WO1986003519A1 - Recombinant methods for production of serine protease inhibitors and dna sequences useful for same - Google Patents

Recombinant methods for production of serine protease inhibitors and dna sequences useful for same Download PDF

Info

Publication number
WO1986003519A1
WO1986003519A1 PCT/US1985/002385 US8502385W WO8603519A1 WO 1986003519 A1 WO1986003519 A1 WO 1986003519A1 US 8502385 W US8502385 W US 8502385W WO 8603519 A1 WO8603519 A1 WO 8603519A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
inhibitor
gene
sequence
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1985/002385
Other languages
English (en)
French (fr)
Inventor
Pradip K. Bandyopadhyay
Stephen P. Eisenberg
Gary L. Stetler
Robert C. Thompson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Boulder Inc
Original Assignee
Synergen Biologicals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27102096&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1986003519(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Synergen Biologicals Inc filed Critical Synergen Biologicals Inc
Priority to HU86332A priority Critical patent/HU204563B/hu
Priority to KR1019860700537A priority patent/KR940011339B1/ko
Priority to EP85905953A priority patent/EP0205475B2/en
Priority to DE3587875T priority patent/DE3587875T3/de
Publication of WO1986003519A1 publication Critical patent/WO1986003519A1/en
Priority to DK372086A priority patent/DK372086D0/da
Priority to FI863188A priority patent/FI108943B/fi
Priority to NO863182A priority patent/NO301122B1/no
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81Protease inhibitors
    • C07K14/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811Serine protease (E.C. 3.4.21) inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • Endogenous proteolytic enzymes serve to degrade invading organisms, antigen-antibody complexes and certain tissue proteins which are no longer necessary or useful to the organism.
  • proteolytic enzymes are pro ⁇ substituted in a limited quantity and are regulated in part through the synthesis of protease inhibitors.
  • protease inhib ⁇ itors serve to control the endogenous proteases by limiting thei reactions locally and temporally.
  • the protease in ⁇ hibitors may inhibit proteases introduced into the body by infec ⁇ tive and parasitic agents. Tissues that are particularly prone to proteolytic attack and infection, e.g., those of the respira ⁇ tory tract, are rich in protease inhibitors.
  • Protease inhibitors comprise approximately 10% of the human plasma proteins. At least eight inhibitors have been iso ⁇ lated from this source and characterized in the literature. These include 2 -macroglobulin ( 2 M) , , -protease inhibitor ( -.PI ) , , -antichymotrypsin ( ,Achy) , , -anticollagenase ( -.AC), and inter- -trypsin inhibitor (I I).
  • a disturbance of the protease/protease inhibitor bal ⁇ ance can lead to protease mediated tissue destruction, including emphysema, arthritis, glomerulonephritis, periodontitis, muscula dystrophy, tumor invasion and various other pathological condi ⁇ tions.
  • protease mediated tissue destruction including emphysema, arthritis, glomerulonephritis, periodontitis, muscula dystrophy, tumor invasion and various other pathological condi ⁇ tions.
  • severe pathological pro ⁇ such as sepsis or acute leukemia
  • the amount of free proteolytic enzymes present increases due to the release of en ⁇ zyme from the secretory cells.
  • a diminished regulating inhibitor capacity of the organism may also cause alterations in the protease/protease inhibitor balance.
  • protease inhibitors have been sought which are capable of being adminis ⁇ tered to an organism to control the proteolytic enzymes.
  • Leukocyte elastase is an example of a serine protease of particular interest from a phamacological standpoint. Leukocyte elastase, when released extracellularly, degrades con ⁇ nective tissue and other valuable proteins. While it is neces ⁇ sary for a normally functioning organism to degrade a certain amount of connective tissue and other proteins, the presence of an excessive amount of leukocyte elastase has been associated with various pathological states, such as emphysema and rheumatoid arthritis . To counteract the effects of leukocyte elastase when it is present in amounts greater than normal, a protease inhibitor has been sought which is effective against leukocyte elastase. Such a protease inhibitor would be espe ⁇ cially useful if it were capable of being prepared, via a recombinant DNA method, in a purified form and in sufficient quantities to be pharmaceutically useful.
  • the single-polypeptide-chain serine protease in ⁇ hibitors of the prior art are not "substantially homologous" to the proteins of the present invention.
  • Trypsin is another protease of particular interest from a pharmacological standpoint. Trypsin is known to initiate deg ⁇ radation of certain soft organ tissue, such as pancreatic tissue, during a variety of acute conditions, such as pancreatitis. Var ⁇ ious efforts have been directed toward the treatment of these conditions, without marked success, through the use of proteins which it was hoped would inhibit the action of trypsin. Illus ⁇ trative of such efforts are attempts to use exogenous bovine trypsin inhibitors in treatment of human pancreatitis. While such techniques have been attempted in Europe, they have not been approved as effective by the U.S. Food and Drug Administration.
  • a protease inhibitor effective in neu ⁇ tralizing excess trypsin in a variety of acute and chronic condi ⁇ tions .
  • a trypsin inhibitor would be particularly useful if it could be isolated and prepared, by recombinant DNA methods, in a purified form and in sufficient quantities to be pharmaceu ⁇ tically useful.
  • Cathepsin G is another protease present in large quan ⁇ tities in leukocytes. Cathepsin G is known to be capable of de ⁇ grading in vitro a variety of valuable proteins, including those of the complement pathway. Pancreatic elastase is another pro ⁇ tease which may have a role in pancreatitis. Thus, inhibitors for these proteases are also of potential pharmaceutical value. Leukocyte elastase, trypsin, cathepsin G and pancreatic elastase are examples of a class of proteases known as serine proteases, which have elements of common structure and mechanism.
  • the protease inhibitor of the present invention prepared by the recombinant DNA methods set forth herein, is believed to have at least two active sites; one site which exhibits leukocyte elastase inhibiting properties and a second site which exhibits inhibitory activity against trypsin.
  • the recombinant inhibitor produced by the present invention is believed to be remarkably resistant to denaturation by heat and acids and resistant to proteolytic degradation by a variety of proteolytic enzymes.
  • "recombinant inhibitor” refer to a protease in ⁇ hibitor which is produced by recombinant DNA methodology and techniques.
  • the active form of the recombinant in ⁇ hibitor of the present invention is thermodynamically stable under conditions that are normally encountered extracellularly in the mammalian body. Denatured forms of the recombinant protease inhibitor also have the ability to form the disulfide bonds and to form the non-covalent interactions necessary to assume an active tertiary structure in the absence of biochemical stimulus.
  • DNA sequences of the present invention are capable of directing synthesis of a protein which differs greatly from other published leukocyte elastase inhibitor sequences.
  • identification of the DNA sequence of the present invention has made possible the invention of recombinant DNA methods of manufacturing the novel recombinant protease inhibitors disclosed herein.
  • This invention relates to recombinant DNA methods for the manufacture of protease inhibitors generally and, more spe ⁇ cifically, to the manufacture of recombinant inhibitors directed to human polymorphonuclear (PMN)-granulocyte proteases.
  • PMN polymorphonuclear
  • this invention relates to recombinant DNA methods for the manufacture of inhibitors for human serine proteases, including leukoctye elastase and trypsin.
  • the present invention relates to recombinant DNA methods for the manufacture of analogs of the in stant serine protease inhibitors.
  • the present invention also re lates to synthetic and natural DNA sequences useful in the recombinant DNA methods as set forth below.
  • These inhibitors possess activity which is biologically equivalent to that activity exhib ited by native leukocyte elastase or trypsin inhibitors isolated from human parotid secretions .
  • a DNA sequence has been discov ⁇ ered which is capable of directing the production, by recombinant DNA methodology, of protease inhibitors which, in their active forms, are single-polypeptide-chain proteins that exhibit serine protease inhibitor activity.
  • protease inhibitors which, in their active forms, are single-polypeptide-chain proteins that exhibit serine protease inhibitor activity.
  • These recombinant protease inhib ⁇ itors are remarkably resistant to denaturation by heat and acids.
  • these protease inhibitors retain their biological activity even after exposure to many proteolytic enzymes, such as chymotrypsin, mouse submaxillary protease and clostripain.
  • the coding strand of a DNA sequence which has been dis ⁇ covered to direct manufacture of these recombinant serine pro ⁇ tease inhibitors is : 5 ' AGCGG TAAAA GCTTC AAAGC TGGCG TATGC CCGCC
  • GAAAA CCGGG TAAAT GCCCG GTAAC CTATG GCCAG
  • the nucleotides represented by the foregoing abbrevia ⁇ tions are set forth in the Detailed Description of the Preferred Embodiment.
  • the coding strand for a second, preferred DNA sequence which has been discovered to direct manufacture of these recombinant serine protease inhibitors, particularly a secretory leukocyte protease inhibitor (SLPI) of the present invention is: 5' TCTGG TAAAA GCTTC AAAGC TGGCG TATGC CCGCC
  • GAAAA CCGGG TAAAT GCCCG GTAAC CTATG GCCAG
  • a recombinant DNA method which results in microbial manufacture of the in ⁇ stant serine protease inhibitors using either the natural or syn ⁇ thetic DNA sequences referred to above.
  • This recombinant DNA method comprises:
  • the synthetic DNA sequences useful in the processes of the present invention may be prepared by polynucleotide synthesis and sequencing techniques known to those of ordinary skill in the art.
  • the natural DNA sequences useful in the foregoing process may be identified and isolated through a method comprising:
  • pharmaceutically useful analogs of the serine protease inhibitor may be produced by the above-recited recombinant DNA method by altering the synthetic DNA sequence or the natural DNA segment, through recombinant DNA techniques, to create a gene capable of inducing expression of the desired analog when cloned into an appropriate vector and transferred into an appropriate host microorganism.
  • Figure 1 is a map of plasmid pSGE ⁇ .
  • Figure 2 is a map of plasmid pSGE8.
  • Figure 3 is a map of plasmid pGS285.
  • Figure 4 is a map of plasmid pGS485. DESCRIPTION OF THE PREFERRED EMBODIENTS
  • the present invention relates to pro ⁇ tease inhibitors which have been isolated in a purified form.
  • the serine protease inhibitors of the present inven ⁇ tion are single-polypeptide-chain proteins which are substantial ⁇ ly homologous to, and most preferably biologically equivalent to, native serine protease inhibitors isolated from human parotid se ⁇ cretions .
  • compositions are capable of preventing protease induced tissue damage of the same type, but not necessarily to the same degree, as the native pro ⁇ tease inhibitor.
  • substantially homologous as used throughout the ensuing specification and claims, is meant a de ⁇ gree of homology to the native parotid inhibitor in excess of that displayed by previously reported single-polypeptide-chain serine protease inhibitor proteins.
  • the degree of homology is in excess of 40%, most preferably in excess of 50%, with a particularly preferred group of proteins being in excess of 60% homologous with the native parotid inhibitor.
  • the per ⁇ centage homology as above described is calculated as the percent ⁇ age of the components found in the smaller of the two sequences that may also be found in the larger of the two sequences, a com ⁇ ponent being understood as a sequence of four, contiguous amino . acids.
  • Preferred protease inhibitors produced by the present recombinant methods are described in United States Patent Appli ⁇ cation Serial No. 678,823 of Robert C. Thompson et al. entitled “Serine Protease Inhibitors and Methods for Isolation of Same," filed December 6, 1984 and United States Patent Application Seri ⁇ al No. of Robert C. Thompson et. al . entitled "Serine
  • protease inhibitors are remarkably re ⁇ sistant to denaturation by heat and acids and resistant to loss of activity when exposed to many proteolytic enzymes, including chymotrypsin, mouse submaxillary protease and clostripain.
  • inhibitors also have the ability to form the necessary disulfide bonds and undergo appropriate non-covalent interactions to assume an active tertiary structure capable of expressing serine protease inhibitor activity in the absence of a biochemical stim ⁇ ulus or, if the disulfide bonds have been broken and the non- covalent interactions have been disrupted, to re-form such bonds and interactions to regain such active tertiary structure in the absence of biochemical stimulus.
  • a preferred serine protease inhibitor having these characteristics has been sequenced.
  • the sequence was determined to be as follows :
  • protease inhibitors manu ⁇ factured by the recombinant DNA methods disclosed herein have more than one distinct domain.
  • more than one distinct domain it is meant that the protein has multiple active sites which are functional against different enzymes . The presence and location of these sites have been determined by the discovery of a sub ⁇ stantial homology between at least two portions of the protease inhibitor. It is believed that the presence of distinct domains confers on the instant protease inhibitors the ability to inhibit a wide variety of serine proteases that includes both leukocyte elastase and trypsin.
  • protease in ⁇ hibitors may serve as frameworks on which various other active sites may be constructed to create protease inhibitors having additional properties.
  • the preferred embodiment of the present invention involves production of a protease inhibitor that inhib ⁇ its leukocyte elastase, cathepsin G, pancreatic elastase and trypsin.
  • protease inhibitor that inhib ⁇ its leukocyte elastase, cathepsin G, pancreatic elastase and trypsin.
  • amino acid-side chain changes required to attain these goals are suggested by certain elements of structural simi ⁇ larity between the preferred inhibitor produced by the present invention and other serine protease inhibitors for which the important functional part of the inhibitor has been elucidated through X-ray crystallography. Those elements of structural sim ⁇ ilarity incude amino acids 17 to 29 and amino acids 70 to 83 of the preferred serine protease inhibitor produced by the present invention described above.
  • the changes suggested to improve the inhibitor's activity, either in terms of quantity or quality, to ⁇ ward trypsin-like serine proteases include changing one or more of amino acid 20 from Arg to Lys, amino acid 72 or 74 from Leu to Lys or Arg, and amino acid 73 from Met to Lys or Arg.
  • the changes suggested to improve the inhibitor's activ ⁇ ity, either in terms of quantity or quality, toward chymotrypsin- like serine proteases, including cathepsin G, include changing one or more of amino acid 20 from Arg to Phe, Tyr or Trp, amino acid 72 or 74 from Leu to Phe, Tyr or Trp, and amino acid 73 from Met to Phe, Tyr, or Trp.
  • the changes suggested to improve the inhibitor's activ ⁇ ity, either in terms of quantity or quality, toward pancreatic- elastase-like serine proteases include changing one or more of amino acid 20 from Arg to Ala, amino acid 72 or 74 from Leu to Ala, and amino acid 73 from Met to Ala.
  • substitution of dis ⁇ crete amino acids or of discrete sequences of amino acids may enhance either the leukocyte elastase inhibitor properties or the trypsin inhibitory properties of the present protease inhibitors while sacrificing some activity of the unen- hanced domain. Indeed, the activity of any domain within the in ⁇ hibitor protein may be eliminated entirely by appropriate amino ⁇ acid substitutions, thereby creating inhibitor proteins which ar specific for one or some subset of the enzymes against which the protein is normally active.
  • substitution of Gly fo Arg in position 20 deactivates the trypsin inhibitory domain while substitution of Gly for Met in the 73 position or for Leu in the 72 or 74 position deactivates the leukocyte elastase in ⁇ hibitory domain.
  • the domains may also be separated into separate proteins, each of which retains the desired inhibitory functions.
  • the present inventors have discovered a synthetic DNA sequence which is capable of directing intracellular production of the above-discussed protease inhibitors.
  • This sequence has the following structure:
  • the present inventors have discovered a second, pre ⁇ ferred synthetic DNA sequence which is capable of directing ex ⁇ tracellular production of the above-discussed protease inhib ⁇ itors, particularly the secretory leukocyte protease inhibitor (SLPI) referred to above.
  • This sequence has the following struc ⁇ ture:
  • R, and R- are the same or different and are selected from the group consisting of a substituted or unsubstituted amino acid residue or derviative thereof;
  • R ⁇ , R 3 , R4, Re Rg, Rn and R g are the same or different and are selected from the group consisting of methionine, valine, alanine, phenylalanine, tyrosine, tryptophan, lysine, glycine and arginine.
  • DNA sequence set forth above represents a preferred embodiment of the present invention. Due to the degeneracy of the genetic code, it is to be understood that numerous choices of nucleotides may be made which will lead to a DNA sequence capable of directing production of the instant protease inhibitors or their analogs. As such, DNA sequences which are functionally equivalent to the sequence set forth above or which are functionally equivalent to sequences which would direct production of analogs of the protease inhibitor produced pursuant to the amino acid sequence set forth above, are- intended to be encompassed within the present invention.
  • the following diagram represents addi ⁇ tional DNA sequences which are intended to be included within the scope of the present invention for manufacture of the preferred amino acid sequence enumerated above.
  • the example for determining equivalent DNA sequences for production of this protein those of ordinary skill in the art will be able to de ⁇ termine equivalent DNA sequences for production of analogs of the preferred amino acid sequence as well.
  • codons for use in the synthetic DNA se ⁇ quences of the present invention including that set forth imme ⁇ diately above, it is preferred that the codons used to indicate a particular amino acid be those which are associated with highly expressed proteins . Examples of these preferred codons are set forth in part in Grantham, R. et al . , "Codon Catalog Usage Is a Genome Strategy Modulated For Gene Expressivity" in Nucleic Acids Research 9_:r43 (1981).
  • the preferred DNA sequence of the present invention was chosen by selecting Escherichia coli sequence codons for any of the degenerate sequences.
  • nucleotide sequences are selected which, if possible, create restriction endonuelease sites at, or close to, positions in the synthetic DNA sequence into which it may be desired to insert additional codons or at which sites it may be desired to replace a codon so that analogs may be created.
  • the restriction sites are indicated below the nucleotide sequence set forth above.
  • Methods of creating the synthetic DNA sequences contem ⁇ plated herein are generally within the ambit of routine tasks performed by one of ordinary skill in the art guided by instant disclosure.
  • An example of a suitable method which may be used to obtain the synthetic DNA sequence disclosed herein is set forth in Matteacci, M.D. and Caruthers, M.H., J.Am.Chem.Soc. 103:3185 (1981) and Beaucage, S.L. and Caruthers, M.H., Tetrahedron Lett. 2_2:1859 (1981), both of which are specifically incorporated here ⁇ in by reference.
  • a suitable method which may be used to obtain the synthetic DNA sequence disclosed herein is set forth in Matteacci, M.D. and Caruthers, M.H., J.Am.Chem.Soc. 103:3185 (1981) and Beaucage, S.L. and Caruthers, M.H., Tetrahedron Lett. 2_2:1859 (1981), both of which are specifically
  • DNA sequence has been isolated from a human genomic library which encodes a preferred secretory leukocyte protease inhibitor (SLPI) of the present invention.
  • This sequence encoding from the fourth codon and including the introns as presently known to the inventors, is as follows:
  • a synthetic DNA sequence can be constructed, that, when added to the genomic sequence above, leads to a gene which codes for the entire protease inhibitor.
  • probes may be constructed using the DNA sequence set forth above and used to retrieve a DNA segment from a human genomic library which has codons for the first three amino acids.
  • probes may be used to identify a human genomic sequence which contains an appropriate leader se ⁇ quence. It is contemplated that this leader sequence, or any other appropriate leader sequence, could be used in conjunction with this genomic DNA sequence in a mammalian expression system.
  • a cDNA clone has been isolated from a parotid library which encodes a DNA sequence capable of directing intracellular produc ⁇ tion of a preferred secretory leukocyte protease inhibitor of the present invention.
  • This clone is included on on de ⁇ posit at American Type Culture Collection, Rockville, Maryland, under Accession No. .
  • a recombinant DNA method for the manufacture of a pro ⁇ tease inhibitor composed of a single polypeptide chain with at least one active site possessing serine protease inhibitor activ ⁇ ity has been disclosed.
  • the active site functions in a manner biologically equivalent to that of the native leukocyte elastase inhibitor isolated from human parotid secretions.
  • Synthetic DNA sequences contemplated for use in this method have been discussed in detail above. It is further con ⁇ templated, in an alternative embodiment, that natural DNA se ⁇ quences may also be used in this method. These sequences included cDNA or genomic DNA segments. In a preferred version of this em bodiment, it is contemplated that the natural DNA sequence will be obtained by' a method comprising:
  • the vectors contemplated for use in the present inven ⁇ tion include any vectors into which a DNA sequence as discussed above can be inserted, along with any preferred or required oper ⁇ ational elements, and which vector can then be subsequently transferred into a host microorganism and replicated in such mi ⁇ croorganism.
  • Preferred vectors are those whose restriction sites have been well documented and which contain the operational ele ⁇ ments preferred or required for transcription of the DNA se ⁇ quence.
  • the "operational elements,” as discussed herein, in ⁇ clude at least one promoter, at least one operator, at least one leader sequence, at least one Shine-Dalgarno sequence, at least one terminator codon, and any other DNA sequences necessary or preferred for appropriate transcription and subsequent translation of the vector DNA.
  • such vectors will contain at least one origin of replication recognized by the host microorganism along with at least one selectable marker and at least one promoter sequence capable of initiating transcription of the synthetic DNA sequence. It is additionally preferred that the vector, in one embodiment, con ⁇ tains certain DNA sequences capable of functioning as regulators, and other DNA sequences capable of coding for regulator protein.
  • regulators serve to prevent expression of the synthetic DNA sequence in the presence of certain environ ⁇ mental conditions and, in the presence of other environmental conditions, allow transcription and subsequent expression of the protein coded for by the synthetic DNA sequence.
  • regulatory segments be inserted into the vector such that expression of the synthetic DNA will not occur in the absence of, for example, is ⁇ propylthio- -d-galactoside.
  • the transformed microorganisms containing the synthetic DNA may be grown to a desired density prior to initia ⁇ tion of the expression of the protease inhibitor.
  • expression of the desired protease inhibitor is induce by addition of a substance to the microbial environment capable of causing expression of the DNA sequence after the desired den ⁇ sity has been achieved.
  • an appropriate se ⁇ cretory leader sequence be present, either in the vector or at the 5' end of the synthetic DNA sequence.
  • the leader sequence i in a position which allows the leader sequence to be immediately adjacent to the initial portion of the nucleotide sequence capa ⁇ ble of directing expression of the protease inhibitor without an intervening translation termination signals.
  • leader sequence The presence of th leader sequence is desired in part for one or more of the follow ing reasons: 1) the presence of the leader sequence may facili tate host processing of the initial product to the mature recom ⁇ binant protease inhibitor; 2) the presence of the leader sequenc may facilitate purification of the recombinant protease inhib ⁇ itors, through directing the protease inhibitor out of the cell cytoplasm; 3) the presence of the leader sequence may affect the ability of the recombinant protease inhibitor to fold to its active structure through directing the protease inhibitor out of the cell cytoplasm.
  • the leader sequence may direct cleavage of the initial translation product by a leader peptidase to re ⁇ move the leader sequence and leave a polypeptide with the pre- fered amino acid sequence which has the potential of serine pro ⁇ tease inhibitory activity.
  • the presence of the appropriate leader sequence will allow transport of the completed protein into the periplasmic space, as in the case of ]_ _ coli.
  • the appro ⁇ priate leader sequence will allow transport of the protein through the cell membrane and into the extracellular medium. In this situation, the protein may be purified from extracellular protein.
  • the presence of the leader se ⁇ quence may be necessary to locate the completed protein in an en ⁇ vironment where it may fold to assume its active structure, which structure possesses the appropriate elastase-inhibitor activity.
  • Additional operational elements include, but are not limited to, ribosome binding sites and other DNA sequences neces ⁇ sary for microbial expression of foreign proteins.
  • the sequence GAGGCGCAAAAA(ATG) would be used as the ribosome binding site.
  • the operational elements as discussed herein are routinely se ⁇ lected by those of ordinary skill in the art in light of prior literature and the teachings contained herein. General examples of these operational elements are set forth in B. Lewin, Genes, Wiley & Sons, New York (1983), which is specifically incorporated herein by reference.
  • the vectors as contemplated herein may be constructed in part from portions of plasmids pBR322 and/or pIQ.
  • an additional DNA sequence is located immediately preceding the synthetic DNA sequence which codes for the protease inhibitor.
  • the additional DNA sequence is capable of functioning as a translational coupler, i.e., it is a DNA sequence that encodes an RNA which serves to position ribosomes immediately adjacent to the ribosome binding site of the protease inhibitor RNA with which it is contiguous .
  • the translational coupler may be derived using the DNA se ⁇ quence TAACGAGGCGCAAAAAATGAAAAAGACAGCTATCGCGATCGGAGTGTAAGAAATG and methods currently known to those of ordinary skill in the art related to translational couplers.
  • a second, preferred transla ⁇ tional coupler has the DNA sequence TAACGAGGCGCAAAAAATGAAAAAGACAGCTATCGCGATCAAGGAGAAA AAATG.
  • the vector is assembled by methods generally known to those of ordinary skill in the art. Assembly of such vectors is believed to be within the duties and tasks performed by those with ordinary skill in the art and, as such, is capable of being performed without undue experimentation.
  • similar DNA se ⁇ quences have been ligated into appropriate cloning vectors, as set forth in Schoner et al . , Proceedings of the National Academy of Sciences U.S.A., 81_:5403-5407 (1984), which is specifically incorporated herein by reference.
  • the host organism would produce greater amounts per vector of the desired protease inhibitor.
  • the number of multiple copies of the DNA se ⁇ quence which may be inserted into the vector is limited only by the ability of the resultant vector, due to its size, to be transferred into and replicated and transcribed in an appropriate host microorganism.
  • the vector contain a selectable marker, such as a drug resistance marker or other marker which causes expression of a selectable trait by the host microorganism.
  • a selectable marker such as a drug resistance marker or other marker which causes expression of a selectable trait by the host microorganism.
  • the gene for tetracy ⁇ line resistance is pref ⁇ erably included on the cloning vector.
  • a drug resistance or other selectable marker is intended in part to facilitate in the selection of transformants.
  • the presence of such a selectable marker on the cloning vector may be of use in keeping contaminating microorga ⁇ nisms from multiplying in the culture medium. In this embodi ⁇ ment, such a pure culture of the transformed host microorganisms would be obtained by culturing the microorganisms under condi ⁇ tions which require the induced phenotype for survival .
  • the vector thus obtained is then transferred into the appropriate host microorganism. It is believed that any micororganism having the ability to take up exogenous DNA and ex ⁇ press those genes and attendant operational elements may be cho ⁇ sen. It is preferred that the host microorganism be a faculta ⁇ tive anaerobe or an aerobe. Particular hosts which may be preferable for use in this method include yeasts and bacteria. Specific yeasts include those of the genus Saccharomyces, and es ⁇ pecially Saccharomyces cerevisiae. Specific bacteria include those of the genera Bacillus, Escherichia, and Pseudomonas, espe ⁇ cially Bacillus subtilis and Escherichia coli.
  • the vector is transferred into the host organism using methods generally known by those of ordinary skill in the art. Examples of such methods may be found in Advanced Bacterial Genetics by R. W. Davis et al. , Cold Spring Harbor Press, Cold Spring Harbor, New York, (1980), which is specifically incorporated herein by reference. It is preferred, in one embodiment, that the transformation occur at low temperatures, as temperature regulation is contemplated as a means of regulating gene expression through the use of opera ⁇ tional elements as set forth above. In another embodiment, if osmolar regulators have been inserted into the vector, regulation of the salt concentrations during the transformation would be re ⁇ quired to insure appropriate control of the synthetic genes.
  • the cloning vector first be transferred into Escherichia coli, where the vector would be allowed to replicate and from which the vector would be obtained and purified after amplification. The vector would then be transferred into the yeast for ultimate expression of the serine protease inhibitor.
  • the host microorganisms are cultured under conditions appropriate for the expression of the serine protease inhibitor. These conditions are generally specific for the host organism, and are readily determined by one of ordinary skill in the art, in light of the published literature regarding the growth condi ⁇ tions for such organisms, for example Sergey's Manual of Determinative Bacteriology, 8th Ed., Williams & Wilkins Company, Baltimore, Maryland, which is specifically incorporated herein by reference.
  • any conditions necessary for the regulation of the ex ⁇ pression of the DNA sequence, dependent upon any operational ele ⁇ ments inserted into or present in the vector, would be in effect at the transformation and culturing stages.
  • the cells are grown to a high density in the presence of appro ⁇ priate regulatory conditions which inhibit the expression of the DNA sequence.
  • the envi ⁇ ronmental conditions are altered to those appropriate for expres ⁇ sion of the synthetic- DNA sequence. It is thus contemplated that the production of the protease inhibitor will occur in a time span subsequent to the growth of the host cells to near optimal density, and that the resultant protease inhibitor will be har ⁇ vested at some time after the regulatory conditions necessary for its expression were induced.
  • the recombinant protease inhibitor is purified subsequent to harvest ⁇ ing and prior to assumption of its active structure. This em ⁇ bodiment is preferred as the inventors believe that recovery of high yield of re-folded protein is facilitated if the protein is first purified.
  • the protease inhibitor may be allowed re-fold to assume its active structure prior to purification.
  • the protease inhibitor is present in its re-folded, active state upon recovery from the culturing medium.
  • the protease inhibitor will assume its proper, active structure upon expression in the host microorganism and transport of the protein through the cell wall or membrane or into the periplasmic space. This will generally occur if DNA coding for an appropriate leader sequence has been linked to the DNA coding for the recombinant protein. If the protease inhibitor does not assume its proper, active structure, any disulfide bonds which have formed and/or any noncovalent in ⁇ teractions which have occurred will first be disrupted by denaturing and reducing agents, for example, guanidinium chloride and -mercaptoethanol, before the protease inhibitor is allowed to assume its active structure following dilution and oxidation of these agents under controlled conditions.
  • denaturing and reducing agents for example, guanidinium chloride and -mercaptoethanol
  • a tac promoter for initiatio of transcription at high levels
  • a lac operator for transcriptio regulation
  • a lac repressor lae I g
  • an OmpA Shine-Dalgarno sequence to initiate transla tion at a high level
  • an OmpA leader to facilitate periplasmic export of the product
  • an Ala of an Ala-Ser junction between the protein sequence encoded by these operator elements and that encoded by the structural genes described above to dictate cleav ⁇ age of the initial product to yield the mature leukocyte elastase inhibitor All of these features are incorporated into the fol ⁇ lowing DNA sequence:
  • CTGCA GCTGT TGACA ATTAA TCATC GGCTC GTCTC GTATA ATGTG ATAAC GAGGC GCAAA AAATG AAAAA GACAG CTATC GCGAT CGCAG TGGCA CTGGC TGGTT TCGCT ACCGT AGCGC AGGCC.
  • the fol ⁇ lowing operational elements are proposed: the tac promoter; the lac operator, and the lac repressor (lac i") ; a consensus of Shine-Dalgarno sequences; and, to initiate a high level of trans ⁇ lation, a fragment of the OmpA leader peptide to be used as a translational coupler.
  • the translational coupling sequence com ⁇ prises the DNA coding for the translation initiation region of the OmpA gene, the first eight amino acids of the OmpA leader peptide, the consensus Shine-Dalgarno sequence described above and a translational terminator.
  • the translational coupling se ⁇ quence is to be inserted between the promoter and the translation initiation site of the serine protease inhibitor gene, overlapping the latter. All of these features are incorporated into the following DNA sequence:
  • CTGCA GCTGT TGACA ATTAA TCATC GGCTC GTCTC GTATA ATGTG ATAAC GAGGC GCAAA AAATG AAAAA GACAG CTATC GCGAT CGGAG TGTAA GAAAT G.
  • the following deoxy- ribonucleotides are synthesized using the ABI DNA synthesizer (Foster City, California). The products are purified by polyacrylamide gel electrophoresis as described in the ABI in ⁇ strument manual. They are 5' phosphorylated using T4 polynucleotide kinase and ATP using standard means.
  • fragment Aa The following group of oligonucleotide sequences are used to construct fragment Aa.
  • Oligonucleotide Aal is: GCTGT TGACA ATTAA TCAT.
  • Oligonucleotide Aa2 is: CGGCT CGTAT AATGT GTGGA ATTGT GAGCG GATAA CAATT T.
  • Oligonucleotide Aa3 is: CACAC ATAAC GAGGC GCAAA AA.
  • Oligonucleotide Aa4 is: ATGAA AAAGA CAGCT ATCGC GATCG.
  • Oligonucleotide Aa5 is: CAGTG GCACT GGCTG GTTTC GCTAC CGTAG CGCAG GCCAG CGGTA AA.
  • Oligonucleotide Aa6 is: GAGCC GATGA TTAAT TGTCA ACAGC TGCA.
  • Oligonucleotide Aa7 is: TCCGC TCACA ATTCC ACACA TTATA C.
  • Oligonucleotide Aa8 is: CCTCG TTATG TGTGA AATTG TTA.
  • Oligonucleotide Aa9 is: GCCAC TGCGA TCGCG ATAGC TGTCT TTTTC ATTTT TTGCG.
  • Oligonucleotide AalO is: AGCTT TTACC GCTGG CCTGC GCTAC GGTAG CGAAA CCAGC CAGT. The following oligonucleotide sequences are assembled to make up fragment Ab.
  • Nucleotide Abl is: GCTGT TGACA ATTAA TCAT.
  • Nucleotide Ab2 is: CGGCT CGTAT AATGT GTGGA ATTGT GAGCG GATAA CAATT T.
  • Nucleotide Ab3 is: CACAC ATAAC GAGGC GCAAA AA.
  • Nucleotide Ab4 is: ATGAA AAAGA CAGCT ATCGC GATCG.
  • Nucleotide Ab5 is : GAGTG TAAGA AATGA GCGGT AAA.
  • Nucleotide Ab6 is: GAGCC GATGA TTAAT TGTCA ACAGC TGCA.
  • Nucleotide Ab7 is: TCCGC TCACA ATTCC ACACA TTATA C.
  • Nucleotide Ab8 is: CCTCG TTATG TGTGA AATTG TTA.
  • Nucleotide Ab9 is: AGCTT TTACC GCTCA TTTCT TACAC TCCGA TCGCG ATAGC TGTCT TTTTC ATTTT TTGCG. The following are the oligonucleotide sequences assembled to con ⁇ struct fragment B.
  • Oligonucleotide Bl is: AGCTT CAAAG CTGGC GTATG CCCGC CGAAA AAATC CGCG.
  • Oligonucleotide B2 is: CAGTG TCTGC GGTAC AAAAA ACCGG AATGC CAG.
  • Oligonucleotide B3 is: TCCGA CTGGC AGTGC CCGGG TAAAA AACGT TGTTG C.
  • Oligonucleotide B4 is: CCGGA CACCT GCGGC ATCAA ATGCC TG.
  • Oligonucleotide B5 is: GATCC AGGCA TTTGA TGCCG CAGGT GTCCG GGCAA CAACG TTTTT TACCC GGGCA.
  • Oligonucleotide B6 is: CTQCC AGTCG GACTG GCATT CCGGT TTTTT GTACC G.
  • Oligonucleotide B7 is: CAGAC ACTGC GCGGA TTTTT TCGGC GGGCA TACGC CAGCT TTGA. The following are the oligonucleotide sequences used to construct fragment C.
  • Oligonucleotide Cl is: GATCC GGTTG ATACC CCGAA CCCG.
  • Oligonucleotide C2 is: ACTCG TCGAA AA.
  • Oligonucleotide C3 is: CCGGG TAAAT GCCCG GTAAC CTATG GC.
  • Oligonucleotide C4 is: CAGTG TCTGA TGCTG AACCC GCCGA AC.
  • Oligonucleotide C5 is: TTCTG CGAAA TGGAC GGCCA GTGTA AACGA GAT.
  • Oligonucleotide C6 is: CTAGA TCTCG TTTAC ACTGG CCGTC CATTT CGCAG AAGT .
  • Oligonucleotide C7 is: CGGCG GGTTC AGCAT CAGAC ACTGG CCATA GGTTA CCGGG CA.
  • Oligonucleotide C8 is: TTTAC CCGGT TTTCG ACGAG TCGGG TT.
  • Oligonucleotide C9 is: CGGGG TATCA ACCG. The following group of oligonucleotide sequences are assembled to form fragment D.
  • Oligonucleotide Dl is: GATCT GAAAT GCTGT ATGGG TATGT GCGGC.
  • Oligonucleotide D2 is: AAATC TTGTG TTTCC CCGGT AAAAG CATAA G.
  • Oligonucleotide D3 is: TCGAC TTATG CTTTT ACCGG GGAAA CACAA GATTT GCCGC A.
  • Oligonucleotide D4 is: CATAC CCATA CAGCA TTTCA.
  • oligonucleotides are mixed and annealed under standard conditions and ligated to each other and to cloning and sequencing vectors M13 mpl8 and 19 cut with appro ⁇ priate restriction endonucleases using T4 DNA ligase under stan ⁇ dard conditions.
  • the products are used to transform E. coli JM105 and clones containing the DNA of interest are selected from white plaques in IPTG- Xgal plates, and further screened by hy- b ⁇ dization with 32P labelled oligonucleotides selected from the group used in the annealing step.
  • the insert structure is con ⁇ firmed by dideoxy sequencing of the cloned DNA using a universal primer.
  • Group Aa contains oligonucleotides Aal-AalO which are ligated to Ml3 mpl8 and 19 cut with Pstl and Hindlll.
  • Group Ab contains oligonucleotides Abl-Ab9, which are ligated to M13 mpl8 and 19 cut with Pstl and Hindlll.
  • Group B which contains oligonucleotides Bl to B7, is ligated to M13 mpl8 and 19 cut with Hindlll and BamHI.
  • Group C which contains oligonucleotides Cl to C9, is ligated to M13 mpl8 and 19 cut with BamHI and Xbal .
  • Group D which contains oligonucleotides Dl to D4, is ligated to M13 mpl8 and 19 cut with BamHI and Sail.
  • M13 replicative form DNA is recovered from the clone having the desired insert DNA by standard means .
  • the insert DNA corresponding to Group Aa is excised from the M13 DNA by cutting the DNA with appropriate restriction endonucleases and is purified by polyacrylamide gel electrophoresis. Its structure is: AATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGCTG GCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCGAC
  • the insert DNA corresponding to Group Ab is excised by cutting the DNA with restriction endonucleases EcoRI and Hindlll and is purified by polyacrylamide gel electrophoresis. Its structure is:
  • the insert DNA corresponding to Group B is excised by cutting the DNA with restriction endonucleases Hindlll and BamHI and is purified by polyacrylamide gel electrophoresis. Its structure is:
  • the insert DNA corresponding to Group C is excised by cutting the DNA with restriction endonucleoases BamHI and Bglll and is purified by polyacrylamide gel electrophoresis. Its structure is:
  • the insert DNA corresponding to Group D is excised by cutting the DNA with restriction endonucleases SauIIIA and Sail and is purified by acrylamide gel electrophoresis. Its structur is:
  • the inserts from group Aa, B, C, and D are combined and ligated to M13 mpl8 and 19 cut with EcoRI and Sail using T4 DNA ligases under standard condi ⁇ tions.
  • the clones containing the gene are selected by their color on Xgal plates and screened further by hybridization with the 32p labelled oligonucleotide. The structure of selected clones is confirmed by dideoxy sequencing of the insert region of the DNA using the universal primer.
  • the in ⁇ serts from groups Ab, B, C, and D are combined and ligated to M13 mpl8 and 19 cut with EcoRI and Sail using T4 DNA ligase under standard conditions.
  • the clones containing the genes are se ⁇ lected by their color on Xgal plates and screened further by hy- bridization with the 32P labelled insert.
  • the structures of se ⁇ lected clones are confirmed by dideoxy sequencing of the insert region of the DNA using the universal primer.
  • a tac promoter on plasmid pKK223-3 for initiation of transcription at high levels a lac operator on plasmid pKK223-3 for transcription regulation; a lac repressor ( lac i") , to be encoded on the chromosome of E.
  • coli strain JM107 an OmpA Shine-Dalgarno sequence to initiate trans ⁇ lation at a high level; an OmpA leader to facilitate periplasmic export of the product; an Ala of an Ala-Ser junction between the protein sequence encoded by these operator elements and that encoded by the structural genes described above to dictate cleav ⁇ age of the initial product to yield the mature leukocyte elastase inhibitor.
  • the ompA elements are incorporated into the following DNA sequence:
  • the fol ⁇ lowing operational elements are proposed: the tac promoter on plasmid pKK223-3; the lac operator of plasmid pKK223-3 and the lac repressor (lac i") on the chromosome of E. coli strain JM107; a consensus Shine-Dalgarno sequence; and, to initiate a high level of translation, a fragment of the OmpA leader peptide to be used as a translational coupler.
  • the translational coupling se ⁇ quence comprises the DNA coding for the translation initiation region of the OmpA gene, the first eight amino acids of the OmpA leader peptide, the consensus Shine-Dalgarno sequence described above and a translational terminator.
  • the translational coupling sequence is to be inserted between the lac operator and the translation initiation site of the serine protease inhibitor gene, overlapping the latter.
  • the features of the translational coupler are incorporated into the following DNA sequence: GAATT CGATA TCTCG TTGGA GATAT TTCAT GACGT ATTTT GGATG ATAAC GAGGC GCAAA AAATG AAAAA GACAG CTATC GCGAT CAAGG AGAAA TAAAT G.
  • the following deoxy- ribonucleotides are synthesized using the ABI DNA synthesizer (Foster City, California). The products are purified by polyacrylamide gel electrophoresis as described in the ABI in ⁇ strument manual. They are 5' phosphorylated using T4 polynucleotide kinase and ATP using standard means.
  • fragment Aa The following group of oligonucleotide sequences are used to construct fragment Aa.
  • Oligonucleotide Aal is : AATTCGATATCTCGTTGGAGATATTCATGACGTATTTTGGATGATAACGAGGCGCAAAA.
  • Oligonucleotide Aa2 is: ATGAAAAAGACAGCTATCGCGATCG.
  • Oligonucleotide Aa3 is: GATCCGATCGCGATAGCTGTCTTTTTCATTTTTTGC.
  • Oligonucleotide Aa4 is: GCCTCGTTATCATCCAAAATACGTCATGAATATCTCCAACGAGATATCG.
  • Oligonucleotide Aa5 is: GATCCGATCGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCCTCTGGTAAA.
  • Oligonucleotide Aa6 is : AGCTTTTACCAGAGGCCTGCGCTACGGTAGCGAAACCAGCCAGTGCCACTGCGATCG. The following oligonucleotide sequences are assembled to make up fragment Ab.
  • Oligonucleotide Abl is: AATTCGATATCTCGTTGGAGATATTCATGACGTATTTTGGATGATAACGAGGCGCAAAA.
  • Oligonucleotide Ab2 is: ATGAAAAAGACAGCTATCGCGATCG.
  • Oligonucleotide Ab3 is: GATCCGATCGCGATAGCTGTCTTTTTCATTTTTTGC.
  • Oligonucleotide Ab4 is: GCCTCGTTATCATCCAAAATACGTCATGAATATCTCCAACGAGATATCG.
  • Oligonucleotide Ab5 is: CAAGGAGAAATAAATGAGCGGTAAA.
  • Oligonucleotide Ab6 is: AGCTTTTACCGCTCATTTATTTCTCCTTGAT. The following are the oligonucleotide sequences assembled to con ⁇ struct fragment B.
  • Oligonucleotide Bl is: AGCTT CAAAG CTGGC GTATG CCCGC CGAAA AAATC CGCG.
  • Oligonucleotide B2 is: CAGTG TCTGC GGTAC AAAAA ACCGG AATGC CAG.
  • Oligonucleotide B3 is : TCCGA CTGGC AGTGC CCGGG TAAAA AACGT TGTTG C.
  • Oligonucleotide B4 is: CCGGA CACCT GCGGC ATCAA ATGCC TG.
  • Oligonucleotide B5 is: GATCC AGGCA TTTGA TGCCG CAGGT GTCCG GGCAA CAACG TTTTT TACCC GGGCA.
  • Oligonucleotide B6 is: CTGCC AGTCG GACTG GCATT CCGGT TTTTT GTACC G.
  • Oligonucleotide B7 is: CAGAC ACTGC GCGGA TTTTT TCGGC GGGCA TACGC CAGCT TTGA. The following are the oligonucleotide sequences used to construct fragment C.
  • Oligonucleotide Cl is: GATCC GGTTG ATACC CCGAA CCCG.
  • Oligonucleotide C2 is: ACTCG TCGAA AA.
  • Oligonucleotide C3 is: CCGGG TAAAT GCCCG GTAAC CTATG GC.
  • Oligonucleotide C4 is: CAGTG TCTGA TGCTG AACCC GCCGA AC.
  • Oligonucleotide C5 is: TTCTG CGAAA TGGAC GGCCA GTGTA AACGA GAT.
  • Oligonucleotide C6 is: CTAGA TCTCG TTTAC ACTGG CCGTC CATTT CGCAG AAGTT.
  • Oligonucleotide C7 is: CGGCG GGTTC AGCAT CAGAC ACTGG CCATA GGTTA CCGGG CA.
  • Oligonucleotide C8 is: TTTAC CCGGT TTTCG ACGAG TCGGG TT.
  • Oligonucleotide C9 is: CGGGG TATCA ACCG. The following group of oligonucleotide sequences are assembled to form fragment D.
  • Oligonucleotide Dl is: GATCT GAAAT GCTGT ATGGG TATGT GCGGC.
  • Oligonucleotide D2 is: AAATC TTGTG TTTCC CCGGT AAAAG CATAA G.
  • Oligonucleotide D3 is: TCGAC TTATG CTTTT ACCGG GGAAA CACAA GATTT GCCGC A.
  • Oligonucleotide D4 is: CATAC CCATA CAGCA TTTCA.
  • oligonucleotides are mixed and annealed under standard conditions and ligated to each other and to cloning and sequencing vectors M13 mpl8 and 19 cut with appro ⁇ priate restriction endonucleases using T4 DNA ligase under stan ⁇ dard conditions .
  • the products are used to transform E. coli
  • JM105 and clones containing the DNA of interest are selected by hybridization with 32P labelled oligonucleotides selected from the group used in the annealing step.
  • the insert structure is confirmed by dideoxy sequencing of the cloned DNA using a univer ⁇ sal primer.
  • Oligonucleotides Aal-Aa4 are ligated to M13mpl8 and M13mpl9 cut with EcoRI and BamHI.
  • M13 replicative form DNA having the desired insert DNA is recovered by standard means.
  • the insert DNA is excised from the M13 DNA by cutting the M13 DNA with restriction endonucleases EcoRI and Pvul and is purified by polyacrylamide gel electrophoresis . Its structure is : AATTCGATATCTCGTTGGAGATATTCATGACGTATTTTGGATGATAACGAGGCGCAAAAAATGA GCTATAGAGCAACCTCTATAAGTACTGCATAAAACCTACTATTGCTCCGCGTTTTTTACT AAAAGACAGCTATCGCGAT TTCTGTCGATAGCGC
  • Oligonucleotides Aa5 and Aa6 are ligated to M13mpl8 and ml3mpl9 cut with BamHI and Hindlll.
  • M13 replicative form DNA having the desired insert DNA is recovered by standard means.
  • the insert DNA is excised from the M13 DNA by cutting the DNA with restriction endonucleases Pvul and Hindlll and is purified by polyacrylamide gel electrophoresis. Its structure is: CGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCCTCTGGTAAA TAGCGTCACCGTGACCGACCAAAGCGATGGCATCGCGTCCGGAGACCATTTTCGA
  • This Pvul-Hindlll fragment is combined with the EcoRI-PvuI frag ⁇ ment prepared from oligonucleotides Aal-Aa4 and ligated with M13mpl8 or M13mpl9 cut with EcoRI and Hindlll.
  • M13 replicative form DNA having the desired insert DNA is recovered by standard means.
  • the insert DNA which is DNA Fragment Aa, is excised fro the M13 DNA by cutting the M13 DNA with restriction endonucleases EcoRI and Hindlll and is purified by polyacrylamide gel electrophoresis. Its structure is:
  • Oligonucleotides Abl-Ab4 are ligated to M13mpl8 and M13mpl9 cut with EcoRI and BamHI.
  • M13 replicative form DNA having the desired insert DNA is recovered by standard means .
  • the insert DNA is excised from the M13 DNA by cutting the DNA with restriction endonucleases EcoRI and Pvul and is purified by polyacrylamide gel electrophoresis. Its structure is: AATTCGATATCTCGTTGGAGATATTCATGACGTATTTTGGATGATAACGAGGCGCAAAAAATGA
  • This EcoRI-Pvul fragment is combined with oligonucleotides Ab5 and Ab6 and ligated with M13mpl8 or M13mpl9 cut with EcoRI and Hindlll.
  • M13 replicative form DNA having the desired insert DNA is recovered by standard means.
  • the insert DNA which is Fragmen Ab is excised from the M13 DNA by cutting the DNA with restric ⁇ tion endonucleases EcoRI and Hindlll and is purified by polyacrylamide gel electophoresis. Its structure is: AATTCGATATCTCGTTGGAGATATTCATGACGTATTTTGGATGATAACGAGGCGCAAAAAATGA
  • Group B which contains oligonucleotides Bl to B7, is ligated to M13mp 18 and 19 cut with Hindlll and BamHI.
  • the in ⁇ sert DNA corresponding to Group B is excised by cutting the DNA with restriction endonucleases Hindlll and BamHI and is purified by polyacrylamide gel electrophoresis. Its structure is: AGCTTCAAAGCTGGCGTATGCCCGCCG
  • Group C which contains oligonucleotides Cl to C9, is ligated to M13mp 18 and 19 cut with BamHI' and Xbal.
  • the insert DNA corresponding to Group C is excised by cutting the DNA with restriction endonucleoases BamHI and Bglll and is purified by polyacrylamide gel electrophoresis. Its structure is: GATCCGGTTGATACCCCGAACCCGACT
  • Group D which contains oligonucleotides Dl to D4, is ligated to Ml3mp 18 and 19 cut with BamHI and Sail.
  • the insert DNA corresponding to Group D is excised by cutting the DNA with restriction endonucleases SauIIIA and Sail and is purified by acrylamide gel electrophoresis. Its structure is: GATCTGAAATGCTGTATGGGTATG
  • the inserts from Groups Aa, B, C, and D are combined and ligated to M13 mpl8 and 19 cut with EcoRI and Sail using T4 DNA ligase under standard condi ⁇ tions.
  • the in ⁇ serts from Groups Ab, B, C and D are combined and ligated to M13 mpl8 and 19 cut with EcoRI and Sail using T4 DNA ligase under standard conditions.
  • the clones containing the gene are selected by their color on Xgal plates and screened further by hy- bri .di.zation with the 32P labelled oligonucleotide. The structure of selected clones is confirmed by dideoxy sequencing of the in ⁇ sert region of the DNA using the universal primer.
  • the inserts for the construction for export and the construction for cytoplasmic expression were transferred to ex ⁇ pression plasmids as follows.
  • M13 replicative form DNA having the desired insert DNA is recovered by standard means as indi ⁇ cated above.
  • the appropriate insert DNA is excised from the M13 DNA by cutting the DNA with restriction endonucleases EcoRI and Pstl and is purified by polyacrylamide gel electrophoresis. It is then ligated to pKK223-3 cut with restriction endonucleases EcoRI and Pstl and the resulting plasmid cloned into E. coli JM107.
  • the construction for use in Examples 4 and 5 for export is pSGE6 and that for use in Example 7 for cytoplasmic expression is pSGE8.
  • the E. coli strain for export in Examples 4 and 5 is SGE10 and that for cytoplasmic expression in Example 6 is SGE30.
  • Plasmid pSGE6 was constructed by replacing the DNA be ⁇ tween the EcoRI and Pstl sites of ⁇ KK223-3 with an EcoRl/PstI fragment containing DNA coding for ompA SLPI.
  • the DNA sequence of ompA-SLPI is as follows: 10 20 30 40 50 60 GAATTCGATA TCTCGTTGGA GATATTCATG ACGTATTTTG GATGATAACG AGGCGCAAAA CTTAAGCTAT AGAGCAACCT CTATAAGTAC TGCATAAAAC CTACTATTGC TCCGTTTTTTTTTTTT
  • AAATGCCCGG TAACCTATGG CCAGTGTCTG ATGCTGAACC CGCCGAACTT TTTTGGCCCA TTTACGGGCC ATTGGATACC GGTCACAGAC TACGACTTGG GCGGCTTGAA
  • ompA-SLPI The sequence hereinafter referred to as "ompA-SLPI" is the DNA from the final M13mpl8 construct for export discussed above. Plasmid pSGE ⁇ is depicted in Figure 1.
  • the first codon for ompAss-SLPI is at position 62-64 of the DNA sequence called "ompA-SLPI.”
  • the first codon for mature SLPI is at posi ⁇ tion 125-127.
  • Ptac contains DNA for the tac promoter, lac . opera ⁇ tor and the beta galactosidase Shine/Dalgarno sequence.
  • the abbreviations Rl, Pst and Bam are recognition sequences for the restriction enzymes EcoRI, Pstl and BamHI.
  • Tet r is a part of the gene from pBR322 which confers resistance to tetracycline, amp confers resistance to ampicillin, rrnB contains the DNA from the rrnB operon from position 6416 to position 6840. Arrows indicate the direction of transcription.
  • Plasmid pCJ-ompA-SLPI is the same as pSGE6 except that it contains the complete tetracycline resistance gene and promot ⁇ er rather than the partial gene. This plasmid confers tetracycline resistance when inserted into E. coli and was con ⁇ structed in a analogous fashion to pSGE6 except that the EcoRl/PstI fragment containing DNA coding for ompA SLPI was cloned into vector pCJl rather than pKK223-3.
  • the vector pCJl was constructed as follows. Plasmid pKK223-3 was digested com ⁇ pletely with SphI and partially with BamHI. A 4.4Kbp fragment was gel purified and combined with a synthetic adaptor: GATCTAGAATTGTCATGTTTGACAGCTTATCAT
  • ATCTTAACAGTACAAACTGTCGAATAGTAGC ATCTTAACAGTACAAACTGTCGAATAGTAGC and a 539 bp fragment of DNA from a Clal, SphI digest of the tet gene of pBR322 (PL Biochemicals, 27-4891-01).
  • Plasmid pSGE8 is isogenic to pSGE6 with the exception that the DNA between the EcoRI and Pst sites contains the se ⁇ quence called ompA-tc-met-SLPI which is derived from the final M13mpl8 construct for cytoplasmic expression as discussed above.
  • This sequence directs the synthesis of methionyl-SLPI in the cytoplasm of E. coli.
  • a partial diagram of pSGE8 is contained i Fig. 2. In the sequence called "ompA-tc-met-SLPI, "the initiation codon for ompA is at position 62-64, the termination codon is at 95-97, and the initiation codon for methionyl-SLPI i at 98-100.
  • the DNA sequence of ompA-tc-met-SLPI is as follows:
  • Plasmid pCJ-met-SLPI is the same as pSGE8 except that it contains the complete (rather than the partial) tetracycline resistance gene. Plasmid CJ-met-SLPI was constructed analogously to pSGE8 except that the EcoRl/PstI fragment containing DNA coding for ompA-tc-met-SLPI was cloned into vector pCJl rather than pKK223-3.
  • the plasmid pUC8 was digested with Hindlll and ligated to a Hindlll/Smal adaptor (obtained from Amersham, Cat. No. DA1006). The addition of this adaptor to a Hindlll site does not reconstruct the Hindlll site.
  • the DNA was then digested with Smal and ligated in dilute solution followed by tranformation of E. coli JM83.
  • the correct plasmid i.e., a plasmid lacking the restriction sites in the polylinker from the Hindlll site to the Smal site, was identified by digesting plasmid DNA isolated from transformants with EcoRI, Smal or Hindlll. A transformant con ⁇ taining a plasmid that lacked the Hindlll site but contained the EcoRI site and Smal site was identified in this manner. This plasmid is pGS185.
  • Plasmid pGS285 was digested to completion with Hindlll and religated under dilute conditions to eliminate three of the four internal Hindlll sites in the MF 1 gene as noted by Kurjan Herskowitz, ibid. The correct construct was selcted as describe above. This is plasmid pGS385.
  • the ligation mix was digested with Hindlll and Sail to re lease a fragment purified by agarose gel electrophoresis and electrolution. This fragment was digested once more with Hindll and then ligated with pGS385 DNA that had been cut with Hindlll and Sail. E. coli HB101 was transformed with the ligation mix ⁇ ture and ampicillin resistant transformants were selected. Transformants containing plasmids with the correct insert DNA were identified by preparing plasmid DNA and digesting it with Hindlll and Sail. A plasmid constructed and isolated in this manner has been designated pGS485 and is depicted in Figure 4.
  • This plasmid contains the MF 1 gene fused, in frame, to the syn thetic SLPI gene at the Hindlll site in the first spacer region of the MF 1 gene.
  • Such constructs when placed in yeast, have been demonstrated to direct the synthesis, processing and secre ⁇ tion of the heterologous proteins as shown by A.J. Brake et al ⁇ in PNAS (USA) 8_1_:4642, specifically incorporated herein by refer ence.
  • the fusion of the MF 1 gene and SLPI is contained on an EcoRI fragment in pGS485. This EcoRI fragment was cloned into the vector YIp5 as described in Example 8.
  • SLPI secretory leukocyte protease inhibitor
  • E. coli cells containing plasmid pSGE6 were cultured for 6 hours in 10 liters of M9 media with 2% tryptone, 0.5% yeast extract, 20g/l glucose, 200 mg/l Vitamin B 1 and 100 mg/l ampicillin added. IPTG was added to 0.2mM and the culture grown for another 6 hours.
  • the pellet was resuspended in 2.7 li ⁇ ters T50E4 and frozen in 150ml lots. Eight of these lots (equiv ⁇ alent to 36 gms of cells) were pooled and lysed by a single pass through a french press at 12,000 psi and 4° C. The lysate was centrifuged for 1.5hrs at 20,000 x g. One sixth of the pellet containing the cell insolubles (equivalent to six grams of cells) was washed twice with 125ml of T50E4 and the remaining material was frozen overnight.
  • the frozen pellet was extracted with 25ml of lOOmM Tris.HCl (pH 8.0), 4mM EDTA (hereinafter T100E4) containing 20mM DTT (obtained from Sigma, Cat. No. D-0632), 4mM PMSF (obtained from Sigma, Cat. No. P-7626) and 8M urea (ultrapure, obtained from BRL, Cat. No. 5505UA) for Bit at 37° C. and centrifuged at 10,000 x g for ten minutes.
  • T100E4 4mM EDTA
  • 20mM DTT obtained from Sigma, Cat. No. D-0632
  • 4mM PMSF obtained from Sigma, Cat. No. P-7626
  • 8M urea ultrapure, obtained from BRL, Cat. No. 5505UA
  • the resultant supernatant was mixed with 10ml packed Sephadex SP-C25 (obtained from Pharmacia) which had been pre-equilibrated with the extraction buffer T100E4 con ⁇ taining 20mM DTT and 8M urea and mixed on a roller for ten minutes at 37°C to absorb the SLPI to the SP-Sephadex.
  • the resin with the absorbed SLPI was pelleted by a ten minute centrifuge at 3,000 x g and the supernatant decanted. The remaining resin was washed twice with 25ml of T100E4 containing 20mM DTT and 8M urea followed by two washes with 25ml T100E4 con ⁇ taining 20mM DTT. The resin was then extracted once with a mix ⁇ ture of 0.6ml 5 M NaCl and 25ml of T100E4 containing 20 mM DTT and 0.3 M NaCl. This extract contained about 0.15mg/ml protein and more than 0.04mg/ml SLPI. The SLPI obtained by this method was determined to be greater than 70% pure by high pressure liquid chromatography. EXAMPLE 5
  • Example 4 Using the method of Example 4, a second frozen pellet was extracted with T100E4 containing 1% Triton x-100 (obtained from Sigma, Cat. No. T-6878) in place of the first T100E4/DTT/PMSF/urea wash.
  • T100E4 1% Triton x-100 (obtained from Sigma, Cat. No. T-6878) in place of the first T100E4/DTT/PMSF/urea wash.
  • the resultant SLPI was slightly more pure than that obtained in Example 4 and gave higher activity in the refolding assay set forth in Example 6 below.
  • SLPI partially-purified SLPI from Example 4 or 5 was made 8M in urea or 5M in guanidine hydrochloride (obtained from Pierce Chemical Co., #24110), and 4mM in DTT and incubated for lhr at room temperature.
  • Oxidized glutathione obtained from Sigma, Cat. No. G-4626 was added to 13.5mM and the mixture was again incubated for 1 hr at room temperatrue. The mixture was diluted 10-fold with a solution of 50mM Tris in NaOH, pH10.7 and incubated for a further 4 hrs at room temp.
  • the mixture was then diluted 5-fold with 50mM Tris, pH8.0, and 0.15M NaCl and applied to a 1 x 2 cm column of Sepahdex SP-C25 preequilibrated with 50mM Tris, pH8.0 and 0.25M NaCl.
  • the resin was washed with 50mM Tris, pH 8.0, containing 0.25M NaCl and then with 50mM Tris, pH8.0, containing 0.5M NaCl.
  • the fraction eluting with the 0.5M salt wash was fully active and represented about 30% of the SLPI applied to the column.
  • SLPI expression of the plasmid pSGE8 in E. coli SGE30 cells produced SLPI in both the soluble and insoluble fractions of the cell lysate. At 1% of the total cell protein, the SLPI was dis ⁇ tributed about 80% to the soluble and about 20% to the insoluble fractions .
  • the E. coli SGE30 cells containing pSGE8 were grown in LB Media containing 50 ug/ml ampicillin in a shaker flask to an OD600 of 0.7 and induced by the addition of IPTG to 0.2mM. After three hours the cells are pelleted and were suspended in two A. Purification of SLPI from the insoluble fraction The E. coli SGE30 cells containing pSGE8 were grown in
  • the pellet was washed in three volumes of T50E4 and was solublized at room temperature in a solution containing either 10M urea or 6M guanidine hydrochloride, and 5mM reduced DTT. After a one hour incubation at room temperature, oxidized glutathione was added at a concentration of 17.5mM and the mix ⁇ ture was incubated for another hour. The mixture was then di ⁇ luted into 10 volumes of 50 mM Tris.HCl, pH 10.7. The diluted mixture was allowed to stand for 4 hours at room temperature fol ⁇ lowed by pH adjustment to 8 by the addition of 5 N HCl. This mix ⁇ ture was centrifuged to remove precipitated protein.
  • the supernatant so produced contained SLPI which exhib ⁇ ited secretory leukocyte protease inhibitor activity.
  • This pro ⁇ tein was purified by chromatography on a Sephadex SP-C25 column as described above.
  • E. coli SGE30 cells containing plasmid pSGE8 were grown in a shaker flask to an OD600 of 0.7 and induced by the addition of IPTG to 0.2mM. At an OD600 of 1.1, the cells were pelleted at 25,000 x g for 15 minutes. The pellet was resuspended in T50E4 and was lysed by two passages through a french press at 20,000 psi at 4° C. The lysate was centrifuged at 25,000 x g for 15 minutes .
  • the supernatant was made 25mM in DTT. This mixture was incubated at 0° C. for one hour and sufficient HCl was added to reach a final concentration of 5%. After a 30 minute incubation at 0° C. , the mixture was centrifuged at 25,000 x g for 15 minutes and the supernatant removed for further processing. The pH of the supernatant was adjusted to 8.0 with 10M NaOH and
  • the EcoRI fragment containing the fused SLPI-MF 1 gene was ligated to the EcoRI site of the yeast vector YIp5 as described by D. Botstein and R.W. Davis in The Molecular Biology of the Yeast Saccharomyces, Cold Spring Harbor Laborato ⁇ ry, pp. 607-636 (1982), specifically incorporated herein by ref ⁇ erence, to generate YIpSLPI-1 and has been integrated into the URA3 gene of S. cerevisiae BS214 (MAT , Ura3-52, pep4, prbl ) by site-directed recombination as described by T. Orr-Weaver et al . in Methods in Enzymology 101: 228 (1983), specifically incorpo ⁇ rated herein by reference.
  • This strain carries the MF 1::SLPI fusion on the replicating yeast plasmid pGS585.
  • This plasmid was constructed from pJDB207 as described by J.R. Broach in Methods in Enzymology 101: 307 (1983), specifically incorporated herein by reference, b the addition of the yeast URA3 gene, isolated from the plasmid YEp24 as described by D. Botstein and R.W. Davis in The Molecular Biology of the Yeast Saccharomyces, Cold Spring Harbor Laborato ⁇ ry, pp.
  • the MF 1::SLPI fusion gene contained on an EcoRI fragment, was cloned into the Sail site of pGS585 using EcoRI-XhoI adaptors (obtained from Amersham, Cat. No. DA1007) to generate YEpSLPI-1.
  • This plasmid was introduced into S. cerevisiae DBY746 (MAT , Ura3-52, leu2-3, his3 1, trp 1-289) by transformation as de ⁇ scribed by Ito et al . in J. Bacteriology 153: 163 (1983), specifi ⁇ cally incorporated herein by reference.
  • Saccharomyces cerevisiae strains SGY-1 and SGY-3 were grown at 30°C to stationary phase in SD medium lacking uracil according to the method of F. Sherman et al . described in Methods in Yeast Genetics, p. 62, Cold Spring Harbor Laboratories, Cold Spring Harbor, New York (1981), specifically incorporated herein by reference. Cells were removed from the culture medium by centrifugation and the culture supernatant was assayed for SLPI activity by measuring (1) protease inhibitory activity and (2) the amount of material that specifically reacts with anti-SLPI antibodies by an enzyme-linked immunoassay. Purification schemes may be developed in a manner analogous to prior methods described herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
PCT/US1985/002385 1984-12-06 1985-12-04 Recombinant methods for production of serine protease inhibitors and dna sequences useful for same Ceased WO1986003519A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
HU86332A HU204563B (en) 1984-12-06 1985-12-04 Process for producing recombinant serine-protease inhibitors and dns sequencyes for them
KR1019860700537A KR940011339B1 (ko) 1984-12-06 1985-12-04 세린프로테아제억제제의 제조를 위한 dna 재조합 방법
EP85905953A EP0205475B2 (en) 1984-12-06 1985-12-04 Recombinant methods for production of serine protease inhibitors and dna sequences useful for same
DE3587875T DE3587875T3 (de) 1984-12-06 1985-12-04 Rekombinantverfahren zur herstellung von serinproteaseinhibitoren, sowie dns-sequenzen dazu.
DK372086A DK372086D0 (da) 1984-12-06 1986-08-05 Fremgangsmaade til rekombinant-dna-syntese af en serinproteaseinhibitor og dna-sekvenser, som er nyttige derved
FI863188A FI108943B (fi) 1984-12-06 1986-08-05 Menetelmiä seriiniproteaasi-inhibiittorien valmistamiseksi ja menetelmässä käytettävä synteettinen tai eristetty DNA-sekvenssi, yhdistelmävektori sekä bakteeri- tai hiivaisäntäsolu
NO863182A NO301122B1 (no) 1984-12-06 1986-08-06 Rekombinant-metoder til produksjon av serinproteaseinhibitorer og DNA-sekvenser for disse

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US67882284A 1984-12-06 1984-12-06
US678,822 1984-12-06
US80347185A 1985-12-02 1985-12-02
US803,471 1985-12-02

Publications (1)

Publication Number Publication Date
WO1986003519A1 true WO1986003519A1 (en) 1986-06-19

Family

ID=27102096

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1985/002385 Ceased WO1986003519A1 (en) 1984-12-06 1985-12-04 Recombinant methods for production of serine protease inhibitors and dna sequences useful for same

Country Status (18)

Country Link
EP (1) EP0205475B2 (https=)
JP (1) JP2683500B2 (https=)
AT (1) ATE108205T1 (https=)
AU (1) AU590238B2 (https=)
CA (1) CA1296273C (https=)
DD (1) DD253642A5 (https=)
DE (1) DE3587875T3 (https=)
DK (1) DK372086D0 (https=)
FI (1) FI108943B (https=)
GR (1) GR852940B (https=)
HU (1) HU204563B (https=)
IE (1) IE64175B1 (https=)
IL (3) IL77227A (https=)
MX (1) MX9203519A (https=)
NO (1) NO301122B1 (https=)
NZ (1) NZ214456A (https=)
PT (1) PT81624B (https=)
WO (1) WO1986003519A1 (https=)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0205555A4 (en) * 1984-12-06 1987-11-09 Synergen Biolog Inc SERINE PROTEAS INHIBITORS AND INSULATION PROCEDURE THEREFOR.
EP0232523A3 (en) * 1986-01-10 1988-12-07 Grunenthal Gmbh Dna sequences which encode for proteins with the biological activity of husi-type i inhibitors, their production by gene technology and drugs containing these proteins
EP0329693A4 (en) * 1986-10-30 1989-09-26 Synergen Biolog Inc HUMAN PANCREAS SECRETIONAL TRYPSIN INHIBITORS, MANUFACTURED BY DNA RECOMBINATION METHODS AND METHOD FOR THEIR PRODUCTION.
EP0267692A3 (en) * 1986-10-14 1989-10-25 Shionogi Seiyaku Kabushiki Kaisha Trading Under The Name Of Shionogi & Co. Ltd. Production of recombinant human psti, psti polypeptides and their use and corresponding dna
EP0278112A3 (en) * 1987-01-07 1990-01-10 Bayer Ag Pancreatic secretory trypsin inhibitor and its variants produced by genetic engineering
EP0357391A3 (en) * 1988-08-31 1991-07-31 Allelix Biopharmaceuticals Inc. Excretion of heterologous proteins from e. coli
US5079229A (en) * 1988-03-07 1992-01-07 Ciba-Geigy Corporation Modified eglin proteins
US5180667A (en) * 1988-03-07 1993-01-19 Ciba-Geigy Corporation Genes encoding eglin C mutants
US5633227A (en) * 1994-09-12 1997-05-27 Miles, Inc. Secretory leukocyte protease inhibitor as an inhibitor of tryptase
US5646015A (en) * 1988-08-31 1997-07-08 Astra Ab Excretion of heterologous proteins from E. coli
US5851983A (en) * 1987-12-28 1998-12-22 Teijin Limited Elastase inhibitory polypeptide and process for production thereof by recombinant gene technology
US5871956A (en) * 1984-12-06 1999-02-16 Amgen Inc. Recombinant methods for production of serine inhibitors and DNA sequences useful for same
US5900400A (en) * 1984-12-06 1999-05-04 Amgen Inc. Serine protease inhibitor analogs
US5900401A (en) * 1994-03-23 1999-05-04 Tokyo Tanabe Company Limited Remedy for respiratory-tract viral disease
US6017880A (en) * 1994-03-09 2000-01-25 Amgen Inc. Inhibition of retrovirus infection
US6132990A (en) * 1984-12-06 2000-10-17 Amgen Boulder Inc. Recombinant methods for production of serine protease inhibitors and DNA sequences useful for same
US6291662B1 (en) 1984-12-05 2001-09-18 Amgen Inc. Recombinant methods for production of serine protease inhibitors and DNA sequences
US6869925B1 (en) * 1992-09-09 2005-03-22 Amgen Inc. Inhibition of retrovirus infection
US7018982B2 (en) 1997-06-19 2006-03-28 Nps Allelix Corp. Methods useful in the treatment of bone resorption diseases
US7247704B2 (en) 2000-12-18 2007-07-24 Arriva Pharmaceuticals, Inc. Multifunctional protease inhibitors and their use in treatment of disease

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0188312A3 (en) * 1985-01-07 1988-01-13 Celltech Limited Process for the production of a protein
US5278049A (en) * 1986-06-03 1994-01-11 Incyte Pharmaceuticals, Inc. Recombinant molecule encoding human protease nexin

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0103409A2 (en) * 1982-08-13 1984-03-21 Zymogenetics, Inc. Glycolytic promoters for regulated protein expression: protease inhibitor
DE3247922A1 (de) * 1982-12-24 1984-06-28 Boehringer Ingelheim International GmbH, 6507 Ingelheim Dna-sequenzen, deren herstellung, diese sequenzen enthaltende plasmide und deren verwendung zur synthese eukaryotischer genprodukte in prokaryoten

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GR79124B (https=) * 1982-12-22 1984-10-02 Genentech Inc
EP0122080B1 (en) * 1983-03-25 1989-09-13 Celltech Limited A process for the production of a protein
JPS60186290A (ja) * 1983-08-10 1985-09-21 チモ−ジエネテイツクス インコ−ポレ−テツド アルフア−1−アンチトリプシンを細菌に表現させる方法
US4711848A (en) * 1984-03-14 1987-12-08 Zymogenetics, Inc. Site specific mutagenesis in alpha-1-antitrypsin

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0103409A2 (en) * 1982-08-13 1984-03-21 Zymogenetics, Inc. Glycolytic promoters for regulated protein expression: protease inhibitor
DE3247922A1 (de) * 1982-12-24 1984-06-28 Boehringer Ingelheim International GmbH, 6507 Ingelheim Dna-sequenzen, deren herstellung, diese sequenzen enthaltende plasmide und deren verwendung zur synthese eukaryotischer genprodukte in prokaryoten

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
FRITZ, H. et al, CHEMICAL ABSTRACTS, Vol 88: 132417t, 1978 *
KURACHI, K. et al, Proc. Natl. Acad. Sci, Vol 78, pp 6826-6830, 1981 *
OHLSSON, K. et al, CHEMICAL ABSTRACTS, Vol 99: 173443u, 1983. *
ROGERS, J. et al, Biochem. Biophys Res. Comm, Vol 116, pp 375-382,1983 *
SCHIESSLER, H. et al, CHEMICAL ABSTRACTS, Vol 89: 192866u, 1978 *
SCHIESSLER,H. et al, CHEMICAL ABSTRACTS, Vol 90: 117084e, 1979 *
SCHONER, B, et al, Proc. Natl. Acad. Sci., Vol 81, pp 5403-5407, 1984 *
See also references of EP0205475A4 *
SHOCAT, D. et al, J. Biological Chem, Vol 253, pp 5630-5634, 1978 *
TRAVIS, J. et al, Ann. Rev. Biochem, Vol 52, pp 655-709, 1983 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6291662B1 (en) 1984-12-05 2001-09-18 Amgen Inc. Recombinant methods for production of serine protease inhibitors and DNA sequences
EP0205555A4 (en) * 1984-12-06 1987-11-09 Synergen Biolog Inc SERINE PROTEAS INHIBITORS AND INSULATION PROCEDURE THEREFOR.
US6132990A (en) * 1984-12-06 2000-10-17 Amgen Boulder Inc. Recombinant methods for production of serine protease inhibitors and DNA sequences useful for same
US5900400A (en) * 1984-12-06 1999-05-04 Amgen Inc. Serine protease inhibitor analogs
US5871956A (en) * 1984-12-06 1999-02-16 Amgen Inc. Recombinant methods for production of serine inhibitors and DNA sequences useful for same
EP0232523A3 (en) * 1986-01-10 1988-12-07 Grunenthal Gmbh Dna sequences which encode for proteins with the biological activity of husi-type i inhibitors, their production by gene technology and drugs containing these proteins
US4845076A (en) * 1986-01-10 1989-07-04 Grunenthal Gmbh DNA sequences coding for proteins having the biological activity of HUSI-type I inhibitors, biotechnological methods for the preparation of said proteins and pharmaceutical compositions containing said proteins
EP0267692A3 (en) * 1986-10-14 1989-10-25 Shionogi Seiyaku Kabushiki Kaisha Trading Under The Name Of Shionogi & Co. Ltd. Production of recombinant human psti, psti polypeptides and their use and corresponding dna
EP0329693A4 (en) * 1986-10-30 1989-09-26 Synergen Biolog Inc HUMAN PANCREAS SECRETIONAL TRYPSIN INHIBITORS, MANUFACTURED BY DNA RECOMBINATION METHODS AND METHOD FOR THEIR PRODUCTION.
EP0278112A3 (en) * 1987-01-07 1990-01-10 Bayer Ag Pancreatic secretory trypsin inhibitor and its variants produced by genetic engineering
US5126322A (en) * 1987-01-07 1992-06-30 Bayer Aktiengesellschaft Pancreatic secretory tryspin inhibitor and variants thereof produced by a recombinant host therefore and pharmaceutical use thereof
US5851983A (en) * 1987-12-28 1998-12-22 Teijin Limited Elastase inhibitory polypeptide and process for production thereof by recombinant gene technology
US5180667A (en) * 1988-03-07 1993-01-19 Ciba-Geigy Corporation Genes encoding eglin C mutants
US5079229A (en) * 1988-03-07 1992-01-07 Ciba-Geigy Corporation Modified eglin proteins
EP0357391A3 (en) * 1988-08-31 1991-07-31 Allelix Biopharmaceuticals Inc. Excretion of heterologous proteins from e. coli
US5646015A (en) * 1988-08-31 1997-07-08 Astra Ab Excretion of heterologous proteins from E. coli
US6869925B1 (en) * 1992-09-09 2005-03-22 Amgen Inc. Inhibition of retrovirus infection
US6017880A (en) * 1994-03-09 2000-01-25 Amgen Inc. Inhibition of retrovirus infection
US5900401A (en) * 1994-03-23 1999-05-04 Tokyo Tanabe Company Limited Remedy for respiratory-tract viral disease
US5633227A (en) * 1994-09-12 1997-05-27 Miles, Inc. Secretory leukocyte protease inhibitor as an inhibitor of tryptase
US7018982B2 (en) 1997-06-19 2006-03-28 Nps Allelix Corp. Methods useful in the treatment of bone resorption diseases
US7507715B2 (en) 1997-06-19 2009-03-24 Nps Allelix Corp. Methods useful in the treatment of bone resorption diseases
US7749543B2 (en) 1997-06-19 2010-07-06 Nps Pharmaceuticals, Inc. Methods useful in the treatment of bone resorption diseases
US8153588B2 (en) 1997-06-19 2012-04-10 Nps Pharmaceuticals, Inc. Methods useful in the treatment of bone resorption diseases
US8765674B2 (en) 1997-06-19 2014-07-01 Nps Pharmaceuticals, Inc. Methods useful in the treatment of bone resorption diseases
US7247704B2 (en) 2000-12-18 2007-07-24 Arriva Pharmaceuticals, Inc. Multifunctional protease inhibitors and their use in treatment of disease
US7709446B2 (en) 2000-12-18 2010-05-04 Arrive Pharmaceuticals, Inc. Multifunctional protease inhibitors and their use in treatment of disease

Also Published As

Publication number Publication date
IE853083L (en) 1986-06-06
DK372086A (da) 1986-08-05
JPH06315384A (ja) 1994-11-15
IE64175B1 (en) 1995-07-12
DE3587875T3 (de) 2003-01-02
HU204563B (en) 1992-01-28
IL95223A0 (en) 1991-06-10
MX9203519A (es) 1992-08-01
IL95223A (en) 1992-08-18
FI863188A0 (fi) 1986-08-05
AU590238B2 (en) 1989-11-02
DD253642A5 (de) 1988-01-27
AU5202986A (en) 1986-07-01
JP2683500B2 (ja) 1997-11-26
FI108943B (fi) 2002-04-30
HUT41442A (en) 1987-04-28
DE3587875D1 (de) 1994-08-11
EP0205475A1 (en) 1986-12-30
DK372086D0 (da) 1986-08-05
DE3587875T2 (de) 1994-10-13
EP0205475B1 (en) 1994-07-06
GR852940B (https=) 1986-04-07
NO863182L (no) 1986-08-06
NO301122B1 (no) 1997-09-15
NO863182D0 (no) 1986-08-06
FI863188L (fi) 1986-08-05
PT81624A (en) 1986-01-01
NZ214456A (en) 1988-02-12
EP0205475A4 (en) 1990-06-27
IL77227A (en) 1992-08-18
PT81624B (pt) 1987-10-20
ATE108205T1 (de) 1994-07-15
CA1296273C (en) 1992-02-25
EP0205475B2 (en) 2002-09-04

Similar Documents

Publication Publication Date Title
AU590238B2 (en) Recombinant methods for production of serine protease inhibitors and dna sequences useful for same
KR100316347B1 (ko) 대장균엔테로톡신ⅱ신호펩티드의변형체와인체성장호르몬의융합단백질을발현하는재조합미생물및그를이용한인체성장호르몬의제조방법
RU1776276C (ru) Способ получени полипептида со свойствами гирудина
SK116896A3 (en) Enhanced secretion of polypeptides
JP2533869B2 (ja) Husi―i型インヒビタ―の生物学的活性を有するタンパク質をコ―ドするdna配列、前記dna配列を含む組換え体クロ―ニングベクタ―及び前記ベクタ―により形質転換された細菌
CN108840951A (zh) 一种由猪白蛋白、猪干扰素γ和猪干扰素α组成的融合蛋白及其制备方法
AU775923B2 (en) Signal sequences for the production of leu-hirudine via secretion by E. coli in a culture medium
NO303735B1 (no) Fremgangsmöte for fremstilling av en hirudinanalog, samt DNA-sekvens, sekresjonsvektor og transformerte mikroorganismer som inneholder vektoren
CN101220092B (zh) 人角质细胞生长因子-1结构类似物,其生产方法及应用
US6291662B1 (en) Recombinant methods for production of serine protease inhibitors and DNA sequences
EP0329693A1 (en) Human pancreatic secretory trypsin inhibitors produced by recombinant dna methods and processes for the production of same
US6342374B1 (en) Human collagenase inhibitor, recombinant vector system for using same and recombinant-DNA method for the manufacture of same
US5871956A (en) Recombinant methods for production of serine inhibitors and DNA sequences useful for same
US6132990A (en) Recombinant methods for production of serine protease inhibitors and DNA sequences useful for same
KR940011339B1 (ko) 세린프로테아제억제제의 제조를 위한 dna 재조합 방법
JP2683500C (https=)
RU2130071C1 (ru) Вектор секреции для получения гирудина hv1 (варианты), рекомбинантный штамм escherichia coli - продуцент гирудина hv1 и способ его получения
PT716705E (pt) Processo para a preparacao por recombinacao de proteinas na levedura hansenula
RU2106408C1 (ru) Аналог гирудина, днк, вектор, способ получения аналога гирудина
JPH04258294A (ja) 分泌ベクター、該ベクターで形質転換した微生物及び該微生物から産生される産物の製造法
JPH07196688A (ja) 新規な生理活性ポリペプチド、その製造方法及び用途
JPH04112791A (ja) トリプスタチン構造遺伝子及びその用途

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU DK FI HU JP KR NO

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1985905953

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 863188

Country of ref document: FI

WWP Wipo information: published in national office

Ref document number: 1985905953

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1985905953

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 863188

Country of ref document: FI