This suspension (50pl) was then spread onto an LB plate supplemented with gentamycin sulfate (25pg/ml, Sigma), tetracycline (5pg/ml, Sigma) and spectinomycin sulfate (50pg/ml, Sigma). Single colonies were streaked onto fresh selective plates and the plasmids were re-isolated (as described above), transformed 15 into E. coli and re-sequenced to confirm that the final versions maintained the correct sequence and structure. Agrobacterium strains were inoculated in 50 ml LB liquid medium supplemented with the above antibiotics and grown at 28 0 C for 16-24 hours. The cultures were then centrifuged at 5000 rpm for 10 minutes at 4oC and the cells were resuspended to a final OD600 of 1.0 in liquid MS medium (21 mM NH 4

NO

3 , 3 mM CaCl 2 , 22 mM KNO 3 , 18 20 mM MgSO 4 , 1.25 mM KH 2

PO

4 , 100tM boric acid, 100pM MnSO 4 , 100pM FeSO 4 , 1004M EDTA, 30jtM ZnSO 4 , 5vM KI, 1tM Na 2 MoO 4 , 100 nM CuSO 4 , 100 nM CoC1 2 , 500pg/1 nicotinic acid, 500p.g/l pyridoxine HC1, 100pg/l thiamine HC1, 1 mg/1 glycine, 30g/1 sucrose and 100 mg/1 myoinositol at pH 5.8) supplemented with 200pM acetosyringone. 25 Example 2. Identification of genes differentially expressed between rust strains with different avirulence genes. Many avirulence specificities have been described in various strains of flax rust and these 30 have been proposed to be the result of expression of specific avirulence genes encoding products that control recognition by particular host resistance genes (Lawrence et al., 1981; WO 2004/099417 PCT/AU2004/000602 -41 Flor 1971). We attempted to identify genes encoding these avirulence products by performing a search for genes that are differentially expressed between rust strains expressing different avirulence phenotypes. This search relied on the assumption that the difference between the avirulent (AVR) and virulent (avr) genotypes may be reflected in 5 differences in transcript expression level for the respective genes. This would be true if for instance the avr allele resulted from a deletion of the AVR gene, or if the sequences of allelic variants were sufficiently diverged to prevent cross-hybridisation. For this analysis we used the rust strains C and H, which express different avirulence specificities. Sixteen different avirulence specificities (mostly derived from rust H) segregate as alleles of ten loci in an F2 10 family of 81 individuals that was generated by crossing these two rust strains and then self fertilising the F1 hybrid, CH5 (Figure 1, Lawrence et al., 1981). Three loci contain multiple avirulence specificities (A-L5/L6/L7, A-M1/M4 and A-P/P1/P2/P3) and these may represent complex loci with duplicated genes. We used suppression subtractive hybridisation (Diatchenko et al 1996) to prepare subtracted eDNA libraries that were enriched for 15 transcripts more abundant in leaves infected by rust H than rust C or vice versa. A third subtracted library contained transcripts present in leaves infected by rust H, but absent in uninfected leaves, and was expected to consist largely of unselected rust H-derived transcripts. The procedure for constructing and screening these libraries is detailed above. 20 Five to 10 pig of polyA RNA was isolated from 1.0 mg total RNA for each sample. Driver and tester cDNAs were prepared and hybridised as described above. Libraries enriched for cDNAs more abundant in the tester than driver samples were prepared by a two-step PCR amplification of the renatured cDNA mixtures using the Advantage cDNA polymerase kit (CLONTECH) as described above. The selectively amplified cDNAs were cloned using the 25 pGEMT-Easy PCR cloning kit (Promega). Colonies containing recombinant plasmids were identified by blue/white screening on X-Gal medium. Selected colonies were inoculated into 100 tl liquid LB medium in 96 well plates, grown at 37 0 C and stored at -70 0 C after the addition of 50tl 50% (w/v) sterile glycerol. These stock plates were used to inoculate working plates using the same procedure and these were used for subsequent analysis of the 30 libraries.

WO 2004/099417 PCT/AU2004/000602 - 42 Three subtracted eDNA libraries were prepared. For library #1 the driver cDNA was derived from flax leaves infected with rust H and the tester was from flax leaves infected with rust C. This library should be enriched for eDNAs that are more highly expressed during infection by rust C than rust H. 288 clones from this library were selected and arrayed into three 96 5 well plates (designated HC1-3). For library #2 the driver eDNA was derived from flax leaves infected with rust C and the tester was from flax leaves infected with rust H. This library should be enriched for cDNAs that are more highly expressed during infection by rust H than rust C. 480 clones from this library were selected and arrayed into five 96 well plates (designated HC4-8). For library #3 the driver eDNA was derived from uninfected flax leaves 10 and the tester was from flax leaves infected with rust H. This library should be enriched for cDNAs that are present in leaves infected by rust H, but not in uninfected leaves and therefore should represent unselected rust H derived cDNAs. 288 clones from this library were selected and arrayed into three 96 well plates (designated IU1-3). Thus a total of 1056 subtracted eDNA clones were selected and these were subsequently analysed for differential 15 expression between rusts C and H by either nylon filter or glass slide hybridisation as described above. Spots showing clear differences in hybridisation signal intensities with the two probes were selected by visual inspection of the films. Figure 2 shows a plot of the transformed signal 20 intensities for the two cDNA probes for each of the cDNA spots on the microarray and a list of the clones showing greater than about threefold difference in signal intensity between the two probes. These were selected for further analysis. A total of 130 putatively differentially expressed cDNA clones were identified in the 25 differential hybridisation screens. Plasmid DNAs were isolated as described above, and the nucleotide sequences determined. Some of these 130 clones were identical and a total of 74 unique sequences of between 40 and 500 nucleotides were identified. BLAST searches (Altschul et al., 1997) against the NCBI sequence databases detected matches to known genes for some of the eDNA clones, but most showed no matches to genes in the public 30 databases. Nine eDNAs of less than 80bp were not analysed further, while the remainder WO 2004/099417 PCT/AU2004/000602 - 43 were tested by DNA gel blot analysis to determine whether they were derived from flax or rust genes. On the basis of DNA hybridisation or BLAST search results 29 cDNAs were assigned as 5 flax derived genes. A further 13 cDNAs failed to hybridise to either flax or rust DNA. One possible explanation for this observation is that the corresponding genomic sequences of these genes may contain closely spaced introns that disrupt hybridisation to the genomic DNA. The remaining 23 cDNAs hybridised specifically to genomic DNA from flax rust and thus represent rust genes. 10 Example 3. IU2F2 identifies an RFLP that co segregates with the A-L6 locus The 23 cDNAs from flax rust were used as probes to detect restriction fragment length polymorphisms (RFLPs) between rust strains C and H. Where restriction fragment length 15 polymorphisms (RFLPs) were detected between rusts C and H, the same probe/enzyme combination was used to score the segregation of these RFLP markers among the individual progeny of the CH5F2 family. For this analysis, genomic DNA isolated from in vitro germinated rust spores rather than infected plant tissue was used. The segregation of these markers was then compared to the known avirulence phenotypes of the F2 individuals to 20 check for genetic linkage using the Mapmanager software (version 0.23, http://mapmgr.roswellpark.oru/mmqtx.html). Most of the RFLPs detected by the subtracted cDNA clones did not cosegregate with any known avirulence loci. However one of the differential cDNA probes detected an RFLP that co-segregated with the A-L5/A-L6/A-L7 avirulence genes. This probe was derived from the E. coli culture at position F2 in plate 2 of 25 the infected minus uninfected subtracted cDNA library (IU2F2). However, this culture contained a mixture of two plasmids with different cDNA inserts, which was apparent from the presence of two fragments of -400bp and ~200bp in the PCR amplified probe. These were isolated separately by retransformation of E. coli with the plasmid mixture isolated from this culture and selection of transformed colonies containing different cDNA inserts. 30 Probes derived from the two inserts were then prepared as described above and hybridised to the rust genomic DNA blots as described above. The larger cDNA probe of ~400bp failed to WO 2004/099417 PCT/AU2004/000602 -44 hybridise to rust genomic DNA, while the smaller probe detected the same RFLPs as the original mixed probe, indicating that this cDNA was closely linked to the Avirulence locus. This cDNA clone is henceforth referred to as the IU2F2 cDNA. It contained a 187 bp sequence that appeared to consist of a 5' untranslated region of 105 bp followed by an open 5 reading frame encoding 27 amino acids that resembled a hydrophobic secretion signal (see Figure 5). Example 4. Identification of genomic clones of IU2F2 locus 10 Since the IU2F2 eDNA represented a candidate for encoding one or more of the A-L5, A-L6 or A-L7 avirulence functions, we isolated larger genomic DNA clones from this region from a lambda vector genomic library prepared from the F1 hybrid rust CH5 (Ayliffe et al, 2001). Hybridisation under stringent conditions identified 17 genomic clones. Digested lambda DNA from each clone was analysed by gel blotting and hybridisation to the IU2F2 probe as 15 described above. Comparison of the restriction fragment and hybridisation patterns of the lambda clones was used to group the clones into several independent classes with different inserted DNA fragments. The lambda clones 6-1, 8-1 and 10-1 were initially chosen for analysis by sequencing sub-cloned restriction fragments in plasmid vectors. Fragments were inserted into pBluescriptSK+ plasmids (either ampicillin or kanamycin resistance versions) 20 after treatment with calf intestinal alkaline phosphatase (1 unit, MBI Fermentas) to remove the 3' phosphate groups and prevent self-ligation. Plasmid DNA was prepared from isolated colonies as described above and analysed by restriction digest (as above) to identify clones containing different fragments. 25 Independent clones were sequenced using the ml13 forward and reverse primers. Gaps in the sequence contigs were filled by either subeloning further restriction fragments from within the plasmids, or by using primers synthesized to the internal sequence (primer sequences are shown in Table 1). In this way the entire sequences of these lambda clones was determined. The 6-1 and 8-1 sequences overlapped and contained identical sequences in the common 30 regions while the 10-1 clone contained some related but not identical sequences. These thus represent two separate sequence contigs. The remaining 14 lambda clones were sequenced WO 2004/099417 PCT/AU2004/000602 - 45 with the XSA: 5'-TTCATTACTGAACACTCGTC-3' (SEQ ID NO: 39) and XLA: 5' TATCTGCTTCTCATAGAGTC-3' (SEQ ID NO: 40) primers directly on the purified lambda DNA to identify the endpoints of these clones. These sequences all overlapped with either the 6-1/8-1 or 10-1 sequence contigs, and additional sequence was obtained from the 5 lambda clones 12-3, 11-1, 15-1 and 15-9, which extended furthest from the already sequenced regions. This process resulted in two large sequence contigs of approximately 26.5 and 17.5 kbp (Figure 3). Comparison of the predicted restriction digest fragments of the cloned sequences to the 10 RFLP patterns obtained with the IU2F2 probe on total rust genomic DNA, indicated that both contigs were derived from the chromosome that carries the avirulence allele of the A L5/A-L6/A-L7 locus. These two contigs together contain three copies of the IU2F2 sequence (designated 2F2-A,-B,-C; Figure 3), while the RFLP analysis suggested that the virulent allele of this locus contained only a single copy of these repeated sequences. The sequence 15 of the corresponding region from the virulent allele was determined from PCR amplified genomic DNA fragments from the F2 individual CH5F2-112, which is homozygous for the virulent allele of the A-L5/L6/L7 locus and also the linked IU2F2 allele. The primer combinations 10-1.8/10-1.16, 10-1.27/10-1.16, 10-1.15/10-1.9, 10-1.4/10-1.41, 20 10-1.4/10-1.37 (see Table 1 for primer sequences) were used to generate overlapping PCR fragments of 4.5kbp, 3. lkbp, 3.3kbp, 3.7kbp, 4.5kbp respectively. These were purified using the QIAquick PCR purification kit (QIAGEN) and sequenced directly using internal primers as described above to generate a complete sequence contig of approximately 10.5 kbp. An additional 500bp region at the 3' end of this contig was identified by inverse PCR and 25 sequenced. The inverse PCR clones contained sequence from the 5' ends of the predicted BaminHI and EcoRV fragments as well as an additional 240 bp (BamHI) or 500bp (EcoRV) from the region 3' of that previously sequenced. This region differed from the corresponding region of the 8-1 sequence contig. The predicted restriction map of this 1 lkbp sequence was consistent with the RFLP fragments observed for the alternative IU2F2 allele segregating in 30 the CH5F2 family, and there was a single copy of the IU2F2 probe present (designated 2F2 D, Figure 3).

WO 2004/099417 PCT/AU2004/000602 - 46 Example 5. Genomnic structure of the IU2F2 locus The genomic sequences reveal that the IU2F2 cDNA occurs in a multigene complex. The 5 allelic version associated with the A-L5/L6/L7 avirulence haplotype in flax rust contains three related copies of the cDNA (2F2-A,-B,-C), while the alternative version associated with the virulence allele contains a single copy (2F2-D). Analysis of the cloned genomic DNA sequences suggested that one other duplicated gene family was present in this region of the flax rust genome in addition to the IU2F2 homologs. These were detected by BLAST 10 searching (Altshcul et al 1997) of the DNA and protein sequence database maintained by the National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/BLAST/ using the flax rust genomic DNA sequences as query. These genes are close homologs (BLAST score 89, E-value I e-59) of the yeast gene Secl4 (Bankaitis et al., 1989), which encodes a phosphatidylinositol-phosphatidylcholine 15 transfer protein involved in the process of membrane fusion (Lopez et al 1994). However, comparison of the four secl4-like sequences from the flax rust A-L5/L6/L7 locus showed that they were almost identical to each other. Only one amino acid difference, a conservative glutamate-aspartate substitution, distinguishes the products of these genes, which makes it unlikely to encode the avirulence function. This gene is highly conserved among diverse 20 fungi (Figure 4), and thus it is likely to be similarly conserved within the rust family. If micro-colinearity exists with the syntenous regions of other rust fungal genomes, this sequence would identify the equivalent genomic region in other rust fungi, which could contain avirulence genes related to the flax rust A-L5/A-L6/A-L7 genes. However the IU2F2 homologous sequences showed characteristics more indicative of a 25 role in pathogen recognition. Comparison of the original IU2F2 eDNA clone to the genomic sequence indicated that it covered the 5' region of the transcript spanning two introns upstream of the first methionine residue as well as the first 27 predicted amino acids (Figure 5). The genomic sequence contained an open reading frame of 450bp beginning at this methionine codon, but no other significant open reading frames nearby, suggesting a 30 predicted protein product of 150 amino acids. We confirmed that this constituted the entire coding sequence of these genes by PCR amplification (as described above) of cDNA from WO 2004/099417 PCT/AU2004/000602 - 47 rust H-infected leaves (prepared as described above) with the primers 10-1.15 and 10-1.16 which flank the predicted open reading frame (Figure 5). This PCR generated an amplification product of 600bp, which was purified using the QIAquick kit, cloned into pGEMT-Easy and sequenced as described above. Of 21 sequenced clones, 2 corresponded to 5 the 2F2-A gene sequence and 4 to 2F2-B. The remaining 15 clones represented two novel sequences, 2F2-E (6 clones) and 2F2-F (9 clones) apparently derived from the alternative allele present in rust H but not inherited in CH5. All 21 sequences lacked the two predicted introns and contained the predicted 450bp open reading frame and the predicted stop codon. Thus this sequence represents the full coding sequence of these genes. The predicted 150 10 amino acid product of the 2F2 genes includes a predicted 23aa cleavable secretion signal peptide that is completely conserved between all the gene copies (detected by the PSORT analysis program, http://psort.nibb.ac.jp/), suggesting that a mature protein of 127aa is secreted from flax rust. The four copies of this gene showed substantial nucleotide and amino acid variation (Figure 6), with an excess of nucleotide changes that result in amino 15 acid changes relative to the number of neutral changes (Figure 6; determined using the Molecular Evolutionary Genetics Analysis software version 1.02, Kumar et al., 1993; http://evolen.biol.metro-u.ac.ip/MEGA/). This observation suggests that the accumulation of amino acid variation has been favoured by selection during the evolution of these genes (Hughes and Nei, 1988), which is consistent with a role in recognition by the corresponding 20 flax resistance genes, since selection would favour variants that are able to avoid detection by the corresponding resistance genes. Two other points are suggested by this observation. Firstly that the function of these proteins is important to the rust, since selection favours altering the protein sequence rather than deleting it entirely in order to escape resistance recognition. Secondly it suggests that 25 sequence and structural features of these proteins determine the specificity of their interaction with resistance proteins. These two points imply that the differential recognition of these products by the corresponding resistance proteins is based on direct interactions, rather than on the detection of different induced responses in plant cells, as is predicted for the RPS2/Avrrpt2 and RPM1/AvrRpml/AvrB recognition in Arabidopsis (Mackey et al 30 2002, Mackey et al, 2003, Axtell and Staskawicz 2003).

WO 2004/099417 PCT/AU2004/000602 -48 Example 6. Co-expression of Avirulence gene candidates with the corresponding resistance gene induces a hypersensitive cell death response in flax. 5 We confirmed that the cloned 2F2-A, -B and -C genes from flax rust do encode the avirulence functions associated with the A-L5/A-L6/A-L7 locus by transient expression assays in flax plants. We generated Agrobacteriumi T-DNA vector constructs containing the candidate avirulence gene homologs driven by the strong cauliflower mosaic virus 35S promoter and tested these by transient expression in flax lines containing different resistance 10 genes. Transient expression of the three avirulence haplotype genes in flax induced a resistance gene-dependent cell death response consistent with the expected specificity constraints. We made constructs encoding either the full length proteins with a predicted secretion signal 15 peptide or truncated versions in which the signal peptide was removed and translation initiated at Met-24, the first amino acid of the predicted mature peptide. Full length gene constructs were based on a 2F2-A RT-PCR clone in pGEMT-Easy (described above). The EcoRI fragment of this plasmid containing the entire sequence shown in Figure 5 was inserted at an EcoRI site between the 35S cauliflower mosaic virus promoter (+1 to -419 bp 20 fragment, genbank accession #E05206) and nopaline synthase (Nos) terminator (697 bp BamHI-ClaI fragment from pTiT37, genbank accession #V00087) in the binary vector pTNotTReg which also contains the selectable spectinomycin resistance gene between the left and right T-DNA transfer borders and the tetracycline resistance gene outside the T DNA region (Anderson et al., 1997). To construct full length versions of the 2F2-B, -C and 25 -D genes, the primers 10-1.15/10-1.16 were used to amplify the genomic DNA versions from the subcloned lambda vectors by PCR. The PCR fragments were purified, cloned into pGEMT-Easy and sequenced to ensure no errors were introduced. Then the BamHI/XbaI fragments (Figure 5) from the PCR clones were inserted into the corresponding sites of pGEMT-2F2-A to generate pGEMT2F2-B, pGEMT-2F2-C and pGEMT-2F2-D. These 30 genes were also inserted into the EcoRI site of the 35S/Nos binary vector.

WO 2004/099417 PCT/AU2004/000602 - 49 The truncated versions of the putative avirulence genes, which initiate translation at methionine-24, the first amino acid of the predicted mature proteins after signal peptide cleavage were made using the primers 10-1.48/10-1.16 (for 2F2-A and -B) or 10-1.53/10 1.16 (for 2F2-C and -D) and the coding sequences amplified using the pGEMT2F2-A, -B, 5 C, and -D plasmids as templates. These primers change an alternative upstream out-of-frame ATG codon to TTG to ensure that translation initiates at the desired ATG codon. PCR products were cloned in pGEMT-Easy and sequenced as described above to identify error free clones, then the EcoRI fragments were inserted into the 35S/Nos binary vector as described above. All gene expression constructs were fully sequenced to confirm their 10 integrity. Binary plasmids were transferred from E. coli into Agrobacterium tumefaciens strain GV3101 by a triparental mating with the helper E. coli strain RK2013. Cultures of the Agrobacterium transconjugants were infiltrated into flax leaves by pressing the syringe 15 opening against the underside of the leaf and applying a gentle pressure until the leaf was visibly flooded. The six lowest leaves of four week old plants were injected with the Agrobacterium suspensions. Leaves were observed in the following days to detect the induction of cell death/HR-like phenotypes in the presence of the appropriate resistance genes. The results demonstrated that the gene copies derived from the avirulence alleles were 20 capable of inducing a cell death response in the presence of the L5, L6 or L7 resistance genes. When tested on near-isogenic lines carrying L5, L6, L7 or L9 resistance genes, the 2F2-A gene induced necrosis on both L5 and L6 plants and weakly on L7, the 2F2-B gene induced necrosis on L5 only, and the 2F2-C gene induced necrosis on L6 and L7 (figure 7). These responses were first visible after 4 to 7 days. No responses were observed on L9 25 plants and expression of the 2F2-D gene (derived from the virulence allele) did not induce necrotic responses on any flax line even up to 20 days after infiltration. Therefore these genes can account for the three avirulence specificities that cosegregate at this locus. The results described above were obtained using the truncated versions of the IU2F2 30 homologs, lacking the 23 amino acid secretion signal and hence expressing the expected mature protein products (initiated at Met-24) as intracellular products in transformed plant WO 2004/099417 PCT/AU2004/000602 - 50 cells. This demonstrates that the recognition reaction between the 2F2 avirulence products and the corresponding resistance proteins can occur inside the plant cells, which is consistent with the expected location of the L resistance proteins. Expression of full length (secreted) versions of the 2F2 genes in flax induced weaker responses, typically involving chlorosis 5 rather than necrosis, that took longer to develop (9-12 days). Thus, the full length versions also retain some activity to induce a resistance response, when targeted to the apoplast. We also tested the interaction with L6 by co-infiltration assays in the flax variety Hoshangabad which does not express resistance to any known rust strain, although it does 10 contain a potentially functional gene-copy at the L locus (Ellis et al 1999). In these experiments, leaves were infiltrated with a mixture of two different Agrobacterium cultures; one containing either 35S-avirulence gene constructs (2F2-A) or an empty vector (pTNotTReg) and the second containing either the empty vector or a full length genomic DNA copy of the L6 resistance gene, including 2.4kbp native promoter sequence, in the 15 pTNotTReg (described by Lawrence et al 1995). Results are shown in Figure 8. Co infiltration of these two gene constructs into the rust susceptible cultivar, Hoshangabad, resulted in cell death of the infiltrated tissue, but either gene alone caused no effect, as expected. This indicated that co-expression of the resistance and avirulence genes in plant cells was able to induce defence responses, with retention of specificity. 20 Example 7. Co-expression of flax rust avirulence genes with the L6 resistance gene induces a hypersensitive cell death response in tobacco. We infiltrated tobacco leaves with the Agrobacterium strains containing the 35S-avirulence 25 gene constructs and/or the L6 resistance gene (as described above, except that the L6 containing Agrobacterium cultures were diluted to an OD600 of 0.5) and assayed for the development of the cell death response. Because of the different architecture of the tobacco leaves, we were able to perform separate infiltration experiments on single leaves. Each Agrobacteriumn suspension was infiltrated into a separate region of the leaf bounded by the 30 major veins. As observed in flax, co-expression of the L6 resistance protein along with the intracellular forms of the 2F2-A and 2F2-C avirulence products triggered a hypersensitive WO 2004/099417 PCT/AU2004/000602 - 51 cell death response, but this response was not observed when these proteins were expressed individually in tobacco (Figure 9). This demonstrated that the interaction between this R/Avr gene pair is capable of triggering a defense response in plants other than flax and could be used to induce disease resistance in crop plants. No response was observed when the 2F2-B 5 or 2F2-D (virulence allele) proteins were expressed in tobacco with the L6 resistance protein, showing that the R-AVR specificity was maintained in this heterologous system. Example 8. Homologous genes in other fungi. 10 We used gel blot hybridisation analysis to show that the wheat leaf rust pathogen, Puccinia recondita .f sp. tritici, also contains genes homologous to the flax rust avirulence genes and Secl4 homologs. Restriction digested DNA from rust-infected wheat leaves was separated on 1% agarose gels and transferred to nylon membranes as described above. The filters were then hybridised with 32 P-labeled DNA probes from the 2F2-A or Sec14 genes. These probes 15 were purified PCR products of plasmid subclones made with the primers 10-1.15 and 10 1.16 (2F2-A) or 10-1.4 and 10-1.9 (Secl4) as described above. Hybridisation was performed at a low stringency, with a 55 0 C hybridisation step and filters were washed in 1xSCC 0.1%SDS at 45°C. The Secl4 probe hybridised strongly to two bands in a HindIll digest and three in the XbaI digest (Figure 11). The 2F2-A probes hybridised to the same bands as the 20 Secl 14 probe, plus 1 or 2 additional bands. Thus homologs of both genes are present in wheat leaf rust. Flax rust and wheat leaf rust are both members of the Uredinales order, which includes all the rusts, but are very distantly related within this order being members of the melampsoreacae and pucciniaceae subfamilies respectively. This means that the 2F2 gene family, which encodes avirulence in flax rust, predates the diversification of these two 25 subfamilies and homologs would be widespread amongst rust species, many of which constitute important pathogens of agricultural crops. Homologs may also be present in other fungi. Methods: Isolation of rust DNA 30 Genomic DNA was isolated from leaf rust infected wheat by grinding 2g heavily infected leaf tissue (10 days after rust inoculation) in liquid nitrogen and then adding 7 mL extraction WO 2004/099417 PCT/AU2004/000602 - 52 buffer (100 mM Tris-HC1, 50 mM EDTA, 0.5 M NaC1, 1.25% [w/v] SDS, 10 mM 3 mercaptoethanol, pH 8.0) and incubating at 65 0 C for 10 minutes. Then 2 ml 5 M K-acetate was added followed by a 20 minute incubation on ice and a 15 minute spin at 4000 rpm to remove cell debris. The supernatant was then filtered through a kimwipe tissue and DNA 5 precipitated by the addition of 1 volume of isopropanol. The DNA was spooled from the interphase between the two liquids, placed into 1 ml of 70% ethanol and centrifuged at 14000 rpm in a microfuge. The DNA pellet was resuspended in 0.4 ml of T5E (50 mM Tris HC1, 10 mM EDTA, pH 8.0) with 20gg RNaseA (NEB) and incubated at 37 0 C for 15 minutes to remove RNA. The DNA solution was extracted once with PCI and then 0.5 10 volumes of 10 M NH 4 -acetate was added and the solution placed on ice for 10 minutes. A precipitate was removed by a 10 minute spin at 4 0 C 14000 rpm, and DNA was then precipitated from the supernatant by adding 1 volume of isopropanol. After rinsing with 70% ethanol the DNA pellet was resuspended in 100 pl TE. 15 Homologs of the 2F2 avirulence genes are isolated from rust fungi other than flax rust fungi by using DNA fragments of the sequences described here as probes to screen a DNA library prepared from a fungus species by standard techniques. These libraries are of genomic DNA fragments in a lambda phage vector such as is described in Example 1, or are genomic or cDNA libraries prepared in a variety of other vector systems such as plasmid, cosmid, YAC 20 or BAC vectors. The DNA probes are labelled using 32P or other labelling reagent and hybridised at high or low stringency to individual DNA clones using the methods as described in Example 1 to identify clones containing the homologous sequences. Alternatively, primers based on the DNA sequences described herein may be used to amplify related sequences from genomic DNA or cDNA of another rust fungus. To determine 25 whether the homologous sequences encodes avirulence activity, the DNA sequences are mapped using standard techniques such as RFLP or PCR based markers in a family segregating for known avirulence phenotypes such as the wheat stem rust family described by Zambinoet al (2000). In addition, the avirulence gene homologs are expressed in host plants using a transient transformation system such as the Agrobacterium infiltration method 30 described herein or alternatively a particle bombardment technique such as described by Shirasu et al (1999) or expressed stably in transformed plant. Induction of a specific WO 2004/099417 PCT/AU2004/000602 - 53 hypersensitive response (HR) when a corresponding host R gene was also expressed would indicate a positive avirulence function. The Avr gene homolog is also expressed stably in transformed plants generated by standard techniques and crossed to lines containing potential corresponding R genes, or the R genes may be expressed transiently in the 5 transgenic line as described in Example 10. Example 9. Additional variants ofAvr genes Genes homologous to the avirulence gene 2F2 were isolated from several different rust 10 strains by PCR amplification using the primers 10-1.15/10-1.16 (as described above) and genomic DNA from rust isolates. These rusts were originally isolated from cultivated flax in geographically isolated areas. As described in Example 5, two additional 2F2 gene variants, (E and F) were detected in and isolated from rust strain H, at the alternative allele to the 2F2 A and -B genes. An additional two variants (G and K) were identified in and isolated from 15 the virulent parent strain C at the alternative allele to 2F2-D. Rust strain 271 contained 5 2F2 variant genes (A, B, F, H and I). PCR amplification of these genes from progeny derived from a cross between strains 271 and C indicated that the A, B and F variants co-segregated at one allele encoding avirulence on L5 and L6, while the H and I variants occurred at the alternative virulence allele. Rust strain 339 contained three 2F2 gene variants (A, B and L). 20 These data are shown schematically in Figure 12. Homologous genes were also amplified from the rust strain WA, which was isolated from a different host species, the native Australian flax, Linum marginale. Two 2F2 variants (C and J) were identified in this isolate, one of which was identical to the 2F2-C gene identified 25 from the genomic DNA library in Example 4. Subsequent Southern blot hybridisation analysis using the 2F2 probe on genomic DNA from rusts CH5, H and WA indicated that restriction fragments specific to the 2F2-C genomic sequence were not present in rust H or CH5, but were present in rust WA, indicating that this or a related rust was the source of the genomic clone rather than CH5. 30 WO 2004/099417 PCT/AU2004/000602 - 54 The 12 predicted 2F2 amino acid sequences varied in 35 of the 150 amino acid positions (Figure 13). The translation products were all of 150 amino acids with a predicted 23-amino acid signal peptide, resulting in 127-amino acid mature polypeptides. 5 T-DNA vectors for use in Agrobacterium were generated that encoded the 2F2-E, F, G, H, I, J, K and L avirulence gene proteins, without the predicted signal peptides, each driven by the 35S promoter. These were tested by Agrobacterium-mediated introduction of the genes into the leaves of flax plants, for transient expression in flax lines carrying the L5, L6 or L7 resistance genes as described above. When tested in the flax transient assay system, all of the 10 genes isolated from known avirulence alleles gave positive necrotic responses (hypersensitive response) with L5, L6 or L7, while all of those genes found at virulence alleles gave no response with these resistance genes (Figure 13). RNA was extracted from the flax leaves 6 days after infiltration with Agrobacterium strains 15 carrying the 35S-2F2 constructs and analysed by Northern blot hybridisation with the 32

P

labeled 2F2 DNA probe (Figure 14). This experiment showed that all of the 2F2 variants were expressed to a similar level in the transient assay and indicated that the basis of the virulence/avirulence phenotype encoding by these loci was the ability of the encoded avirulence proteins to induce a response with the corresponding resistance genes, rather than 20 merely the presence of these genes or reduced expression levels. In addition we observed some differences in the recognition specificity of the 2F2 gene variants, with 2F2-C and -E giving a positive response with L6 but not L5, while others are recognised by both R genes. These differences are also apparently due to the amino acid sequence differences between these proteins. 25 Example 10. Co-expression ofresistance and avirulence genes in transgenic plants. Specific HR induction has been observed previously when stably transformed plants expressing Avr products were crossed to plants containing the corresponding R genes, with 30 the progeny showing seedling death or stunted growth phenotypes (Jones et al., 1994; Gopalan et al., 1995; Hammond-Kosack et al., 1998; Erickson et al., 1999). Therefore, the WO 2004/099417 PCT/AU2004/000602 -55 35S driven 2F2-A, B, C and D constructs described in Example 6 (both the full length and truncated versions lacking the signal peptide) were stably transformed into the flax variety Ward, which contained L9. No visible phenotypes were observed among the primary To transgenic plants. This was expected since the Avr proteins were not expected to interact 5 with the L9 resistance gene. For each construct, at least three independent To plants were crossed to lines homozygous for the LS, L6, L7 or Lx resistance genes. Lx had an identical specificity to L7, but conferred a stronger resistance phenotype (Luck et al., 2000). Each To plant was also crossed to the universally susceptible flax line Hoshangabad, and self fertilised T 1 seed were collected. All progeny from these control fertilisations showed 10 normal growth and phenotype. However, progeny resulting from some crosses involving L5, L6, L7 or Lx segregated for seedling lethal or stunted growth phenotypes. No abnormal phenotypes were observed among the self-progeny or the outcross progeny involving the Hoshangabad, L 7 or Lx parents. However, in the crosses to the L5 or L6 parents, the progeny segregated for wild type and stunted phenotypes. Table 3 summarises the seedling 15 phenotypes observed in progeny of crosses between each of the To transgenic plants and the panel of resistant lines. Twelve seeds for each cross were assayed. The severity of these phenotypes varied between different outcross families, but was consistent within each family. In the most severe cases thin, incompletely filled seeds were produced and these failed to germinate when placed on wet filter paper (score = 0). In other cases, apparently 20 normal seeds were produced that germinated in vitro, but gave rise to stunted seedlings. When germinated in soil, these seedlings either failed to emerge (score = 1), were arrested in growth after cotyledon emergence (score = 2), or gave rise to extremely stunted (score = 3) or moderately stunted (score = 4) dwarf plants. In some crosses only wild type progeny (score = 5) were observed. Segregation of wild-type and stunted phenotypes was generally 25 consistent with the 1:1 ratio expected for single locus transgenes. These experiments showed that the Avr genes were functional in transformed plants. The specificity of the interactions observed in this experiment were very similar to those observed in the agro-infiltration transient expression assays. Five independent To plants 30 containing the truncated 2F2-A transgene (lacking the signal peptide) each gave rise to non viable seed when crossed to the L5, L6 or Lx lines. A milder stunted phenotype was observed WO 2004/099417 PCT/AU2004/000602 - 56 when these plants were crossed to the L7 line (score = 3-4). Of seven To plants expressing 2F2-B minus the signal peptide, four gave rise to non-viable seed when crossed to L5, while the remainder gave rise to extremely stunted progeny (one plant each with scores 1, 2 or 3). Progeny of these seven To plants crossed to L6 showed a range of weaker phenotypes from 5 seedlings arrested after cotyledon emergence (score 2, one To plant) to dwarf seedlings (4 To plants with score 3, one To plant with score 4) and one To plant gave only wildtype progeny (score 5). This weaker phenotype in the L6 background compared to L5 was consistently observed for each of the individual To plants, with seedling phenotype scores 2-3 points higher in the crosses to L6 than in the crosses to L5. No effects were observed when the 2F2 10 B plants were crossed to L7 or Lx (Table 3). The 2F2-C gene showed no phenotype in crosses to L5, but induced a strong phenotype (score 0) when crossed to L6 and a weaker phenotype in crosses to Lx (score 2-4). DNA gel blot hybridisation using the 2F2 derived probe on genomic DNA from individual progeny of several crosses (as described above) showed that the 2F2 transgenes co-segregated with the abnormal growth phenotypes. 15 Just as in the transient assays, constructs encoding the 2F2-A, -B and -C full-length proteins showed weaker responses than the truncated versions, but with a similar relative specificity (Table 3). For instance, nine independent full-length 2F2-A To plants gave rise to progeny with a range of severe to mild stunted phenotypes when crossed to L5 or L6, a very mild 20 phenotype when crossed to Lx and only wild-type progeny when crossed to L7. This weaker interaction was not due to lower transgene expression, since we detected equivalent transcript levels in transgenic plants with the full length and truncated constructs. No abnormal phenotypes were observed in crosses involving transgenic plants expressing the 2F2-D full length or truncated genes, although DNA gel blot hybridisation showed that these 25 transgenes were inherited in crosses to the LS and L6 lines. RNA gel blot analysis also showed that the full-length 2F2-D construct was expressed at similar levels to the avirulence allele constructs in the transgenic plants. However, the three transgenic plants containing the truncated 2F2-D gene showed low expression of this transgene. 30 Tobacco plants stably transformed with the 35S2F2-C gene construct were generated and assayed by infiltration with an Agrobacterium strain containing the flax L6 resistance gene.

WO 2004/099417 PCT/AU2004/000602 -57 This treatment triggered a rapid cell death response, indicating that the specific HR induction was induced in stably transformed plants expressing the flax rust avirulence gene. Methods 5 Transformation of the flax line Ward was as described by Anderson et al. (1997), except that the selective agent spectinomycin was used at 50 pg/mL. Flax seeds were surface sterilised by immersion in a 70% [v/v] ethanol for 5 minutes followed by a 2% [w/v] solution of Zephirin in 10% ethanol [v/v] for 5 minutes and then washed in sterile distilled water. Seeds were germinated on solid MS media (containing 0.8% agar). Agrobacterium strains were 10 grown overnight in LB medium plus appropriate antibiotics, centrifuged at 2500g and resuspended in liquid MS medium as described above. Sterile flax hypocotyls cut into 0.5 0.75 cm lengths were floated on the Agrobacterium suspension for 15 minutes and then placed onto solid MS medium and incubated at 28 0 C for 3 days. Hypocotyl pieces were transferred to callusing medium (solid MS containing 1 pig/mL BAP (benzyl aminopurine), 15 0.1 pg/mL NAA (o-napthalene acetic acid), 100 [tg/mL cefotaxime and 50 gg/mL spectinomycin) and incubated for a further for 3 weeks. Calli were then transferred to regeneration medium (as for callusing medium but with 0.02 gg/mL NAA) and incubated further with changes to fresh medium every three weeks. Green shoots were removed and transferred to rooting medium (solid MS plus 100 jig/mL cefotaxime) until roots formed, 20 and then transferred to soil. For tobacco transformation, leaves of W38 tobacco maintained in sterile tissue culture on solid MS medium were sliced into -lcm 2 pieces and floated on Agrobacterium suspensions as above then transferred to MS plates for two days. Explants were then transferred to 25 tobacco shooting medium (as for flax but with 0.5 pg/mL NAA) until shoots appeared. Shoots were transferred to rooting medium (as for flax but with 0.05 5 pg/mL NAA) and then to soil after roots appeared. Genomic DNA was extracted from To plants using DNAzol reagent (Molecular Research 30 Center Inc., Cincinnati Ohio) and analysed by gel blot hybridisation to determine transgene copy number. Selected plants containing 1-3 intact copies of the transgene were used as the WO 2004/099417 PCT/AU2004/000602 -58 female parents in crosses to flax lines carrying various L resistance genes. Flowers were emasculated prior to maturity and then hand pollinated. Twelve seeds from each cross were planted in soil to examine the phenotypes of the resultant progeny. Seeds from some crosses were also germinated in petri dishes on wet filter paper. 5 Example 11. AvrL567 genes are expressed in haustoria The expression pattern of the AvrL567 genes in rust was examined by RNA gel blot analysis (Figure 15A). 2F2-derived transcripts were detected in RNA samples derived from flax 10 leaves infected with rust strain CH5, but not in RNA from germ tubes of rust spores germinated in vitro. This suggested that 2F2 avirulence gene expression was induced during infection. On the other hand the linked Secl4 rust gene and a flax rust 3-tubulin gene (Ayliffe et al., 2001) were expressed in germinated spores as well as during infection. 2F2 transcripts were detected in RNA from leaves infected with rust strains homozygous for the 15 either the virulence or avirulence alleles (Figure 15A), indicating that the 2F2-D gene is expressed in rust. Again, this suggested that the lack of recognition of this allele by the L5, L6 and L7 genes was due to the amino acid sequence differences from the avirulent variants, rather than differences in expression of the gene. The slightly lower amount of transcript detected from the virulent rust was consistent with the presence of only a single gene at this 20 allele compared to the two copies present at the avirulence allele. Due to the low levels of rust RNA present in infected leaves at early time points after infection, RT-PCR was used to examine 2F2 avirulence gene expression at these early stages (Figure 15B). Even with this more sensitive assay no 2F2 transcript was detected in RNA from rust spores germinated in vitro, but it was detected in leaves 24 hours after inoculation. Expression of the rust tubulin 25 and Secl4 genes was also detected by RT-PCR at 24 hours after inoculation. Rust infection involved germination of the rust spore, growth of the germ tube on the leaf surface, and then appresorium formation over a stoma to allow penetration of the leaf. Inside the leaf a sub-stomatal vesicle formed and growth of infection hyphae leads to differentiation 30 of a haustorial mother cell that extended a haustorium into a leaf mesophyll cell. In rust infected flax, the first haustoria appear about 12 hours after infection and by 24 hours WO 2004/099417 PCT/AU2004/000602 -59 haustoria have formed at almost all penetration sites (Kobayashi et al., 1994). Haustoria are the primary site of contact between rust pathogens and host mesophyll cells and in L6 mediated resistance, hypersensitive cell death was first induced in cells containing developing haustoria by 24 hours post infection (Kobayashi et al., 1994), suggesting that 5 avirulence genes were likely to be expressed in these structures. Affinity chromatography with a sepharose ConA column (Hahn and Mendgen, 1992) was used to purify haustoria from flax leaves infected with rust CH5. No contaminating plant cells or fungal mycelia were observed by microscopy in the purified haustorial samples, although some chloroplasts were present. The 2F2 avirulence gene transcript was highly abundant in RNA isolated from 10 the purified haustoria (Figure 15A). A cDNA library prepared from the purified flax rust haustorial RNA was screened with a 2F2 probe, which identified 4, 2 and 13 cDNA clones derived from 2F2-A, -B and -D respectively, indicating that each of the three genes was expressed in haustoria. Thus the observed expression pattern of the 2F2 avirulence genes was consistent with the timing and location of HR induction in resistant L6 plants. 15 Methods RNA was prepared from infected plant tissue or purified haustoria using the QIAGEN Plant RNeasy kit. For RNA gel blot analysis total RNA (10tg) was denatured at 65 0 C for 10 minutes in 50% formamide, 5% formaldehyde, lX MOPS buffer (200 mM 20 MOPS {3-[N-Morpholino]propanesulfonic acid; Sigma}, 50 mM sodium acetate, 10 mM EDTA, pH7.0) and then separated on 1.5% agarose genes containing 6% formaldehyde in 1X MOPS buffer. RNA was blotted onto nylon membranes in 20X SSC and hybridised to 32 P-labeled DNA probes as described above. For RT-PCR analysis, total RNA was reverse transcribed using Superscript Reverse Transcriptase (Gibco BRL) with an oligo-dT 25 primer 25 and then amplified by Taq polymerase with the following thermal profile: 94 0 C 2 minutes; 38 cycles 94 0 C 20 seconds, 55 0 C 30 seconds, 72 0 C 1 minute; 72 0 C 5 minutes. 2F2 transcripts were amplified with the primers 10-1.15 and 10-1.16, Secl4 transcripts with 10 1.4 and 10-1.9, and flax rust tubulin transcripts with tub 10: 5' AAACACTAAATCAAACATGAGGG-3' (SEQ ID NO: 41), and tubl 12 5' 30 ACAAAGAACCAAAAGGACCCGA-3' (SEQ ID NO: 42). Each primer set spanned one or more introns to distinguish cDNA and genomic DNA derived products.

WO 2004/099417 PCT/AU2004/000602 - 60 Haustoria were isolated from flax leaves 7 days after inoculation with rust strain CH5 by affinity chromatography essentially as described by Hahn and Mendgen (1992). An affinity column was prepared by covalently attaching Concanavalin-A (Pharmacia Biotech AB, 5 Uppsala, Sweden) to CNBR-activated Sepharaose 6MB (Pharmacia Biotech AB). Four grams of CNBr-Sepharose 6MB was swelled in 1mM HC1 for 15 min, then washed on a glass filter with 200ml ImM HC1. The gel was then washed quickly with 30ml coupling buffer (0.1 M NaHCO 3 , 0.5M NaC1, pH 8.6). The gel was incubated with 10-20mg Concanavalin-A (in coupling buffer; ratio gel to buffer approx. 1:1) overnight at 4oC under 10 gentle shaking. After incubation the gel was extensively washed with coupling buffer and the active groups were blocked by 2 h incubation at room temperature in a buffer containing 0.5 M glycine, 0.1 M NaHCO 3 , pH 8.3. The gel was washed three times alternating with 0.1 M Na-acetate, 0.5M NaC1, pH 4.0 and with 0.1 M Tris-HC1, pH 8.0 (10 ml each per ml of gel). The gel was then equilibrated with storage buffer (0.15 M NaC1, 10 mM Tris-HCl ph 15 7.2, 1 mM CaCl 2 , 1 mM MnC1 2 , 0.02% sodium azide) as a 50% slurry and stored at 40C. Thirty grams of infected leaf material were placed in 180 mls of homogenisation medium (0.3M sorbitol, 20mM MOPS, pH 7.2, 0.1% (w/v) BSA, 0.2 % (v/v) 2-mercaptoethanol, 0.2 % (w/v) PEG 6000). The leaves were homogenised in a Waring Blender at maximum speed 20 for 30 seconds. The homogenate was filtered through a 100 pm nylon mesh, then through a 11 pIm nylon mesh. The filtrate was divided into 6 30 ml centrifuge tubes and centrifuged in a HB-6 rotor for 5 minutes at 6500 rpm. The pellets were each resuspended in 1 ml suspension medium (0.3M sorbitol, 10mM MOPS, pH 7.2, 0.2% (w/v) BSA, 1mM KC1, 1mM MgC1 2 , 1mM CaCl 2 ). The resuspended pellet suspension was loaded onto the column, 25 which contained 5 mls of gel in volume, equilibrated with suspension medium. The loading was carried out in two consecutive rounds, across three columns, each loading containing 1 ml of suspension. Each loading of suspension was allowed to incubate on the column for 15 minutes. After the second incubation the suspension was washed through the column with 10-15 mls of suspension buffer. The haustoria were released by adding 5 mls of suspension 30 buffer to the column and agitating the beads using a blunt ended lml pipette tip by pipetting up and down. The supernatant containing the haustoria were removed after the beads had WO 2004/099417 PCT/AU2004/000602 -61 settled. The haustoria were pelleted by centrifugation for 3 min at 9000 g. The pellet was then quickly frozen in liquid nitrogen and stored at -80 0

C.

WO 2004/099417 PCT/AU2004/000602 -62 TABLE 1 Nucleotide sequences of primers used for sequencing and PCR of the flax rust avirulence locus. Primer Sequence SEQ ID Primer Sequence SEQ ID NO. NO. 10-1.1 AACTTGCTTGGTAAGTATCAC 43 10-1.28 GGATGTTCGAGGTAGTGTC 70 10-1.2 GTCCTTACATATTGCTAGGTC 44 10-1.29 CAAAGTTGGCGTTTATCTGC 71 10-1.3 CACAATCATGAACATAGCTAG 45 10-1.30 TATGGGGTGGTAAGGCATC 72 10-1.4 GTCGACCGATCTATATCGAG 46 10-1.31 ATCTTTCATTTCAAGAGATGTG 73 10-1,5 CACCTCCGTACATATCGTC 47 10-1132 CGTGCACTTACTCAAACACG 74 10-1.6 TTGCATGGATCCCACCAAG 48 10-1.33 GAACTCCATTTTGATGTACATC 75 10-1.7 GGCAAGTTTTACATCATCAATG 49 10-1.34 CCACTACTTCTGTATGCCTC 76 10-1.8 TGCCTTGAGCCGGTGATTC 50 10-1.35 TAATGACAAATATCCCAATTCAG 77 10-1.9 GTCTCTTCGTCCTTCCAAG 51 10-1.36 CCACCCGTGGAAAGATGC 78 10-1.10 ACATTAGTGGTGTGATCTAGC 52 10-1.37 CGAGCATTTGTAGGCATTTGTC 79 10-1.11 CGAGCGTGGGACTTTTGC 53 10-1.38 CTTTTCAAAAGTATGAAAGTCAAC 80 10-1.12 AAATCCAAAACTTTGGCACTTG 54 10-1.39 CACTGGAATTGATTTCAATCAC 81 10-1.13 AAATGAACAAGCTCAGGTAGC 55 10-1.40 AGCGATTATAAAATGAGACAAG 82 10-1.14 CATTTGCATGTATAAGCAGAC 56 10-1.41 CAAAATACATCCAAGAATATCTTC 83 10-1.15 AAGCTTGAGAGCTCCGCTC 57 10-1.42 GAAAACCTGTCAATGGGACG 84 10-1.16 TAATCCTCGTTGACATCAGTC 58 10-1.43 GTCTTTCATTAACAAATCCACG 85 10-1.17 CTTCAATTGTACGGCGAGTC 59 10-1.44 AGAACTTGTATAACTGATCATC 86 10-1.18 CCCAGATCTTGCAAGAAGTAAG 60 10-1.45 TGCCATGACATGTTTATCAAAG 87 10-1.19 CCAGACTACATCAAAATCAAG 61 10-1.46 TGAACTCTTTTAACCTTAAGTTG 88 10-1.20 ATGTTAAATGATTGGTTGACAG 62 10-1.47 GATACGAGCACAAGAAGTAG 89 10-1.21 ATAGGATCAAAACTGACCAATC 63 10-1.48 GGATCCTTGCAATGGAACATGTAC 90 10-1.22 GATGGCAACTTAAGACCGTG 64 10-1.49 AGTTATACAAGTTCTTCAAAGAC 91 10-1.23 CGAATCGACCTAAAAACGATC 65 10-1.50 TTACAATCCACATCGAATTGTG 92 10-1.24 TGCGTTAATACTTTCGTCATC 66 10-1.51 AGCGAGTGATTGAGATTGAG 93 10-1.25 CAGGCTTAAACTTAGCCAAAG 67 10-1.52 TTCTTGACCTGACTATATTTCG 94 10-1.26 ACCGCGCCAATGCCATAC 68 10-1.53 GGATCCTTGCAATGGAAGATGTAC 95 10-1.27 CCTTTGTACAGTCTTCAGTAG 69 5 TABLE 2 A selection of rust diseases of plants. CEREAL RUST DISEASES Host plant Common disease name Rust Species Barley Crown rust Puccinia coronata Corda Leaf rust Puccinia hordei Otth 10 Stem rust Puccinia graminis Pers.:Pers. Stripe (yellow) rust Puccinia stritformis Westend. Corn Common rust Puccinia sorghi Schwein. Southern rust Pucciniapolysora Underw.

WO 2004/099417 PCT/AU2004/000602 - 63 Tropical rust Physopella pallescens (Arth) Cummins & Ramachar P. zeae (Mains) Cummins & Ramachar = Angiopsora zeae Mains 5 Oats Crown rust, Puccinia coronata Corda Stem Rust Puccinia graminis Pers. Rye Stem rust Puccinia gramninis Pers.:Pers. = P. graminis Pers. f. sp. secalis Eriks. & E. Henn. 10 Leaf (brown) rust Puccinia recondita Roberge ex Desmaz. (anamorph: Aecidium clematidis DC.) Sorghum Rust Pucciniapurpurea Cooke Sugarcane Common Rust Puccinia melanocephala Syd. & P. Syd. = P. erianthi Padw. & Khan 15 Orange Rust Puccinia kuehnii (Kruger) E. Wheat Leaf (brown) rust Puccinia triticina Eriks. = P. recondita Roberge ex Desmaz. f. sp. tritici (Eriks. & E. Henn.) D.M. Henderson = P. tritici-duri Viennot-Bourgin 20 Stem (black) rust Puccinia graminis Pers.:Pers. = P. graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn. Stripe (yellow) rust Puccinia striiformis Westend. (anamorph: Uredo glumarumin JC. Schmidt) 25 OTHER RUST DISEASES Apple American hawthorne rust Gymnosporangium globosum (Farl.) Farl. Cedar apple rust Gymnnosporangiumjuniperi-virginianae Schwein 3apanese apple rust Gymnosporangium yamadae Miyabe ex Yamada Pacific Coast pear rust Gymnosporangium libocedri (C. Henn.) F. Kern 30 Quince rust Gymnosporangium clavipes (Cooke & Peck) Cooke & Peck in Peck Asparagus Rust Puccinia asparagi De Candolle Banana Leaf rust Uredo musae Cummins Uromyces musae Henn. 35 Bean Rust Uromyces appendiculatus (Pers.: Pers.) Unger Beet Seedling rust Puccinia subnitens Dietel Carrot Rust Aecidiumfoeniculi Cast. Uromyces gramninis (Niessl) Dietel U. lineolatus (Desmaz.) J. Schrot. subsp. nearcticus 40 Savile = U. scirpi Burrill Chickpea Rust Uromyces ciceris-arietini Jacz. in Boyer & Jacz. Uromyces striatus J. Schrat Coffee Rust (orange or leaf rust) Hemileia vastatrix Berk. & Br.

WO 2004/099417 PCT/AU2004/000602 - 64 Rust (powdery or grey rust) Hemileia coffeicola Mauble. & Rog. Cotton Cotton rust Puccinia schedonnardi Kellerm. & Swingle Southwestern rust Puccinia cacabata Arth. & Holw. in Arth. Tropical rust Phakopsora gossypii (Lagerh.) Hiratsuka 5 Eucalyptus rust Puccinia psidii Winter. Flax Rust Melampsora lini (Ehrenb.) Desmaz. Grape Rust Physopella ampelopsidis (Dietel & P. Syd.) Cummins & Ramachar Lettuce Rust Puccinia dioicae Magnus 10 = P. extensicola Plowr. var. hieraciata (Schwein.) Arthur Onion Asparagus rust Puccinia asparagi DC. in Lam. & DC. Onion rust Puccinia allii F. Rudolphi Pea Rust Uromycesfabae (Grev.) Fuckel 15 peanut Rust Puccinia arachidis Speg. Pear American hawthorne Rust Gymnosporangium globosum (Farl.) Farl. Kern's pear Rust Gymnosporangium kernianum Bethel Pacific Coast pear Rust Gymnosporangium libocedri (C. Henn.) F. Kern Pear trellis Rust 20 (European pear rust) Gymnosporangiumfuscum R. Hedw. in DC. Rocky Mountain pear Rust Gymnosporangiumn nelsoniiArth. Poplar European Poplar rust Melampsora larici-populinaKlebahn. American leaf rust Melampsora medusaeThuem. Potato Common rust Pucciniapittieriana P. Henn. 25 Deforming rust Aecidium cantensis Arthur Red clover Rust Uromnyces trifolii-repentis Liro ex Liro var.fallens (Arth.) Cummins Soybean Rust Phakopsora pachyrhizi Syd. Strawberry Leaf rust Phragmidium potentillae (Pers.:Pers.) P. Karst 30 = Frommea obtusa (F. Strauss) Arth. Sunflower Rust Puccinia helianthi Schwein. P. xanthii Schwein. Uromycesjunci (Desmaz.) Tul. Sweet potato Red rust Coleosporium ipomoeae (Schwein.) Burrill 35 WO 2004/099417 PCT/AU2004/000602 - 65 Table 3. Abnormal growth phenotypes of progeny from crosses between 2F2 transformed flax and various L gene lines. # To a Phenotypesb of progeny from crosses to; 5 Transgene plants LS L6 L7 Lx 2F2-A1 27 c 5 0 0 3-4 0 10 2F2-A" 5 o 9 1-3 1-5 5 4-5 2F2-Bl 27 7 0-3 2-5 5 5 2F2-B is o 7 1-3 4-5 5 5 15 2F2-C 127 5 5 0 5 2-4 2F2-C 1 5 7 5 3 5 5 2F2-D 127 3 5 5 5 5 2F2-D 15 7 5 5 5 5 20 a The number of independent transgenic To plants used in crosses to L gene lines. b Each To plant was crossed to the L5, L6, L7 and Lx lines. Each cross was scored according to the severity of any stunted growth phenotype segregating among the 25 progeny. For each 2F2 transgene/L gene combination the range of scores obtained for crosses involving independent To plants is shown. Numerical scores represent the following phenotypes: 0 = incompletely filled seed, no germination in vitro 1 = seeds germinate in vitro, but seedlings do not emerge from soil 30 2 = seedling growth arrested after cotyledon emergence 3 = extreme dwarf seedlings 4 = moderate dwarf seedlings 5 = all progeny have wild type growth 35 C The truncated and full length 2F2 constructs are designated by the superscripts 127 and 150 respectively, which indicate the number of amino acids in the predicted protein products.

WO 2004/099417 PCT/AU2004/000602 - 66 REFERENCES 1. Altschul, S.F., Madden, T.L., Schiffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein 5 database search programs, Nuc. Acids Res. 25, 3389-3402. 2. Anderson, P.A., Lawrence, G.J., Morrish, B.C., Ayliffe, M.A., Fimnnegan, E.J. and Ellis, J.G. (1997). Inactivation of the flax rust resistance gene M associated with loss of a repeated unit within the leucine-rich repeat coding region. Plant Cell 9, 641-651. 3. Axtell M.J., and Staskawicz B.J. (2003). Initiation of RPS2-specified resistance in 10 Arabidopsis is coupled to AvrRpt2-directed elimination of RIN4. Cell 112, 369-377. 4. Ayliffe M.A., Dodds P.N. and Lawrence, G.J. (2001). Characterisation of the beta tubulin genes from Melampsora lini and comparison of fungal beta-tubulin genes. Mycological Research 105, 818-826. 5. Ayliffe M.A., Roberts J.K., Mitchell H.J., Zhang R., Lawrence G.J., Ellis J.G. and 15 Pryor T.J. (2002). A plant gene upregulated at rust infection sites. Plant Physiol. 129:169-180. 6. Bankaitis, V.A., Malehorn, D.E., Emr, S.D. and Greene R. (1989). The Saccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that is required for transport of secretory proteins from the yeast Golgi complex. J. Cell Biol. 108, 1271-1281. 20 7. Diatchenko, L., Lau, Y-F.C., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Svberdlov, E.D., and Siebert, P.D. (1996). Suppression subtractive hybridisation: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93, 6025 6030. 25 8. Dodds, P.N., Lawrence, G. and Ellis, J. (2001a). Contrasting modes of evolution acting on the complex N locus for rust resistance in flax. Plant Journal 27, 439-453. 9. Dodds, P.N., Lawrence, G.J. and Ellis, J.G. (2001). Six amino acid changes confined to the LRR P-strand/p3-turn motif determine the difference between the P and P2 rust resistance specificities in flax. Plant Cell 13, 163-178.

WO 2004/099417 PCT/AU2004/000602 - 67 10. Ellis, J.G., Lawrence, G.J., Luck, J.E., and Dodds, P.N. (1999). Identification of regions in alleles of the flax rust resistance gene L that determine differences in gene for-gene specificity. Plant Cell 11, 495-506. 11. Erickson, F.L., Holzberg, S., Calderon-Urrea, A., Handley, V., Axtell, M., Corr, C. and 5 Baker,B. (1999). The helicase domain of the TMV replicase proteins induces the N mediated defence response in tobacco. Plant J. 18, 67-75. 12. Eyal, Y., Meller, Y., Lev-Yadun, S., Fluhr, R. (1993). A basic-type PR-1 promoter directs ethylene responsiveness, vascular and abscission zone-specific expression. Plant Journal 4:225-234. 10 13. Flor, H.H. (1971). Current status of the gene-for-gene concept. Annu. Rev. Phytopath. 9, 275-296. 14. Gopalan, S., Bauer, D.W., Alfano, J.R., Loniello, A.O., He, S.Y. and Collmer, A. (1996). Expression of the Pseudomonas syringae avirulence protein AvrB in plant cells alleviates its dependence on the hypersensitive response and pathogenicity (hrp) 15 secretion system in eliciting genotype specific hypersensitive cell death. Plant Cell 8, 1095-1105. 15. Hahn, M. and Mendgen, K. (1992). Isolation by ConA binding of haustoria from different rust fungi and comparison of their surface qualities. Protoplasma 170, 95 103. 20 16. Hammond-Kosack, K.E., Tang, S., Harrison, K. and Jones, J.D.G. (1998). The tomato Cf-9 disease resistance gene functions in tobacco and potato to confer responsiveness to the fungal avirulence gene product Avr9. Plant Cell 10, 1251-1266. 17. Hughes, A.L. and Ne, M. (1988). Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature 335, 25 167-170. 18. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 19, 4004-4014. 19. Jones, D.A., Thomas, C.M., Hammond-Kosack, K.E., Balint-Kurti, R.J and Jones, 30 J.D.G. (1994). Isolation of the tomato Cf-9 gene for resistance to Cladosporiumfulvum by transposon tagging. Science 266, 789-793.

WO 2004/099417 PCT/AU2004/000602 - 68 20. Joosten, M.H.A.J., Cozijnsen, A.J., and de Wit, P.J.G.M. (1994). Host resistance to a fungal tomato pathogen lost by a single base pair change in an avirulence gene. Nature 367, 384-386. 21. Kobayashi, I., Kobayashi, Y. and Hardham, A.R. (1994). Dynamic reorganisation of 5 microtubules and microfilaments in flax cells during the resistance response to flax rust infection. Planta 195, 237-247. 22. Kumar, S., Tamura, K. and Nei, M. (1993) MEGA: Molecular Evolutionary Genetics Analysis, version 1.0. The Pennsylvania State University, University Park, PA 16802. 23. Lawrence, G.J., Mayo, G.M.E., and Shepherd, K.W. (1981). Interactions between 10 genes controlling pathogenicity in the flax rust fungus. Phytopathology 71, 12-19. 24. Lawrence, G.J., Finnegan E.J., Ayliffe, M.A., and Ellis J.G. (1995). The L6 gene for flax resistance is related to the Arabidopsis bacterial resistance gene Rps2 and the tobacco viral resistance gene N. Plant Cell 7, 1195-1206. 25. Lopez,M.C., Nicaud,J.M., Skinner,H.B., Vergnolle,C., Kader,J.C., Bankaitis,V.A. and 15 Gaillardin,C. (1994). A phosphatidylinositol/phosphatidylcholine transfer protein is required for differentiation of the dimorphic yeast Yarrowia lipolytica from the yeast to the mycelial form. J. Cell Biol. 125, 113-127 26. Luck, J.E., Lawrence, G.J., Dodds, P.N., Shepherd, K.W., and Ellis, J.G. (2000). Regions outside of the leucine-rich repeats of flax rust resistance proteins have a role 20 in specificity determination. Plant Cell 12,. 27. Luderer, R., Takken, F.L.W., de Wit, P.J.G.M., and Joosten, M.H.A.J. (2002). Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins. Molecular Microbiol. 45, 875-884. 28. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R. and Dangl, J.L. (2003). 25 Arabidopsis RIN4 is a target of the type III effector AvrRpt2 and modulates RPS2 mediated resistance. Cell 112, 379-389. 29. Mackey, D., Holt, B.F., Wiig, A. and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1 mediated resistance in Arabidopsis. Cell 108, 743-754.

WO 2004/099417 PCT/AU2004/000602 - 69 30. Mayda E., Marques C., Conejero V. and Vera P. (2000). Expression of a pathogen induced gene can be mimicked by auxin insensitivity. Mol.Plant Microbe Interacts. 13:23-31. 31. Opperman, C.H., Taylor, C.G. and Conkling, M.A. (1994). Root knot nematode 5 directed expression of a plant root-specific gene. Science 263:221-223. 32. Orbach, M.J., Farrall, L., Sweigard, J.A., Chumley, F.G., and Valent, B. (2000). A telomeric avirulence gene determines efficacy for the rice blast resistance gene Pi-ta. Plant Cell 12, 2019-2032. 33. Pontier D., Balague C., Bezombes-Marion I., Tronchet M., Deslandes L. and Roby D. 10 (2001). Identification of a novel pathogen responsive element in the promoter of the tobacco gene HSR203J, a molecular marker of the hypersensitive response. Plant J 26:495-507. 34. Roberts, J.K. and Pryor, A. (1995). Isolation of a flax (Linum usitatissimum) gene induced during susceptible infection by flax rust (Melampsora lini). Plant J. 8:1-8. 15 35. Roby, D., Broglie, K., Cressman, R., Biddle, P., Chet, I. and Broglie, R. (1990). Activation of a bean chitinase promoter in transgenic tobacco plants by phytopathogenic fungi. Plant Cell 2:999-1007. 36. Rohe, M., Gierlich, A., Hermann, H., Hahn, M., Schmidt, B., Rosahl, S., and Knogge, W. (1995). The race-specific elicitor NIP1 from the barley pathogen Rhynchosporium 20 secalis determines avirulence on host plants of the Rrsl resistance genotype. EMBO J. 14, 4168-4177. 37. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, NY, Cold Spring Laboratory Press. 38. Santamaria, M., Thomson, C.J., Read, N.D. and Loake, G.J. (2001) The promoter of a 25 basic PRI-like gene, AtPRB1, from Arabidopsis establishes an organ-specific expression pattern and responsiveness to ethylene and methyl jasmonate. Plant Mol. Biol. 47:641-652. 39. Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michelmore, R.W. and Staskawicz, B.J. (1996). Molecular basis of specificity in bacterial speck 30 disease of tomato. Science 274, 2063-2065.

WO 2004/099417 PCT/AU2004/000602 - 70 40. Shirasu, K., Nielsen, K., Piffanelli, P., Oliver, R. and Schulze-Lefert, P. (1999).Cell autonomous complementation of mlo resistance using a biolistic transient expression system. Plant J. 17, 293-299. 41. Somssich, I. and Hahlbrook, K. (1998). Pathogen defense in plants- a paradigm of 5 biological complexity. Trends Plant Sci. 3:86-90. 42. Stermer, B.A., Schmid, J., Lamb, C.J. and Dixon, R.A. (1990). Infection and stress activation of bean chalcone synthase promoters in transgenic tobacco. Molec. Plant Microbe Interacts. 3:381-388. 43. van den Ackerveken, G.F.J.M., van Kal, J.A.L., and de Wit, P.J.G.M. (1992). 10 Molecular analysis of the avirulence gene avr9 of the fungal tomato pathogen Cladosporiumfulvum fully supports the gene-for-gene hypothesis. Plant J. 2, 359-366. 44. van den Ackervecken, G., Marois, E. and Bonas, U. (1996). Recognition of the bacterial avirulence protein AvrBs3 occurs inside the host plant cell. Cell 87, 1307 1316. 15 45. van der Biezen, E.A., and Jones, J.D.G. (1998). Plant disease-resistance proteins and the gene-for-gene concept. TIBS 23, 454-456. 46. Wan, J., Dunning, F.M. and Bent, A.F. (2002). Probing plant-pathogen interactions and downstream defense signalling using DNA microarrays. Funct. Integ. Genomics 2:259-273. 20 47. Yin, S.H., Leng, M., Newman, J., Back, K., Chappell, J., Yin, S.H. and Leng, M. (1997). Regulation of sesquiterpene cyclase gene expression. Characterization of an elicitor- and pathogen - inducible promoter. Plant Physiology 115:437-451. 48. Zambino, P.J., Kubelik, A.R. and Szabo, L.J. (2000). Gene action and linkage of avirulence genes to DNA markers in the rust fungus Puccinia graminis. Phytopathol. 25 90, 819-826.

Claims (31)

1. An isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence of nucleotides encoding an avirulence product of a 5 plant rust fungus.

2. The nucleic acid molecule of claim 1, wherein said plant rust fungus is a pathogen of a plant selected from the group consisting of barley, corn, oat, rye, sorghum, sugarcane, wheat, apple, asparagus, banana, bean, beet, carrot, chickpea, coffee, 10 cotton, eucalyptus, flax, grape, lettuce, onion, pea, peanut, pear, poplar, potato, red clover, soybean, strawberry, sunflower and sweet potato.

3. The nucleic acid molecule of claim 1, wherein said plant rust fungus is a pathogen of flax. 15

4. The nucleic acid molecule of claim 1, wherein said avirulence product of a plant rust fungus is capable of being recognised by a disease resistance gene product in a plant.

5. The nucleic acid molecule of claim 4, wherein said plant is a crop or cereal plant. 20

6. The nucleic acid molecule of claim 4, wherein said avirulence product is capable of being recognised by a product of one or more of the disease resistance genes L, M, N or P which control host resistance to rust in flax (Linum usitatisimum). 25

7. An isolated nucleic acid molecule comprising a sequence of nucleotides selected from: (i) a nucleotide sequence selected from the group consisting of the coding regions of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 30 2F2-L sequences; (ii) a nucleotide sequence having at least 45% identity overall to a sequence selected WO 2004/099417 PCT/AU2004/000602 - 72 from the group consisting of the coding regions of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; (iii) a nucleotide sequence capable of hybridising under at least low stringency conditions to at least about 20 contiguous nucleotides complementary to a sequence selected 5 from the group consisting of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 2F2-K and 2F2-L sequences; (iv) a nucleotide sequence encoding a 2F2 protein; and (v) a nucleotide sequence that is complementary to any one of (i) to (iv). 10

8. A gene construct comprising a nucleic acid molecule of claim 1 or claim 7.

9. The gene construct of claim 8, which is an expression gene construct for expression of the avirulence product of a plant rust fungus in a bacterial, insect, yeast, plant, fungal or animal cell. 15

10. An isolated cell comprising a non-endogenous nucleic acid molecule of claim 1 or claim 7.

11. The isolated cell of claim 10, wherein said nucleic acid molecule is present in said 20 cell in an expressible format.

12. The isolated cell of claim 10, which is a bacterial cell.

13. The isolated cell of claim 10, which is a plant cell. 25

14. A transformed plant comprising the nucleic acid molecule of claim 1 or claim 7 introduced into its genome in an expressible format.

15. The transformed plant of claim 14, which has increased disease resistance compared 30 to an isogenic non-transformed plant. WO 2004/099417 PCT/AU2004/000602 - 73

16. The transformed plant of claim 15, wherein said nucleic acid molecule is co expressed with a corresponding disease resistance gene in said plant.

17. The transformed plant of claim 16, wherein the corresponding disease resistance gene 5 is endogenous in the plant.

18. The transformed plant of claim 16, wherein the corresponding disease resistance gene is non-endogenous in the plant.

19. The transformed plant of any of claims 14 to 18, which is a crop or cereal plant. 10

20. The transformed plant of any of claims 14 to 18, which is flax or tobacco.

21. A plant cell, tissue, organ or other plant part derived from a transformed plant of any of claims 14 to 20. 15

22. A plant seed derived from a transformed plant of any of claims 14 to 20, said seed comprising said nucleic acid molecule.

23. A progeny plant, or a cell, tissue, organ or other part thereof, derived from a 20 transformed plant of any of claims 14 to 20, said progeny plant, cell, tissue, organ or part comprising said nucleic acid molecule.

24. A method of identifying a nucleic acid sequence which encodes an avirulence product of a plant rust fungus, which comprises 25 (i) hybridising a probe or primer to nucleic acid of a plant rust fungus, and either (ii) detecting said hybridisation, or (iii) performing an amplification reaction and detecting the amplified product; wherein said probe or primer comprises at least about 20 contiguous nucleotides of 30 (a) a nucleotide sequence encoding an avirulence product of a plant rust fungus, or a degenerate or complementary nucleotide sequence thereto, or (b) a nucleotide WO 2004/099417 PCT/AU2004/000602 - 74 sequence which is genetically linked to a gene encoding an avirulence product of a plant rust fungus.

25. The method of claim 24, further comprising the step of isolating the hybridised or 5 amplified nucleic acid sequence.

26. The method of claim 24, wherein said probe or primer comprises at least about 20 contiguous nucleotides of a nucleotide sequence selected from the group consisting of the 2F2-A, 2F2-B, 2F2-C, 2F2-D, 2F2-E, 2F2-F, 2F2-G, 2F2-H, 2F2-I, 2F2-J, 10 2F2-K and 2F2-L sequences, or degenerate or complementary nucleotide sequences thereto.

27. The method of claim 24, wherein said probe or primer comprises at least about 20 contiguous nucleotides of a flax rust sec 14 homologue. 15

28. A method of inducing a disease resistance response in a plant, which comprises the step of transforming the plant, or a cell, tissue, organ or other part thereof, with the nucleic acid molecule of claim 1 or claim 7 to obtain expression of an avirulence product of a plant rust fungus in the plant. 20

29. The method of claim 28, wherein said nucleic acid molecule is co-expressed with a corresponding disease resistance gene in said plant.

30. The method of claim 29, wherein the corresponding disease resistance gene is 25 endogenous in the plant.

31. The method of claim 29, wherein corresponding disease resistance gene is non endogenous in the plant. 30