WO1992019743A2 - Hcv genomic sequences for diagnostics and therapeutics - Google Patents

Hcv genomic sequences for diagnostics and therapeutics Download PDF

Info

Publication number
WO1992019743A2
WO1992019743A2 PCT/US1992/004036 US9204036W WO9219743A2 WO 1992019743 A2 WO1992019743 A2 WO 1992019743A2 US 9204036 W US9204036 W US 9204036W WO 9219743 A2 WO9219743 A2 WO 9219743A2
Authority
WO
WIPO (PCT)
Prior art keywords
εequence
region
nucleic acid
hcv
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1992/004036
Other languages
English (en)
French (fr)
Other versions
WO1992019743A3 (en
Inventor
Tai-An Cha
Eileen Beall
Bruce Irvine
Janice Kolberg
Michael S. Urdea
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=24800701&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1992019743(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to EP92913881A priority Critical patent/EP0585398B1/en
Priority to RO93-01493A priority patent/RO117267B1/ro
Priority to CZ19932377A priority patent/CZ288720B6/cs
Priority to KR1019930703367A priority patent/KR100193801B1/ko
Priority to CA002108466A priority patent/CA2108466C/en
Priority to JP4512055A priority patent/JPH06508026A/ja
Priority to AU21558/92A priority patent/AU668355C/en
Priority to HU9303166A priority patent/HU227548B1/hu
Application filed by Chiron Corp filed Critical Chiron Corp
Priority to AT92913881T priority patent/ATE252154T1/de
Priority to DK92913881T priority patent/DK0585398T3/da
Priority to PL92312096A priority patent/PL170151B1/pl
Priority to DE69233234T priority patent/DE69233234T2/de
Priority to PL92301282A priority patent/PL169880B1/pl
Priority to SK1232-93A priority patent/SK284205B6/sk
Publication of WO1992019743A2 publication Critical patent/WO1992019743A2/en
Priority to BG98200A priority patent/BG62142B1/bg
Priority to NO934019A priority patent/NO309532B1/no
Priority to FI934937A priority patent/FI115725B/fi
Anticipated expiration legal-status Critical
Publication of WO1992019743A3 publication Critical patent/WO1992019743A3/en
Priority to BG101876A priority patent/BG101876A/xx
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08Peptides having 5 to 11 amino acids
    • A61K38/09Luteinising hormone-releasing hormone [LHRH], i.e. Gonadotropin-releasing hormone [GnRH]; Related peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/162Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/706Specific hybridization probes for hepatitis
    • C12Q1/707Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24211Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the invention relates to compositions and methods for the detection and treatment of hepatitis C virus, (HCV) infection, formerly referred to as blood-borne non-A, non-B hepatitis virus (NANBV) infection. More ⁇ pecifically, embodiments of the present invention feature compositions and methods for the detection of HCV, and for the development of vaccines for the prophylactic treatment of infections of HCV, and development of antibody products for conveying passive immunity to HCV.
  • HCV hepatitis C virus
  • HCV The prototype isolate of HCV was characterized in U.S. Patent Application Serial No. 122,714 (See also EPO Publication No. 318,216 ⁇ .
  • HCV includes new isolates of the same viral species.
  • HCV-1 referred to in U.S. Patent Application Serial No. 122,714.
  • SUBSTITUTE SHEET HCV is a transmissible disease distinguishable from other forms of viral-associated liver diseases, including that caused by the known hepatitis viruses, i.e., hepatitis A virus (HAV), hepatitis B virus (HBV), and delta hepatitis virus (HDV), as well a ⁇ the hepatitis induced by cytomegalovirus (CMV) or Epstein-Barr virus (EBV) .
  • HCV was fir ⁇ t identified in individuals who had received blood transfu ⁇ ions.
  • Post-transfusion hepatitis occurs in approximately 10% of transfused patients, and HCV accounts for up to 90% of these cases. The disea ⁇ e frequently progresses to chronic liver damage (25-55%).
  • Patient care as well as the prevention of transmission of HCV by blood and blood products or by close personal contact require reliable screening, diagnostic and prognostic tools to detect nucleic acids, antigens and antibodies related to HCV.
  • the HCV has several genotypes. That i ⁇ , the genetic information of the HCV viru ⁇ may not be totally identical for all HCV, but encompasses groups with differing genetic information.
  • DNA consist ⁇ of covalently
  • SUBSTITUTE SHEET linked chains of deoxyribonucleotides and RNA consists of covalently linked chains of ribonucleotides.
  • Each nucleotide is characterized by one of four bases: adenine (A), guanine (G), thy ine (T), and cytosine (C) .
  • the bases are complementary in the sense that, due to the orientation of functional groups, certain base pairs attract and bond to each other through hydrogen bonding and ir-stacking interactions.
  • Guanine in one strand of DNA pairs with cytosine in an opposing complementary strand are examples of the bases that are complementary to the orientation of functional groups.
  • RNA In RNA, the thymine base is replaced by uracil (U) which pairs with adenine in an opposing complementary strand.
  • U uracil
  • the HCV genome is comprised of a single positive strand of RNA.
  • the HCV genome possesses a continuous, translational open reading frame (ORF) that encodes a polyprotein of about 3,000 amino acids.
  • ORF translational open reading frame
  • the structural protein(s) appear to be encoded in approximately the first quarter of the N-terminus region, with the majority of the polyprotein responsible for non-structural proteins.
  • HCV polyprotein compri ⁇ es, from the amino terminus to the carboxy terminus, the nucleocapsid protein (C), the envelope protein (E), and the non-structural protein ⁇ (NS) 1, 2 (b), 3, 4 (b), and 5.
  • HCV of differing genotypes may encode for proteins which present an altered respon ⁇ e to host immune ⁇ y ⁇ tem ⁇ .
  • HCV of differing genotype ⁇ may be difficult to detect by immuno diagnostic techniques and nucleic acid probe techniques which are not ⁇ pecifically directed to ⁇ uch genotype.
  • corresponding means homologous to or complementary to a particular sequence of nucleic acid. As between nucleic acids and peptides, corresponding refers to amino acids of a peptide in an order derived from the sequence of a nucleic acid or its complement.
  • non-naturally occurring nucleic acid refers to a portion of genomic nucleic acid, cDNA, semisynthetic nucleic acid, or synthetic origin nucleic acid which, by virtue of its origin or manipulation: (1) is not associated with all of a nucleic acid with which it is associated in nature, (2) is linked to a nucleic acid or other chemical agent other than that to
  • a non-naturally occurring peptide refers to a portion of a large naturally occurring peptide or protein, or ⁇ emi- ⁇ ynthetic or ⁇ ynthetic peptide, which by virtue of it ⁇ origin or manipulation (1) i ⁇ not associated with all of a peptide with which it is associated in nature, (2) is linked to peptides, functional groups or chemical agents other than that to which it is linked in nature, or (3) does not occur in nature.
  • primer refers to a nucleic acid which is capable of initiating the synthesis of a larger nucleic acid when placed under appropriate conditions.
  • the primer will be completely or substantially complementary to a region of the nucleic acid to be copied. Thus, under conditions conducive to hybridization, the primer will anneal to a complementary region of a larger nucleic acid.
  • the primer is extended by the polymerizing agent to form a copy of the larger nucleic acid.
  • binding pair refers to any pair of molecules which exhibit mutual affinity or binding capacity.
  • ligand will refer to one molecule of the » binding pair, and the term "antiligand” or "receptor”
  • a binding pair may comprise two complementary nucleic acids.
  • One of the nucleic acids may be designated the ligand and the other strand i ⁇ designated the antiligand receptor or target.
  • the designation of ligand or antiligand is a matter of arbitrary convenience.
  • Other binding pairs comprise, by way of example, antigens and antibodies, drug ⁇ and drug receptor ⁇ ite ⁇ and enzymes and enzyme substrates, to name a few.
  • label refer ⁇ to a molecular moiety capable of detection including, by way of example, without limitation, radioactive isotopes, enzymes, luminescent agents, precipitating agents, and dyes.
  • support includes conventional ⁇ upport ⁇ such a ⁇ filters and membranes a ⁇ well a ⁇ retrievable supports which can be substantially disper ⁇ ed within a medium and removed or ⁇ eparated from the medium by immobilization, filtering, partitioning, or the like.
  • ⁇ upport mean ⁇ refer ⁇ to supports capable of being associated to nucleic acids, peptide ⁇ or antibodie ⁇ by binding partner ⁇ , or covalent or noncovalent linkage ⁇ .
  • HCV-l ⁇ equence of the original i ⁇ olate derived from the USA
  • the present invention features compositions of matter comprising nucleic acids and peptide ⁇ corresponding to the HCV viral genome which define different genotypes.
  • the present invention also features methods of u ⁇ ing the compositions corresponding to sequences of the HCV viral genome which define different genotype ⁇ described herein.
  • nucleic acid compo ⁇ ition ⁇ The nucleic acid of the present invention, corre ⁇ ponding to the HCV viral genome which define different genotypes, have utility as probes in nucleic acid hybridization as ⁇ ay ⁇ , a ⁇ primers for reaction ⁇ involving the synthesis of nucleic acid, as binding partners for separating HCV viral nucleic acid from other constituents which may be present, and a ⁇ anti- ⁇ en ⁇ e nucleic acid for preventing the transcription or translation of viral nucleic acid.
  • One embodiment of the present invention features a compo ⁇ ition compri ⁇ ing a non-naturally occurring nucleic acid having a nucleic acid ⁇ equence of at lea ⁇ t eight nucleotide ⁇ corresponding to a non-HCV-l nucleotide sequence of the hepatitis C viral genome.
  • the nucleotide ⁇ equence i ⁇ selected from a ⁇ equence pre ⁇ ent in at lea ⁇ t one region con ⁇ i ⁇ ting of the NS5 region, envelope 1 region, 5'UT region, and the core region.
  • the sequence is selected from a sequence within a sequence numbered 2-22.
  • the ⁇ equence numbered 1 corresponds to HCV-1. Sequences numbered 1-22 are defined in the Sequence Listing of the application.
  • Sequence No. 23 correspond ⁇ to HCV- .
  • Sequences numbered 23-32 are set forth in the Sequence Listing of the application.
  • the ⁇ equence is ⁇ elected from a ⁇ equence within sequences numbered 34-51.
  • Sequence No. 33 corresponds to HCV-1. Sequence No. 33-51 are set forth in the Sequence Listing of this application.
  • sequences are ⁇ elected from a sequence within the sequence ⁇ numbered 53-66.
  • Sequence No. 52 corresponds to HCV-1. Sequences 52-66 are set forth in the Sequence Li ⁇ ting of this application.
  • composition ⁇ of the present invention form hybridization products with nucleic acid corresponding to different genotypes of HCV.
  • HCV has at least five genotypes, which will be referred to in this application by the designations GI-GV.
  • the first genotype, GI i ⁇ exemplified by ⁇ equence ⁇ numbered 1-6, 23-25, 33-38 and 52-57.
  • the second genotype, Gil is exemplified by the sequence ⁇ numbered 7-12, 26-28, 39-45 and 58-64.
  • the third genotype, GUI i ⁇ exemplified by sequences numbered 13-17, 32, 46-47 and 65-66.
  • the fourth genotype, GIV The fourth genotype, GIV,
  • SUBSTITUTE SHEET i ⁇ exemplified by sequences numbered 20-22, and 29-31 and 48-49.
  • the fifth genotype, GV is exemplified by ⁇ equence ⁇ numbered 18, 19, 50 and 51.
  • composition ⁇ comprising a nucleic acid having a ⁇ equence corre ⁇ ponding to one or more sequence ⁇ which exemplify a genotype of HCV.
  • Embodiments of the present invention also feature a method of forming a hybridization product with nucleic acid having a sequence corresponding to HCV nucleic acid.
  • One method compri ⁇ e ⁇ the ⁇ tep ⁇ of placing a non-naturally occurring nucleic acid having a non-HCV-l ⁇ equence corre ⁇ ponding to HCV nucleic acid under condition ⁇ in which hybridization may occur.
  • the non-naturally occurring nucleic acid is capable of forming a hybridization product with HCV nucleic acid, under hybridization conditions.
  • the method further comprises the step of imposing hybridization conditions to form a hybridization product in the presence of nucleic acid corresponding to a region of the HCV genome.
  • hybridization product ha ⁇ utility for detecting the presence of one or more genotypes of HCV.
  • the non-naturally occurring nucleic acid forms a hybridization product
  • SUBSTITUTE SHEET with nucleic acid of HCV in one or more region ⁇ compri ⁇ ing the NS5 region, envelope 1 region, 5'UT region and the core region.
  • To detect the hybridization product it is useful to associate the non-naturally occurring nucleic acid with a label.
  • the formation of the hybridization product is detected by separating the hybridization product from labeled non-naturally occurring nucleic acid, which has not formed a hybridization product.
  • the formation of a hybridization product ha ⁇ utility a ⁇ a mean ⁇ of ⁇ eparating one or more genotypes of HCV nucleic acid from other constituents potentially present.
  • it i ⁇ useful to associate the non-naturally occurring nucleic acid with a support for ⁇ eparating the re ⁇ ultant hybridization product from the the other con ⁇ tituents.
  • Nucleic acid "sandwich assays” employ one nucleic acid associated with a label and a ⁇ econd nucleic acid associated with a support.
  • An embodiment of the present invention features a sandwich assay comprising two nucleic acids, both have sequence ⁇ which correspond to HCV nucleic acids; however, at least one non-naturally occurring nucleic acid has a sequence corresponding to non-HCV-1 HCV nucleic acid. At least one nucleic acid is capable of as ⁇ ociating with a label, and the other i ⁇ capable of associating with a support.
  • SUBSTITUTE SHEET occurring nucleic acid is u ⁇ ed to ⁇ eparate the hybridization product ⁇ which include an HCV nucleic acid and the non-naturally occurring nucleic acid having a non-HCV-1 ⁇ equence.
  • One embodiment of the pre ⁇ ent invention features a method of detecting one or more genotypes of HCV.
  • the method comprise ⁇ the ⁇ tep ⁇ of placing a non-naturally occurring nucleic acid under conditions which hybridization may occur.
  • the non-naturally occurring nucleic acid is capable of forming a hybridization product with nucleic acid from one or more genotypes of HCV.
  • the hybridization product of HCV nucleic acid with a non-naturally occurring nucleic acid having non-HCV-1 ⁇ equence corre ⁇ ponding to ⁇ equence ⁇ within the HCV genome has utility for priming a reaction for the synthesis of nucleic acid.
  • the ⁇ ynthesized nucleic acid is indicative of the presence of one or more genotypes of HCV.
  • the synthesis of nucleic acid may also facilitate cloning of the nucleic acid into expression vectors which synthesize viral proteins.
  • Embodiments of the present method ⁇ have utility a ⁇ anti- ⁇ ense agents for preventing the transcription or translation of viral nucleic acid.
  • the formation of a hybridization product of a non-naturally occurring nucleic acid having ⁇ equence ⁇ which corre ⁇ pond to a particular genotype of HCV genomic ⁇ equencing with HCV nucleic acid may block tran ⁇ lation or transcription of ⁇ uch genotype.
  • Therapeutic agents can be engineered to include all five genotype ⁇ for inclu ⁇ ivity.
  • a further embodiment of the present invention features a composition of matter compri ⁇ ing a non-naturally occurring peptide of three or more amino acids corre ⁇ ponding to a nucleic acid having a non-HCV-l ⁇ equence.
  • the non-HCV-1 ⁇ equence corresponds with a sequence within one or more regions consisting of the NS5 region, the envelope 1 region, the 5'UT region, and* the core region.
  • SUBSTITUTE SHEET Preferably, with respect to peptides corre ⁇ ponding to a nucleic acid having a non-HCV-l ⁇ equence of the NS5 region, the ⁇ equence i ⁇ within ⁇ equence ⁇ numbered 2-22.
  • Sequence ⁇ numbered 1-22 are ⁇ et forth in the Sequence Li ⁇ ting.
  • the ⁇ equence i ⁇ within ⁇ equence ⁇ numbered 24-32 the ⁇ equence numbered 23 corre ⁇ pond ⁇ to HCV-1.
  • Sequence ⁇ numbered 23-32 are ⁇ et forth in the Sequence Listing.
  • the further embodiment of the present invention features peptide composition ⁇ corre ⁇ ponding to nucleic acid ⁇ equence ⁇ of a genotype of HCV.
  • the third genotype, GUI is exemplified by ⁇ equence ⁇ numbered 13-17, 32, 46-47 and 65-66.
  • the non-naturally occurring peptides of the present invention are useful as a component of a vaccine.
  • the ⁇ equence information of the pre ⁇ ent invention permits the design of vaccines which are inclusive for all or ⁇ ome of the different genotype ⁇ of HCV. Directing a vaccine to a particular genotype allow ⁇ prophylactic treatment to be tailored to maximize the protection to tho ⁇ e agent ⁇ likely to be encountered. Directing a vaccine to more than one genotype allow ⁇ the vaccine to be more inclusive.
  • the peptide compositions are also useful for the development of ⁇ pecific antibodie ⁇ to the HCV protein ⁇ .
  • One embodiment of the pre ⁇ ent invention features as a composition of matter, an antibody to peptide ⁇ corresponding to a non-HCV-l sequence of the HCV genome.
  • the non-HCV-l sequence is ⁇ elected from the ⁇ equence within a region con ⁇ i ⁇ ting of the NS5 region, the envelope 1 region, and the core region. There are no peptide ⁇ associated with the untranslated 5'UT region.
  • the peptide corre ⁇ pond ⁇ to a ⁇ equence within ⁇ equence ⁇ numbered 2-22.
  • SUBSTITUTE SHEET corre ⁇ ponding to the envelope 1 region the peptide corre ⁇ pond ⁇ to a ⁇ equence within ⁇ equence ⁇ numbered 24-32.
  • the peptide corre ⁇ pond ⁇ Preferably, with re ⁇ pect to the antibodie ⁇ directed to peptide ⁇ corre ⁇ ponding to the core region, the peptide corre ⁇ pond ⁇ to a ⁇ equence within ⁇ equence ⁇ numbered 53-66.
  • Antibodies directed to peptides which reflect a particular genotype have utility for the detection of ⁇ uch genotypes of HCV and therapeutic agents.
  • One embodiment of the pre ⁇ ent invention feature ⁇ an antibody directed to a peptide corre ⁇ ponding to nucleic acid having ⁇ equence ⁇ of a particular genotype.
  • the third genotype, GUI is exemplified by sequence ⁇ numbered 13-17, 32, 46-47 and 65-66.
  • composition ⁇ of the present invention can be packaged with instructions for use in the form of a kit for performing nucleic acid hybridization ⁇ or immunochemical reaction ⁇ .
  • SUBSTITUTE SHEET The pre ⁇ ent invention i ⁇ further described in the following figures which illustrate ⁇ equence ⁇ demonstrating genotypes of HCV.
  • the ⁇ equences are de ⁇ ignated by numerals 1-145, which numerals and ⁇ equences are con ⁇ istent with the numeral ⁇ and ⁇ equence ⁇ ⁇ et forth in the Sequence Li ⁇ ting.
  • Sequence ⁇ 146 and 147 facilitate the di ⁇ cu ⁇ ion of an a ⁇ ay which numeral ⁇ and ⁇ equences are consi ⁇ tent with the numeral ⁇ and ⁇ equence ⁇ ⁇ et forth in- the Sequence Li ⁇ ting.
  • FIG. 1 depicts schematically the genetic organization of HCV
  • Figure 2 set ⁇ forth nucleic acid ⁇ equences numbered 1-22 which ⁇ equence ⁇ are derived from the NS5 region of the HCV viral genome;
  • Figure 3 ⁇ et ⁇ forth nucleic acid sequence ⁇ numbered 23-32 which ⁇ equence ⁇ are derived from the envelope 1 region of the HCV viral genome;
  • Figure 4 ⁇ et ⁇ forth nucleic acid ⁇ equence ⁇ numbered 33-51 which ⁇ equence ⁇ are derived from the 5'UT region of the HCV viral genome; and.
  • Figure 5 ⁇ et ⁇ forth nucleic acid ⁇ equence ⁇ numbered 52-66 which ⁇ equence ⁇ are derived from the core region of the HCV viral genome.
  • the pre ⁇ ent invention will be de ⁇ cribed in detail a ⁇ a ⁇ nucleic acid having ⁇ equence ⁇ corre ⁇ ponding to the HCV genome and related peptide ⁇ and binding partner ⁇ , for diagnostic and therapeutic applications.
  • the practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See e.g., Maniatis, Fitsch & Sambrook, Molecular Cloning; A Laboratory Manual (1982); DNA Cloning, Volumes I and II (D.N Glover ed. 1985); Oligonucleotide Synthesi ⁇ (M.J.
  • cDNA libraries are derived from nucleic acid sequence ⁇ pre ⁇ ent in the plasma of an HCV-infected chimpanzee.
  • the construction of one of these libraries, the "c" library (ATCC No. 40394), is described in PCT Pub. No. WO90/14436.
  • the sequences of the library relevant to the present invention are ⁇ et forth herein as ⁇ equence number ⁇ 1, 23, 33 and 52.
  • Nucleic acids i ⁇ olated or synthesized in accordance with feature ⁇ of the pre ⁇ ent invention are
  • SUBSTITUTE SHEET u ⁇ eful by way of example without limitation a ⁇ probe ⁇ , primer ⁇ , anti- ⁇ en ⁇ e gene ⁇ and for developing expre ⁇ sion ⁇ ystems for the synthesis of peptides corresponding to such sequences.
  • the nucleic acid ⁇ equence ⁇ described define genotype ⁇ of HCV with re ⁇ pect to four region ⁇ of the viral genome.
  • Figure 1 depicts schematically the organization of HCV. The four regions of particular interest are the NS5 region, the envelope 1 region, the 5'UT region and the core region.
  • sequences ⁇ et forth in the pre ⁇ ent application a ⁇ ⁇ equence ⁇ numbered 1-22 suggest at least five genotypes in the NS5 region. Sequences numbered 1-22 are depicted in Figure 2 as well as the Sequence Li ⁇ ting. Each ⁇ equence numbered 1-22 i ⁇ derived from nucleic acid having 340 nucleotide ⁇ from the NS5 region. The five genotypes are defined by groupings of the ⁇ equence ⁇ defined by ⁇ equence numbered 1-22. For convenience, in the pre ⁇ ent application, the different genotype ⁇ will be assigned roman numeral ⁇ and the letter "G".
  • GI fir ⁇ t genotype
  • GIV genotype
  • SUBSTITUTE SHEET ⁇ equence ⁇ within ⁇ equence ⁇ numbered 20-22.
  • the ⁇ equence ⁇ set forth in the pre ⁇ ent application a ⁇ ⁇ equence ⁇ numbered 23-32 ⁇ uggest at least four genotypes in the envelope 1 region of HCV. Sequences numbered 23-32 are depicted in Figure 3 as well a ⁇ in the Sequence Listing. Each ⁇ equence numbered 23-32 i ⁇ - derived from nucleic acid having 100 nucleotides from the envelope 1 region.
  • sequences numbered 33-51 ⁇ ugge ⁇ t at lea ⁇ t three genotype ⁇ in the 5'UT region of HCV.
  • Sequence ⁇ numbered 33-51 are depicted in Figure 4 as well as in the Sequence Li ⁇ ting.
  • Each ⁇ equence numbered 33-51 i ⁇ derived from the nucleic acid having 252 nucleotides from the 5'UT region, .although ⁇ equences 50 and 51 are somewhat shorter at approximately 180 nucleotide ⁇ .
  • SUBSTITUTE SHEET The first 5'UT genotype (GI) i ⁇ exemplified by the ⁇ equences within sequence ⁇ numbered 33-38.
  • a third 5'UT genotype (GUI) is exemplified by the sequence ⁇ within ⁇ equence ⁇ numbered 46-47.
  • the ⁇ equences numbered 52-66 are depicted in Figure 5 as well as in the Sequence Listing.
  • the first core region genotype is exemplified by the ⁇ equence ⁇ within ⁇ equences numbered 52-57.
  • the ⁇ econd core region genotype is exemplified by ⁇ equences within sequences numbered 58-64.
  • the third core region genotype is exemplified by sequence ⁇ within sequences numbered 65 and 66. Sequences numbered 52-65 are comprised of 549 nucleotides.
  • Sequence numbered 66 i ⁇ comprised of 510 nucleotides.
  • the variou ⁇ genotype ⁇ described with respect to each region are consistent. That is, HCV having features of the first genotype with respect to the NS5 region will sub ⁇ tantially conform to feature ⁇ of the fir ⁇ t genotype of the envelope 1 region, the 5'UT region and the core region.
  • Nucleic acid i ⁇ olated or synthesized in accordance with the ⁇ equence ⁇ ⁇ et forth in ⁇ equence number ⁇ 1-66 are u ⁇ eful a ⁇ probes, primers, capture ligands and anti-sense agents.
  • the nucleic acid wil normally compri ⁇ e approximately eight or more nucleotide ⁇ for specificity as well a ⁇ the ability to form stable hybridization products.
  • a nucleic acid i ⁇ olated or synthesized in accordance with a sequence defining a particular genotype of a region of the HCV genome can be used as a probe to detect ⁇ uch genotype or u ⁇ ed in combination with other nucleic acid probe ⁇ to detect ⁇ ub ⁇ tantially all genotype ⁇ of HCV.
  • ⁇ equence ⁇ of eight or more nucleotide ⁇ are identified which provide the de ⁇ ired inclu ⁇ ivity and exclu ⁇ ivity with re ⁇ pect to variou ⁇ genotypes within HCV, and extraneous nucleic acid ⁇ equences likely to be encountered during hybridization conditions.
  • nucleic acid ⁇ equence ⁇ for u ⁇ e a ⁇ probe ⁇ , can be provided with a label to facilitate detection of a hybridization product.
  • nucleic acid ⁇ elected in the manner de ⁇ cribed above with re ⁇ pect to probes can be readily associated with supports.
  • Nucleic acid having ⁇ equence ⁇ corresponding to a sequence within sequence ⁇ numbered 1-66 have utility to ⁇ eparate viral nucleic acid of one genotype from the nucleic acid of HCV of a different genotype.
  • Nucleic acid i ⁇ olated or synthesized in accordance with ⁇ equence ⁇ within ⁇ equence ⁇ numbered 1-66, used in combination ⁇ , have utility to capture ⁇ ub ⁇ tantially all nucleic acid of all HCV genotype ⁇ .
  • Nucleic acid i ⁇ olated or synthesized in accordance with the sequence ⁇ de ⁇ cribed herein have utility a ⁇ primer ⁇ for the amplification of HCV ⁇ equence ⁇ .
  • nucleic acid ⁇ equence ⁇ of eight or more nucleotide ⁇ corresponding to one or more sequence ⁇ of ⁇ equence ⁇ numbered 1-66 have utility in conjunction with ⁇ uitable enzyme ⁇ and reagent ⁇ to create copie ⁇ of the viral nucleic acid.
  • a plurality of primer ⁇ having different ⁇ equence ⁇ corresponding to more than one genotype can be used to create copies of viral nucleic acid for such genotypes.
  • SUBSTITUTE SHEET The copies can be used in diagnostic assays to detect HCV virus.
  • the copie ⁇ can also be incorporated into cloning and expres ⁇ ion vectors to generate polypeptide ⁇ corre ⁇ ponding to the nucleic acid ⁇ ynthe ⁇ ized by PCR, a ⁇ will be de ⁇ cribed in greater detail below.
  • Nucleic acid i ⁇ olated or ⁇ ynthe ⁇ ized in accordance with the ⁇ equence ⁇ de ⁇ cribed herein have utility a ⁇ anti- ⁇ en ⁇ e gene ⁇ to prevent the expre ⁇ ion of HCV.
  • nucleotide ⁇ 30 or more nucleotide ⁇ to provide nece ⁇ ary ⁇ tability of a hybridization product of viral nucleic acid or viral messenger RNA.
  • Patent 4,241,046 issued December 23, 1980 to
  • SUBSTITUTE SHEET generate peptides.
  • the ⁇ equence ⁇ exemplified by ⁇ equences numbered 1-32 and 52-66 can be cloned into ⁇ uitable vector ⁇ or u ⁇ ed to i ⁇ olate nucleic acid.
  • the i ⁇ olated nucleic acid i ⁇ combined with suitable DNA linker ⁇ and cloned into a ⁇ uitable vector.
  • the vector can be u ⁇ ed to tran ⁇ form a ⁇ uitable ho ⁇ t organi ⁇ m ⁇ uch as E_j_ coli and the peptide encoded by the sequence ⁇ i ⁇ olated.
  • the isolated peptide has utility as an antigenic substance for the development of vaccines and antibodies directed to the particular genotype of HCV.
  • the peptide materials of the present invention have utility for the development of antibodies and vaccine ⁇ .
  • the availability of cDNA ⁇ equence ⁇ , or nucleotide ⁇ equence ⁇ derived therefrom (including segments and mod fications of the sequence), permit ⁇ the construction of expression vectors encoding antigenically active regions of the peptide encoded in either strand.
  • the antigenically active regions may be derived from the NS5 region, envelope 1 regions, and the core region.
  • SUBSTITUTE SHEET Fragments encoding the desired peptides are derived from the cDNA clones using conventional restriction digestion or by synthetic methods, and are ligated into vectors which may, for example, contain portions of fu ⁇ ion ⁇ equence ⁇ ⁇ uch a ⁇ beta galacto ⁇ ida ⁇ e or ⁇ uperoxide di ⁇ muta ⁇ e (SOD), preferably SOD.
  • SOD ⁇ uperoxide di ⁇ muta ⁇ e
  • HCV cDNA containing an open reading frame in either sense strand, can be obtained as a recombinant peptide, such as a mature or fu ⁇ ion protein; alternatively, a peptide encoded in the cDNA can be provided by chemical synthesis.
  • the DNA encoding the desired peptide may be ligated into expres ⁇ ion vector ⁇ ⁇ uitable for any convenient ho ⁇ t. Both eukaryotic and prokaryotic host sy ⁇ tem ⁇ are pre ⁇ ently u ⁇ ed in forming recombinant peptide ⁇ .
  • the peptide i ⁇ then i ⁇ olated from ly ⁇ ed cell ⁇ or from the culture medium and purified to the extent needed for its intended use. Purification may be by techniques known in the art, for example, differential extraction, ⁇ alt fractionation, chromatography on ion exchange resins, affinity chromatography, centrifugation, and
  • SUBSTITUTE SHEET the like. See, for example. Methods in Enzymology for a variety of method ⁇ for purifying protein ⁇ . Such peptide ⁇ can be u ⁇ ed as diagnostics, or those which give ri ⁇ e to neutralizing antibodies may be formulated into vaccines. Antibodies raised again ⁇ t these peptides can al ⁇ o be u ⁇ ed a ⁇ diagnostics, or for passive immunotherapy or for isolating and identifying HCV.
  • An antigenic region of a peptide i ⁇ generally relatively ⁇ mall—typically 8 to 10 amino acid ⁇ or le ⁇ in length. Fragment ⁇ of a ⁇ few a ⁇ 5 amino acid ⁇ may characterize an antigenic region. These segments may correspond to NS5 region, envelope 1 region, and the core region of the HCV genome. The 5'UT region is not known to be tran ⁇ lated. Accordingly, u ⁇ ing the cDNAs of ⁇ uch region ⁇ , DNA ⁇ encoding short segments of HCV peptides corre ⁇ ponding to ⁇ uch regions can be expressed recombinantly either as fusion protein ⁇ , or a ⁇ i ⁇ olated peptide ⁇ .
  • ⁇ hort amino acid sequences can be conveniently obtained by chemical synthe ⁇ is.
  • the peptide may be linked to a ⁇ uitable carrier.
  • a number of technique ⁇ for obtaining such linkage are known in the art, including the formation of disulfide linkages using N-succinimidyl-3-(2-
  • the ⁇ e reagents create a disulfide linkage between them ⁇ elve ⁇ and peptide cy ⁇ teine re ⁇ idue ⁇ on one protein and an amide linkage through the ep ⁇ ilon-amino on a ly ⁇ ine, or other free amino group in the other.
  • a variety of ⁇ uch di ⁇ ulfide/amide-forming agent ⁇ are known. See, for example, Immun Rev (1982) 62:185.
  • Other bifunctional coupling agent ⁇ form a thioether rather than a di ⁇ ulfide linkage.
  • ⁇ e thio-ether-forming agent ⁇ are commercially available and include reactive e ⁇ ter ⁇ of 6-maleimidocaprioc acid, 2-bromoacetic acid, 2-iodoacetic acid, 4-N-maleimido-methyl)cyclohexane-l- carboxylic acid, and the like.
  • the ca box 1 group ⁇ can be activated by combining them with ⁇ uccinimide or l-hydroxyl-2 nitro-4- ⁇ ulfonic acid, ⁇ odium ⁇ alt.
  • Additional method ⁇ of coupling antigens employs the rotavirus/"binding peptide" ⁇ ystem described in EPO Pub. No. 259,149, the disclosure of which i ⁇ incorporated herein by reference. The foregoing li ⁇ t i ⁇ not meant to be exhaustive, and modifications of the named compounds can clearly be used.
  • Any carrier may be u ⁇ ed which does not itself induce the production of antibodie ⁇ harmful to the
  • Suitable carrier ⁇ are typically large, ⁇ lowly metabolized macromolecules such a ⁇ protein ⁇ ; poly ⁇ accharide ⁇ , ⁇ uch as latex functionalized Sepharo ⁇ e, agaro ⁇ e, cellulose, cellulose beads and the like; polymeric amino acids, such a ⁇ polyglutamic acid, polyly ⁇ ine, and the like; amino acid copolymers; and inactive virus particles.
  • Especially useful protein substrates are serum albumins, keyhole limpet hemocyanin, immunoglobulin molecules, thyroglobulin, ovalbumin, tetanu ⁇ toxoid, and other protein ⁇ well known to those skilled in the art.
  • Peptides comprising HCV amino acid sequences encoding at least one viral epitope derived from the NS5, envelope 1, and core region are useful immunological reagents.
  • the 5'UT region i ⁇ not known to be translated.
  • peptides comprising such truncated sequence ⁇ can be u ⁇ ed as reagents in an immunoas ⁇ ay.
  • These peptides also are candidate subunit antigens in compositions for antiserum production or vaccines.
  • the truncated ⁇ equence ⁇ can be produced by variou ⁇ known treatment ⁇ of native viral protein, it i ⁇ generally preferred to make synthetic or recombinant peptides comprising HCV sequence.
  • HCV sequence ⁇ can be made up entirely of HCV ⁇ equences (one or more epitopes, either contiguous or noncontiguou ⁇ ), or HCV ⁇ equence ⁇ and heterologous sequence ⁇ in a fu ⁇ ion protein.
  • SUBSTITUTE SHEET heterologou ⁇ ⁇ equence ⁇ include ⁇ equence ⁇ that provide for secretion from a recombinant ho ⁇ t, enhance the immunological reactivity of the HCV epitope( ⁇ ), or facilitate the coupling of the polypeptide to an immunoas ⁇ ay ⁇ upport or a vaccine carrier. See, E.G., EPO Pub. No. 116,201; U.S. Pat. No. 4,722,840; EPO Pub. No. 259,149 U.S. Pat. No. 4,629,783.
  • the ⁇ ize of peptide ⁇ compri ⁇ ing the truncated HCV ⁇ equence ⁇ can vary widely, the minimum ⁇ ize being a ⁇ equence of ⁇ ufficient ⁇ ize to provide an HCV epitope, while the maximum ⁇ ize i ⁇ not critical.
  • the maximum ⁇ ize usually is not ⁇ ub ⁇ tantially greater than that required to provide the desired HCV epitopes and function(s) of the heterologous ⁇ equence, if any.
  • the truncated HCV amino acid sequence will range from about 5 to about 100 amino acids in length.
  • the HCV ⁇ equence will be a maximum of about 50 amino acid ⁇ in length, preferably a maximum of about 30 amino acid ⁇ . It i ⁇ usually desirable to select HCV ⁇ equence ⁇ of at lea ⁇ t about 10, 12 or 15 amino acids, up to a maximum of about 20 or 25 amino acids.
  • HCV amino acid ⁇ equences compri ⁇ ing epitopes can be identified in a number of way ⁇ .
  • the entire protein ⁇ equence corre ⁇ ponding to each of the NS5, envelope 1, and core region ⁇ can be ⁇ creened by preparing a ⁇ erie ⁇ of short peptide ⁇ that together ⁇ pan
  • peptide ⁇ of approximately 100 amino acid ⁇
  • the immunogenicity of the epitopes of HCV may also be enhanced by preparing them in mammalian or yeast ⁇ y ⁇ tem ⁇ fu ⁇ ed with or a ⁇ embled with particle-forming protein ⁇ ⁇ uch as, for example, that associated with hepatiti ⁇ B ⁇ urface antigen. See, e.g. , US 4,722,840. Constructs wherein the HCV epitope is linked directly to the particle-forming protein coding sequence ⁇ produce hybrid ⁇ which are immunogenic with re ⁇ pect to the HCV epitope.
  • all of the vector ⁇ prepared include epitope ⁇ ⁇ pecific to HBV, having various degrees of immunogenicity, such as, for example, the pre-S peptide.
  • particle ⁇ con ⁇ tructed from particle forming protein which include HCV ⁇ equences are immunogenic with respect to HCV ⁇ and HBV.
  • HBSAg Hepatiti ⁇ surface antigen
  • S. cerevi ⁇ iae P. Valenzuela et al. (1982)
  • a ⁇ well a ⁇ in, for example, mammalian cells P. Valenzuela et al. 1984
  • the formation of ⁇ uch particle ⁇ ha ⁇ been ⁇ hown to enhance the immunogenicity of the monomer ⁇ ubunit.
  • the constructs may also include the immunodominant epitope of HBSAg, compri ⁇ ing the 55 amino acid ⁇ of the presurface (pre-S) region. Neurath et al. (1984).
  • Constructs of the pre-S-HBSAg particle expressible in yeast are disclo ⁇ ed in EPO 174,444, published March 19, 1986; hybrid ⁇ including heterologou ⁇ viral ⁇ equence ⁇ for yea ⁇ t expre ⁇ ion are di ⁇ clo ⁇ ed in EPO 175,261, published March 26, 1966.
  • These construct ⁇ may al ⁇ o be expressed in mammalian cells such a ⁇ Chine ⁇ e hamster ovary (CHO) cells u ⁇ ing an SV40-dihydrofolate reducta ⁇ e vector (Michelle et al. (1984)).
  • portion ⁇ of the particle-forming protein coding ⁇ equence may be replaced with codon ⁇ encoding an HCV epitope.
  • regions which are not required to mediate the aggregation of the units to form immunogenic particles in yea ⁇ t of mammals can be deleted, thus eliminating additional HBV antigenic ⁇ ite ⁇ from competition with the HCV epitope.
  • Vaccines may be prepared from one or more
  • SUBSTITUTE SHEET immunogenic peptide ⁇ derived from HCV The ob ⁇ erved homology between HCV and Flaviviru ⁇ es provides information concerning the peptides which are likely to be most effective as vaccines, as well as the region ⁇ of the genome in which they are encoded.
  • Multivalent vaccine ⁇ again ⁇ t HCV may be compri ⁇ ed of one or more epitope ⁇ from one or more protein ⁇ derived from the NS5, envelope 1, and core region ⁇ .
  • vaccine ⁇ are contemplated compri ⁇ ing one or more HCV protein ⁇ or ⁇ ubunit antigens derived from the NS5, envelope 1, and core regions.
  • vaccine ⁇ which contain an immunogenic peptide a ⁇ an active ingredient, i ⁇ known to one skilled in the art.
  • vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared.
  • the preparation may also be emulsified, or the protein encapsulated in liposome ⁇ .
  • the active immunogenic ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipient ⁇ are, for example, water, ⁇ aline, dextro ⁇ e, glycerol, ethanol, or the like and combinations thereof.
  • the vaccine may contain minor amount ⁇ of auxiliary ⁇ ubstances ⁇ uch a ⁇ wetting or
  • SUBSTITUTE SHEET emul ⁇ ifying agent ⁇ , pH buffering agent ⁇ , and/or adjuvants which enhance the effectivene ⁇ of the vaccine include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-theronyl-D- isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl- D-i ⁇ oglutamine (CGP 11637, referred to a ⁇ nor-MDP), N- acetylmuramyl-L- alanyl-D-i ⁇ oglutaminyl-L-alanine-2-(1- 2-dipalmitoyl - ⁇ n-glycero-3-hydroxypho ⁇ phoryloxy)- ethylamine (CGP 19835A, referred to a ⁇ MTP-PE), and RIBI, which contain ⁇ three component ⁇ extracted from bacteria, monopho ⁇ phoryl lipid A
  • the effectivene ⁇ of an adjuvant may be determined by mea ⁇ uring the amount of antibodie ⁇ directed again ⁇ t an immunogenic peptide containing an HCV antigenic ⁇ equence re ⁇ ulting from admini ⁇ tration of thi ⁇ peptide in vaccines which are also comprised of the variou ⁇ adjuvant ⁇ .
  • the vaccine ⁇ are conventionally admini ⁇ tered parenterally, by injection, for example, either subcutaneously or intramuscularly.
  • Additional formulation ⁇ which are ⁇ uitable for other modes of administration include ⁇ uppo ⁇ itorie ⁇ and, in ⁇ ome cases, oral formulations.
  • traditional binder ⁇ and carrier ⁇ may include, for example, polyalkylene glycol ⁇ or triglycerides; ⁇ uch
  • SUBSTITUTE SHEET ⁇ uppo ⁇ itorie ⁇ may be formed from mixtures containing the active ingredient in the range of 0/5% to 10%, preferably l%-2%.
  • Oral formulation ⁇ include ⁇ uch normally employed excipient ⁇ as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium ⁇ tearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
  • PCR cDNA Synthesis and Polymerase Chain Reaction
  • nucleotides are consi ⁇ tent with 37 C.F.R. SSI.821- 1.825. Thu ⁇ , the letters A, C G, T, and U are u ⁇ ed in the ordinary ⁇ en ⁇ e of adenine, cyto ⁇ ine, guanine, thymine, and uracil.
  • the letter M means A or C; R mean ⁇ A or G; W mean ⁇ A or T/U; S mean ⁇ C or G; Y mean ⁇ C or T/U; K mean ⁇ G or T/U; V means A or C or G, not T/U; H means A or C or T/U, not G; D means A or G or T/ ⁇ , not C; B mean ⁇ C or G or T/U, not A; N mean ⁇ (A or C or G or T/U) or (unknown or other).
  • sequences 67 and 68 were used as primers in the PCR reaction. These primers amplify a ⁇ egment corre ⁇ ponding to the core and envelope regions. After amplification, the reaction product ⁇ were separated on an agaro ⁇ e gel and then transferred to a nylon membrane. The immobilized reaction products were allowed to hybridize with a
  • Genotype 1 P-labelled nucleic acid corresponding to either Genotype I (core or envelope 1) or Genotype II (core or envelope 1).
  • Nucleic acid corresponding to Genotype 1 comprised sequence ⁇ numbered 69 (core), 71 (envelope), and 73 (envelope).
  • SUBSTITUTE SHEET Genotype II comprised sequences numbered 70 (core), 72 (envelope), and 74 (envelope).
  • Genotype I probes only hybridized to the product amplified from isolate ⁇ which had Genotype I ⁇ equence.
  • Genotype II probe ⁇ only hybridized to the product amplified from i ⁇ olates which had Genotype II sequence.
  • PCR products were generated using sequence ⁇ 79 and 80.
  • the products were analyzed as described above except Sequence No. 73 was used to detect Genotype I, Sequence No. 74 was used to detect Genotype II, Sequence No. 77 (5'UT) was u ⁇ ed to detect Genotype III, and Sequence No. 78 (5'UT) wa ⁇ u ⁇ ed to detect Genotype IV.
  • Sequence No. 73 was used to detect Genotype I
  • Sequence No. 74 was used to detect Genotype II
  • Sequence No. 77 was u ⁇ ed to detect Genotype III
  • Sequence No. 78 5'UT
  • a capture probe nucleic acid is capable of associating a complementary probe bound to a solid support and HCV nucleic acid to effect capture.
  • a detection probe nucleic acid has a first ⁇ egment (A) that binds to HCV nucleic acid and a second segment (B) that hybridizes to a second amplifier nucleic acid.
  • the amplifier ' nucleic acid has a fir ⁇ t ⁇ egment (B*) that hybridizes to ⁇ egment (B) of the probe nucleic acid and al ⁇ o comprises fifteen iterations of a ⁇ egment (C).
  • Segment C of the amplifier nucleic acid is capable of hybridizing to three labeled nucleic acids.
  • Nucleic acid sequence ⁇ which corre ⁇ pond to nucleotide ⁇ equence ⁇ of the envelope 1 gene of Group I HCV i ⁇ olate ⁇ are ⁇ et forth in ⁇ equence ⁇ numbered 81-99.
  • Table 2 ⁇ et ⁇ forth the area of the HCV genome to which the nucleic acid ⁇ equence ⁇ corre ⁇ pond and a preferred u ⁇ e of the ⁇ equence ⁇ .
  • Nucleic acid sequences which correspond to nucleotide sequences of the envelope 1 gene of Group II HCV isolates are set forth in sequences 100-118.
  • Table 3 sets forth the area of the HCV genome to which the nucleic acid corresponds and the preferred use of the sequences.
  • SUBSTITUTE SHEET are ⁇ et forth in ⁇ equence ⁇ 119-145.
  • Table 4 identifie ⁇ the ⁇ equence with a preferred u ⁇ e.
  • Detection ⁇ equence ⁇ are ⁇ equence ⁇ numbered 119-140.
  • Each detection ⁇ equence contained, in addition to the sequences substantially complementary to the HCV sequence ⁇ , a 5' exten ⁇ ion (B) which exten ⁇ ion (B) i ⁇ complementary to a ⁇ egment of the ⁇ econd amplifier nucleic acid.
  • Each capture ⁇ equence contained, in addition to the ⁇ equences substantially complementary to HCV ⁇ equence ⁇ , a ⁇ equence complementary to DNA bound to a solid pha ⁇ e.
  • the ⁇ equence complementary to DNA bound to a solid ⁇ upport was carried downstream from the capture ⁇ equence.
  • the sequence complementary to the DNA bound to the support i ⁇ ⁇ et forth a ⁇ Sequence No. 147 and is reproduced below.
  • CTTCTTTGGAGAAAGTGGTG Microtiter plates were prepared a ⁇ follows.
  • White Microlite 1 Re ovawell ⁇ trip ⁇ poly ⁇ tyrene microtiter plates, 96 wells/plate) were purchased from Dynatech Inc. -
  • Each well was filled with 200 ⁇ l 1 N HC1 and incubated at room temperature for 15-20 min. The plates were then washed 4 times with IX PBS and the well ⁇ aspirated to remove liquid. The well ⁇ were then filled with 200 ⁇ l 1 N NaOH and incubated at room temperature for 15-20 min. The plate ⁇ were again washed 4 times with IX PBS and the wells aspirated to remove liquid.
  • Poly(phe-lys) was purcha ⁇ ed from Sigma Chemicals, Inc. This polypeptide ha ⁇ a 1:1 molar ratio of phe:ly ⁇ and an average m.w. of 47,900 gm/mole. It ha ⁇ an average length of 309 amino acids and contains 155 amines/mole. A 1 mg/ml ⁇ olution of the polypeptide was mixed with 2M NaCl/lX PBS to a final concentration of
  • the coupling mixture DSS-DMF ⁇ olution was added to 2 ml 10 mM sodium phosphate, pH 6.5, at 4°C. The mixture was vortexed to mix and loaded onto the equilibrated NAP-25 column. DSS-activated immobilized nucleic acid DNA was eluted from the column with 3.5 ml 10 mM sodium phosphate, pH 6.5. A quantity of 5.6 OD 2g . units of eluted
  • DSS-activated immobilized nucleic acid DNA was added to 1500 ml 50 mM sodium phosphate, pH 7.8. A volume of 50
  • Serum samples to be as ⁇ ayed were analyzed u ⁇ ing PCR followed by ⁇ equence analy ⁇ i ⁇ to determine the genotype.
  • Alkaline pho ⁇ phatase label nucleic acid disclo ⁇ ed in EP 883096976, wa ⁇ then added to each well (50 ⁇ l/well of 2.66 fmole ⁇ / ⁇ l). After incubation at 52°C for 15 min., and 10 min. at room temperature, the wells were wa ⁇ hed twice a ⁇ above and then 3X with 0.015 M NaCl/0.0015 M sodium citrate.
  • An enzyme-triggered dioxetane (Schaap et al., Tet. Lett. (1987) 28:1159-1162 and EPA Pub. No. 0254051), obtained from Lumigen, Inc., was employed.
  • Lumiphos 530 (Lumigen) wa ⁇ added to each well.
  • the well ⁇ were tapped lightly so that the reagent would fall to the bottom and gently swirled to di ⁇ tribute the reagent evenly over the bottom.
  • the wells were covered and incubated at 37 ⁇ C for 20-40 min.
  • polypeptide ⁇ formed in Section IV i ⁇ evaluated in the following manner.
  • Polyethylene pins arranged on a block in an 8 12 array are prepared by placing the pins in a bath (20% v/v piperidine in dimethylformamide (DMF)) for 30 minutes at room
  • the protected amino acids are placed in micro-titer plate wells with HOBt, and the pin block placed over the plate, immersing the pin ⁇ in the well ⁇ .
  • the assembly is then sealed in a plastic bag and allowed to react at 25 ⁇ C for 18 hour ⁇ to couple the fir ⁇ t amino acids to the pins.
  • the block i ⁇ then removed, and the pin ⁇ washed with DMF (2 min.), MeOH (4 x, 2 min.), and again with DMF (2 min.) to clean and deprotect the bound amino acids.
  • the procedure i ⁇ repeated for each additional amino acid coupled, until all octamer ⁇ are prepared.
  • the free N-termini are then acetylated to compensate for the free amide, as most of the epitope ⁇ are not found at the N-terminu ⁇ and thu ⁇ would not have the associated positive charge.
  • Acetylation is accomplished by filling the well ⁇ of a microtiter plate with DMF/acetic anhydride/triethylamine (5:2:1 v/v/v) and allowing the pins to react in the wells for 90 minutes at 20 ⁇ C. The pins are then washed with DMF (2
  • the side chain protecting groups are removed by treating the pin ⁇ with trifluoroacetic acid/phenol/ dithioethane (95:2.5:1.5, v/v/v) in polypropylene bags for 4 hours at room temperature.
  • the pin ⁇ are then washed in dichloromethane (2 x, 2 min.), 5% di-isopropylethylamine/dichloromethane (2 x, 5 min.), dichloromethane. (5 min.), and air-dried for at lea ⁇ t 10 minutes.
  • the pin ⁇ are then wa ⁇ hed in water (2 min.), MeOH (18 hour ⁇ ), dried in vacuo, and ⁇ tored in ⁇ ealed plastic bags over silica gel.
  • IV.B.lS.b A ⁇ ay of Peptide ⁇ .
  • Octamer-bearing pin ⁇ are treated by ⁇ onicating for 30 minute ⁇ in a di ⁇ ruption buffer (1% sodium dodecylsulfate, 0.1% 2-mercaptoethanol, 0.1 M NaH2P04) at 60 ⁇ C.
  • the pin ⁇ are then immer ⁇ ed ⁇ everal times in water (60 ⁇ C), followed by boiling MeOH (2 min.), and allowed to air dry.
  • the pins are then precoated for 1 hour at 25 ⁇ C in microtiter wells containing 200 ⁇ L blocking buffer (1% ovalbumin, 1% BSA, 0.1% Tween, and 0.05% NaN3 in PBS), with agitation.
  • the pins are then immersed in microtiter wells containing 175 ⁇ L antisera obtained from human patients diagno ⁇ ed a ⁇ having HCV and allowed to incubate at 4°C overnight.
  • polypeptide initiates that the peptides give rise to an immune response in vivo.
  • peptides are candidates for the development of vaccines.
  • CGCAAAGCTC CAGGACTGCA CGCTCCTGGT GTGTGGTGAT 320
  • TGCAAAGCTC CAGGACTGCA CGCTCCTGGT GTGTGGTGTG 280
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120 GCTCAATGCC TGGAGATTTG GGCGTGCCCC CGCAAGACTG 160
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120 GCTCAATGCC TGGAGATTTG GGCACGCCCC CGCAAGATCA 160
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATAAACCC 120
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120 GCTCAATGCC TGGAGATTTG GGCGTGCCCC CGCGAGACTG 160
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120 GCTCAATGCC TGGAGATTTG GGCGTGCCCC CGCGAGACTG 160
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120 GCTCAATGCC TGGAGATTTG GGCGTGCCCC CGCGAGACTG 160
  • GGAATTGCCA GGACGACCGG GTCCTTTCTT GGATCAACCC 120 GCTCAATGCC TGGAGATTTG GGCGTGCCCC CGCGAGACTG 160
  • GGAATTGCCG GGAAGACTGG GTCCTTTCTT GGATAAACCC 120 ACTCTATGCC CGGCCATTTG GGCGTGCCCC CGCAAGACTG 160
  • GCTCAATACC CAGAAATTTG GGCGTGCCCC CGCGAGATCA 160
  • GCTCAATACC CAGAAATTTG GGCGTGCCCC CGCGAGATCA 160
  • GGAATTGCCG GGATGACCGG GTCCTTTCTT GGATAAACCC 120
  • GGAATTGCCG GGATGACCGG GTCCTTTCTT GGATAAACCC 120 GCTCAATGCC CGGAGATTTG GGCGTGCCCC CGCGAGACTG 160 CTAGCCGAGT AGTGTTGGGT 180

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Communicable Diseases (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Reproductive Health (AREA)
  • Endocrinology (AREA)
  • General Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
PCT/US1992/004036 1991-05-08 1992-05-08 Hcv genomic sequences for diagnostics and therapeutics Ceased WO1992019743A2 (en)

Priority Applications (18)

Application Number Priority Date Filing Date Title
SK1232-93A SK284205B6 (sk) 1991-05-08 1992-05-08 Prirodzene sa nevyskytujúca nukleová kyselina, spôsob tvorby hybridizačného produktu a spôsob detekcie genotypov HCV
DK92913881T DK0585398T3 (da) 1991-05-08 1992-05-08 HCV genomiske sekvenser til diagnostiske og terapeutiske midler
CZ19932377A CZ288720B6 (cs) 1991-05-08 1992-05-08 Nukleová kyselina, kompozice s jejím obsahem, způsob tvorby hybridizačního produktu a způsob detekce genotypů HCV
KR1019930703367A KR100193801B1 (ko) 1991-05-08 1992-05-08 진단 및 치료용 c형 간염 바이러스(hcv) 게놈서열
CA002108466A CA2108466C (en) 1991-05-08 1992-05-08 Hcv genomic sequences for diagnostics and therapeutics
JP4512055A JPH06508026A (ja) 1991-05-08 1992-05-08 診断と治療に用いるhcvゲノム配列
AU21558/92A AU668355C (en) 1991-05-08 1992-05-08 HCV genomic sequences for diagnostics and therapeutics
DE69233234T DE69233234T2 (de) 1991-05-08 1992-05-08 Genomische hcv-sequenzen für diagnostik und therapie
RO93-01493A RO117267B1 (ro) 1991-05-08 1992-05-08 Secventa de acid nucleic si peptida codificata de aceasta, pentru diagnostic si tratament
AT92913881T ATE252154T1 (de) 1991-05-08 1992-05-08 Genomische hcv-sequenzen für diagnostik und therapie
PL92312096A PL170151B1 (pl) 1991-05-08 1992-05-08 Sposób wykrywania jednego lub wiecej genotypów wirusa zapalenia watroby C PL PL PL
EP92913881A EP0585398B1 (en) 1991-05-08 1992-05-08 Hcv genomic sequences for diagnostics and therapeutics
HU9303166A HU227548B1 (en) 1991-05-08 1992-05-08 Process for production of non-naturally occuring non-hcv-1 nucleic acids, forming a hybridization product, and detecting hcv genotypes
PL92301282A PL169880B1 (pl) 1991-05-08 1992-05-08 Sposób wytwarzania produktu hybrydyzacji z kwasem nukleinowym wirusa zapalenia watroby C PL PL PL
NO934019A NO309532B1 (no) 1991-05-08 1993-11-05 Ikke-naturlig forekommende nukleinsyre og anvendelse av denne for deteksjon
BG98200A BG62142B1 (bg) 1991-05-08 1993-11-05 Нсv геномни последователности за диагностика и лечение
FI934937A FI115725B (fi) 1991-05-08 1993-11-08 HCV:n genomisia sekvenssejä diagnostiikkaan
BG101876A BG101876A (en) 1991-05-08 1997-09-04 Hcv genome sequences for diagnostics and treatment

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US69732691A 1991-05-08 1991-05-08
US697,326 1991-05-08

Publications (2)

Publication Number Publication Date
WO1992019743A2 true WO1992019743A2 (en) 1992-11-12
WO1992019743A3 WO1992019743A3 (en) 1993-11-25

Family

ID=24800701

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/004036 Ceased WO1992019743A2 (en) 1991-05-08 1992-05-08 Hcv genomic sequences for diagnostics and therapeutics

Country Status (20)

Country Link
EP (2) EP0585398B1 (https=)
JP (7) JPH06508026A (https=)
KR (1) KR100193801B1 (https=)
AT (1) ATE252154T1 (https=)
BG (3) BG62142B1 (https=)
CA (1) CA2108466C (https=)
CZ (2) CZ288720B6 (https=)
DE (1) DE69233234T2 (https=)
DK (1) DK0585398T3 (https=)
ES (1) ES2207633T3 (https=)
FI (1) FI115725B (https=)
HU (1) HU227548B1 (https=)
IE (1) IE921482A1 (https=)
NO (1) NO309532B1 (https=)
PL (2) PL169880B1 (https=)
PT (1) PT100472B (https=)
RO (1) RO117267B1 (https=)
RU (1) RU2155228C2 (https=)
SK (1) SK284205B6 (https=)
WO (1) WO1992019743A2 (https=)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0532167A3 (en) * 1991-08-09 1993-03-31 Immuno Japan Inc. Non-a, non-b hepatitis virus genome, polynucleotides, polypeptides, antigen, antibody and detection systems
EP0532258A3 (https=) * 1991-09-09 1994-04-06 Japan Immuno Inc
WO1994012670A3 (en) * 1992-11-27 1994-07-21 Innogenetics Nv Process for typing of hcv isolates
EP0633320A1 (en) * 1992-11-27 1995-01-11 Immuno Japan Inc. Oligonucleotides of HCV, primers ND probes therefrom, method of determining HCV genotypes and method of detecting HVC in samples
EP0633321A1 (en) * 1993-06-14 1995-01-11 Immuno Japan Inc. HCV related oligonucleotides and uses thereof in methods for detecting and genotyping of HCV, and kits used in these methods
WO1994025601A3 (en) * 1993-04-27 1995-03-02 Innogenetics Nv New sequences of hepatitis c virus genotypes and their use as therapeutic and diagnostic agents
WO1995011918A1 (en) * 1993-10-29 1995-05-04 Srl, Inc. Antigen peptide compound and immunoassay method
US5428145A (en) * 1991-08-09 1995-06-27 Immuno Japan, Inc. Non-A, non-B, hepatitis virus genome, polynucleotides, polypeptides, antigen, antibody and detection systems
WO1995001442A3 (en) * 1993-06-29 1995-08-10 Us Health Nucleotide and amino acid sequences of the envelope 1 gene of 51 hepatitis c virus isolates and the use of reagents derived therefrom as diagnostic reagents and vaccines
WO1996005315A3 (en) * 1994-08-15 1996-04-04 Us Health Nucleotide and amino acid sequences of the envelope 1 and core genes of hepatitis c virus
EP0642592A4 (en) * 1992-05-29 1997-01-02 Abbott Lab LIGASE CHAIN REACTION STARTING WITH RNA SEQUENCES.
WO1997040190A1 (en) * 1996-04-19 1997-10-30 Chiron Corporation Heteroduplex tracking assay (hta) for genotyping hcv
WO1997046716A1 (en) * 1996-06-07 1997-12-11 Wabco B.V. Method to detect hcv specific nucleic acids
US5763159A (en) * 1991-11-21 1998-06-09 Common Services Agency Hepatitis-C virus testing
WO1999023249A3 (de) * 1997-11-04 1999-09-10 Roche Diagnostics Gmbh Spezifisches und empfindliches nukleinsäurenachweisverfahren
US6001990A (en) * 1994-05-10 1999-12-14 The General Hospital Corporation Antisense inhibition of hepatitis C virus
US6284458B1 (en) * 1992-09-10 2001-09-04 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of hepatitis C virus-associated diseases
US6423489B1 (en) * 1992-09-10 2002-07-23 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of Hepatitis C virus-associated diseases
US6586584B2 (en) 2001-01-29 2003-07-01 Becton, Dickinson And Company Sequences and methods for detection of Hepatitis C virus
US6649735B1 (en) 1992-03-06 2003-11-18 N.V. Innogenetics S.A. Process for the determination of peptides corresponding to immunologically important epitopes and their use in a process for determination of antibodies or biotinylated peptides corresponding to immunologically important epitopes, a process for preparing them and compositions containing them
US6680059B2 (en) 2000-08-29 2004-01-20 Tripep Ab Vaccines containing ribavirin and methods of use thereof
US6709828B1 (en) 1992-03-06 2004-03-23 N.V. Innogenetics S.A. Process for the determination of peptides corresponding to immunologically important epitopes and their use in a process for determination of antibodies or biotinylated peptides corresponding to immunologically important epitopes, a process for preparing them and compositions containing them
US6858590B2 (en) 2000-08-17 2005-02-22 Tripep Ab Vaccines containing ribavirin and methods of use thereof
US6960569B2 (en) 2000-08-17 2005-11-01 Tripep Ab Hepatitis C virus non-structural NS3/4A fusion gene
US6974864B2 (en) 1994-10-21 2005-12-13 Innogenetics N.V. Sequences of hepatitis C virus genotypes and their use as prophylactic, therapeutic and diagnostic agents
US7022830B2 (en) 2000-08-17 2006-04-04 Tripep Ab Hepatitis C virus codon optimized non-structural NS3/4A fusion gene
US7070790B1 (en) 1993-06-29 2006-07-04 The United States Of America As Represented By The Department Of Health And Human Services Nucleotide and deduced amino acid sequences of the envelope 1 and core genes of isolates of hepatitis C virus and the use of reagents derived from these sequences in diagnostic methods and vaccines
US7122306B2 (en) 1993-04-27 2006-10-17 N.V. Innogenetics S.A. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
US7196183B2 (en) 2001-08-31 2007-03-27 Innogenetics N.V. Hepatitis C virus genotype, and its use as prophylactic, therapeutic and diagnostic agent
US7258977B1 (en) 1992-11-27 2007-08-21 Innogenetics N.V. Process for typing of HCV isolates
US7473773B2 (en) 2004-01-07 2009-01-06 Third Wave Technologies, Inc. Determination of hepatitis C virus genotype
US8124747B2 (en) 2003-08-29 2012-02-28 Innogenetics HCV clade and prototype sequences thereof
US8883169B2 (en) 2007-08-16 2014-11-11 Chrontech Pharma Ab Immunogen platform

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100733186B1 (ko) * 2005-05-31 2007-06-27 재단법인 목암생명공학연구소 Hcv 유전자에 특이적인 작은 간섭 rna 및 그를유효성분으로 포함하는 c형 간염 치료제

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH02500880A (ja) * 1987-11-18 1990-03-29 カイロン コーポレイション Nanbvの診断用薬およびワクチン
SU1645302A1 (ru) * 1989-01-05 1991-04-30 Московский Научно-Исследовательский Институт Педиатрии И Детской Хирургии Минздрава Рсфср Способ дифференциальной индикации вирусспецифических нуклеотидных последовательностей вируса герпеса простого типа 1 и 2.
KR0185373B1 (ko) * 1989-03-17 1999-05-01 로버트 피. 블랙버언 Hcv 폴리단백질에서 유래되는 hcv 아미노산 서열 부분을 포함하는 폴리펩티드 및 그 사용
GR1001261B (el) * 1989-12-18 1993-06-30 Wellcome Found Ιϊκός παράγων.
WO1991014779A1 (fr) * 1990-03-28 1991-10-03 Mitsui Toatsu Chemicals, Incorporated Diagnostic du virus de l'hepatite
DE69132332T2 (de) * 1990-04-06 2000-11-30 Genelabs Technologies, Inc. Hepatitis c-virus-epitope
EP0933426A1 (en) * 1990-06-25 1999-08-04 The Research Foundation for Microbial Diseases of Osaka University Non-a, non-b hepatitis virus genomic cdna fragments and antigen polypeptides
AU652941B2 (en) * 1990-06-25 1994-09-15 Research Foundation For Microbial Diseases Of Osaka University, The Non-A, Non-B hepatitis virus particles
EP0510952A1 (en) * 1991-04-26 1992-10-28 Immuno Japan Inc. Oligonucleotide primers and their application for high-fidelity detection of non-a, non-b hepatitis virus

Cited By (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0532167A3 (en) * 1991-08-09 1993-03-31 Immuno Japan Inc. Non-a, non-b hepatitis virus genome, polynucleotides, polypeptides, antigen, antibody and detection systems
US5428145A (en) * 1991-08-09 1995-06-27 Immuno Japan, Inc. Non-A, non-B, hepatitis virus genome, polynucleotides, polypeptides, antigen, antibody and detection systems
US5427909A (en) * 1991-09-09 1995-06-27 Immuno Japan Inc. Oligonucleotides and determination system of HCV genotypes
EP0532258A3 (https=) * 1991-09-09 1994-04-06 Japan Immuno Inc
US7179470B2 (en) 1991-11-21 2007-02-20 Common Services Agency Hepatitis-C virus testing
US5763159A (en) * 1991-11-21 1998-06-09 Common Services Agency Hepatitis-C virus testing
US7976849B2 (en) 1991-11-21 2011-07-12 Common Services Agency Hepatitis-C virus testing
US7709006B2 (en) 1991-11-21 2010-05-04 Common Services Agency Hepatitis-C virus testing
US8318421B2 (en) 1991-11-21 2012-11-27 Common Services Agency Hepatitis-C virus testing
US6649735B1 (en) 1992-03-06 2003-11-18 N.V. Innogenetics S.A. Process for the determination of peptides corresponding to immunologically important epitopes and their use in a process for determination of antibodies or biotinylated peptides corresponding to immunologically important epitopes, a process for preparing them and compositions containing them
US6709828B1 (en) 1992-03-06 2004-03-23 N.V. Innogenetics S.A. Process for the determination of peptides corresponding to immunologically important epitopes and their use in a process for determination of antibodies or biotinylated peptides corresponding to immunologically important epitopes, a process for preparing them and compositions containing them
US5686272A (en) * 1992-05-29 1997-11-11 Abbott Laboratories Amplification of RNA sequences using the ligase chain reaction
EP0642592A4 (en) * 1992-05-29 1997-01-02 Abbott Lab LIGASE CHAIN REACTION STARTING WITH RNA SEQUENCES.
US6284458B1 (en) * 1992-09-10 2001-09-04 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of hepatitis C virus-associated diseases
US6423489B1 (en) * 1992-09-10 2002-07-23 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of Hepatitis C virus-associated diseases
US7258977B1 (en) 1992-11-27 2007-08-21 Innogenetics N.V. Process for typing of HCV isolates
US6891026B2 (en) 1992-11-27 2005-05-10 Innogenetics N.V. Process for typing of HCV isolates
US6887985B2 (en) 1992-11-27 2005-05-03 Innogenetics N.V. Process for typing of HCV isolates
US8101351B2 (en) 1992-11-27 2012-01-24 Innogenetics N.V. Process for typing of HCV isolates
EP1197568A3 (en) * 1992-11-27 2004-04-14 Innogenetics N.V. Detection and typing of HCV using 5'UTR and NS5 nucleic acid sequences
US7258982B2 (en) 1992-11-27 2007-08-21 Innogenetics, S.A. Process for typing of HCV isolates
EP0633320A1 (en) * 1992-11-27 1995-01-11 Immuno Japan Inc. Oligonucleotides of HCV, primers ND probes therefrom, method of determining HCV genotypes and method of detecting HVC in samples
US6548244B2 (en) 1992-11-27 2003-04-15 Innogenetics N.V. Process for typing HCV isolates
US6495670B1 (en) * 1992-11-27 2002-12-17 Innogenetics, N.V. Process for typing of HCV isolates
WO1994012670A3 (en) * 1992-11-27 1994-07-21 Innogenetics Nv Process for typing of hcv isolates
EP1197568A2 (en) 1992-11-27 2002-04-17 Innogenetics N.V. Detection and typing of HCV using 5'UTR and NS5 nucleic acid sequences
US7157226B1 (en) 1993-04-27 2007-01-02 Innogenetics S.A. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
US6762024B2 (en) 1993-04-27 2004-07-13 Innogenetics, S.A. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
EP1004670A2 (en) 1993-04-27 2000-05-31 Innogenetics N.V. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
EP0984068A2 (en) 1993-04-27 2000-03-08 Innogenetics N.V. Sequences of hepatitis c virus genotypes and their use as therapeutic and diagnostic agents
US7195765B2 (en) 1993-04-27 2007-03-27 N.V. Innogenetics S.A. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
WO1994025601A3 (en) * 1993-04-27 1995-03-02 Innogenetics Nv New sequences of hepatitis c virus genotypes and their use as therapeutic and diagnostic agents
US7255997B1 (en) 1993-04-27 2007-08-14 N.V. Innogenetics S.A. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
EP0984067A3 (en) * 1993-04-27 2000-09-27 Innogenetics N.V. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
AU688323B2 (en) * 1993-04-27 1998-03-12 N.V. Innogenetics S.A. New sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
US7855052B2 (en) 1993-04-27 2010-12-21 N.V. Innogenetics S.A. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
US7122306B2 (en) 1993-04-27 2006-10-17 N.V. Innogenetics S.A. Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents
EP0651807A1 (en) * 1993-04-27 1995-05-10 N.V. Innogenetics S.A. New sequences of hepatitis c virus genotypes and their use as therapeutic and diagnostic agents
EP0633321A1 (en) * 1993-06-14 1995-01-11 Immuno Japan Inc. HCV related oligonucleotides and uses thereof in methods for detecting and genotyping of HCV, and kits used in these methods
US5882852A (en) * 1993-06-29 1999-03-16 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Hepatitic C virus (HCV) core gene nucleotide sequences and related methods of detecting major and minor genotypes of HCV isolates
US5871962A (en) * 1993-06-29 1999-02-16 The United States Of America As Represented By The Department Of Health And Human Services Nucleotide and deduced amino acid sequences of the envelope 1 gene of 51 isolates of hepatitis C virus and the use of reagents derived from these sequences in diagnostic methods
WO1995001442A3 (en) * 1993-06-29 1995-08-10 Us Health Nucleotide and amino acid sequences of the envelope 1 gene of 51 hepatitis c virus isolates and the use of reagents derived therefrom as diagnostic reagents and vaccines
US6572864B1 (en) 1993-06-29 2003-06-03 The United States Of America As Represented By The Department Of Health And Human Services Nucleotide and deduced amino acid sequences of the envelope 1 gene of 51 isolates of hepatitis C virus and the use of reagents derived from these sequences in diagnostic methods and vaccines
US7070790B1 (en) 1993-06-29 2006-07-04 The United States Of America As Represented By The Department Of Health And Human Services Nucleotide and deduced amino acid sequences of the envelope 1 and core genes of isolates of hepatitis C virus and the use of reagents derived from these sequences in diagnostic methods and vaccines
US5514539A (en) * 1993-06-29 1996-05-07 The United States Of America As Represented By The Department Of Health And Human Services Nucleotide and deduced amino acid sequences of the envelope 1 gene of 51 isolates of hepatitis C virus and the use of reagents derived from these sequences in diagnostic methods and vaccines
US5885771A (en) * 1993-10-29 1999-03-23 Srl, Inc. Antigenic peptide compound and immunoassay
WO1995011918A1 (en) * 1993-10-29 1995-05-04 Srl, Inc. Antigen peptide compound and immunoassay method
US6001990A (en) * 1994-05-10 1999-12-14 The General Hospital Corporation Antisense inhibition of hepatitis C virus
WO1996005315A3 (en) * 1994-08-15 1996-04-04 Us Health Nucleotide and amino acid sequences of the envelope 1 and core genes of hepatitis c virus
AU712385B2 (en) * 1994-08-15 1999-11-04 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Nucleotide and amino acid sequences of the envelope 1 and core genes of hepatitis C virus
US6974864B2 (en) 1994-10-21 2005-12-13 Innogenetics N.V. Sequences of hepatitis C virus genotypes and their use as prophylactic, therapeutic and diagnostic agents
US7129337B1 (en) 1994-10-21 2006-10-31 Innogenetics N.V. Sequences of hepatitis C virus genotypes and their use as prophylactic, therapeutic and diagnostic agents
WO1997040190A1 (en) * 1996-04-19 1997-10-30 Chiron Corporation Heteroduplex tracking assay (hta) for genotyping hcv
WO1997046716A1 (en) * 1996-06-07 1997-12-11 Wabco B.V. Method to detect hcv specific nucleic acids
US7105318B2 (en) 1997-11-04 2006-09-12 Roche Diagnostics Gmbh Specific and sensitive nucleic acid detection method
WO1999023249A3 (de) * 1997-11-04 1999-09-10 Roche Diagnostics Gmbh Spezifisches und empfindliches nukleinsäurenachweisverfahren
US7241440B2 (en) 2000-08-17 2007-07-10 Tripep Ab Vaccines containing ribavirin and methods of use thereof
US7244715B2 (en) 2000-08-17 2007-07-17 Tripep Ab Vaccines containing ribavirin and methods of use thereof
US7022830B2 (en) 2000-08-17 2006-04-04 Tripep Ab Hepatitis C virus codon optimized non-structural NS3/4A fusion gene
US6960569B2 (en) 2000-08-17 2005-11-01 Tripep Ab Hepatitis C virus non-structural NS3/4A fusion gene
US6858590B2 (en) 2000-08-17 2005-02-22 Tripep Ab Vaccines containing ribavirin and methods of use thereof
US7307066B2 (en) 2000-08-17 2007-12-11 Tripep Ab Hepatitis C virus codon optimized non-structural NS3/4A fusion gene
US7261883B2 (en) 2000-08-29 2007-08-28 Tripep Ab Vaccines containing ribavirin and methods of use thereof
US6680059B2 (en) 2000-08-29 2004-01-20 Tripep Ab Vaccines containing ribavirin and methods of use thereof
US6586584B2 (en) 2001-01-29 2003-07-01 Becton, Dickinson And Company Sequences and methods for detection of Hepatitis C virus
US7196183B2 (en) 2001-08-31 2007-03-27 Innogenetics N.V. Hepatitis C virus genotype, and its use as prophylactic, therapeutic and diagnostic agent
US8124747B2 (en) 2003-08-29 2012-02-28 Innogenetics HCV clade and prototype sequences thereof
US8071750B2 (en) 2004-01-07 2011-12-06 Third Wave Technologies, Inc. Determination of hepatitis C virus genotype
US7473773B2 (en) 2004-01-07 2009-01-06 Third Wave Technologies, Inc. Determination of hepatitis C virus genotype
US8883169B2 (en) 2007-08-16 2014-11-11 Chrontech Pharma Ab Immunogen platform

Also Published As

Publication number Publication date
AU668355B2 (en) 1996-05-02
JP2003009891A (ja) 2003-01-14
PL169880B1 (pl) 1996-09-30
EP0585398B1 (en) 2003-10-15
SK123293A3 (en) 1994-06-08
FI115725B (fi) 2005-06-30
HU227548B1 (en) 2011-08-29
NO934019D0 (no) 1993-11-05
NO934019L (no) 1993-11-05
WO1992019743A3 (en) 1993-11-25
CZ288720B6 (cs) 2001-08-15
BG98200A (bg) 1995-01-31
BG101876A (en) 1998-11-30
KR100193801B1 (ko) 1999-06-15
EP1394256A3 (en) 2008-03-12
FI934937A0 (fi) 1993-11-08
FI934937L (fi) 1994-01-05
BG62142B1 (bg) 1999-03-31
IE921482A1 (en) 1992-11-18
PL170151B1 (pl) 1996-10-31
CZ288722B6 (cs) 2001-08-15
CA2108466C (en) 2007-07-10
JP2003024090A (ja) 2003-01-28
DE69233234D1 (de) 2003-12-04
CZ237793A3 (en) 1994-04-13
BG64627B1 (bg) 2005-09-30
JP2008178416A (ja) 2008-08-07
JP2003009893A (ja) 2003-01-14
EP0585398A1 (en) 1994-03-09
NO309532B1 (no) 2001-02-12
CZ121096A3 (en) 1996-08-14
CA2108466A1 (en) 1992-11-09
DK0585398T3 (da) 2004-02-02
JP2003009892A (ja) 2003-01-14
DE69233234T2 (de) 2004-08-05
HU9303166D0 (en) 1994-03-28
HUT69609A (en) 1995-09-28
EP1394256A2 (en) 2004-03-03
JPH06508026A (ja) 1994-09-14
RU2155228C2 (ru) 2000-08-27
PT100472A (pt) 1993-08-31
JP2004290204A (ja) 2004-10-21
SK284205B6 (sk) 2004-10-05
ES2207633T3 (es) 2004-06-01
RO117267B1 (ro) 2001-12-28
AU2155892A (en) 1992-12-21
ATE252154T1 (de) 2003-11-15
PT100472B (pt) 1999-08-31

Similar Documents

Publication Publication Date Title
WO1992019743A2 (en) Hcv genomic sequences for diagnostics and therapeutics
US6214583B1 (en) HCV genomic sequences for diagnostics and therapeutics
CN100397082C (zh) 检测样品中hcv的方法
AU666576B2 (en) NANBV diagnostics and vaccines
IE83867B1 (en) HCV genomic sequences for diagnostics and therapeutics
NZ288000A (en) Hepatitis g virus and molecular cloning thereof
WO1995032290A2 (en) Non-a/non-b/non-c/non-d/non-e hepatitis agents and molecular cloning thereof
AU668355C (en) HCV genomic sequences for diagnostics and therapeutics
EP0832114A2 (en) Nucleotide and amino acid sequences of hypervariable region 1 of the envelope 2 gene of hepatitis c virus
AU624105B2 (en) Nanbv diagnostics and vaccines
US5437974A (en) DNA sequence and encoded polypeptide useful in the diagnosis of hepatitis disease
RU2162894C2 (ru) Полипептид, обладающий антигенными свойствами вируса гепатита с и его фрагмент (варианты), диагностический реагент (варианты), набор для обнаружения антител (варианты), способ обнаружения антител (варианты)
AU684177C (en) Hepatitis G virus and molecular cloning thereof
AU624105C (en) NANBV diagnostics and vaccines

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU BB BG BR CA CS FI HU JP KP KR LK MG MN MW NO PL RO RU SD

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE BF BJ CF CG CH CI CM DE DK ES FR GA GB GN GR IT LU MC ML MR NL SE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2108466

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 123293

Country of ref document: SK

WWE Wipo information: entry into national phase

Ref document number: PV1993-2377

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 934937

Country of ref document: FI

Ref document number: 93-01493

Country of ref document: RO

Ref document number: 1019930703367

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1992913881

Country of ref document: EP

AK Designated states

Kind code of ref document: A3

Designated state(s): AU BB BG BR CA CS FI HU JP KP KR LK MG MN MW NO PL RO RU SD

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE BF BJ CF CG CH CI CM DE DK ES FR GA GB GN GR IT LU MC ML MR NL SE SN TD TG

WWP Wipo information: published in national office

Ref document number: 1992913881

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: PV1993-2377

Country of ref document: CZ

EX32 Extension under rule 32 effected after completion of technical preparation for international publication
LE32 Later election for international application filed prior to expiration of 19th month from priority date or according to rule 32.2 (b)
WWE Wipo information: entry into national phase

Ref document number: PV1996-1210

Country of ref document: CZ

WWP Wipo information: published in national office

Ref document number: PV1996-1210

Country of ref document: CZ

WWG Wipo information: grant in national office

Ref document number: PV1993-2377

Country of ref document: CZ

Ref document number: PV1996-1210

Country of ref document: CZ

WWG Wipo information: grant in national office

Ref document number: 1992913881

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 934937

Country of ref document: FI

WWW Wipo information: withdrawn in national office

Ref document number: 1992913881

Country of ref document: EP