WO1991009137A1 - Recepteur de thyrotropine recombinant - Google Patents

Recepteur de thyrotropine recombinant Download PDF

Info

Publication number
WO1991009137A1
WO1991009137A1 PCT/US1990/007387 US9007387W WO9109137A1 WO 1991009137 A1 WO1991009137 A1 WO 1991009137A1 US 9007387 W US9007387 W US 9007387W WO 9109137 A1 WO9109137 A1 WO 9109137A1
Authority
WO
WIPO (PCT)
Prior art keywords
tsh
receptor
antibody
thyrotropin receptor
binding
Prior art date
Application number
PCT/US1990/007387
Other languages
English (en)
Inventor
Basil Rapoport
Original Assignee
Basil Rapoport
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basil Rapoport filed Critical Basil Rapoport
Priority to JP3504332A priority Critical patent/JPH05504683A/ja
Publication of WO1991009137A1 publication Critical patent/WO1991009137A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/10—Drugs for disorders of the endocrine system of the posterior pituitary hormones, e.g. oxytocin, ADH
    • A61P5/12—Drugs for disorders of the endocrine system of the posterior pituitary hormones, e.g. oxytocin, ADH for decreasing, blocking or antagonising the activity of the posterior pituitary hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2869—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against hormone receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G01N33/76—Human chorionic gonadotropin including luteinising hormone, follicle stimulating hormone, thyroid stimulating hormone or their receptors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Definitions

  • the present invention relates to the field of molecular biology and immunology. More particularly, the invention relates to the production of recombinant thyrotropin receptor in non-thyroidal eukaryotic cells. The invention is further related to methods of using recombinant thyrotropin receptor, and, in particular, to methods of using recombinant thyrotropin receptor in diagnosis and differentiation between autoimmune and non-autoimmune causes of thyrotoxicosis. The invention is also related to the treatment of immune disorders such as Graves' Disease.
  • thyrotoxicosis The most important of the diseases that cause thyrotoxicosis is Graves' disease, also known as Parry's or Basedow's disease. However, not all hyperthyroidism is a result of Graves' disease. Additionally, not all thyrotoxicosis is due to hyperthyroidism. Thyrotoxicosis is the clinical, biochemical and physiological result of sustained delivery of excessive quantities of thyroid hormones to the peripheral tissues. Hyperthyroidism is used to denote the situation where this excess of hormone is the result of sustained thyroid hyperfunction.
  • thyrotoxicosis There are a number of causes for thyrotoxicosis, the major ones include: Graves' disease, toxic adenoma, toxic multinodular goiter, thyrotoxicosis factitia, ectopic thyroid, and thyroiditi ⁇ . A portion of these are hyperthyroid in nature whereas the remaining portion is nonhyperthyroid. Graves' disease is by far the most common cause of thyrotoxicosis, as well as the only autoimmune cause. It is therefore of extreme importance that an accurate assay be available to allow the differentiation between the autoimmune and non-autoimmune varieties; since the treatments, and pathogenesis differ so drastically. Bardin, C.W., Current Therapy in Endocrinology and Metabolism-3, B.C. Decker Inc. Toronto (1988).
  • Graves' disease is a relatively common disorder that occurs at any age, but most often in the third and fourth decades. The disease is more frequent in women and the ratio of predominance in women may be as high as 7:1.
  • the manifestations of Graves' disease include one or more of the following: hyperthyroidism with diffuse goiter; ophthalmopathy; and dermopathy.
  • Thyrotropin also known as thyroid stimulating hormone (TSH) , is the primary hormone that regulates thyroid cell differentiated function and proliferation
  • Thyroid stimulating auto-antibodies the cause of thyrotoxicosis in Graves' disease, mimic the actions of TSH by their interaction with the TSH receptor (Rees Smith, B., et al.. Endocr. Rev. £:106-121 (1988)).
  • anti-TSH receptor auto-antibody binds to the TSH receptor on the thyroid cell surface. Such binding causes unregulated stimulation of the thyroid cell which then produces excessive amounts of thyroid hormone.
  • TSH receptor Because of its pivotal role in the pathophysiology of the thyroid cell, the molecular cloning and expression of the TSH receptor has been a long-standing, but elusive, goal for many laboratories. There has been no molecular characterization of the TSH receptor. Previous studies have not even agreed as to the size of the TSH receptor. Conventional approaches for the molecular cloning of the TSH receptor have been thwarted by the inability to purify this molecule, primarily because of its extraordinary low abundance on thyroid cells. Attempts to use polyclonal or monoclonal antibodies against the TSH receptor (Yoshida, T. , et al.. Clin. Res. 36:610A (Abstract) (1988); Chan, J.Y.C., et al.. J. Biol. Chem. 264:3651-3654 (1989); H. Hirayu and B.
  • LH ⁇ CG receptor McFarland, K.C., et al.. Science 45:494-499 (1989); Loosfelt, H. , et al..
  • Graves' disease There are several current treatments with many drawbacks. In one treatment for Graves' disease, drugs are administered that block thyroid hormone synthesis. These drugs are administered for many months or years, while waiting for a spontaneous remission of the thyroid overactivity. Another radical treatment requires ablation of part or all of the thyroid by surgery or radioactive iodine. This commonly leads to hypothyroidism and the need for life-long administration of thyroid hormone.
  • TSH receptor In order to obtain full-length TSH receptor free of other potential thyroid antigens for studying the pathogenesis of Graves' disease, the present inventors therefore attempted, and herein report, the expression of recombinant human TSH receptor in non-thyroidal eukaryotic cells. Like native human TSH receptor, this recombinant TSH receptor is functionally active and is not a fusion protein. It is an object of the present invention, then, to provide for a convenient and economical source of recombinant TSH receptor. The present invention thus provides a number of important advances in the characterization of the TSH receptor. Recombinant, functionally active TSH receptor has been generated in non-thyroidal eukaryotic cells.
  • the TSH receptor belongs to a family of G protein-coupled receptors, including the receptors for LH ⁇ CG, substance K, rhodopsin, serotonin, as well as the ⁇ l-, ⁇ 2-, ⁇ l- and J2-adrenergic and muscarinic cholinergic receptors (McFarland, .C., et al. f Science 245:494- 499 (1989); Loosfelt, H. , et al.. Science 245:525-528 (1989) ) .
  • G protein-coupled receptors including the receptors for LH ⁇ CG, substance K, rhodopsin, serotonin, as well as the ⁇ l-, ⁇ 2-, ⁇ l- and J2-adrenergic and muscarinic cholinergic receptors (McFarland, .C., et al. f Science 245:494- 499 (1989); Loosfelt, H.
  • the extracellular domain of the TSH receptor is much larger and more complex. This finding is consistent with the complexity of the glycoprotein hormones, which are approximately 30 kD in size, and suggests that the extracellular domain plays an important role in hormone binding and signal transduction. Of interest is a 50 amino acid insertion upstream of the transmembrane domain that is unique to the TSH receptor, and which is therefore a potential TSH binding domain.
  • the molecular cloning of the TSH receptor now opens the way for future studies to answer many questions that have remained unanswered for a number of years.
  • These questions include a) the site(s) of binding (epitopes) of stimulatory and inhibitory anti- TSH receptor antibodies present in the sera of patients with autoimmune thyroid disease, and the relationship between these binding sites and that for TSH; b) determination of the mechanism of signal transduction by which TSH increases adenylate cyclase activity in thyroid cells; and c) the mechanism by which continued TSH stimulation leads to a decrease in TSH receptor-coupling with G B and reduced adenylate cyclase activation (homologous desensitization) .
  • TSH receptor The production of recombinant TSH receptor also makes possible new treatments for thyrotoxicosis which would not have the drawbacks of current therapies.
  • thyrotropin receptor which is produced by non-thyroidal eukaryotic cells.
  • Yet another embodiment of the invention comprises the plasmid pSV2-NEO-ECE-hTSHR.
  • a non- thyroidal eukaryotic cell transformed with this plasmid, as well as methods of producing thyrotropin receptor, comprising culturing the transformed cell under conditions allowing expression of thyrotropin receptor, and recovering said thyrotropin receptor.
  • the present invention provides for an antibody against the thyrotropin receptor of the invention.
  • a method of detecting thyrotropin receptor in a sample comprising contacting said sample with an antibody crossreactive with the thytropin receptor, wherein said antibody is detectably labeled, so as to form a complex between the thyrotropin receptor in said sample and said detectably labeled antibody, and detecting the complexed or uncomplexed detectably labeled antibody.
  • a kit for the detection of thyrotropin receptor in a sample comprising container means comprising one or more containers, wherein one of said containers comprises detectably labeled antibody against thyrotropin receptor.
  • a method of detecting antibodies to thyrotropin receptor in a sample comprising contacting said sample with the recombinant thyrotropin receptor, wherein said thyrotropin receptor is detectably labeled, so as to form a complex between the TSH receptor antibodies in said sample and said detectably labeled recombinant TSH receptor, and detecting the complexed antibody.
  • a kit for the detection of antibodies to thyrotropin receptor in a sample comprising container means comprising one or more con ⁇ tainers, wherein one of said containers comprises detectably labeled recombinant TSH receptor.
  • An additional embodiment of the current invention comprises a method for differentiating between autoimmune and non-autoimmune varieties of thyrotoxicosis comprising an assay specific for either thyrotropin receptor, anti-thyrotropin receptor autoantibodies or functional or chemical derivatives thereof.
  • Another embodiment of the current invention comprises a method of treating thyrotoxicosis with pharmacologically effective amounts of recombinant thyrotropin receptor, or a functional or chemical derivative thereof.
  • a thymus-derived lymphocyte which is specific for the autoimmune T-cell receptor (TCR) for TSH receptor.
  • Another embodiment of the invention provides for a pharmaceutical preparation comprising a T cell which is specific for the autoimmune TCR for TSH receptor.
  • a method of treating autoimmune thyrotoxicosis comprising the use of a pharmaceutical preparation comprising a T cell which is specific for the autoimmune TCR for TSH receptor.
  • Another embodiment provides a peptide which is specific for the autoimmune TCR for TSH receptor.
  • Another embodiment of the invention provides for a pharmaceutical preparation comprising a peptide which is specific for the autoimmune TCR for TSH receptor.
  • a method of treating autoimmune thyrotoxicosis comprising the use of a pharmaceutical preparation comprising a peptide which is specific for the autoimmune TCR for TSH receptor.
  • suppressor T cells specific for anti-thyrotropin receptor auto-antibodies is provided.
  • Another embodiment provides a pharmaceutical preparation comprising suppressor T cells specific for anti-thyrotropin receptor auto- antibodies.
  • Yet another embodiment provides a method of treating thyrotoxicosis with a pharmaceutical preparation comprising T cells specific for anti- thyrotropin receptor auto-antibodies.
  • Figure 1 Nucleotide and derived amino acid sequence of the cDNA for clone 4, the human TSH receptor. Amino acids are annotated by the single letter amino acid code. Potential glycosylation sites are underlined.
  • Figure 2 Hydropathy plot (17) of the translated region of the TSH receptor. A putative signal peptide is present at the amino terminus. Seven potential transmembrane domains are marked by the horizontal bars.
  • Figure 3 Comparison of the amino acid sequences of the human TSH receptor and the pig LH ⁇ CG receptor. - aligned identical residues; upper case - aligned non-identical residues; lower case - unaligned residues; .... - gaps.
  • FIG. 4 Functional activity of the human TSH receptor stably transfected into Chinese hamster ovary (CHO) cells. Cells were exposed for 1 hour to the indicated hormones prior to the measurement of intracellular cAMP levels. 10 mU/ml TSH is equivalent to 10 ⁇ 8 M. Brackets indicate the range of determi ⁇ nations in duplicate dishes of cells. The horizontal line indicates the lack of effect of 10 mU/ml TSH on untransfected, wild-type (CHO-K1) cell cAMP levels, and a similar lack of effect of 10 "7 M hCG, (1-24)ACTH and insulin on cAMP levels on cells transfected with pSV2-NEO-ECE-hTSHR.
  • FIG. 5 Schematic representation of the extracellular domains of the mutant human TSH recep- tors.
  • the solid bars represent segments in the TSH receptor that are not present in the LH receptor. Lines interrupting the open bars represent deletions in the TSH receptor. The hatched bar indicates substitution rather than deletion of 8 amino acids in the TSH receptor. The amino acids are shown in the single letter code. Numbers indicate amino acid positions in the wild-type human TSH receptor, as previously reported (Nagayama et al.. Biochem. Bio ⁇ phvs. Res. Comm. 165:1184 (1989)).
  • Figure 6 Measurement of the intracellular cAMP response to TSI stimulation in pooled clones of stably-transfected CHO cells.
  • WT-hTSHR -wild type human TSH receptor The structures of hTSHR-Dl-3 and hTSHR-Sl are shown in Figure 1. Each bar (with the exception of hTSHR-Sl which was tested once in dupli ⁇ cate) represents the mean + S.E. of values obtained in duplicate dishes in 3 separate experiments using IgG prepared (Kasagi et al.. J. Clin. Endocrinol. Metab. J52 . :855 (1986)) from pools of 4 individual TSI-positive sera or TSI-negative sera. TSI stimulation was for 2 hr at 37°C. Intracellular cAMP levels were measured as previously described (Hirayu et al.. Molec. Cell. Endocrinol. 42:21 (1985)).
  • FIG. 7 Sites of potential glycosylation in the human TSH receptor. All sites are in the extracellular domain of the receptor. Numbers indicate amino acid positions in the wild-type human TSH receptor, as previously reported (Nagayama et al.. Biochem. Biophvs. Res. Comm. 165:1184-1190 (1989)).
  • IB Mutant TSH receptor cDNA plasmid constructs used in these experiments.
  • FIG. 8 Specific TSH binding to recombinant wild-type and mutant TSH receptor forms stably expressed in Chinese hamster ovary (CHO) cells. The binding of 1 5 I-TSH was measured in the presence of increasing concentrations of bTSH, as described in Methods. Non-specific TSH binding was determined in the presence of 10 ⁇ 6 M unlabeled TSH, and was subtracted from each point to give the indicated values ( ⁇ 10% of total binding) . Each point represents the mean of two duplicate determinations; the data shown are representative of three to five separate experiments.
  • FIG. 9 Cyclic AMP response to TSH stimulation in CHO cells expressing the wild-type and mutated TSH receptors. Incubations and cAMP assay were performed as described in Methods. Data are expressed as the percentage of values obtained in cells incubated under identical conditions in the absence of TSH and are representative of three separate experiments; each point represents the mean of duplicate values deter ⁇ mined in duplicate dishes of cells.
  • FIG. 10 Schematic representation of chimeric TSH-LH/CG receptor extracellular domains.
  • the 418 amino acid extracellular region of the human TSH receptor (764 amino acids) was divided into 5 arbitrary domains (A-E) on the basis of the indicated restriction sites.
  • A-E arbitrary domains
  • Chimeric receptors are designated as TSH-LHR-1 through TSH-LHR- 10.
  • the numbers assigned to the amino acids are those published for the human TSH receptor (Nagayama, Y. , et al. , Biochem. Biophvs. Res. Comm. 165:1184-1190 0 (1989)) and for the rat LH/CG receptor (McFarland,
  • FIG. 11 Desensitization of the cAMP response to TSH stimulation occurs in human thyroid cells, but not in Chinese hamster ovary (CHO) cells expressing
  • Each bar represents the mean + the range of duplicate values obtained in duplicate dishes.
  • the data are representative of 3 experiments with the CHO-TSHR cells, and more than 100 experiments with the human thyroid cells.
  • Con control incubations without TSH.
  • Figure 12 Time course of specific 125 I-TSH binding to CHO-TSHR cells expressing recombinant human TSH receptor.
  • cells were plated in 24 well Costar plates, and allowed to grow to total confluence.
  • 125 I-TSH binding was performed in 0.5 ml of modified Hank's buffer
  • CHO-TSHR recombinant human TSH receptors
  • CHO-TSHR and wild-type CHO cells in 24 well Costar plates were grown to total confluence.
  • 125 I-TCH binding was performed for 2 h at 37°C in 0.5 ml of modified Hank's buffer (Tramontano,
  • FIG. 14 Scatchard analysis of specific TSH binding to CHO-TSHR cells. Calculations were performed on the data shown in Fig. 3, and are representative of 3 separate experiments.
  • FIG. 15 The recombinant human TSH receptor in CHO-TSHR cells does not "down-regulate" following prolonged exposure to high concentrations of TSH or dBcAMP.
  • Cells were preincubated for the indicated periods of time in medium containing 10 mU/ml TSH or lmM dBcAMP.
  • Methods In order to remove non-labeled TSH prior to 125 I-TSH binding, the cells were rinsed three times (Methods) . Data are expressed as the % of 125 I-TSH specifically bound. Absolute specific binding in the experiment shown was 9%. Each point represents the mean + range of duplicate determinations. Similar data were obtained in two other experiments, one performed at the same TSH concentration (10 mU/ml) , and the other at the extremely high level of 1000 mU/ml (10 "6 M) .
  • FIG. 16A Mutations in the first cytoplasmic loop of the human TSH receptor.
  • amino acid substitutions in the sequence of the wild-type TSH receptor (WT-TSH-R) are boxed. Amino acids are shown in the single letter code. The amino acid numbers shown correspond to those previously reported for the human TSH receptor (Nagayama, Y. et al.. Biochem. Biophys. Res. Comm. 165:1184-1190 (1989)). All the oligonucleotides shown below are in the reverse-complemented orientation, as required for mutagenesis. The sequence of the oligonucleotide used for this mutation was 5'
  • FIG. 16B TSH binding to CHO cells expressing the wild-type human TSH receptor and TSH receptor mutant MUT1-TSH-R.
  • competition for 125 I-TSH binding was performed with the indicated concentrations of unlabeled hormone as described in Methods. Non-specific binding in the presence of 10 ⁇ 6 M TSH (5% of total counts bound in the representative experiment shown) was subtracted from total counts bound to yield specific TSH binding.
  • maximum specific binding of 125 I-TSH in the absence of unlabeled hormone is designated as 100%.
  • Each point represents the mean of two closely agreeing duplicate determinations.
  • the experiments shown are representative of 2 or more different experiments, each made with pooled clones from separate stable transfections. The d values for this and other mutants are listed in Table I.
  • FIG. 16C Cyclic AMP response to TSH stimulation in CHO cells expressing the wild' type human TSH receptor (WT-TSH-R) or the TSH receptor mutated in the first cytoplasmic loop (MUT1-TSH-R) .
  • WT-TSH-R wild' type human TSH receptor
  • MUT1-TSH-R TSH receptor mutated in the first cytoplasmic loop
  • FIG. 17A Mutations in the second cytoplasmic loop of the human TSH receptor. Substitutions in the sequence of the wild-type TSH receptor (WT-TSH-R) are boxed. Amino acids are shown in the single letter code. The sequences of the oligonucleotides used in these mutations were 5'-GATGGCACATGCGCCCTGGAGGCCGATC- TGCTGGCCCAGTTGCATGGCGAAGGT (MUT2-TSH-R) and 5'- GGCGAAGGCGATGGCAGCCCAGCCCTGCAGGGTGAT (MUT3-TSH-R) .
  • FIG. 17B TSH binding to CHC cells expressing the wild-type human TSH receptor (WT-TSH-R) , TSH receptor mutants MUT2-TSH-R and MUT3-TSH-R, and cells transfected with vector not containing the TSH receptor cDNA (pSV2-neo) .
  • WT-TSH-R wild-type human TSH receptor
  • pSV2-neo vector not containing the TSH receptor cDNA
  • FIG 17C Cyclic AMP response to TSH stimulation in CHO cells expressing the wild-type human TSH receptor (WT-TSH-R) or the TSH receptor mutated in the second cytoplasmic loop. For details see the legend to Figure 1C.
  • FIG. 18A Mutations in the third cytoplasmic loop of the human TSH receptor. Substitutions in the sequence of the wild-type TSH receptor (WT-TSH-R) are boxed. Amino acids are shown in the single letter code. The sequences of the oligonucleotides used in these mutations were 5'AGCCATCCCCTGGGCAATTCCGGCATTT- TGGTTCCCTGGGTT (MUT4-TSH-R) and 5'- CCTGGGTTGGCCTGGGGATTTCCGACTGCGATGGGGATCCCCACATGACA (MUT5-TSH-R) .
  • FIG. 18B TSN binding to CHO cells expressing the wild-type human TSH receptor (WT-TSH-R) , TSH receptor mutants MUT4-TSH-R and MUT5-TSH-R, and cells transfected with vector not containing the TSH receptor cDNA (pSV2-neo) .
  • WT-TSH-R wild-type human TSH receptor
  • pSV2-neo vector not containing the TSH receptor cDNA
  • FIG 18C Cyclic AMP response to TSH stimulation in CHO cells expressing the wild-type human TSH receptor (WT-TSH-R) or the TSH receptor mutated in the third cytoplasmic loop. For details see the legend to Figure 1C.
  • FIG. 19A Mutations in the cytoplasmic tail of the human TSH receptor. Substitutions in the sequence of the wild-type TSH receptor (WT-TSH-R) are boxed.
  • Amino acids are shown in the single letter code.
  • the sequences of the oligonucleotides used in these mutations were 5'-ATCCCTCTAGAAGGCCTAGGTGAAAA (MUT6-
  • Figure 19B TSH binding to CHO cells expressing the wild-type human TSH receptor and TSH receptor mutants MUT6-TSH-R, MUT7-TSH-R and MUT8-TSH-R and cells not expressing the TSH receptor (pSV2-neo) .
  • TSH receptor pSV2-neo
  • FIG 19C Cyclic AMP response to TSH stimulation in CHO cells expressing the wild-type human TSH receptor (WT-TSH-R) or the TSH receptor mutated in the cytoplasmic tail (see above) .
  • WT-TSH-R wild-type human TSH receptor
  • TSH receptor mutated in the cytoplasmic tail see above.
  • FIG. 20 Parallel inhibition by TSH and thyroid stimulating IgG of 125 I-TSH binding to recombinant human TSH receptors stably expressed on the surface of Chinese hamster ovary (CHO) cells.
  • FIG. 21 Comparison of different TSH receptors in assays to detect anti-TSH receptor antibodies.
  • Highly-purified IgG DEAE-Sephadex ion exchange
  • TSH binding inhibitory (TBI) activity in IgG prepared from the sera of patients with thyroid dysfunction and from normal individuals.
  • Each point represents the mean of determinations in duplicate dishes of CHO-TSH-R cells.
  • the horizontal dashed line represents the limit of inhibition of 125 I- TSH binding by any serum in the normal group (92% of maximum binding) .
  • the horizontal solid lines indicate the mean value for each group of patients.
  • FIG. 23 Relationship between the TSH binding inhibition (TBI) index and thyroid stimulating immunoglobulin (TSI) bioactivity in the same IgG sample.
  • TBI TSH binding inhibition
  • TSI thyroid stimulating immunoglobulin
  • FIG. 24 Structures of chimeric TSH-LH/CG receptor extracellular regions and summary of the data obtained.
  • the extracellular region of the human TSH receptor was divided into 5 arbitrary domains (A to E) as previously described (Example V) .
  • the open bars denote the human TSH receptor sequence and the black bars denote the rat LH/CG receptor sequence.
  • Domain D in the LH/CG receptor is 50 amino acids smaller than its TSH receptor corresponding region (McFarland, K.C., et al.. Science 245:494-499 (1989); Nagayama, Y., et al.. Biochem. Biophvs. Res. Comm. 165:1184-1190 (1989)) as shown by the thin horizontal line.
  • Chimeric receptors are designated as TSH-LHR-12 through 16. Chimera TSH-LHR-11 was reported in the previous study (Example V) but is included here as a necessary control. Amino acid numbering is that used previously (Example V) . The pluses represent an apprpoximation of the relative activities of the different chimeric receptors.
  • FIG. 25A Competition-inhibition by bTSH of [ 125 I]TSH binding to CHO cells expressing the wild-type human TSH receptor and chimeric TSH-LH/CG receptors.
  • the binding of [ 125 I]TSH was measured in the presence of increasing concentrations of bovine TSH (bTSH) , as described in Methods.
  • Non-specific TSH binding was determined in the presence of 10 ⁇ 6 M unlabeled bTSH, and subtracted from each point to give the indicated value.
  • FIG. 25B cAMP response to recombinant TSH (hTSH) stimulation in CHO cells expressing the wild- type human TSH receptor and chimeric TSH-LH/CG receptors. Incubation and cAMP assay was performed as described in Methods. Data are expressed as the percentage of values obtained in cells incubated under identical conditions in the absence of hTSH. The data represent one of two different experiments with pools of clones from two separate transfections; each point represents the mean of duplicate values determined in duplicate dishes of cells.
  • Ficrure 26A Competition-inhibition of hCG of
  • Figure 26B cAMP response to hCG stimulation in CHO cells expressing chimeric TSH-LH/CG receptors.
  • FIG. 27 Thyroid stimulating immunoglobulin (TSI) activity using selected TSH receptor/LH receptor chimeras. Basal activity is 100%. Stimulation is >100%. Purified IgG from 11 different Graves' disease sera were tested, as well as 4 Hashimoto's thyroiditis sera not containing TSI activity. The chimeras used have been described in Examples IX and VIII, and contain the indicated domains of the TSH receptor e.g. chimera TSH-LHR-6 contains TSH receptor domains A, B and C. WT TSH receptor represents the wild type (non- mutated) TSH receptor. ND indicates Not Done.
  • TSH receptor Thyroid stimulating immunoglobulin
  • FIG. 28 TSH Binding Inhibitory Immunoglobulin (TBII) activity using selected TSH receptor. LH receptor chimeras. TBII activity >15% is considered to be significant. See legend to Fig. 27 for details of chimeras and sera. Data for chimera TSH-LHR-10 are not shown because there was no activity, i.e. there was no inhibition of TSH binding by these IgG to this chimera.
  • cloning is meant the use of in vitro recombination techniques to insert a particular gene or other DNA sequence into a vector molecule.
  • in vitro recombination techniques to insert a particular gene or other DNA sequence into a vector molecule.
  • it is necessary to employ methods for generating DNA fragments, for joining the fragments to vector molecules, for introducing the composite DNA molecule into a host cell in which it can replicate, and for selecting the clone having the target gene from amongst the recipient host cells.
  • cDNA is meant complementary or copy DNA produced from an RNA template by the action of RNA-dependent DNA polymerase (reverse transcriptase) .
  • a "cDNA clone” means a duplex DNA sequence complementary to an RNA molecule of interest, carried in a cloning vector.
  • cDNA library is meant a collection of recombinant DNA molecules containing cDNA inserts which together comprise the entire genome of an organism. Such a cDNA library may be prepared by methods known to those of skill, and described, for example, in Maniatis et al. , Molecular Cloning: A Laboratory Manual. supra.
  • RNA is first isolated from the cells of an organism from whose genome it is desired to clone a particular gene.
  • Preferred for the purposes of the present invention are mammalian, and particularly human, thyroidal cell lines.
  • a presently preferred vector for this purpose is the ⁇ -ZAP II vector.
  • vector is meant a DNA molecule, derived from a plasmid or bacteriophage, into which fragments of
  • DNA may be inserted or cloned.
  • a vector will contain one or more unique restriction sites, and may be capable of autonomous replication in a defined host or vehicle organism such that the cloned sequence is reproducible.
  • DNA expression vector is meant any autonomous element capable of replicating in a host independently of the host's chromosome, after additional sequences of DNA have been incorporated into the autonomous element's genome.
  • DNA ex-pression vectors include bacterial plasmids and phages.
  • substantially pure is meant any antigen of the present invention, or any gene encoding any such antigen, which is essentially free of other antigens or genes, respectively, or of other contaminants with which it might normally be found in nature, and as such exists in a form not found in nature.
  • functional derivative is meant the “fragments,” “variants,” “analogues,” or “chemical derivatives” of a molecule.
  • a “fragment” of a molecule, such as any of the cDNA sequences of the present invention is meant to refer to any nucleotide subset of the molecule.
  • a “variant” of such molecule is meant to refer to a naturally occurring molecule substantially similar to either the entire molecule, or a fragment thereof.
  • an “analog” of a molecule is meant to refer to a non-natural molecule substantially similar to either the entire molecule or a fragment thereof.
  • a molecule is said to be “substantially similar” to another molecule if the sequence of amino acids in both molecules is substantially the same. Substantially similar amino acid molecules will possess a similar biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if one of the molecules contains additional amino acid residues not found in the other, or if the sequence of amino acid residues is not identical.
  • a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule.
  • Such moieties may improve the molecule's solubility, absorption, biological half life, etc.
  • the moieties may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, etc.
  • Moieties capable of mediating such effects are disclosed, for example, in Remington's Pharmaceutical Sciences. 16th ed. , Mack Publishing Co., Easton, Penn.
  • a “functional derivative” of a gene of the TSH receptor antigen of the present invention is meant to include “fragments,” “variants,” or “analogues” of the gene, which may be “substantially similar” in nucleotide sequence, and which encode a molecule possessing similar activity.
  • Preferred functional derivatives include: recombinant active thyrotropin receptor wherein a 50 amino acid region comprising residues 317-366 has been deleted; a recombinant active thyrotropin receptor peptide comprised of the 8 amino acid region comprising residues 38-45; and a recombinant thyrotropin receptor peptide comprised of the mid-region domain C comprising amino acid residues 171-260.
  • thyrotropin receptor (TSH) protein is also meant to include any functional derivative, fragment, variant, analogue, or chemical derivative thereof.
  • a DNA sequence encoding the thyrotropin receptor of the present invention, or its functional derivatives, may be recombined with vector DNA in accordance with conventional techniques, including blunt-ended or staggered-ended termini for ligation, restriction enzyme digestion to provide appropriate termini, filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases. Techniques for such manipulations are disclosed by Maniatis, T. , et al.. supra_ and are well known in the art.
  • a nucleic acid molecule such as DNA, is said to be "capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “operably linked” to nucleotide sequences which encode the polypeptide.
  • An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene expression.
  • regulatory regions needed for gene expression may vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal the initiation of protein synthesis.
  • promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal the initiation of protein synthesis.
  • Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • the non-coding region 3' to the gene sequence coding for the protein may be obtained by the above-described methods.
  • This region may be retained for its transcriptional termination regulatory sequences, such as termination and * polyadenylation.
  • the transcriptional termination signals may be provided. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3' region functional in the host cell may be substituted.
  • Two DNA sequences (such as a promoter region sequence and a thyrotropin receptor encoding sequence) are said to be operably linked if the nature of the linkage between the two DNA sequences does not
  • the present invention encompasses the expression of the thyrotropin receptor protein (or a functional derivative thereof) in either prokaryotic or eukaryotic cells, although eukaryotic (and, particularly, non-thyroidal eukaryotic) expression is preferred.
  • Preferred prokaryotic hosts include bacteria such as E. coli. Bacillus. Streptomyces. Pseudomonas. Salmonella. Serratia, etc.
  • the most preferred prokaryotic host is E. coli.
  • Other enterobacteria such as Salmonella typhimurium or Serratia marcescens, and various Pseudomonas species may also be utilized. Under such conditions, the protein may not be glycosylated.
  • the procaryotic host must be compatible with the replicon and control sequences in the expres- sion plasmid.
  • thyrotropin receptor protein or a functional derivative thereof in a prokaryotic cell (such as, for example, E. coli. B. subtilis. Pseudomonas. Streptomvces. etc.)
  • a prokaryotic promoter such as, for example, E. coli. B. subtilis. Pseudomonas. Streptomvces. etc.
  • Such promoters may be either constitutive or, more preferably, regulatable (i.e., inducible or derepressible) .
  • constitutive promoters include the int promoter of bacteriophage ⁇ , the bla promoter of the
  • inducible prokaryotic promoters include the major right and left promoters of bacteriophage ⁇ (P L and P R ) , the trp. recA, lacZ. lad. and gal promoters of E. coli. the ⁇ -amylase (Ulmanen,
  • ribosome binding sites are disclosed, for example, by Gold, L. , et al. (Ann. Rev. Microbiol. 35:365-404 (1981)).
  • Most preferred hosts are eukaryotic hosts including yeast, insects, fungi, and mammalian cells either in vivo, or in tissue culture. Mammalian cells provide post-translational modifications to protein molecules including correct folding or glycosylation at correct sites. Mammalian cells which may be useful as hosts include cells of fibroblast origin such as
  • VERO or CHO-Kl or cells of lymphoid origin, such as the hybridoma SP2/0-AG14 or the myeloma P3x63Sg8, and their derivatives.
  • CHO-Kl cells are presently preferred mammalian host cells.
  • COS cells also are convenient eukaryotic hosts for thyrotropin receptor expression, as well as for study of the regulation of thyrotropin receptor expression.
  • transcrip ⁇ tional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus. Simian virus, or the like, where the regulatory signals are associated with a particular gene which has a high level of expression.
  • viral sources such as adenovirus, bovine papilloma virus.
  • Simian virus, or the like where the regulatory signals are associated with a particular gene which has a high level of expression.
  • promoters from mammalian expression products such as actin, collagen, myosin, etc.
  • Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the genes can be modulated.
  • regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical regulation, e.g., metabolite.
  • Yeast provides substantial advantages in that it can also carry out post-translational peptide modifications including glycosylation.
  • Yeast recognizes leader sequences on cloned mammalian gene products and secretes peptides bearing leader sequences (i.e., pre-pep- tides) .
  • leader sequences on cloned mammalian gene products and secretes peptides bearing leader sequences (i.e., pre-pep- tides) .
  • the yeast ubiquitin hydrolase system in vivo synthesis of ubiquitin-TSH receptor fusion proteins may be accomplished.
  • the fusion proteins so produced may be processed in vivo or purified and processed in vitro, allowing synthesis of the TSH receptor protein with a specified amino terminus sequence. Moreover, problems associated with retention of initiation codon-derived methionine residues in direct yeast (or bacterial) expression may be avoided. Sabin et al.. Bio/Technol.
  • Any of a series of yeast gene expression systems incorporating promoter and termination elements from the actively expressed genes coding for glycolytic enzymes produced in large quantities when yeast are grown in mediums rich in glucose can be utilized.
  • Known glycolytic genes can also provide very efficient transcriptional control signals.
  • the promoter and terminator signals of the phosphoglycerate kinase gene can be utilized.
  • TSH receptor or functional derivatives thereof in insects can be achieved, for example, by infecting the insect host with a baculovirus engineered to express TSH receptor by methods known to those of skill.
  • sequences encoding human TSH receptor may be operably linked to the regulatory regions of the viral polyhedron protein (Jasny, Science 238: 1653 (1987)).
  • Infected with the recombinant baculovirus, cultured insect cells, or the live insects themselves, can produce the TSH receptor protein in amounts as great as 20 to 50% of total protein production.
  • caterpillars are presently preferred hosts for large scale TSH receptor production according to the invention.
  • eukaryotic regulatory regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis.
  • Preferred eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer, D. , et al.. J. Mol. Appl. Gen. 3.:273-288 (1982)); the TK promoter of
  • Herpes virus McKnight, S., Cell 31:355-365 (1982)
  • the SV40 early promoter (Benoist, C. , et al.. Nature
  • yeast gal4 gene promoter Johnston, S.A. , et al.. Proc. Natl. Acad. Sci. (USA) 79:6971-6975 (1982); Silver, P.A., et al..
  • the TSH receptor encoding sequence and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a non-replicating DNA (or RNA) molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule. Since such molecules are incapable of autonomous replication, the expression of the TSH receptor protein may occur through the transient expression of the introduced se ⁇ quence. Alternatively, permanent expression may occur through the integration of the introduced sequence into the host chromosome. In one embodiment, a vector is employed which is capable of integrating the desired gene sequences into the host cell chromosome.
  • Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector.
  • the marker may provide for prototrophy to an auxotropic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper or the like.
  • the selectable marker gene can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co- transfection. Additional elements may also be needed for optimal synthesis of single chain binding protein mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and ter ⁇ mination signals. cDNA expression vectors incorporat ⁇ ing such elements include those described by Okayama, H., Mol. Cel. Biol. 3:280 (1983).
  • the introduced sequence will be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host.
  • a plasmid or viral vector capable of autonomous replication in the recipient host.
  • Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.
  • Preferred prokaryotic vectors include plasmids such as those capable of replication in E.
  • coli such as, for example, pBR322, ColEl, pSClOl, pACYC 184, rrVX.
  • plasmids are, for example, disclosed by Maniatis, T. , et al. (In: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (1982)).
  • Bacillus plasmids include pC194, pC221, pT127, etc. Such plasmids are disclosed by Gryczan, T. (In: The Molecular Biology of the Bacilli. Academic Press, NY (1982), pp. 307-329).
  • Suitable Streptomvces plasmids include pIJlOl (Kendall, K.J., et al. F J. Bacteriol. 169:4177-4183 (1987)) , and strepto yces bacteriophages such as ⁇ C31 (Chater, K.F., et al. , In: Sixth International Symposium on Actinomvcetales Biology. Akademiai Kaido, Budapest, Hungary (1986) , pp. 45-54) . Pseudomonas plasmids are reviewed by John, J.F., et al. (Rev. Infect. Pis. 8.:693-704 (1986)), and Izaki, K. (Jpn. J. Bacteriol. 33:729-742 (1978)).
  • Preferred eukaryotic plasmids include BPV, vaccinia, SV40, 2-micron circle, etc., or their derivatives.
  • Such plasmids are well known in the art (Botstein, D. , et al.. Miami Wntr. Sy p. 19:265-274 (1982); Broach, J.R. , In: The Molecular Biology of the Yeast Saccharomvces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 445-470 (1981); Broach, J.R. , Cell 28:203-204 (1982); Bollon, D.P., et al.. J. Clin. Hematol. Oncol. 3.0:39-48 (1980); Maniatis, T. , In: Cell Biology: A Comprehensive Treatise, Vol. 3. Gene Expression. Academic Press, NY, pp. 563-608 (1980)).
  • the vector or DNA construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means, including such biochemical means as transformation, transfection, conjugation, protoplast fusion, calcium phosphate-precipitation, and application with polycations such as diethylaminoethyl (DEAE) dextran, and such mechanical means as electro- poration, direct icroinjection, and microprojectile (biolistic) bombardment (Johnston et al. , Science 240(4858) : 1538 (1988)), etc.
  • biochemical means as transformation, transfection, conjugation, protoplast fusion, calcium phosphate-precipitation, and application with polycations such as diethylaminoethyl (DEAE) dextran
  • mechanical means as electro- poration, direct icroinjection, and microprojectile (biolistic) bombardment (Johnston et al. , Science 240(4858) : 1538 (1988)), etc.
  • recipient cells After the introduction of the vector, recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells.
  • Expression of the cloned gene sequence(s) results in the production of the TSH receptor protein, or in the production of a fragment of this protein. This can take place in the transformed cells as such, or following the induction of these cells to differentiate.
  • the expressed protein may be isolated and purified in accordance with conventional conditions, such as extraction, precipitation,, chromatography, affinity chromatography, electrophoresis, or the like.
  • the cells may be collected by centrifuga- tion, or with suitable buffers, lysed, and the protein isolated by column chromatography, for example, on DEAE-cellulose, phosphocellulose, polyribocytidylic acid-agarose, hydroxyapatite or by electrophoresis or immunoprecipitation.
  • the TSH receptor or functional derivative thereof may be isolated by the use of anti-TSH receptor antibodies. Such antibodies may be obtained by well-known methods, some of which as mentioned hereinafter.
  • Yet another embodiment of the present invention comprises antibodies against the TSH receptor protein or a functional derivative thereof.
  • the term "antibody” (Ab) or "monoclonal antibody” (Mab) as used herein is meant to include intact molecules as well as fragments thereof (such as, for example. Fab and
  • F(ab') 2 fragments which are capable of binding an antigen.
  • Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al.. J. Nucl.
  • Antibodies according to the present invention may be prepared by any of a variety of methods.
  • cells expressing the TSH receptor protein, or a functional derivative thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies that are capable of binding TSH receptor.
  • antibodies according to the present invention are monoclonal antibodies.
  • Such monoclonal antibodies can be prepared using hybridoma technology (Kohler et al.. Nature 256:495 (1975); Kohler et al.. Eur. J. Immunol. 6.:511 (1976); Kohler et al.. Eur. J. Immuno1. .6:292 (1976) ; Ha merling et al.. In: Monoclonal Antibodies and T-Cell Hybridomas.
  • Such procedures involve immunizing an animal with TSH receptor antigen.
  • the splenocytes of such animals are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line may be employed in accordance with the present invention. After fusion, the resulting hybridoma cells are selectively
  • Antibodies according to the present invention also may be polyclonal, or, preferably, region specific polyclonal antibodies. Region specific polyclonal antibodies and methods of using them are described in co-pending U.S. application Serial Number 5 06/731,470, filed 07 May 1985, the specification of which is incorporated herein by reference as though set forth in full.
  • Antibodies against TSH receptor a functional derivative thereof, according to the present invention 0 are well suited for use in standard immunodiagnostic assays known in the art, including such immunometric or "sandwich” assays as the forward sandwich, reverse sandwich, and simultaneous sandwich assays.
  • the antibodies may be used in any number of combinations 5 as may be determined by those of skill without undue experimentation to effect immunoassays of acceptable specificity, sensitivity, and accuracy for the TSH receptor antigen or equivalents thereof.
  • detecting it is intended to include determining the presence or absence of a substance or quantifying the amount of a substance.
  • the term thus refers to the use of the materials, compositions, and methods of the present invention for qualitative and quantitative determinations.
  • an anti-idiotypic antibody is an antibody which recognizes unique determinants present on the antibody produced by the clone of interest.
  • the anti-idiotypic antibody is prepared by immunizing an animal of the same strain used as the source of the monoclonal antibody with the monoclonal antibody of interest. The immunized animal will recognize and respond to the idiotypic determinants of the immunizing antibody by producing antibody to these idiotypic determinants (anti- idiotypic antibody) .
  • the anti-idiotypic antibody of the second animal which is specific for the monoclonal antibodies produced by a single clone, it is then possible to identify other clones used for immuniza ⁇ tion. Idiotypic identity between the product of two clones demonstrates that the two clones are identical with respect to their recognition of the same epitopic determinants.
  • the anti-idiotypic antibody may also be used as an "immunogen" to induce an immune response in yet another animal, producing a so-called anti anti- idiotypic antibody which will be epitopically identical to the original MAb.
  • anti ⁇ bodies to the epitopic determinants of a monoclonal antibody it is possible to identify other clones expressing antibodies of identical epitopic specificity.
  • idiotypic determinants are present in the hypervariable region which binds to a given epitope.
  • monoclonal antibodies generated against the TSH receptor antigen or functional derivative thereof may be used to induce anti- idiotypic Abs in suitable animals, such as BALB/c mice. Spleen cells from these animals are used to produce anti-idiotypic hybridoma cell lines. Monoclonal anti-idiotypic Abs coupled to KLH are used as "immunogen" to immunize BALB/c mice. Sera from these mice will contain anti anti-idiotypic Abs that have the binding properties of the original Ab specific for the shared epitope. The anti-idiotypic MAbs thus have idiotopes structurally similar to the epitope being evaluated. For replication, the hybrid cells may be cultivated both in vitro and in vivo.
  • Antibodies according to the present invention are particularly suited for use in immunoassays wherein they may be utilized in liquid phase or bound to a solid phase carrier.
  • the antibodies in these immunoassays can be detectably labeled in various ways.
  • labels and methods of labeling known in the art.
  • Examples of the types of labels which can be used in the present invention include, but are not limited to, enzymes, radioiso- topes, fluorescent compounds, chemiluminescent compounds, bioluminescent compounds and metal chelates.
  • Those of ordinary skill in the art will know of other suitable labels for binding to antibodies, or will be able to ascertain the same by the use of routine experimentation.
  • the binding of these labels to antibodies can be accomplished using standard techniques commonly known to those of ordinary skill in the art.
  • antibodies according to the present invention can be detectably labeled is by linking the antibody to an enzyme.
  • This enzyme when later exposed to its substrate, will react with the substrate in such a manner as to produce a chemical moiety which can be detected as, for example, by spectrophotometric or fluorometric means.
  • enzymes which can be used to detectably label antibodies include malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, biotin- avidin peroxidase, horseradish peroxidase, alkaline
  • fluorescently labeled antibody is exposed to light of the proper wave length, its presence then can be detected due to the fluorescence of the dye.
  • fluorescent labeling compounds are fluoroscein, isothiocyanate, rhodamine,
  • the antibodies of the invention also can be detectably labeled using fluorescent emitting metals such as 152 Eu, or others of the lanthanide series. 0 These metals can be attached to the antibody molecule using such metal chelating groups as diethyl- enetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA) .
  • DTPA diethyl- enetriaminepentaacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • Antibodies also can be detectably labeled by coupling them to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of the chemical reaction.
  • chemiluminescent labeling compounds examples include luminal, isoluminol, theromatic acridinium ester, imidazole, acridinium salts, oxalate ester , and dioxetane.
  • a bioluminescent compound may be used to label the antibodies according to the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a biolumi ⁇ nescent antibody is determined by detecting the presence of luminescence.
  • Important bioluminescent compounds for purposes of labeling include luciferin, luciferase and aequorin.
  • kits may comprise a carrier means being compartmentalized to receive in close confinement therewith one or more container means such as vials, tubes and the like, each of said container means comprising the separate elements of the assay to be used.
  • assays which can be incorporated in kit form are many, and include, for example, competitive and non-competitive assays.
  • Typical examples of assays which can utilize the antibodies of the invention are radioimmunoassays (RIA) , enzyme im ⁇ munoassays (EIA) , enzyme-linked immunosorbent assays (ELISA) r and immunometric, or sandwich, immunoassays.
  • imunometric assay or "sandwich immunoassay,” it is meant to include simultaneous sandwich, forward sandwich and reverse sandwich immunoassays. These terms are well understood by those skilled in the art.
  • Those of skill will also appreciate that antibodies according to the present invention will be useful in other variations and forms of assays which are presently known or which may be developed in the future. These are intended to be in- eluded within the scope of the present invention.
  • the incubation medium usually added with the labeled soluble antibody
  • the "blockers” are added to assure that non-specific proteins, protease, or human antibodies to mouse immunoglobulins present in the experimental sample do not cross-link or destroy the antibodies on the solid phase support, or the radiolabeled indicator antibody, to yield false positive or false negative results.
  • the selection of "blockers” therefore adds substantially to the specificity of the assays described in the present invention.
  • nonrelevant antibodies of the same class or subclass (isotype) as those used in the assays e.g. IgG lf IgG 2a , IgM, etc.
  • concentration of the "blockers” is important, in order to maintain the proper sensitivity yet inhibit any unwanted interference by mutually occurring cross reactive proteins in human serum.
  • buffer system containing the "blockers" needs to be optimized.
  • Preferred buffers are those based on weak organic acids, such as imidazole, HEPPS, MOPS, TES, ADA, ACES, HEPES, PIPES, TRIS, and the like, at physiological pH ranges. Somewhat less preferred buffers are inorganic buffers such as phosphate, borate or carbonate. Finally, known protease inhibi ⁇ tors should be added (normally at 0.01-10 microgs/ml) to the buffer which contains the "blockers. "
  • solid phase immunoadsorbents which have been employed and which can be used in the present invention.
  • Well known immunoadsorbents include glass, polystyrene, polypropylene, dextran, nylon and other materials, in the form of tubes, beads, and microtiter plates formed from or coated with such materials, and the like.
  • the immobilized antibodies can be either covalently or physically bound to the solid phase immunoadsorbent, by tech ⁇ niques such as covalent bonding via an amide or ester linkage, or by adsorption.
  • tech ⁇ niques such as covalent bonding via an amide or ester linkage
  • Those skilled in the art will know many other suitable solid phase immunoadsorbents and methods for immobilizing antibodies thereon, or will be able to ascertain such, using no more than routine experimentation.
  • labels such as radionuclides may be bound to antibodies according to the present invention either directly or by using an intermediary functional group.
  • An intermediary group which is often used to bind radioisotopes which exist as metallic cations to anti ⁇ bodies is diethylenetriaminepentaacetic acid (DTPA) .
  • DTPA diethylenetriaminepentaacetic acid
  • Typical examples of metallic cations which are bound in this manner are: 99m Tc, 123 I, 11:L IN, 131 I, 97 Ru, 67 Cu, 67 Ga and 68 Ga.
  • the antibodies of the invention can also be labeled with non-radioactive isotopes for purposes of diagnosis. Elements which are particularly useful in this manner are 157 Gd, 55 Mn, 162 Dy, 52 Cr and 56 Fe.
  • the DNA sequences which encode TSH receptor, or a fragment thereof, may be used as DNA probes to isolate the corresponding antigen in humans according to well-known methods.
  • the human antigen genes may then be cloned and expressed in a host to give the human antigen. This human antigen may then be used in diagnostic assays for the corresponding auto-antibody.
  • the antigen of the invention may be isolated in substantially pure form employing antibodies according to the present invention.
  • an embodiment of the present invention provides for substantially pure antigen TSH receptor or functional derivative thereof, said antigen characterized in that it is recognized by and binds to antibodies according to the present invention.
  • the present invention provides a method of isolating or purifying the TSH receptor antigen, by forming a complex of said antigen with one or more antibodies directed against
  • TSH receptor or functional derivative thereof.
  • the substantially pure antigen TSH receptor or functional derivative of the present invention may in turn be used to detect or measure antibody to TSH receptor in a sample, such as serum or urine.
  • a sample such as serum or urine.
  • one embodiment of the present invention comprises a method of detecting the presence or amount of antibody to TSH receptor antigen in a sample, comprising contacting said sample containing said antibody to TSH receptor antigen with detectably labeled TSH receptor, and detecting said label.
  • immunoreactive fractions and immunoreactive analogues of TSH receptor also may be used.
  • immunoreactive fraction is intended any portion of the TSH receptor antigen which demonstrates an equi ⁇ valent immune response to an antibody directed against TSH receptor.
  • immunoreactive analogue is intended a protein which differs from the TSH receptor protein by one or more amino acids, but which demonstrates an equivalent immunoresponse to an antibody of the invention.
  • compositions of the invention may be administered to any animal which may experience the beneficial effects of the compounds of the invention.
  • animals Foremost among such animals are humans, although the invention is not intended to be so limited.
  • compositions of the present invention may be administered by any means that achieve their intended purpose.
  • administration may be by parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes.
  • administration may be by the oral route.
  • the new pharmaceutical preparations may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically.
  • suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically.
  • the preparations particularly those preparations which can be administered orally and which can be used for the preferred type of administration, such as tablets, dragees, and capsules, and also preparations which can be administered rectally, such as suppositories, as well as suitable solutions for administration by injection or orally, contain from about 0.01 to 99 percent, together with the excipient.
  • compositions of the present invention are manufactured in a manner which is itself known, for example, by means of conventional mixing, granulating, dragee-making, dissolving, or lyophilizing processes.
  • pharmaceutical preparations for oral use can be obtained by combining the active compounds with solid excipients, optionally grinding the resulting mixture and processing the mixture of granules, after adding suitable auxiliar ⁇ ies, if desired or necessary, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as saccharides, for example lactose or sucrose, mannitol or sorbitol, cellulose preparations and/or calcium phosphates, for example tricalcium phosphate or calcium hydrogen phosphate, as well as binders such as starch paste, using, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methyl cellulose, hydroxy- propylmethylcellulose, sodium carboxymethylcellulose, and/or polyvinyl pyrrolidone.
  • fillers such as saccharides, for example lactose or sucrose, mannitol or sorbitol, cellulose preparations and/or calcium phosphates, for example tricalcium phosphate or calcium hydrogen phosphate, as well as binders such as starch paste, using, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methyl cellulose,
  • disintegrating agents may be added such as the above- mentioned starches and also carboxymethyl-starch, cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate.
  • Auxiliaries are, above all, flow-regulating agents and lubricants, for example, silica, talc, stearic acid or salts thereof, such as magnesium stearate or calcium stearate, and/or polyethylene glycol.
  • Dragee cores are provided with suitable coatings which, if desired, are resistant to gastric juices.
  • concentrated saccharide solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, polyethylene glycol and/or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • suitable cellulose preparations such as acetyl- cellulose phthalate or hydroxypropymethy1-cellulose phthalate, are used.
  • Dye stuffs or pigments may be added to the tablets or dragee coatings, for example, for identification or in order to characterize combinations of active compound doses.
  • Other pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer such as glycerol or sorbitol.
  • the push- fit capsules can contain the active compounds in the form of granules which may be mixed with fillers such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds are preferably dissolved or suspended in suitable liquids, such as fatty oils, or liquid paraffin.
  • stabilizers may be added.
  • Possible pharmaceutical preparations which can be used rectally include, for example, suppositories, which consist of a combination of one or more of the active compounds with a suppository base.
  • Suitable suppository bases are, for example, natural or synthetic triglycerides, or paraffin hydrocarbons.
  • gelatin rectal capsules which consist of a combination of the active compounds with a base.
  • Possible base materials include, for example, liquid triglycerides, polyethylene glycols, or paraffin hydrocarbons.
  • Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water- soluble salts.
  • suspensions of the active compounds as appropriate oily injection suspensions may be administered.
  • Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran.
  • the suspension may also contain stabilizers.
  • the substantially pure antigen TSH receptor of the present invention may be used in pharmacologically effective amounts in pharmaceutical preparations to treat thyrotoxicosis.
  • anti-TSH receptor auto- antibodies bind to TSH receptor on the thyroid cell surface. Such binding causes unregulated stimulation of the thyroid cell which then produces excessive amounts of thyroid hormone.
  • Tolerance to anti-TSH receptor auto-antibodies may be induced in patients by the injection of pharmaceutically effective amounts of recombinant TSH receptor, or a functional or chemical derivative thereof.
  • the auto- antibodies present combine with the recombinant TSH receptor as opposed to the naturally occurring TSH receptor on the thyroid cell surface. As less auto- antibodies combine with the cell bound TSH receptor, the thyroid cells are less stimulated and thyroid hormone production becomes subject to the regulation of thyrotropin.
  • thymus-derived lymphocytes T cells
  • self antigens this self antigen is the epitope of the TSH receptor which is recognized by a receptor on the autoimmune T cells.
  • the present invention allows the determination of this epitope of the TSH receptor using standard techniques commonly known to those of ordinary skill in the art. Further, the present invention makes possible the characterization of the autoimmune T-cell receptor (TCR) specific to the TSH receptor using methods described in, for example, Burns, F., et al.. J. Exp. Med. 169: 27 (1989).
  • T cells that will accomplish this objective may be generated which are specific for the autoimmune TCR for TSH receptor using methods described in, for example, Acha-Orbea, H. , et al.. Ann. Rev. Immuno1. 7_: 371 (1989).
  • a T cell which is specific for the autoimmune TCR for TSH receptor.
  • Another embodiment of the invention provides for a pharmaceutical preparation comprising a T cell which is specific for the autoimmune TCR for TSH receptor.
  • a method of treating autoimmune thyrotoxicosis comprising the use of a pharmaceutical preparation comprising a T cell which is specific for the autoimmune TCR for TSH receptor.
  • peptides may be generated to interfere with the autoimmune TCR using methods described in, for example, Vandenbark, A., et al.. Nature 341: 541
  • a peptide which is specific for the autoimmune TCR for TSH receptor.
  • a pharmaceutical preparation comprising a peptide which is specific for the autoimmune TCR for TSH receptor.
  • a method of treating autoimmune thyrotoxicosis comprising the use of a. pharmaceutical preparation comprising a peptide which is specific for the auto- immune TCR for TSH receptor.
  • suppressor T cells mediate the immunity suppressor system. These cells provide a mechanism for turning off immune responses that otherwise might overwhelm the host. When an animal is exposed to an excess of antigen to which it is genetically nonresponsive, several events take place. Benacerraf, B., In: The Biology of Immunologic Disease. HP Publishing Co., Inc., NY, pp. 49-62 (1983) . Antigen first induces a population of suppressor T cells. These lymphocytes elaborate a soluble factor that combines with small quantities of antigen and induces a second suppressor T-cell clone. It is these effector cells that actually suppress the antibody-producing B cells.
  • Patients with thyrotoxicosis are treated with the suppressor T cells so as to suppress the formation of anti- thyrotropin receptor auto-antibodies.
  • the suppression of the auto-antibody production would greatly lessen or eliminate the effects of thyrotoxicosis.
  • a suppressor T cell which is specific for anti-thyrotropin receptor auto-antibodies.
  • Another embodiment of the invention provides for a pharmaceutical preparation comprising a suppressor T cell which is specific for anti-thyrotropin receptor auto-antibodies.
  • a method of treating autoimmune thyrotoxicosis comprising the use of a pharmaceutical preparation comprising a suppressor T cell which is specific for anti-thyrotropin receptor auto-antibodies.
  • cDNA clone for the human TSH receptor A human thyroid (Graves' disease) cDNA library was constructed in the Eco Rl site of lambda-ZAP II (Stratagene, San Diego, CA) using the Amersha (Arlington Heights, IL) cDNA Synthesis kit. mRNA for cDNA synthesis was prepared (9) from a thyroid gland removed, for appropriate medical indications, from a patient with Graves' disease.
  • the library was screened with two synthetic O1igonuc1eotides (GTGTTCAGGTCCGAGCTGTCCGTGTACACCCTG- ACCGTGATCACCCTGGAGAGGTGGTA and CACGCCTGCAGGATCATGGTG- GGCGGCTGGGTGTGCTGCTTCCTGCTGGCC) end-labeled with gamma 32 P-ATP and polynucleotide kinase (10) .
  • the low stringency screening method of Wood was utilized (11) , with the exception that final washes were at 42°C in 0.2 x SSC, 0.1% SDS.
  • Nucleotide sequence of selected clones was determined by the dideoxynucleotide chain termination method (12) using modified bacteriophage
  • TSH receptor The cDNA insert in clone 4 (approximately 4 kb in length) was excised from Bluescript with Eco Rl and ligated into the Eco Rl site of the eukaryotic expression plasmid pSV2-NEO-ECE. This plasmid was constructed by the combination of pECE (13) with pSV2-NEO (14) . In brief, the Eco Rl site in pSV2-NEO was eliminated by religation after blunting of the ends with the Klenow fragment of DNA polymerase I. pECE was cut with Pvu
  • a putative human TSH receptor and related receptors (8) were used to screen a human thyroid cell cDNA library. Twenty eight clones were obtained from 5 x 10 5 screened. The nucleotide sequence, and derived 0 amino acid sequence, of selected cDNA clones confirmed the amino acid sequence of the region on which the oligonucleotides were based. Three of 4 clones were full-length in that they contained polyadenylated tails and the putative ATG initiation codon downstream 5 of in-frame stop codons. The length on gel electrophoresis of these 3 clones was approximately 4 kb, similar to that of the LH ⁇ CG receptor (6, 7).
  • the translated region of one of these cDNA clones was determined in full in both directions 0 (Fig. 1) .
  • This clone contains an open reading frame of 764 amino acids, with a calculated molecular weight of 86,816 Daltons.
  • a hydrophobicity plot (17) of this derived amino acid sequence reveals a putative signal peptide and seven transmembrane domains (Fig. 2) .
  • the 5 extracellular domain spans approximately 418 amino acids, and contains five potential glycosylation sites. There is only 33% amino acid homology with the corresponding extracellular domain of the pig LH ⁇ CG receptor (7) (Fig. 3) .
  • the transmembrane region of 0 the human TSH receptor is approximately 264 amino acids in length (residues 419-682) . There is greater homology (71%) between the transmembrane regions of the human TSH receptor and the pig LH ⁇ CG receptor, with 100% homology in the third transmembrane domain. -56-
  • PSV2-NEO-ECE 10 PSV2-NEO-ECE.
  • the resulting plasmid (pSV2-NEO-ECE- hTSHR) was transfected into Chinese hamster ovary (CHO) cells.
  • TSH (10 mU/ml, equivalent to 10" 8 M) stimulation of pooled colonies of stable transfectants increased intracellular cAMP levels 5-fold (Fig. 4) .
  • a cAMP response in transfected cells was initially evident at 0.33 mU/ml (3.3 x 10 "10 M) TSH. No effect of TSH on cAMP levels was observed in control, untransfected CHO cells, or in transfected cells stimulated with 10" 7 M hCG, (1-24)ACTH or insulin.
  • TSH binding or on TSH or thyroid stimulating imuunoglobulin (TSI) biological activity In contrast, either deletion or substitution of the 8 a ino acid region (residues 38-45) abolished these activities.
  • This 8 amino acid tract near the amino terminus of the TSH receptor is a uniquely important site of interaction for both TSH and TSI.
  • Thyrotropin regulates thyroid cell function by interacting with the TSH receptor on the plasma membrane (Dumont et al.. Adv. Cyclic Nucleotide Res. 14.:479 (1981)).
  • the sites on the TSH receptor which interact with TSH and TSI are unknown.
  • the nucleotide sequences of the mutagenized and adjacent regions were determined
  • TSH receptor cDNAs were excised with Eco Rl and sub- cloned into the expression vector pSV2-NE0-ECE (Nagayama et al.. Biochem. Biophvs. Res. Comm.
  • hTSHR-Dl 50 amino acid deletion in hTSHR-Dl, the deletion of 8 amino acids near the amino terminus (hTSHR-M2) completely abolished high affinity TSH binding. Again consistent with absent high affinity TSH binding, TSH stimulation did not increase intracellular cAMP concentrations. Not unexpectedly, CHO cells transfected with a TSH receptor cDNA in which both the 50 and the 8 amino acid segments were deleted (hTSHR- D3) had neither high affinity TSH binding nor a cAMP response to TSH stimulation.
  • pSV2-NE0-ECE is the vector without cDNA insert. * - not detectable.
  • Each value represents the mean of data obtained with pools of clones from two separate transfections, each transfection measured in duplicate.
  • the pituitary/placental glycoprotein hormone receptors represent a distinct subgroup in the G protein-coupled receptor family with seven transmem- brane spanning regions.
  • the majority of the members of this receptor family such as the ⁇ -adrenergic, ⁇ - adrenergic, muscarinic acetyl choline and dopamine receptors (which we term group A) , interact with small ligands and have insignificant extracellular regions.
  • the receptors for the very large glyco ⁇ protein hormones TSH, LH, CC and FSH (group B) have large extracellular domains (348-418 amino acids) (Nagayama et al.. Biochem. Biophys. Res. Comm. 165:1184 (1989); Libert et al.. Biochem. Biophvs. Res. Comm. 165:1250 (1989); Misrahi et al.. Biochem.
  • TSH receptor cDNAs were excised with Eco Rl and subcloned into the expression vector pSV2neo- ECE (Nagayama et al.. Biochem. Biophvs. Res. Comm. 165:1184-1190 (1989)).
  • the bTSH (5 ⁇ g, 30 U/mg protein) was radiolabeled to a specific activity of approximately 80 ⁇ Ci/ ⁇ g protein with the Bolton-Hunter reagent (4400 Ci/mmol; New England Nuclear, Boston, MA) according to the protocol of the manufacturer, followed by Sephadex G 100 chromatography.
  • the cells were rapidly rinsed three times with the same buffer (ice-cold) without TSH, solubilized with 1 ml IN NaOH and radioactivity was measured in a gamma counter.
  • Non-specific 125 I-TSH binding was determined in the presence of 10 ⁇ 6 M TSH and this value ( ⁇ 10% of total binding) was subtracted from total binding to yield specific TSH binding.
  • the TSH receptor mutants were further charac-
  • CHO cells expressing TSHR- Gln99, TSHR-Glnl77, TSHRGlnl98 and TSHR-Gln302 all responded to TSH stimulation.
  • the dose responses were similar among these mutant receptors, with an initial response evident at approximately 10 ⁇ 9 M TSH and a 3 - 5-fold increase in intracellular cAMP levels at 10 "7 M TSH (Fig. 9A) .
  • a complete loss of signal transduction was found in cells transfected with the TSH receptors mutated at Asn 77 and Asn 113, as well as with the TSH receptor mutated in all 6 potential glycosylation sites (Fig. 9B) . As described above, all three of these mutated TSH receptors had lost their high affinity for TSH binding.
  • N-linked glycosyla ⁇ tion The recognition sequence for N-linked glycosyla ⁇ tion is Asn-X-Thr/Ser (Marshall et al.. Annu. Rev. Biochem. 41:673-702 (1972)) and it is well-established that mutagenesis of the Asn amino acid in this consen- sus sequence is sufficient to prevent transfer of carbohydrate moieties to proteins.
  • This approach makes it possible to investigate the contribution of single carbohydrate moieties in multiglycosylated proteins, and avoids the problems of other methods such as incomplete enzymatic digestion or toxic effects on the protein backbone.
  • the human TSH receptor amino acid sequence has six potential N-linked oligosaccharide units at asparagine 77, 99, 113, 177, 198 and 302, all placed in the extracellular domain of the protein. By site- directed mutagenesis we replaced asparagine at these potential glycosylated sites with glutamine, an amino acid with a similar polar side chain.
  • site- directed mutagenesis we replaced asparagine at these potential glycosylated sites with glutamine, an amino acid with a similar polar side chain.
  • a single conservative substitution of an amino acid in an exterior, hydrophilie region of a globular protein is well-tolerated without a major conformational change in tertiary structure (Bowie et al.. Science 247:1306- 1310 (1990); Argos, P., J. Mol. Biol. 197:331-348 (1987)) .
  • TSH-LH/CG receptors reveal that multiple regions in the carboxyl terminal half (residues 171-418) of the extracellular domain are involved in signal transduction.
  • TSH binding was influenced by homologous substitutions throughout the TSH receptor extracellular domain, suggesting multiple contact points for the hormone.
  • chimeric receptor construction For chimeric receptor construction we divided the extracellular domain of the human TSH receptor into five regions by restriction endonuclease sites, 3 of which sites were introduced by site-directed mutagenesis. One or more of these regions were replaced with the homologous region of the rat LH/CG receptor (Fig. 10) . Pools of stably transfected clones of cells were tested for their ability to bind to TSH and to respond to TSH stimulation in terms of an increase in intracellular cAMP levels.
  • Chimeras were constructed using five restriction endonuclease sites in the extracellular domain of the full-length human TSH receptor cDNA in Bluescript (Nagayama, Y. , et al.. Biochem. Biophvs. Res. Comm. 165:1184-1190 (1989)) (SnaB I at amino acid 82, Mlu I at amino acid 170, Afl II at amino acid 260, EcoR V at amino acid 360 and Spe I at amino acid 418) , and the Sal I site in the multiple cloning site of the vector.
  • Two of the sites in the TSH receptor cDNA were pre ⁇ existing restriction sites.
  • the other three sites (Mlu I, EcoR V, Spe I) were chosen by their uniqueness to the plasmid containing the cDNA, and were created by using oligonucleotide-directed mutagenesis (Bio-Rad kit, Richmond, CA) (Kunkel, T.A., Proc. Natl. Acad. Sci. USA 8_2.:488-492 (1985)). These new sites created two conservative amino acid substitutions (Glu ⁇ Asp at residue 362, and lle ⁇ Leu at residue 419).
  • TSH receptor cDNA with the two conserved substitutions was excised with Eco Rl and subcloned into the expression vector pSV2-NEO-ECE (Nagayama, Y., et al.. Biochem. Biophys. Res. Comm. 165:1184-1190 (1989)).
  • TSH receptor cDNA from which the corresponding region had been deleted using the same restriction enzymes.
  • the chimeric TSH-LH/CG cDNA was transfected into CHO cells by the calcium-phosphate method (Chen, C. , et al.. Mol. Cell. Biol. 2:2745-2752 (1987)). Surviving colonies were selected by G418 (400 ug/mL) and pooled for study of their ability to bind to TSH and to respond to TSH with respect to an increase iii intracellular cAMP levels.
  • TSH bind ig and intracellular cAMP measurements: TSH bind. : ⁇ g studies were performed as previously described (Chazenbalk, G.D., et al.. Endocrinology (in press)) with the exception that TSH was iodinated with 125 I to approximately 80 uCi/ug protein using the Bolton-Hunter reagent. In addition, we tested competition for 125 I-TSH binding with hCG as well as TSH. Non-specific 125 I-TSH binding was determined in the presence of 10 ⁇ 6 M TSH and this value was subtracted from total binding to yield specific TSH binding. Measurements of the intracellular cAMP response to hormone stimulation (1 hr at 37°C) was as previously described (Hirayu, H. , et al.. Molec. Cell. Endocrinol. 42:21-27 (1985)).
  • the human TSH receptor with two conserved amino acid substitutions was identical to the wild-type receptor (Chazenbalk, G.D., et al.. Endocrinology (in press) ) in terms of its affinity for TSH and in its ability to mediate an increase in intracellular cAMP levels.
  • the chimeric receptors in which only a single TSH receptor region was replaced chimeras TSH-LHR-1 through 5
  • chimeras TSH-LHR-1 substitution of TSH receptor residues 1-82
  • TSH-LHR-3 lost their high affinity TSH binding site.
  • chimeras TSH-LHR-2 (residues 83-170)
  • TSH-LHR-4 (residues 261-360)
  • TSH-LHR-5 (residues
  • TSH TSH with high affinity.
  • wild-type TSH receptor Chozenbalk, G.D., et al..
  • Each value represents the mean of data obtained with pools of clones from two separate transfections, each transfection measured in duplicate.
  • TSH-LHR-5 (see above) , TSH still bound with high affinity similar to the wild-type receptor (Table 3).
  • hCG In the chimeras that bound both TSH and hCG (chimeras TSH-LHR-8, TSH-LHR-9 and TSH-LHR-10) , in order to evaluate whether hCG was interacting with the chimeric receptors in the same region as TSH we also tested competition by hCG for 125 I-TSH binding. In all three chimeras, hCG competed for *125I-TSH binding but only with low affinity (data not shown) .
  • LHR-11 indicates that the extracellular domain of the glycoprotein hormone receptors is sufficient, and critical, for ligand binding. Nevertheless, it is remarkable that no single domain in the extracellular region of the TSH receptor can be implicated as being a dominant site for high affinity TSH binding. That is, there is at least one chimeric receptor with a substitution for every segment of the TSH receptor extracellular domain (A-E) that binds to TSH with high affinity. It seems likely that the absence of high affinity TSH binding with 3 of the 11 chimeras (TSH- LHR-1, TSH-LHR-3 and TSH-LHR-7) may reflect abnormal folding or instability of the chimeric receptor proteins because substitution of the same regions in other chimeras did not affect TSH binding. These findings suggest that the TSH binding site on the receptor is likely to be discontinuous, with multiple contact points between the two molecules. Unlike with the growth hormone-prolactin hormone family (Cunningham et al.. Science 247:1461-1465 (1990);
  • the chimeric receptor approach used in this study is a powerful means to define domains important for the unique functions of members of a homologous protein family. However, it does not identify regions that may be involved in a function common to all members of the protein family. For example, the glycoprotein hormones have a common alpha subunit that binds to the extracellular domain of the receptor. This common region would not be identified by the homologous substitution approach used. Indeed, mutagenesis studies of an 8 amino acid region (amino acid residues 38-45) in the human TSH receptor suggests that this region is critical for TSH binding (Wadsworth et al. Science (in press) (1990)) . Because homologous substitution of this region did not abolish high affinity TSH binding (present study) , it is likely to be a site of interaction with the common alpha subunit of the glycoprotein hormones.
  • Hormonal regulation of tissue activity is influenced both by the amount of hormone binding to the tissue and by changes in tissue responsivity to the hormone.
  • Desensitization to continued hormone stimulation is a general phenomenon involving many hormones and hormone-responsive tissues. Desensitization may be homologous (hormone-specific) or heterologous (one hormone inducing desensitization to other hormones) .
  • prior thyrotropin (TSH) stimulation leads to a 30-70% decrease in the subsequent cAMP response to TSH stimulation (Rapoport, B.,
  • TSH desensitization appears to involve decreased coupling of its receptor to the adenylate cyclase stimulatory regulatory protein, G s (Rapoport, B., et al.. FEBS Letters 146:23-27 (1982)) . Both the functional activity of G s and the adenylate cyclase catalytic unit remain unaffected (Rapoport, B. , et al.. FEBS Letters 146:23-27 (1982)).
  • Cell cultures CHO cells stably-transfected with the plasmid p5V2-NEO-ECE-hTSH, and expressing a functional human TSH receptor (Nagayama, Y. , et al..
  • CHO-TSHR Cells from this line (CHO-TSHR) were cultured in 6 or 24 well plates (Costar, Cambridge, MA) in Ham's F12 medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 40 ug/ml gentamicin, and 2.5 ug/ml amphotericin B.
  • Cryopreserved human thyroid cells were prepared and plated as previously described (Filetti, S., et al.. Endocrinology 114:1379-1385 (1984)). Cells were maintained at 37°C in an atmosphere of 95% air-5% C0 2 .
  • Cellular cAMP measurements Cells were pre- incubated for 16 h in the above medium with or without added TSH (10 mU/ml) . The medium was then removed and replaced with fresh medium containing 10 mU/ml TSH and
  • IBMX isobutyl methylxanthine
  • Radiolabeled TSH binding Highly-purified bTSH (approximately 30 U/mg protein) was radiolabeled with Na- 125 I (Amersham, Arlington Heights, IL) (Goldfine, I.D., et al.. Endocrinology 95:1228-1233 (1974)). The CHO-TSHR cells were rinsed three times with a modified
  • the Chinese hamster ovary cell line CHO-TSHR expressing a functional recombinant human TSH receptor, was established following cloning and subcloning by limiting dilution.
  • maximal TSH stimulation (10 mU/ml) increased CHO-TSHR intracellular cAMP levels 8-10- fold.
  • human thyroid cells Rost, B. , et al.. Metabolism 21:1159-1167 (1982)
  • maximal stimulation of CHO-TSHR cells was attained after 30-60 min of exposure.
  • the TSH receptor belongs to a family of G protein-coupled receptors with seven transmembrane domains. One member of this family is rhodopsin. Recently, a regulatory protein, termed arrestin, has been identified that inhibits rhodopsin functional activity (Kuhn, H. , et al.. FEBS
  • the stable cell line CHO-TSHR obtained by limiting dilution and not available at the time of our initial report of human TSH receptor expression (Nagayama, Y. , et al.. Biochem. Biophvs. Res. Comm. 165:1184-1190 (1989)), has enabled the inventors to study whether or not the TSH receptor in this cell undergoes down-regulation. Characterization of the TSH receptor in CHO-TSHR cells reveals both high affinity (Ka 1.8 + 0.4 x 10 9 M' 1 ) and low affinity (Ka 1.4 ⁇ 0.3 x 10 7 M -1 ) TSH binding sites.
  • TSH receptor down-regulation occurred only after 16 h (Takasu, N. , et al.. Eur. J. Biochem. 90:131-138 (1978)) and 24 h (Tramontano, D., et al.. Endocrinology 118:1945-1951 (1986)) of TSH stimulation in pig and FRTL5 thyroid cells, respectively.
  • TSH receptor and the receptors for the other pituitary and placental glycoprotein hormones LH/CG (McFarland, K.C. et al.. Science 245:494-499 (1989); Loosfelt, H. et al.. Science 245:525-528 (1989)) and FSK (Sprengel, R. et al.. Mol. Endocrinol. 4.:525-530
  • Mutant TSH receptor cDNA was prepared by the method of Kunkel (Kunkel, T.A. , Proc. Natl. Acad. Sci. USA 22:488-492 (1985)) using the Bio-Rad mutagenesis Muta- Gene Phagemid vitro mutagenesis kit according to the protocol of the manufacturer. Oligonucleotides were synthesized by the Molecular Biology Resource Center,
  • G418 400 ug/ml
  • Surviving clones were pooled to generate a series of non-clonal cell lines expressing mutant TSH receptors.
  • TSH Binding Highly purified bTSH (5 ug, 30 U/mg protein) was radiolabeled with 125 I to a specific activity of approximately 80 uCi/ug protein using the Bolton Hunter reagent (4-00 Ci/mmol; New England Nuclear, Boston, MA) according to the protocol of the manufacturer, followed by Sephadex G100 chromatography. TSH receptor-expressing CHO cell lines were grown to confluence in 2 cm 2 diameter dishes. Cells were incubated for 2 hrs at 37°C in 0.25 ml modified Hank's buffer without NaCl with isotonicity maintained with 280 mM sucrose, supplemented with 0.25% bovine serum albumin.
  • 125 I bTSH (- 1.5 x 10 4 cpm) was included in this buffer together with varying concentrations of unlabeled bTSH (Sigma Chemical Co., St. Louis), as previously described (Chazenbalk, G.D. et al.. Endocrinology (in press) (1990)).
  • the cells were rapidly rinsed three times with the same buffer (ice-cold) without TSH, solubilized with 1 ml 1 N NaOH and radioactivity was measured in a gamma counter.
  • Specific TSH binding was defined as the difference between the total binding of 125 I-TSH in the absence and presence of 10 "6 M TSH. Non-specific binding was ⁇ 10% of total binding.
  • MUT2-TSH-R MUT2-TSH-R
  • FIG. 17A The affinity of TSH binding to MUT2-TSH-R was very similar to the wild type receptor (Kd 2 x 10 ⁇ 10 M) (Fig. 17B and Table 3). TSH stimulation did not increase intracellular cAMP levels in this mutant receptor (Fig. 17C) .
  • the third loop was divided into two regions for study. Seven amino acid substitutions were made in the carboxyl terminus of 5 this loop (residues 617-625; MUT4-TSH-R) (Fig. 18A) . s
  • This mutant receptor had an affinity for TSH about 10- fold lower than the wild-type TSH receptor (Fig. 18B and Table 3) .
  • TSH was without effect on cAMP levels in cells expressing MUT4-TSH-R (Fig. 18C) .
  • MUT5-TSH-R led to an increase in cAMP values similar to that with the wild-type TSH receptor (Fig. 18C) .
  • TSH receptor mutant MUT6-TSH-R the cytoplasmic tail (amino acids 683 to 764) was completely deleted.
  • TSH receptor mutant MUT8-TSH-R the carboxyl terminal two-thirds of the cytoplasmic 5 tail that has no homology with the LH/CC receptor was deleted (amino acids 709-764) .
  • the remaining amino terminus of the cytoplasmic tail of this mutant is homologous to the LH/CC receptor (Nagayama, Y. et al.. Biochem. Biophys. Res. Comm. 1 5:1184-1190 (1989)).
  • affinity of TSH binding to MUT6-TSH-R Kd 2 x 10 ⁇
  • MUT8-TSH-R was lower than that of TSH to the wild-type receptor while that of MUT8-TSH-R (Kd - 2 x 10 "10 M) was similar to that of the wild-type receptor (Fig. 19B, Table 3) .
  • MUT6-TSH-R was completely unresponsive to TSH stimulation in terms of intracellular cAMP generation whereas the response in the partial deletion (MUT8-TSH-R) was similar to that with the wild-type TSH receptor (Fig. 19C, Table 3) .
  • TSH receptor mutant MUT7-TSH-R
  • Fig. 19A The affinity of this mutant for TSH was similar to that of the wild-type receptor (Fig. 19B) .
  • cAMP levels in MUT7-TSH-R were increase by TSH stimulation, in three separate pools of stably transfected cells the extent of this cAMP response was less than with the wild-type receptor, but the EC50 appeared to be similar to the wild type receptor (Fig. 19C, Table 3) .
  • the family of G protein-coupled receptors with seven transmembrane domains appears to be divisible into two sub-groups.
  • One sub-group of receptors (which we term A) contains essentially no extracellular region and interacts with very small ligands. Included in this sub-group are the ⁇ and ⁇ adrenergic, muscarinic cholinergic, dopamine, serotonin, neuropeptide Y, substance K receptors and rhodopsin (Johnson, G.L. et al.. Endocr. Rev. 10:317- 331 (1989)) .
  • sub-group B a second sub-group of receptors which contains a large (360-418 amino acid) extracellular domain, and which interacts with the large pituitary/placental glycoprotein hormones, TSH LH/CC and FSH (Nagayama, Y. et al.. Biochem. Biophys. Res. Comm. 165:1184-1190 (1989); Libert, F. et al.. Biochem. Biophys. Res. Comm. 165:1250-1255 (1989); ⁇ 5 Misrahi, M. et al.. Biochem. Biophvs. Res. Comm.
  • All receptors in the family contain three cytoplasmic loops and a cytoplasmic tail.
  • C guanine nucleotide
  • mutagenesis studies with sub ⁇ group A (adrenergic and rhodopsin) receptors (Strader, CD. et al.. J. Biol. Chem. 262:16439-16443 (1987); 20 O'Dowd, B.F. et al.. J. Biol. Chem. 263:15985-15992
  • R has no homology with the LH receptor in contrast to the remaining amino terminal segment of the cytoplasmic tail. Substitution mutagenesis of a number of potentially important positively charged residues and a tyrosine in the cytoplasmic tail
  • this study provides the first information on the importance of several regions of the cytoplasmic domains of the TSH receptor, a member of a new sub ⁇ group of G protein-coupled receptors, on signal transduction in response to hormone stimulation.
  • These data reveal interesting differences and similarities with the sub-group of receptors lacking significant extracellular domains, as exemplified by the 0-adrenergic receptor.
  • the most important regions of the TSH receptor for signal transduction appear to be the relatively small first cytoplasmic loop (residues 441-450) , the carboxy1-terminal regions of the second cytoplasmic loop (residues 528-537) and the carboxyl-terminal (amino acids 603-614) of the third cytoplasmic loop.
  • Antibodies against the TSH receptor are present in the serum of many patients with autoimmune thyroid disease, more so in Graves' disease than in Hashimoto's thyroiditis (Rees Smith et al. , Endocr
  • the other type of assay is not a stimulatory bioassay, but instead measures antibodies that interact with the receptor and compete for TSH binding (Rees Smith et al.. The Lancet 427-431 (1974)).
  • This TSH binding inhibition (TBI) assay detects TSH receptor antibodies of both the stimulatory and the inhibitory variety without discriminating between the two (Rees Smith et al.. Endocr Rev. .9:106-121 (1988)). Both types of antibodies may be present in the same patient (Zakarina et al.. J Clin Invest. 72:1352-1356 (1983)).
  • the molecular cloning and expression of the human TSH receptor has recently been achieved (Nagayama et al.. Biochem Biophys Res Comm. 165:1184-1190 (1989); Libert et al. , Biochem Biophys Res Comm. 165:1250-1255 (1989) ; Misrahi et al.. Biochem Biophvs Res
  • CHO-TSHR human TSH receptor
  • CHO-TSHR a functional human TSH receptor
  • FRTL5 rat thyroid cells Ambesi-Impiombato et al.. Proc Natl Acad Sci USA 77:3455-3459 (1980)
  • primary cultures of human thyroid cells Cells were cultured in 24 well plates (Costar, Cambridge, MA) .
  • CHO-TSHR cells were cultured in Ham's F12 medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 40 ⁇ g/ml gentamycin, and 2.5 ⁇ g/ml fungizone.
  • FRTL5 cells were grown in Coon's modified Ham's F-12 medium supplemented with 5% calf serum, penicillin (125 U/ml) , gentamycin (40 ⁇ g/ml) , amphotericin B (2.5 ⁇ g/ml) and a mixture of three hormones; bTSH (5 mU/ml) , transferrin (5 ⁇ g/ml) and insulin (10 mU/ml) .
  • Radiolabeled TSH binding Highly-purified bTSH 5 (approximately 30 U/mg protein) was radiolabeled with Na- 125 I (Amersham, Arlington Heights, IL) (Goldfine et al. r Endocrinology £5:1228-1233 (1974)). In some experiments radiolabeling with 125 I was preformed with the Bolton-Hunter reagent (Amersham, Milan, Italy) 0 according to the protocol of the manufacturer. Free iodide was removed by Sephadex G100 chromatography. The specific activity of the radiolabeled TSH was 80- 150 ⁇ Ci/ ⁇ g protein.
  • CHO-TSHR or FRTL5 cells were rinsed three times with a modified Hank's buffer without NaCl, and with isotonicity maintained with 280 mM sucrose (Tramontano et al.. Endocrinology 118:1945-1951 (1986)). The cells were then incubated under conditions indicated in the text in the same buffer, supplemented with 0.25% bovine serum albumin
  • BSA BSA , approximately 10 "12 M 125 I-bTSH, and the indicated amount of unlabeled bTSH (Thytropar, Kankakee, IL) or IgG preparation.
  • the cells were rapidly rinsed three times with the same buffer (4°C) lacking additives, solubilized with 1 ml 1 N NaOH, and radioactivity was measured in a gamma counter.
  • Non-specific 125 I-TSH binding was measured in the presence of 10 ⁇ 6 M TSH, and this value was subtracted to yield specific TSH binding values.
  • the range of specific TSH binding in different experiments was 8-15% of total counts added. Non-specific binding was approximately 1%.
  • PEG polyethylene glycol 4000
  • TBI TSH binding inhibition
  • the cells were then rinsed three times with 1 ml of ice-cold KRS. After the solubilization of cells by the addition of 0.5 ml of 1 N NaOH to the wells, 0.4 ml was counted for radioactivity in a gamma counter.
  • TBI TSH binding inhibition
  • Thyroid stimulating immunoglobulin bioassay This assay was performed as previously described in detail using primary monolayer cultures of human thyroid cells (Rapoport et al.. J Clin Endocrinol Metab. 52:332-338 (1984)). Data are expressed, however, as % of basal (unstimulated) cAMP values instead of TSH uU equivalents.
  • Solubilized porcine TSH receptor assay The TRAK radioreceptor assay for measuring TSH receptor antibodies (Henning, Berlin) was used according to the protocol of the manufacturer (15 min preincubation with serum at room temperature prior to the addition of 125 I-TSH for 1 h at 37°C) . In some experiments highly-pufified IgG was used instead of whole serum.
  • the principle of this two-step, non-equilibrium procedure is that the cells are first exposed to the IgG.
  • the unbound IgG as well as the contaminting PEG is removed by rinsing prior to the addition of the labeled TSH which is then able to bind the residual unoccupied TSH receptors.
  • 5 2/75 were TBI negative.
  • TBII positive In 30 patients who relapsed after the withdrawal of anti-thyroid medication 29 of 30 were TBII positive.
  • Four of 12 patients with Hashimoto's thyroiditis (33%) were positive for TBI activity.
  • All 18 patients with non-autoimmune thyroid 0 diseases (4 with toxic nodular goiter, 8 with single toxic adenomata, 3 with subacute thyroiditis and 3 with thyroid cancer) were TBI negative.
  • TRAK assay utilizes a solubilized porcine thyroid membrane as a source of TSH receptors. While this assay is very conveniently performed and is generally sensitive and reliable, an abundant and uniformly constant source of human TSH receptor would be an advantage. A single cell line expressing the human TSH receptor would avoid potential variability among pig thyroid preparations. Although the pig and human TSH receptors appear to be antigenically very similar, it is possible that some anti-TSH receptor antibodies would interact with higher affinity, and may thereby reduce the number of false positives. Indeed, the present data suggest that the recombinant human TSH receptor is, indeed more sensitive than the pig receptor assay, being 96% positive in untreated Graves's disease vs. 87% positive with the same sera in the TRAK assay.
  • the stably transfected CHO cells express approximately 10 5 TSH receptors per cell, 10 times as many receptors as are present on human thyroid cells (Rees Smith et al.. Endocr Rev.
  • TSH receptor assay Although the number of TSH receptors on pig thyroid cells is unknown.
  • a second probable reason for the greater sensitivity of the recombinant TSH receptor assay is the use of polyethylene glycol- precipitated serum rather than whole serum used in the solublized pig thyroid receptor assay. A comparison between these two assays was performed following exactly the protocol of the manufacturers of the IRAK assay. In our experience (data not shown) , the sensitivity of the TRAK assay improves if it is modified to use a partially purified IgG preparation rather than whole serum. The purpose of using whole serum is to greatly simplify the TRAK assay and to make it more widely available to many physicians taking care of patients with autoimmune thyroid disease.
  • TBI thyroid stimulating immunoglobulin
  • TBI assays Physicians utilizing the more readily available TBI assays are obtaining data that, while helpful, does not necessarily reflect the presence of thyroid stimulatory antibodies. Indeed, while all patients in our small series of patients with Hashimoto's thyroiditis were TSI negative, one third were TBI positive in a sensitive TBI assay. Measurement of TBI activity allows for the detection of autoantibodies against the TSH receptor in neonatal hypothyroidism or in following the course of unusual patients who are hypothyroid as the result of TSH receptor blocking antibodies (Rees Smith et al.. Endocrin. Rev. £:106- 121 (1988)). EXAMPLE IX
  • TSH glycoprotein hormones
  • LH lutropin
  • CG chorionic gonadotropin
  • FSH follitropin
  • TSH-LHR-12 was constructed by isolating the 610 bp fragment coding for domains AB from chimera TSH-LHR-2 with Sal I and Mlu I and substituting this fragment for the corresponding region in the same restriction sites in TSH-LHR-7 ( Figure 24) .
  • TSH-LHR- 13 was constructed by ligating the 510 bp by Sal I-Mlu I fragment of TSH-LHR-1 into the corresponding sites in TSH-LHR-7.
  • TSH-LHR-14 was constructed by substituting the 780 bp Sal I-Bfr I (isoschizomer of
  • TSH-LHR-8 (coding for domains ABC) into the corresponding sites of TSH-LHR-6.
  • TSH-LHR-15 was constructed by substituting the 780 bp Sal I-Bfr I fragment of TSH-LHR-9 for the corresponding fragment in TSH-LHR 5.
  • TSH-LHR-16 was constructed by substituting the 780 bp Sal I-Bfr I fragment of TSH- LHR-9 for the corresponding tract in TSH-LHR-4.
  • TSH-LHR-14 which contains domain C of the extracellular component of the TSH receptor and domains ABDE of the LH/CG receptor, exhibited TSH binding of high affinity (Kd
  • Each value represents the mean of data obtained with two pools of clones from two separate transfections
  • chimera TSH-LHR-11 in which the entire LH/CG extracellular domain replaces the corresponding region in the TSH receptor (Table 4, Figure 26A) .
  • chimera TSH-LHR- 14 had a blunted cAMP response to hCG stimulation (EC50 approximately 50-fold higher than that of chimera TSH-LHR-11 (Table 4; Figure 26B) .
  • domains A through E The homology between the human TSH and rat LH/CG receptors in domains A through E is 26% (the putative signal peptide is excluded), 43%, 51%, 19% and 39%, respectively. Surprisingly, domain C is the most conserved of the five domains. Sequence divergence may therefore not be a good predictor for defining regions responsible for functional differences in the glycoprotein hormone receptor family.
  • substitution data is that the alterations in ligand binding observed in the previous (Example V) and present studies are likely to reflect ⁇ -subunit binding.
  • hCG binding to the LH/CG receptor also provide some information with respect to hCG binding to the LH/CG receptor.
  • TSH binding the binding of hCG to its receptor is complex and is likely to involve multiple contact sites in the extracellular domain of the receptor, and may be
  • TSH receptor/LH receptor chimeras were used to assess the Thyroid Stimulating Immunoglobulin (TSI) activity of the various domains of the TSH receptor. Purified IgG from 11 different Graves' disease sera was tested, as well as 4 Hashimoto's thyroiditis sera not containing TSI activity. The chimeras used are described in Examples VIII and IX.
  • TBII TSH binding inhibitory immunoglobulin
  • TSH binding inhibitory activity to inhibit TSI activity was also assessed.
  • the wild type TSH receptor and chimera 6 containing the ABC domains were used in the assay.
  • the data indicate that TBII only blocks TSI activity in the wild-type TSH receptor, and not in the ABC domains of the TSH receptor. (Table 5).
  • the data indicate that TBII blocks TSI activity in the wild-type TSH receptor, and not in the ABC domains of the TSH receptor.
  • Table 6 Summary of data shown in Figures 27, 28 and Table 5.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Rehabilitation Therapy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Reproductive Health (AREA)
  • Rheumatology (AREA)
  • Neurology (AREA)

Abstract

L'invention se rapporte à un récepteur de thyrotropine humaine fonctionnellement actif qu'on a produit par expression à l'intérieur de cellules eukaryotiques non thyroïdiennes. On a soumis une bibliothèque d'ADNc de thyroïde humaine à une opération de triage au moyeu de deux oligonucléotides synthétiques sur la base de la séquence d'acides aminés rapportée des troisième et quatrième domaines transmembranes et d'un récepteur de thyrotropine humaine putatif et de récepteurs associés. La séquence de nucléotides d'un clone de 4 kb a révélé une structure de lecture ouverte de 764 acides aminés (86.816 daltons) avec un peptide de signal putatif, sept domaines transmembrane, cinq sites de glycosylation potentiels et une région intracytoplasmique trés courte. La part d'homologie avec le domaine extracellulaire du récepteur LH/CG du cochon s'est située à 33 % seulement. Des cellules d'ovaire d'hamster chinois, transfectées de façon stable avec cet ADNc dans un vecteur d'expression, on généré un récepteur fonctionnel, capable d'activer l'adénylate cyclase, particulièrement en réponse à une stimulation de thyrotropine.
PCT/US1990/007387 1989-12-20 1990-12-19 Recepteur de thyrotropine recombinant WO1991009137A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP3504332A JPH05504683A (ja) 1989-12-20 1990-12-19 組み換えチロトロピン受容体

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US45197389A 1989-12-20 1989-12-20
US451,973 1989-12-20
US57501890A 1990-08-30 1990-08-30
US575,018 1990-08-30

Publications (1)

Publication Number Publication Date
WO1991009137A1 true WO1991009137A1 (fr) 1991-06-27

Family

ID=27036589

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/007387 WO1991009137A1 (fr) 1989-12-20 1990-12-19 Recepteur de thyrotropine recombinant

Country Status (5)

Country Link
EP (1) EP0506890A4 (fr)
JP (1) JPH05504683A (fr)
AU (1) AU7257391A (fr)
IE (1) IE904641A1 (fr)
WO (1) WO1991009137A1 (fr)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990013643A2 (fr) * 1989-05-05 1990-11-15 Genentech, Inc. Molecules receptrices d'hormone de glycoproteine
EP0493434A1 (fr) * 1989-09-08 1992-07-08 New England Medical Center Hospitals, Inc. Recepteur de thyrotropine
EP0719858A2 (fr) * 1994-12-27 1996-07-03 Tosoh Corporation Lignée cellulaire de myélome exprimant le récepteur humain recombinant pour l'hormone stimulatrice de la thyroide
US5614363A (en) * 1990-01-25 1997-03-25 New England Medical Center Hospitals, Inc. TSH receptor
WO1998020343A2 (fr) * 1996-11-06 1998-05-14 B.R.A.H.M.S Diagnostica Gmbh Test de liaison d'un recepteur, recepteur de fusion recombine approprie pour ce test, vecteur pour sa preparation et jeu de reactifs pour effectuer ce test
DE19645729C1 (de) * 1996-11-06 1998-06-04 Brahms Diagnostica Gmbh Rezeptorbindungsassay, für den Rezeptorbindungsassay geeigneter rekombinanter Fusionsrezeptor, Vektor zu dessen Herstellung sowie Reagenziensatz für die Durchführung des Rezeptorbindungsassays
DE19651093C2 (de) * 1996-12-09 1999-06-10 Brahms Diagnostica Gmbh Rezeptorbindungsassay zum Nachweis von TSH-Rezeptor-Autoantikörpern sowie Reagenziensatz für die Durchführung eines solchen Rezeptorbindungsassays
WO2001027634A2 (fr) * 1999-10-12 2001-04-19 Ulrich Loos Procede de determination de differents types d'autoanticorps contre le recepteur de tsh par immuno-precipitation selective, proteines de fusion pour la mise en oeuvre d'un tel procede, et utilisation de chimeres de recepteur de tsh marquees lors d'un tel procede
US6261800B1 (en) 1989-05-05 2001-07-17 Genentech, Inc. Luteinizing hormone/choriogonadotropin (LH/CG) receptor
WO2004050708A2 (fr) * 2002-11-29 2004-06-17 Rsr Limited Partenaires de liaison du recepteur de la thyrotropine et utilisations de ceux-ci
CN102050875A (zh) * 2010-12-10 2011-05-11 天津市协和医药科技有限公司 一种促甲状腺素受体的提取及纯化方法
US8298771B2 (en) 2001-08-23 2012-10-30 Rsr Limited Epitope regions of a thyrotrophin (TSH) receptor, uses thereof and antibodies thereto
FR3126005A1 (fr) * 2021-08-04 2023-02-10 Upec Activateur pharmacologique et/ou génétique pour son utilisation pour préserver et régénérer la structure et la fonction musculaire en bloquant la sénescence
WO2023045470A1 (fr) * 2021-09-22 2023-03-30 厦门英博迈生物科技有限公司 Protéine de récepteur d'hormone de stimulation de la thyroïde recombinée, son procédé de préparation et son application

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0433509B1 (fr) * 1989-12-14 1996-11-13 B.R.A.H.M.S Diagnostica GmbH Polypeptides possédant l'activité réceptrice de la thyrotropine, séquences d'acides nucléiques codant pour de tels récepteurs et polypeptides, et applications de ces polypeptides
US6686171B2 (en) * 1999-05-10 2004-02-03 Tropix, Inc. Competitive chemiluminescent assay for cyclic nucleotide monophosphates
US8293879B2 (en) 2000-03-30 2012-10-23 Diagnostic Hybrids, Inc. Methods of using chimeric receptors to identify autoimmune disease
US6852546B1 (en) * 2000-03-30 2005-02-08 Diagnostic Hybrids, Inc. Diagnosis of autoimmune disease

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4818684A (en) * 1985-09-10 1989-04-04 The Trustees Of Columbia University In The City Of New York Auto-anti-idiotypic monoclonal antibodies to steroid receptors and uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4472508A (en) * 1982-12-30 1984-09-18 The Beth Israel Hospital Association Test for detecting and measuring the graves' disease-specific immunoglobulins
DK0471030T3 (da) * 1989-05-05 1995-05-29 Genentech Inc Glycoproteinhormonreceptormolekyler
WO1991003483A1 (fr) * 1989-09-08 1991-03-21 New England Medical Center Hospitals, Inc. Recepteur de thyrotropine
EP0433509B1 (fr) * 1989-12-14 1996-11-13 B.R.A.H.M.S Diagnostica GmbH Polypeptides possédant l'activité réceptrice de la thyrotropine, séquences d'acides nucléiques codant pour de tels récepteurs et polypeptides, et applications de ces polypeptides
EP0557273A1 (fr) * 1990-11-15 1993-09-01 THE GOVERNMENT OF THE UNITED STATES OF AMERICA as represented by the SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Gene de rat recepteur de thyrotropine et utilisation dudit gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4818684A (en) * 1985-09-10 1989-04-04 The Trustees Of Columbia University In The City Of New York Auto-anti-idiotypic monoclonal antibodies to steroid receptors and uses thereof

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, Volume 165, No. 3, issued 29 December 1989, NAGAYAMA et al., "Molecular Cloning, Sequence and Functional Expression of the CDNA for the Human Thyrotropin Receptor", pages 1184-1190, see entire article. *
ENDOCRINOLOGY, Volume 122, No. 6, issued 1988, HILL et al. "Monoclonal Antibodies to the Thyrotropin Receptor Raised by an Autoantidiotypic Protocol and their Relationship to Monoclonal Autoantibodies from Graves' Patients", pages 2840-2850, see the Abstract. *
NATURE, Volume 341, issued 12 October 1989, VANDEN-BARK et al. "Immunization with a Synthetic T-cell Receptor V-region peptide Protects Against Experimental Autoimmune Encephalomyelitis", pages 541-544, see Abstract. *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, Volume 82, issued January 1985, T.A. KUNKEL, "Rapid and Efficient Site-Specific Mutagenesis without Phenotypic Selection", pages 488-492, See the Abstract. *
SCIENCE, Volume 245, issued 04 August 1989, McFARLAND et al., "Lutropin-Choriogonadotropin Receptor: An Unusal Member of the G Protein-coupled Receptor Family", pages 494-499, see Abstract. *
See also references of EP0506890A4 *
THE JOURNAL OF BIOLOGICAL CHEMISTRY, Volume 263, No. 31, issued 05 November 1988, YOSHIDA et al., "Monoclonal Antibodies to the Thyrotropin Receptor Bind to A 56-kDa Subunit of the Thyrotropin Receptor and Show Heterogeneous Bioactivities", pages 16341-16347, see Abstract. *

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990013643A2 (fr) * 1989-05-05 1990-11-15 Genentech, Inc. Molecules receptrices d'hormone de glycoproteine
WO1990013643A3 (fr) * 1989-05-05 1991-01-10 Genentech Inc Molecules receptrices d'hormone de glycoproteine
EP0471030A1 (fr) * 1989-05-05 1992-02-19 Genentech Inc Molecules receptrices d'hormone de glycoproteine.
EP0614975A1 (fr) * 1989-05-05 1994-09-14 Genentech, Inc. Molécules réceptrices d'hormone de glycoprotéine
US6261800B1 (en) 1989-05-05 2001-07-17 Genentech, Inc. Luteinizing hormone/choriogonadotropin (LH/CG) receptor
EP0493434A1 (fr) * 1989-09-08 1992-07-08 New England Medical Center Hospitals, Inc. Recepteur de thyrotropine
EP0493434A4 (en) * 1989-09-08 1993-05-05 New England Medical Center Hospitals, Inc. Tsh receptor
US5614363A (en) * 1990-01-25 1997-03-25 New England Medical Center Hospitals, Inc. TSH receptor
EP0719858A2 (fr) * 1994-12-27 1996-07-03 Tosoh Corporation Lignée cellulaire de myélome exprimant le récepteur humain recombinant pour l'hormone stimulatrice de la thyroide
EP0719858A3 (fr) * 1994-12-27 1997-12-29 Tosoh Corporation Lignée cellulaire de myélome exprimant le récepteur humain recombinant pour l'hormone stimulatrice de la thyroide
WO1998020343A2 (fr) * 1996-11-06 1998-05-14 B.R.A.H.M.S Diagnostica Gmbh Test de liaison d'un recepteur, recepteur de fusion recombine approprie pour ce test, vecteur pour sa preparation et jeu de reactifs pour effectuer ce test
DE19645729C1 (de) * 1996-11-06 1998-06-04 Brahms Diagnostica Gmbh Rezeptorbindungsassay, für den Rezeptorbindungsassay geeigneter rekombinanter Fusionsrezeptor, Vektor zu dessen Herstellung sowie Reagenziensatz für die Durchführung des Rezeptorbindungsassays
WO1998020343A3 (fr) * 1996-11-06 1998-07-16 Brahms Diagnostica Gmbh Test de liaison d'un recepteur, recepteur de fusion recombine approprie pour ce test, vecteur pour sa preparation et jeu de reactifs pour effectuer ce test
DE19651093C2 (de) * 1996-12-09 1999-06-10 Brahms Diagnostica Gmbh Rezeptorbindungsassay zum Nachweis von TSH-Rezeptor-Autoantikörpern sowie Reagenziensatz für die Durchführung eines solchen Rezeptorbindungsassays
WO2001027634A2 (fr) * 1999-10-12 2001-04-19 Ulrich Loos Procede de determination de differents types d'autoanticorps contre le recepteur de tsh par immuno-precipitation selective, proteines de fusion pour la mise en oeuvre d'un tel procede, et utilisation de chimeres de recepteur de tsh marquees lors d'un tel procede
WO2001027634A3 (fr) * 1999-10-12 2002-03-14 Ulrich Loos Procede de determination de differents types d'autoanticorps contre le recepteur de tsh par immuno-precipitation selective, proteines de fusion pour la mise en oeuvre d'un tel procede, et utilisation de chimeres de recepteur de tsh marquees lors d'un tel procede
US8298771B2 (en) 2001-08-23 2012-10-30 Rsr Limited Epitope regions of a thyrotrophin (TSH) receptor, uses thereof and antibodies thereto
US9751940B2 (en) 2001-08-23 2017-09-05 Rsr Limited Epitope regions of a thyrotrophin (TSH) receptor, uses thereof and antibodies thereto
US8309693B2 (en) 2001-08-23 2012-11-13 Rsr Limited Epitope regions of a thyrotrophin (TSH) receptor, uses thereof and antibodies thereto
US8298769B2 (en) 2001-08-23 2012-10-30 Rsr Limited Epitope regions of a thyrotrophin (TSH) receptor, uses thereof and antibodies thereto
CN1717418B (zh) * 2002-11-29 2011-03-30 Rsr有限公司 促甲状腺素受体的抗体及其用途
US8110664B2 (en) 2002-11-29 2012-02-07 Rsr Limited Binding partners for the thyrotropin receptor and uses thereof
US20120276117A1 (en) * 2002-11-29 2012-11-01 Rsr Limited Binding Partners for the Thyrotropin Receptor and Uses Thereof
WO2004050708A3 (fr) * 2002-11-29 2004-12-02 Rsr Ltd Partenaires de liaison du recepteur de la thyrotropine et utilisations de ceux-ci
US8753637B2 (en) 2002-11-29 2014-06-17 Rsr Limited Binding partners for the thyrotropin receptor and uses thereof
US8900823B2 (en) 2002-11-29 2014-12-02 Rsr Limited Binding partners for the thyrotropin receptor and uses thereof
WO2004050708A2 (fr) * 2002-11-29 2004-06-17 Rsr Limited Partenaires de liaison du recepteur de la thyrotropine et utilisations de ceux-ci
CN102050875A (zh) * 2010-12-10 2011-05-11 天津市协和医药科技有限公司 一种促甲状腺素受体的提取及纯化方法
FR3126005A1 (fr) * 2021-08-04 2023-02-10 Upec Activateur pharmacologique et/ou génétique pour son utilisation pour préserver et régénérer la structure et la fonction musculaire en bloquant la sénescence
WO2023012264A3 (fr) * 2021-08-04 2023-03-30 Association Francaise Contre Les Myopathies Activateur pharmacologique et/ou genetique pour son utilisation pour preserver et regenerer la structure et la fonction musculaire en bloquant la senescence
WO2023045470A1 (fr) * 2021-09-22 2023-03-30 厦门英博迈生物科技有限公司 Protéine de récepteur d'hormone de stimulation de la thyroïde recombinée, son procédé de préparation et son application

Also Published As

Publication number Publication date
EP0506890A4 (en) 1993-06-30
JPH05504683A (ja) 1993-07-22
AU7257391A (en) 1991-07-18
EP0506890A1 (fr) 1992-10-07
IE904641A1 (en) 1991-07-17

Similar Documents

Publication Publication Date Title
WO1991009137A1 (fr) Recepteur de thyrotropine recombinant
EP0959896B1 (fr) Methode de production des variantes tronquees secretees du recepteur de la thyrotropine humaine
Lowe et al. Human natriuretic peptide receptor-A guanylyl cyclase. Hormone cross-linking and antibody reactivity distinguish receptor glycoforms.
CZ208197A3 (en) Side protein of human receptor for interleukin 1
US7649084B2 (en) Recombinant glycoproteins related to feline thyrotropin
WO1997046206A9 (fr) Compositions a base de recepteur de la thyrotropine humaine
WO1995021866A1 (fr) Molecule immuno-interactive se liant au domaine extracellulaire du recepteur tie2/tek
EP0656007B1 (fr) Genes de recepteurs opioides delta
KR100642602B1 (ko) 갑상선자극호르몬의 돌연변이 및 그에 근거한 방법
WO1996039511A2 (fr) Recepteur du genre c5a a sept transmembranes
JPH05501952A (ja) Ｔｓｈ受容体
US5750366A (en) Cloning and expression of gonadotropin-releasing hormone receptor
WO1991002061A1 (fr) Peroxydase de la thyroide humaine de recombinaison
US7723071B2 (en) DNA molecules encoding opioid receptors and methods of use thereof
AU640480B2 (en) Solubilization and purification of the gastrin releasing peptide receptor
US6432652B1 (en) Methods of screening modulators of opioid receptor activity
US6747139B1 (en) Nucleic acid encoding human thyrotropin receptor
US6638905B2 (en) Cloning and recombinant production of CFR receptor(s)
WO1998053062A1 (fr) Homologue du recepteur edg-6 humain
JPH08245697A (ja) 新規ｇ蛋白質共役型レセプター蛋白質、その製造法および用途
Bozon et al. Agonist-like activity of antibodies directed against the second extracellular loop of the human cardiac serotonin 5-HT 4 (e) receptor in transfected COS-7 cells
WO1997031945A1 (fr) Adn codant un recepteur humain d'imidazoline
AU721053B2 (en) Cloning and recombinant production of CRF receptor(s)
JPH08266280A (ja) 新規ｇ蛋白質共役型レセプター蛋白質、その製造法および用途
JPH07304797A (ja) ヒトｔｒｈレセプター蛋白質、その製造法および用途

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR CA FI HU JP KP KR LK MC MG MW NO RO SD SU US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BF BJ CF CG CH CM DE DK ES FR GA GB GR IT LU ML MR NL SE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 1991904350

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1991904350

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1991904350

Country of ref document: EP