US20190256867A1 - Adeno-associated virus compositions for restoring pah gene function and methods of use thereof - Google Patents

Adeno-associated virus compositions for restoring pah gene function and methods of use thereof Download PDF

Info

Publication number
US20190256867A1
US20190256867A1 US16/265,684 US201916265684A US2019256867A1 US 20190256867 A1 US20190256867 A1 US 20190256867A1 US 201916265684 A US201916265684 A US 201916265684A US 2019256867 A1 US2019256867 A1 US 2019256867A1
Authority
US
United States
Prior art keywords
amino acid
seq
capsid protein
pah
nucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/265,684
Other languages
English (en)
Inventor
Albert Barnes Seymour
Seemin Seher Ahmed
Jason Boke Wright
Serena Nicole Dollive
James Anthony McSwiggen
Jaime Michelle Prout
Danielle Lauren Sookiasian
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Homology Medicines Inc
Original Assignee
Homology Medicines Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Homology Medicines Inc filed Critical Homology Medicines Inc
Priority to US16/265,684 priority Critical patent/US20190256867A1/en
Publication of US20190256867A1 publication Critical patent/US20190256867A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/16Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced pteridine as one donor, and incorporation of one atom of oxygen (1.14.16)
    • C12Y114/16001Phenylalanine 4-monooxygenase (1.14.16.1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/761Adenovirus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/072Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10033Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10051Methods of production or purification of viral material
    • C12N2710/10052Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14121Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • C12N2750/14152Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • Phenylketonuria is an autosomal recessive genetic disorder where the majority of cases are caused by mutations in the phenylalanine hydroxylase (PAH) gene.
  • PAH phenylalanine hydroxylase
  • the PAH gene encodes a hepatic enzyme that catalyzes the hydroxylation of L-phenylalanine (Phe) to L-tyrosine (Tyr) upon multimerization.
  • Reduction or loss of PAH activity leads to phenylalanine accumulation and its conversion into phenylpyruvate (also known as phenylketone). This abnormality in phenylalanine metabolism impairs neuronal maturation and the synthesis of myelin, resulting in mental retardation, seizures and other serious medical problems.
  • LNAA large neutral amino acid
  • cofactor tetrahydrobiopterin therapy enzyme replacement therapy
  • genetically modified probiotic therapy suffer from shortcomings.
  • the LNAA supplementation is suitable only for adults not adhering to a low Phe diet.
  • the cofactor tetrahydrobiopterin can only be used in some mild forms of PKU.
  • Enzyme replacement by administration of a substitute for PAH, e.g., phenylalanine ammonia-lyase (PAL), can lead to immune responses that reduce the efficacy and/or cause side effects.
  • PAL phenylalanine ammonia-lyase
  • the pathogenicity of PAL-expressing E. coli has been a concern.
  • Retroviral vectors including lentiviral vectors, are capable of integrating nucleic acids into host cell genomes.
  • these vectors may raise safety concerns due to their non-targeted insertion into the genome.
  • SCID X-linked severe combined immunodeficiency
  • nuclease-based gene editing technologies such as meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered, regularly interspaced, short palindromic repeat (CRISPR) technology, may be used to correct defects in the PAH gene in PKU patients.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • CRISPR clustered, regularly interspaced, short palindromic repeat
  • adeno-associated virus (AAV) compositions that can restore PAH gene function in cells, and methods for using the same to treat diseases associated with reduction of PAH gene function (e.g., PKU). Also provided are packaging systems for making the adeno-associated virus compositions.
  • AAV adeno-associated virus
  • the instant disclosure provides a method for correcting a mutation in a phenylalanine hydroxylase (PAH) gene in a cell, the method comprising transducing the cell with a replication-defective adeno-associated virus (AAV) comprising:
  • an AAV capsid comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5′ homology arm nucleotide sequence 5′ of the editing element having homology to a first genomic region 5′ to the target locus; and (iii) a 3′ homology arm nucleotide sequence 3′ of the editing element having homology to a second genomic region 3′ to the target locus, wherein the cell is transduced without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.
  • the cell is a hepatocyte, a renal cell, or a cell in the brain, pituitary gland, adrenal gland, pancreas, urinary bladder, gallbladder, colon, small intestine, or breast.
  • the cell is in a mammalian subject and the AAV is administered to the subject in an amount effective to transduce the cell in the subject.
  • the instant disclosure provides a method for treating a subject having a disease or disorder associated with a PAH gene mutation, the method comprising administering to the subject an effective amount of a replication-defective AAV comprising: (a) an AAV capsid; and (b) a correction genome comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5′ homology arm nucleotide sequence 5′ of the editing element having homology to a first genomic region 5′ to the target locus; and (iii) a 3′ homology arm nucleotide sequence 3′ of the editing element having homology to a second genomic region 3′ to the target locus, wherein an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease is not co-administered to the subject.
  • the disease or disorder is phenylketonuria.
  • the subject is a human subject.
  • the instant disclosure provides a replication-defective adeno-associated virus (AAV) comprising:
  • an AAV capsid comprising: (i) an editing element for editing a target locus in the PAH gene; (ii) a 5′ homology arm nucleotide sequence 5′ of the editing element having homology to a first genomic region 5′ to the target locus; and (iii) a 3′ homology arm nucleotide sequence 3′ of the editing element having homology to a second genomic region 3′ to the target locus.
  • the editing element comprises at least a portion of a PAH coding sequence. In certain embodiments, the editing element comprises a PAH coding sequence. In certain embodiments, the PAH coding sequence encodes an amino acid sequence set forth in SEQ ID NO: 23. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24. In certain embodiments, the PAH coding sequence is silently altered. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143.
  • the editing element comprises a PAH intron-inserted coding sequence, optionally wherein the PAH intron-inserted coding sequence comprises a nonnative intron inserted in a PAH coding sequence.
  • the nonnative intron is selected from the group consisting of a first intron of a hemoglobin beta gene and a minute virus in mice (MVM) intron.
  • the nonnative intron consists of a nucleotide sequence at least 90% identical to any one of SEQ ID NOs: 28-30, and 120-130.
  • the nonnative intron consists of a nucleotide sequence set forth in any one of SEQ ID NOs: 28-30, and 120-130.
  • the PAH intron-inserted coding sequence encodes an amino acid sequence set forth in SEQ ID NO: 23.
  • the PAH intron-inserted coding sequence comprises from 5′ to 3′: a first portion of a PAH coding sequence, the intron, and a second portion of a PAH coding sequence, wherein the first portion and the second portion, when spliced together, form a complete PAH coding sequence.
  • the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24.
  • the PAH coding sequence is silently altered.
  • the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25 or 116.
  • the first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65
  • the second portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 66 or 67.
  • the first portion of the PAH coding sequence consist of the amino acid sequence set forth in SEQ ID NO: 64 or 65
  • the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 66 or 67.
  • the editing element comprises from 5′ to 3′: a ribosomal skipping element, and the PAH coding sequence or the PAH intron-inserted coding sequence.
  • the editing element further comprises a polyadenylation sequence 3′ to the PAH coding sequence or the PAH intron-inserted coding sequence.
  • the polyadenylation sequence is an exogenous polyadenylation sequence, optionally wherein the exogenous polyadenylation sequence is an SV40 polyadenylation sequence.
  • the SV40 polyadenylation sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34, and a sequence complementary thereto.
  • the nucleotide 5′ to the target locus is in an exon of the PAH gene. In certain embodiments, the nucleotide 5′ to the target locus is in exon 1 of the PAH gene.
  • the editing element further comprises a splice acceptor 5′ to the ribosomal skipping element.
  • the nucleotide 5′ to the target locus is in an intron of the PAH gene.
  • the nucleotide 5′ to the target locus is in intron 1 of the PAH gene.
  • the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 35.
  • the 5′ homology arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the first genomic region. In certain embodiments, the 3′ homology arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the second genomic region.
  • the first genomic region is located in a first editing window, and the second genomic region is located in a second editing window.
  • the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45.
  • the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45.
  • the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36
  • the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 45.
  • the first genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 36.
  • the second genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 45.
  • each of the 5′ and 3′ homology arm nucleotide sequences independently has a length of about 100 to about 2000 nucleotides.
  • the 5′ homology arm comprises: C corresponding to nucleotide ⁇ 2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, G corresponding to nucleotide 9 of the PAH gene, A corresponding to nucleotide ⁇ 467 of the PAH gene, A corresponding to nucleotide ⁇ 465 of the PAH gene, A corresponding to nucleotide ⁇ 181 of the PAH gene, G corresponding to nucleotide ⁇ 214 of the PAH gene, C corresponding to nucleotide ⁇ 212 of the PAH gene, A corresponding to nucleotide ⁇ 211 of the PAH gene, G corresponding to nucleotide 194 of the PAH gene, C corresponding to nucleotide ⁇ 433 of the PAH gene, C corresponding to nucleotide ⁇ 432
  • the 5′ homology arm consists of a nucleotide sequence set forth in any one of SEQ ID NOs: 36-44, 111, 115, and 142.
  • the 3′ homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 45, 112, 117, 144.
  • the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, 113, 118, 134, 136, and 145.
  • the correction genome further comprises a 5′ inverted terminal repeat (5′ ITR) nucleotide sequence 5′ of the 5′ homology arm nucleotide sequence, and a 3′ inverted terminal repeat (3′ ITR) nucleotide sequence 3′ of the 3′ homology arm nucleotide sequence.
  • 5′ ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 18, and the 3′ ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 19.
  • the 5′ ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 20 and the 3′ ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 21. In certain embodiments, the 5′ ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 26, and the 3′ ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 27.
  • the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146. In certain embodiments, the correction genome consists of the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146.
  • the AAV capsid comprises an AAV Clade F capsid protein.
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17.
  • the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I; the amino acid in the capsid protein
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in the capsid protein
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 68 of SEQ ID NO: 2 is V; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L; the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ
  • the capsid protein comprises the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the integration efficiency of the editing element into the target locus is at least 1% when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.
  • the allelic frequency of integration of the editing element into the target locus is at least 0.5% when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.
  • the instant disclosure provides a pharmaceutical composition comprising an AAV disclosed herein.
  • the instant disclosure provides a packaging system for recombinant preparation of an AAV, wherein the packaging system comprises:
  • the packaging system comprises a first vector comprising the Rep nucleotide sequence and the Cap nucleotide sequence, and a second vector comprising the correction genome.
  • the Rep nucleotide sequence encodes an AAV2 Rep protein.
  • the AAV2 Rep protein is 78/68 or Rep 68/52.
  • the AAV2 Rep protein comprises an amino acid sequence having a minimum percent sequence identity to the AAV2 Rep amino acid sequence of SEQ ID NO: 22, wherein the minimum percent sequence identity is at least 70% across the length of the amino acid sequence encoding the AAV2 Rep protein.
  • the packaging system further comprises a third vector, wherein the third vector is a helper virus vector.
  • the helper virus vector is an independent third vector.
  • the helper virus vector is integral with the first vector.
  • the helper virus vector is integral with the second vector.
  • the third vector comprises genes encoding helper virus proteins.
  • the helper virus is selected from the group consisting of adenovirus, herpes virus, vaccinia virus, and cytomegalovirus (CMV).
  • CMV cytomegalovirus
  • the helper virus is adenovirus.
  • the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4 and VA.
  • the helper virus is herpes simplex virus (HSV).
  • the HSV genome comprises one or more of HSV genes selected from the group consisting of UL5/8/52, ICPO, ICP4, ICP22 and UL30/UL42.
  • the first vector and the third vector are contained within a first transfecting plasmid. In certain embodiments, the nucleotides of the second vector and the third vector are contained within a second transfecting plasmid. In certain embodiments, the nucleotides of the first vector and the third vector are cloned into a recombinant helper virus. In certain embodiments, the nucleotides of the second vector and the third vector are cloned into a recombinant helper virus.
  • the instant disclosure provides a method for recombinant preparation of an AAV, the method comprising introducing a packaging system as described herein into a cell under conditions operative for enclosing the correction genome or the transfer genome in the capsid to form the AAV.
  • FIG. 1A is a map of the pHMI-hPAH-hAC-008 vector.
  • FIG. 1B is a map of the pHMI-hPAH-hlC-007 vector.
  • FIG. 1C is a map of the pHMIA-hPAH-hIlC-032.1 vector.
  • FIG. 2 is an image of Western blot showing the expression of human PAH from the pCOH-WT-PAH (“WT PAH”), pCOH-CO-PAH (“CO PAH pCOH”), and pHMI-CO-PAH (“CO PAH pHMI”) vectors.
  • WT PAH pCOH-WT-PAH
  • CO PAH pCOH pCOH-CO-PAH
  • pHMI-CO-PAH CO PAH pHMI
  • FIG. 3A is a graph showing quantitation of the PAH cDNA cassette following linear amplification (“LAM-Enriched”) or PCR amplification (“Amplicon”) of the editing target site.
  • LAM-Enriched linear amplification
  • Amplicon PCR amplification
  • FIG. 3B is a graph showing quantitative analysis of integration of the pHMI-hPAH-hA-002 vector by droplet digital PCR (ddPCR).
  • FIG. 4A shows the design of the pHMI-hPAH-mAC-006 vector and its expected integration into a mouse genome.
  • FIG. 4B is a diagram illustrating a method for detecting by PCR an allele edited by the pHMI-hPAH-mAC-006 vector.
  • Two pairs of primers were designed: the first pair could amplify a 867 bp DNA from an unedited allele (“Control PCR”); the second pair could specifically amplify a 2459 bp DNA from an edited allele (“Edited Allele PCR”).
  • FIG. 4C is an image of DNA electrophoresis showing the PCR product from the Control PCR (“Control PCR”) and Edited Allele PCR (“Edit PCR”) as illustrated in FIG. 4A .
  • Control PCR Control PCR
  • Edit PCR Edited Allele PCR
  • FIG. 5A is a diagram illustrating a method for quantifying an edited allele by ddPCR.
  • a first pair of primers was designed to amplify a first sequence in the pHMI-hPAH-mAC-006 vector, and a first probe (“vector probe”) was designed to hybridize to the first sequence.
  • a second pair of primers was designed to amplify a second sequence on the mouse genome near the vector, and a second probe (“locus probe”) was designed to hybridize to the second sequence.
  • DNA samples were partitioned into oil droplets. The concentration of DNA was optimized to 600 pg per 20 ⁇ L in order to significantly reduce the probability that one oil droplet randomly contains a vector particle and a genomic DNA particle (p ⁇ 0.001). Upon integration of the vector into the genome, the rate of double positivity of the vector probe and the locus probe in the same droplet increases.
  • FIG. 5B is a diagram illustrating an expected result using the method described in FIG. 5A .
  • each dot represents a single oil droplet.
  • the dots with negative vector probe signal but positive locus probe signal represent the unedited alleles, whereas the dots with positive vector probe signal but positive locus probe signal represent the edited alleles.
  • FIG. 5C is a graph showing the data generated from mouse liver using the method described in FIG. 5A .
  • the pHMI-hPAH-mAC-006 vector packaged in an AAVHSC capsid was injected to two wild-type neonatal mice intravenously via the tail vein at a dose of 2 ⁇ 10 13 vector genomes per kg of body weight. Liver samples were collected after 2 weeks. One sample was analyzed using the method described in FIG. 5A . Vector probe and locus probe double positive droplets were detected.
  • FIG. 5D is a graph showing the data generated from a sample containing liver from a saline treated mouse and the pHMI-hPAH-mAC-006 plasmid. Few probe and locus probe double positive droplets were detected, suggesting that the sample has been sufficiently diluted so that the probability that one oil droplet randomly contains a vector particle and a genomic DNA particle is very low.
  • FIG. 5E is a graph showing the quantification of the graph in FIG. 5D and the graphs generated from other samples.
  • the two control mice had 0% and 0.0395% edited alleles in the liver, respectively, and the two mice treated with the pHMI-hPAH-mAC-006 vector had 2.504% and 2.783% edited alleles in the liver, respectively.
  • FIG. 6 is a graph showing the mRNA expression of human PAH in the liver after administration of the pHMI-hPAH-mAC-006 vector. RNA was extracted and reverse transcribed. A pair of primers and a probe were designed to specifically detect PAH expression from the edited allele. Each PAH expression level is normalized to the expression level of endogenous Hprt.
  • FIG. 7A is a graph showing the transduction efficiency of the pHMI-hPAH-mAC-006 vector packaged in AAVHSC capsids in mouse blood samples, measured by ddPCR using primer and probe sets to measure the vector and the mouse PAH genomic loci copy numbers.
  • the numbers of vector genomes per cell (“VG per Cell”) is calculated from the measured ratio of number of vectors versus the copy numbers of the genomic locus of mouse PAH.
  • FIG. 7B is a graph showing the percentage editing efficiency in mouse blood samples measured by multiplexed ddPCR using primer probe sets to measure the frequency of the integrated DNA from the AAV vector (“payload”) integrating into the mouse PAH locus and the human PAH locus. Editing frequency was calculated based on the detected co-partitioning of a payload and a target DNA in a single droplet in excess of expected probability of co-partitioning of a payload and a target DNA in separate nucleic acid molecules.
  • FIG. 7C is a graph showing the percentage levels of serum phenylalanine relative to the baseline in the mice after administration of the pHMI-hPAH-mAC-006 vector packaged in an AAVHSC capsid. The average levels in the treated animals and control animals (mice that did not receive AAV administration) are plotted.
  • FIG. 7D is a graph showing the percentage levels of serum phenylalanine relative to the baseline in each individual mouse injected with the pHMI-hPAH-mAC-006 vector packaged in an AAVHSC capsid or in each control mice that did not receive AAV administration. The p values were calculated by ANOVA against the control distribution.
  • FIG. 7E is a graph showing the correlation between the percentage levels of serum phenylalanine relative to the baseline and the percentage editing efficiency.
  • FIG. 7F is a set of images showing in situ hybridization (ISH) of Pah mRNA and possibly virus DNA comprising PAH sequence in liver samples of mice injected with the hPAH-mAC-006 vector (middle panel), a non-integrating Pah transgene vector (right panel), or saline control (left panel).
  • ISH in situ hybridization
  • FIG. 8A is a graph showing the transduction efficiency of the hPAH-hAC-008 vector and hPAH-hAC-008-HBB vector in human and mouse hepatocytes in mice administered with the vector packaged in AAVHSC15 capsids, as measured by ddPCR using primers and probe sets specific for the vector.
  • the y-axis represents the number of vectors measured relative to genomes of the mouse or human cells.
  • FIG. 8B is a series of photos showing in situ hybridization of human Pah mRNA and possibly virus DNA comprising PAH sequence with silent codon alteration in liver samples from mice administered an unmodified or a modified hPAH-hAC-008 vector.
  • the probe detected only the mRNA transcribed from a gene locus edited by the unmodified or modified hPAH-hAC-008 vector.
  • FIG. 8C is a graph showing the percentage editing efficiency of the hPAH-hAC-008 vector in mouse and human hepatocytes from mice transplanted with human hepatocytes, as measured by multiplexed ddPCR.
  • the left half of the figure refers to the editing efficiency of an animal treated with the hPAH-hAC-008-HBB vector, and the right half refers to that of an animal treated with the hPAH-hAC-008 vector.
  • the p values were calculated by ANOVA.
  • FIG. 9A depicts a schematic of the assay used to determine editing efficiency of the PAH gene in mice.
  • FIG. 9B is a graph showing the PAH gene editing efficiency in cells from mice that have been administered either the pHMI-hPAH-mAC-006 vector or vehicle control.
  • FIG. 10A is a graph showing the average percentage levels of serum phenylalanine relative to the baseline in mice after administration of either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids or a vehicle control.
  • FIG. 10B is a graph showing the average percentage levels of serum tyrosine relative to the baseline in mice after administration of either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids or a vehicle control.
  • FIG. 10C is a graph showing the ratio between serum phenylalanine and serum tyrosine levels in mice that received either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsids or a vehicle control.
  • FIG. 11A is a graph showing the average PAH gene editing efficiency and transduction efficiency in cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector or a vehicle control.
  • FIG. 11B depicts a graph showing the relative quantity of PAH mRNA expressed, normalized to the expression level of mouse GAPDH, in cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) and or a vehicle control.
  • FIG. 12A is a schematic showing the HuLiv humanized liver mouse model.
  • FIG. 12B depicts the average PAH gene editing efficiency in cells obtained from mice 1 week and 6 weeks after administration of the pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15 capsids.
  • FIG. 13 is a graph showing the average PAH gene editing efficiency, as determined by ddPCR and next generation sequencing (NGS), in cells obtained from HuLiv mice administered the pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15 capsids.
  • FIG. 14 is a graph showing the average serum phenylalanine levels of PAH knock-out mouse model (PAH ENU2 ) mice administered intravenously with either the pHMIK-hPAH-hI1C-032 vector (hPAH-032) or the pHMI-hPAH-mAC-006 vector (mPAH-006), packaged in AAVHSC15 capsids, compared to control mice.
  • PAH ENU2 PAH knock-out mouse model
  • FIG. 15A is a graph showing the relationship between human PAH expression and serum Phe levels.
  • FIG. 15B is a plot showing the expression of human PAH relative to human GAPDH in two different HuLiv mice treated with pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15 capsids.
  • FIG. 16 is a plot showing human PAH gene expression in HuLiv mice treated with (left) and mouse PAH gene expression in PAH ENU2 mice treated with pHMI-hPAH-mAC-006 vector (right) packaged in AAVHSC15 capsids.
  • FIG. 17A, 17B, 17C, 17D, 17E depict vector maps of pKITR-hPAH-mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, pKITR-hPAH-mAC-006-SD.3, pHMIA2-hPAH-hI1C-032-SD.3, and pHMIA2-hPAH-mAC-006-HBB1, respectively.
  • the instant disclosure provided adeno-associated virus (AAV) compositions that can restore PAH gene function in a cell. Also provide are packaging systems for making the adeno-associated virus compositions.
  • AAV adeno-associated virus
  • replication-defective adeno-associated virus refers to an AAV comprising a genome lacking Rep and Cap genes.
  • PAH gene refers to the phenylalanine hydroxylase (PAH) gene, including but not limited to the coding regions, exons, introns, 5′ UTR, 3′ UTR, and transcriptional regulatory regions of the PAH gene.
  • the human PAH gene is identified by Entrez Gene ID 5053.
  • An exemplary nucleotide sequence of a PAH mRNA is provided as SEQ ID NO: 24.
  • An exemplary amino acid sequence of a PAH polypeptide is provided as SEQ ID NO: 23.
  • correcting a mutation in a PAH gene refers to the insertion, deletion, or substitution of one or more nucleotides at a target locus in a mutant PAH gene to create a PAH gene that is capable of expressing a wild-type PAH polypeptide.
  • “correcting a mutation in a PAH gene” involves inserting a nucleotide sequence encoding at least a portion of a wild-type PAH polypeptide or a functional equivalent thereof into the mutant PAH gene, such that a wild-type PAH polypeptide or a functional equivalent thereof is expressed from the mutant PAH gene locus (e.g., under the control of an endogenous PAH gene promoter).
  • the term “correction genome” refers to a recombinant AAV genome that is capable of integrating an editing element (e.g., one or more nucleotides or an internucleotide bond) via homologous recombination into a target locus to correct a genetic defect in a PAH gene.
  • the target locus is in the human PAH gene.
  • the portion of a correction genome comprising the 5′ homology arm, editing element, and 3′ homology arm can be in the sense or antisense orientation relative to the target locus (e.g., the human PAH gene).
  • the term “editing element” refers to the portion of a correction genome that when integrated at a target locus modifies the target locus.
  • An editing element can mediate insertion, deletion, or substitution of one or more nucleotides at the target locus.
  • target locus refers to a region of a chromosome or an internucleotide bond (e.g., a region or an internucleotide bond of the human PAH gene) that is modified by an editing element.
  • the term “homology arm” refers to a portion of a correction genome positioned 5′ or 3′ of an editing element that is substantially identical to the genome flanking a target locus.
  • the target locus is in a human PAH gene, and the homology arm comprises a sequence substantially identical to the genome flanking the target locus.
  • Clade F capsid protein refers to an AAV VP1, VP2, or VP3 capsid protein that comprises an amino acid sequence having at least 90% identity with the VP1, VP2, or VP3 amino acid sequences set forth, respectively, in amino acids 1-736, 138-736, and 203-736 of SEQ ID NO:1 herein.
  • the identity between two nucleotide sequences or between two amino acid sequences is determined by the number of identical nucleotides or amino acids in alignment divided by the full length of the longer nucleotide or amino acid sequence.
  • a disease or disorder associated with a PAH gene mutation refers to any disease or disorder caused by, exacerbated by, or genetically linked with variation of a PAH gene.
  • the disease or disorder associated with a PAH gene mutation is phenylketonuria (PKU).
  • silently altered refers to alteration of a coding sequence or a stuffer-inserted coding sequence of a gene (e.g., by nucleotide substitution) without changing the amino acid sequence of the polypeptide encoded by the coding sequence or stuffer-inserted coding sequence.
  • Codon alteration can be conducted by any method known in the art (e.g., as described in Mauro & Chappell (2014) Trends Mol Med. 20(11):604-13, which is incorporated by reference herein in its entirety).
  • Such silent alteration is advantageous in that it reduces the likelihood of integration of the correction genome into loci of other genes or pseudogenes paralogous to the target gene.
  • Such silent alteration also reduces the homology between the editing element and the target gene, thereby reducing undesired integration mediated by the editing element rather than by a homology arm.
  • coding sequence refers to the portion of a complementary DNA (cDNA) that encodes a polypeptide, starting at the start codon and ending at the stop codon.
  • a gene may have one or more coding sequences due to alternative splicing and/or alternative translation initiation.
  • a coding sequence may either be wild-type or silently altered.
  • An exemplary wild-type PAH coding sequence is set forth in SEQ ID NO: 24.
  • the term “intron-inserted coding sequence” of a gene refers to a nucleotide sequence comprising one or more introns inserted in a coding sequence of the gene.
  • at least one of the introns is a nonnative intron, i.e., having a sequence different from a native intron of the gene.
  • all of the introns in the intron-inserted coding sequence are nonnative introns.
  • a nonnative intron can have the sequence of an intron from a different species or the sequence of an intron in a different gene from the same species. Alternatively or additionally, at least a portion of a nonnative intron sequence can be synthetic.
  • nonnative intron sequences can be designed to mediate RNA splicing by introducing any consensus splicing motifs known in the art. Exemplary consensus splicing motifs are provided in Sibley et al., (2016) Nature Reviews Genetics, 17, 407-21, which is incorporated by reference herein in its entirety. Insertion of a nonnative intron may promote the efficiency and robustness of vector packaging, as stuffer sequences allow adjustments of the vector to reach an optimal size (e.g., 4.5-4.8 kb).
  • at least one of the introns is a native intron of the gene. In certain embodiments, all of the introns in the intron-inserted coding sequence are native introns of the gene.
  • the nonnative or native introns can be inserted at any internucleotide bonds in the coding sequence.
  • one or more nonnative or native introns are inserted at internucleotide bonds predicted to promote efficient splicing (see e.g., Zhang (1998) Human Molecular Genetics, 7(5):919-32, which is incorporated by reference herein in its entirety).
  • one or more nonnative or native introns are inserted at internucleotide bonds that link two endogenous exons.
  • ribosomal skipping element refers to a nucleotide sequence encoding a short peptide sequence capable of causing generation of two peptide chains from translation of one mRNA molecule.
  • the ribosomal skipping element encodes a peptide comprising a consensus motif of X 1 X 2 EX 3 NPGP, wherein X 1 is D or G, X 2 is V or I, and X 3 is any amino acid (SEQ ID NO: 75).
  • the ribosomal skipping element encodes thosea-asigna virus 2A peptide (T2A), porcine teschovirus-1 2A peptide (P2A), foot-and-mouth disease virus 2A peptide (F2A), equine rhinitis A virus 2A peptide (E2A), cytoplasmic polyhedrosis virus 2A peptide (BmCPV 2A), or flacherie virus of B. mori 2A peptide (BmIFV 2A).
  • T2A a-asigna virus 2A peptide
  • P2A porcine teschovirus-1 2A peptide
  • F2A foot-and-mouth disease virus 2A peptide
  • E2A equine rhinitis A virus 2A peptide
  • BmCPV 2A cytoplasmic polyhedrosis virus 2A peptide
  • BmIFV 2A flacherie virus of B. mori 2A peptide
  • the ribosomal skipping element encodes a peptide that further comprises a sequence of Gly-Ser-Gly at the N terminus, optionally wherein the sequence of Gly-Ser-Gly is encoded by the nucleotide sequence of GGCAGCGGA.
  • ribosomal skipping elements function by: terminating translation of the first peptide chain and re-initiating translation of the second peptide chain; or by cleavage of a peptide bond in the peptide sequence encoded by the ribosomal skipping element by an intrinsic protease activity of the encoded peptide, or by another protease in the environment (e.g., cytosol).
  • ribosomal skipping peptide refers to a peptide encoded by a ribosomal skipping element.
  • polyadenylation sequence refers to a DNA sequence that when transcribed into RNA constitutes a polyadenylation signal sequence.
  • the polyadenylation sequence can be native (e.g., from the PAH gene) or exogenous.
  • the exogenous polyadenylation sequence can be a mammalian or a viral polyadenylation sequence (e.g., an SV40 polyadenylation sequence).
  • nucleotide positions in a PAH gene are specified relative to the first nucleotide of the start codon.
  • the first nucleotide of a start codon is position 1; the nucleotides 5′ to the first nucleotide of the start codon have negative numbers; the nucleotides 3′ to the first nucleotide of the start codon have positive numbers.
  • nucleotide 1 of the human PAH gene is nucleotide 5,473 of the NCBI Reference Sequence: NG_008690.1
  • nucleotide ⁇ 1 of the human PAH gene is nucleotide 5,472 of the NCBI Reference Sequence: NG_008690.1.
  • exons and introns in a PAH gene are specified relative to the exon encompassing the first nucleotide of the start codon, which is nucleotide 5473 of the NCBI Reference Sequence: NG_008690.1.
  • the exon encompassing the first nucleotide of the start codon is exon 1.
  • Exons 3′ to exon 1 are from 5′ to 3′: exon 2, exon 3, etc.
  • Introns 3′ to exon 1 are from 5′ to 3′: intron 1, intron 2, etc.
  • the PAH gene comprises from 5′ to 3′: exon 1, intron 1, exon 2, intron 2, exon 3, etc.
  • exon 1 of the human PAH gene is nucleotides 5001-5532 of the NCBI Reference Sequence: NG_008690.1
  • intron 1 of the human PAH gene is nucleotides 5533-9704 of the NCBI Reference Sequence: NG_008690.1.
  • integration refers to introduction of an editing element into a target locus (e.g., of a PAH gene) by homologous recombination between a correction genome and the target locus. Integration of an editing element can result in substitution, insertion and/or deletion of one or more nucleotides in a target locus (e.g., of a PAH gene).
  • the term “integration efficiency of the editing element into the target locus” refers to the percentage of cells in a transduced population in which integration of the editing element into the target locus has occurred.
  • the term “allelic frequency of integration of the editing element into the target locus” refers to the percentage of alleles in a population of transduced cells in which integration of the editing element into the target locus has occurred.
  • standard AAV administration conditions refers to transduction of human hepatocytes implanted into a mouse following hepatocyte ablation, wherein the AAV is administered intravenously at a dose of 1 ⁇ 10 13 vector genomes per kilogram of body weight, as provided by the method of Example 5, section b.
  • the term “effective amount” in the context of the administration of an AAV to a subject refers to the amount of the AAV that achieves a desired prophylactic or therapeutic effect.
  • novel replication-defective AAV compositions useful for restoring PAH expression in cells with reduced or otherwise defective PAH gene function.
  • Such AAV compositions are highly efficient at correcting mutations in the PAH gene or restoring PAH expression, and do not require cleavage of the genome at the target locus by the action of an exogenous nuclease (e.g., a meganuclease, a zinc finger nuclease, a transcriptional activator-like nuclease (TALEN), or an RNA-guided nuclease such as a Cas9) to facilitate such correction.
  • an exogenous nuclease e.g., a meganuclease, a zinc finger nuclease, a transcriptional activator-like nuclease (TALEN), or an RNA-guided nuclease such as a Cas9
  • the AAV composition disclosed herein does not comprise an exogenous nuclease or a nucleotide
  • the AAV disclosed herein comprise: an AAV capsid; and a correction genome for editing a target locus in a PAH gene.
  • the AAV capsid proteins that can be used in the AAV compositions disclosed herein include without limitation AAV capsid proteins and derivatives thereof of Clade A AAVs, Clade B AAVs, Clade C AAVs, Clade D AAVs, Clade E AAVs, and Clade F AAVs.
  • the AAV capsid protein is an AAV capsid protein or a derivative thereof of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAVrh10.
  • the AAV capsid comprises an AAV Clade F capsid protein.
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17, wherein: the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N; the amino acid in
  • the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G
  • the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G
  • the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H
  • the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R
  • the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
  • the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R.
  • the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R
  • the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C.
  • the AAV Clade F capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17, wherein: the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q; the amino acid in the amino acid in the
  • the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G
  • the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G
  • the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H
  • the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R
  • the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
  • the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R.
  • the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R
  • the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C.
  • the AAV Clade F capsid protein comprises the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV Clade F capsid protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17, wherein: the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I; the amino acid in the capsid protein corresponding to amino acid 68 of SEQ ID NO: 2 is V; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L; the amino acid in the capsi
  • the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T, and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q.
  • the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I
  • the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y.
  • the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R
  • the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K.
  • the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L, and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S.
  • the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
  • the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
  • the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R.
  • the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I
  • the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R
  • the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C.
  • the AAV Clade F capsid protein comprises the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17.
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%,
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 8.
  • the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 8.
  • the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 8; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 8; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 8.
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 11.
  • the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 11.
  • the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 11; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 11; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 11.
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 13.
  • the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 13.
  • the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 13; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 13; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 13.
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%
  • the AAV capsid comprises one or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 16.
  • the AAV capsid comprises two or more of: (a) a Clade F capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein comprising the amino acid sequence of amino acids 1-736 of SEQ ID NO: 16.
  • the AAV capsid comprises: (a) a Clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 16; (b) a Clade F capsid protein having an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 16; and (c) a Clade F capsid protein having an amino acid sequence consisting of amino acids 1-736 of SEQ ID NO: 16.
  • Correction genomes useful in the AAV compositions disclosed herein generally comprise: (i) an editing element for editing a target locus in an PAH gene, (ii) a 5′ homology arm nucleotide sequence 5′ of the editing element having homology to a first genomic region 5′ to the target locus, and (iii) a 3′ homology arm nucleotide sequence 3′ of the editing element having homology to a second genomic region 3′ to the target locus, wherein the portion of the correction genome comprising the 5′ homology arm, editing element, and 3′ homology arm can be in the sense or antisense orientation relative to the PAH gene locus.
  • the correction genome comprises a 5′ inverted terminal repeat (5′ ITR) nucleotide sequence 5′ of the 5′ homology arm nucleotide sequence, and a 3′ inverted terminal repeat (3′ ITR) nucleotide sequence 3′ of the 3′ homology arm nucleotide sequence.
  • 5′ ITR 5′ inverted terminal repeat
  • 3′ ITR 3′ inverted terminal repeat
  • Editing elements used in the correction genomes disclosed herein can mediate insertion, deletion or substitution of one or more nucleotides at the target locus.
  • the editing element when correctly integrated by homologous recombination at the target locus, inserts a nucleotide sequence comprising at least a portion of a PAH coding sequence into a mutant PAH gene, such that a wild-type PAH polypeptide or a functional equivalent thereof is expressed from the mutant PAH gene locus.
  • the editing element comprises a complete PAH coding sequence (e.g., a wild-type PAH coding sequence or a silently altered PAH coding sequence).
  • the editing element comprises nucleotides 4 to 1359 of a PAH coding sequence.
  • the editing element comprises a PAH intron-inserted coding sequence (e.g., comprising an intron inserted in a wild-type or silently altered PAH coding sequence).
  • the PAH coding sequence encodes a wild-type PAH polypeptide (e.g., having the amino acid sequence set forth in SEQ ID NO: 23). In certain embodiments, the PAH coding sequence is wild-type (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 24). In certain embodiments, the PAH coding sequence is silently altered to be less than 100% (e.g., less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, or 50%) identical to the corresponding exons of the wild-type PAH gene. In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 25). In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 116).
  • the PAH intron-inserted coding sequence encodes a wild-type PAH polypeptide (e.g., having the amino acid sequence set forth in SEQ ID NO: 23).
  • the PAH intron-inserted coding sequence comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) intron inserted in a PAH coding sequence.
  • the intron can comprise a native intron sequence of the PAH gene, an intron sequence from a different species or a different gene from the same species, and/or a synthetic intron sequence.
  • the nonnative intron is no more than 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1,500, or 2,000 nucleotides in length. While not wishing to be bound by theory, it is hypothesized that introns can increase transgene expression, for example, by reducing transcriptional silencing and enhancing mRNA export from the nucleus to the cytoplasm. A skilled worker will appreciate that synthetic intron sequences can be designed to mediate RNA splicing by introducing any consensus splicing motifs known in the art (e.g., in Sibley et al., (2016) Nature Reviews Genetics, 17, 407-21, which is incorporated by reference herein in its entirety).
  • the editing element comprises a first intron of a hemoglobin beta gene in any species (e.g., human, mouse, or rabbit).
  • the editing element comprises a first intron of a human HBB gene (e.g., comprising a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 28).
  • the editing element comprises a first intron of a mouse HBB gene (e.g., comprising a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 29).
  • the editing element comprises a minute virus of mouse (MVM) intron (e.g., comprising a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 30).
  • VMM minute virus of mouse
  • the editing element comprises a chimeric MVM intron (also referred to herein as ChiMVM), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 120.
  • the editing element comprises an SV40 intron, e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 121.
  • the editing element comprises an adenovirus tripartite leader intron (also referred to herein as AdTPL), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 122.
  • AdTPL adenovirus tripartite leader intron
  • the editing element comprises a mini ⁇ -globin intron (also referred to herein as MiniBGlobin), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 123.
  • the editing element comprises an AdV/Ig chimeric intron (also referred to herein as AdVIgG), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 124.
  • AdVIgG AdV/Ig chimeric intron
  • the editing element comprises a ⁇ -globin Ig heavy chain intron (also referred to herein as BglobinIg), which is a chimeric intron comprising a ⁇ -globin splice donor region and a IgG heavy chain splice acceptor region, e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 125.
  • BglobinIg ⁇ -globin Ig heavy chain intron
  • the editing element comprises a Wu MVM intron (also referred to herein as Wu MVM), which is a variant of the wild type MVM intron, e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 126.
  • Wu MVM intron also referred to herein as Wu MVM
  • the editing element comprises an HCR1 element (also referred to herein as OptHCR), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 127.
  • the editing element comprises a ⁇ -globin intron (also referred to herein as Bglobin), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 128.
  • the editing element comprises a Factor IX intron (also referred to herein as tFIX or FIX intron), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 129.
  • the editing element comprises a ch2BLood intron (also referred to herein as BloodEnh), e.g., comprising or consisting of a nucleotide sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 130.
  • the PAH intron-inserted coding sequence encodes a wild-type PAH polypeptide (e.g., having the amino acid sequence set forth in SEQ ID NO: 23).
  • the PAH intron-inserted coding sequence comprises portions of a PAH coding sequence that when spliced together, form a complete PAH coding sequence.
  • the PAH coding sequence is wild-type (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 24).
  • the PAH coding sequence is silently altered to be less than 100% (e.g., less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, or 50%) identical to the corresponding exons of the wild-type PAH gene.
  • the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 25).
  • the PAH coding sequence comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 116.
  • an intron-inserted PAH coding sequence comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 116.
  • the PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 116.
  • an intron-inserted PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 80, 81, 82, 131, 132, or 143.
  • an intron-inserted PAH coding sequence comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 80, 81, 82, 131, 132, or 143.
  • an intron-inserted PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 80, 81, 82, 131, 132, or 143.
  • the intron can be inserted at any position in the PAH coding sequence. In certain embodiments, the intron is inserted at a position corresponding to an internucleotide bond that links two native exons. In certain embodiments, the intron is inserted at a position corresponding to an internucleotide bond that links native exon 8 and exon 9.
  • the PAH intron-inserted coding sequence comprises from 5′ to 3′: a first portion of a PAH coding sequence, the intron, and a second portion of a PAH coding sequence, wherein the first portion and the second portion, when spliced together, form a complete PAH coding sequence (e.g., wild-type PAH coding sequence, or silently altered PAH coding sequence).
  • the first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65
  • the second portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 66 or 67.
  • the first portion of the PAH coding sequence consist of the amino acid sequence set forth in SEQ ID NO: 64 or 65
  • the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 66 or 67
  • the first portion of the PAH coding sequence consist of the amino acid sequence set forth in SEQ ID NO: 65
  • the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 67.
  • the editing element comprises from 3′ to 5′: a first portion of a PAH coding sequence consist of the nucleotide sequence set forth in SEQ ID NO: 64, or a silently altered variant thereof (e.g., consisting of the nucleotide sequence set forth in SEQ ID NO: 65); an intron (e.g., consisting the nucleotide sequence set forth in SEQ ID NO: 28, 29, or 30); and a second portion of a PAH coding sequence consist of the nucleotide sequence set forth in SEQ ID NO: 66, or a silently altered variant thereof (e.g., consisting of the nucleotide sequence set forth in SEQ ID NO: 66).
  • the PAH coding sequence comprises a modified splice donor site.
  • a splice donor site-modified PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 138 or 139.
  • a splice donor site-modified PAH coding sequence comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 138 or 139.
  • a splice donor site-modified PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 138 or 139.
  • the editing element further comprises a transcription terminator 3′ to the PAH coding sequence or the PAH intron-inserted coding sequence.
  • the transcription terminator comprises a polyadenylation sequence (e.g., an exogenous polyadenylation sequence).
  • the exogenous polyadenylation sequence comprises an SV40 polyadenylation sequence (e.g., comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34, or a sequence complementary thereto).
  • the SV40 polyadenylation sequence comprises the nucleotide sequence set forth in SEQ ID NO: 31.
  • the editing element comprises from 5′ to 3′: a PAH coding sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 25) or a PAH intron-inserted coding sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 80), and an SV40 polyadenylation sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 31).
  • a PAH coding sequence e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 25
  • a PAH intron-inserted coding sequence e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 80
  • an SV40 polyadenylation sequence e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 31.
  • the editing element may further comprise an ID cassette 5′ to an SV40 polyadenylation sequence (e.g., comprising the nucleotide sequence set forth in SEQ ID NO: 31).
  • the ID cassette provides a sequence that can be used for identification purposes when performing next generation sequencing experiments.
  • the ID cassette comprises the nucleotide sequence set forth in SEQ ID NO: 33.
  • the ID cassette comprises a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 33.
  • the ID cassette consists of the nucleotide sequence set forth in SEQ ID NO: 33.
  • the editing element comprises from 5′ to 3′: a PAH coding sequence or PAH intron-inserted coding sequence, an ID cassette, and an SV40 polyadenylation sequence.
  • the editing element further comprises a ribosomal skipping element 5′ to the PAH coding sequence or the PAH intron-inserted coding sequence.
  • the editing element comprises from 5′ to 3′: a ribosomal skipping element; a PAH coding sequence or a PAH intron-inserted coding sequence; and optionally a transcription terminator (e.g., polyadenylation sequence).
  • the aforementioned editing elements can be integrated into an exon of the PAH gene (e.g., the nucleotide 5′ to the target locus is in an exon of the PAH gene) by homologous recombination to produce a recombinant sequence comprising from 5′ to 3′: a portion of the PAH gene 5′ to the target locus; the ribosomal skipping element; the PAH coding sequence or PAH intron-inserted coding sequence; and the transcription terminator (e.g., polyadenylation sequence), wherein the ribosomal skipping element is positioned such that it is in frame with the portion of the PAH gene 5′ to the target locus and the complete PAH coding sequence.
  • the ribosomal skipping element is positioned such that it is in frame with the portion of the PAH gene 5′ to the target locus and the complete PAH coding sequence.
  • Transcription and translation of this recombinant sequence produces a first polypeptide comprising the amino acid sequence encoded by the portion of the PAH gene 5′ to the target locus fused to a 5′ portion of the encoded ribosomal skipping peptide, and a second polypeptide comprising a 3′ portion of the encoded ribosomal skipping peptide fused to the complete amino acid sequence of the PAH polypeptide.
  • the nucleotide 5′ to the target locus is in an exon (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, or exon 13) of the PAH gene.
  • the target locus is an internucleotide bond in an exon (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, or exon 13) of the PAH gene.
  • the target locus is a sequence in the PAH gene, wherein the 5′ end of this sequence is in an exon (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, or exon 13) of the PAH gene or in the intergenic region between Achaete-scute homolog 1 (ASCL1) and PAH, and wherein the 3′ end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and insulin-like growth factor 1 (IGF1).
  • the nucleotide 5′ to the target locus is in exon 1, exon 2, or exon 3 of the PAH gene.
  • the target locus is an internucleotide bond in exon 1, exon 2, or exon 3 of the PAH gene.
  • the target locus is a sequence in the PAH gene wherein the 5′ end of this sequence is in exon 1, exon 2, or exon 3 of the PAH gene, wherein the 3′ end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1.
  • the editing element comprises a splice acceptor 5′ to the ribosomal skipping element. In certain embodiments, the editing element comprises from 5′ to 3′: a splice acceptor; a ribosomal skipping element; a PAH coding sequence or a PAH intron-inserted coding sequence; and optionally a transcription terminator (e.g., polyadenylation sequence).
  • a transcription terminator e.g., polyadenylation sequence
  • the aforementioned editing element can be integrated into an intron of the PAH gene (e.g., the nucleotide 5′ to the target locus is in an intron of the PAH gene) by homologous recombination to produce a recombinant sequence comprising 5′ to 3′: a portion of the PAH gene 5′ to the target locus including the endogenous splice donor site but not the endogenous splice acceptor of the intron; the splice acceptor; the ribosomal skipping element, the PAH coding sequence or PAH intron-inserted coding sequence; and the transcription terminator (e.g., polyadenylation sequence), wherein the ribosomal skipping element is positioned such that it is in frame with the PAH coding sequence or PAH intron-inserted coding sequence, and such that splicing of the splice acceptor to the endogenous splice donor of the intron of PAH places it in frame with the portion of the
  • Expression of this recombinant sequence produces a first polypeptide comprising the amino acid sequence encoded by the portion of the PAH gene 5′ to the target locus fused to a 5′ portion of the encoded ribosomal skipping peptide, and a second polypeptide comprising the complete amino acid sequence of the PAH polypeptide fused to a 3′ portion of the encoded ribosomal skipping peptide.
  • the nucleotide 5′ to the target locus is in an intron (e.g., intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12) of the PAH gene.
  • the target locus is an internucleotide bond in an intron (e.g., intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12) of the PAH gene.
  • the target locus is a sequence in the PAH gene wherein the 5′ end of this sequence is in an intron (e.g., intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12) of the PAH gene, wherein the 3′ end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1.
  • the nucleotide 5′ to the target locus is in intron 1, intron 2, or intron 3 of the PAH gene.
  • the target locus is an internucleotide bond in intron 1, intron 2, or intron 3 of the PAH gene.
  • the target locus is a sequence in the PAH gene wherein the 5′ end of this sequence is in intron 1, intron 2, or intron 3 of the PAH gene, wherein the 3′ end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1.
  • the nucleotide 5′ to the target locus is in intron 1 of the PAH gene.
  • the target locus is a sequence in the PAH gene wherein the 5′ end of this sequence is in intron 1 of the PAH gene, wherein the 3′ end of this sequence can be any nucleotide in the PAH gene or in the intergenic region between PAH and IGF1.
  • Any and all of the editing elements disclosed herein can further comprise a restriction endonuclease site not present in the wild-type PAH gene.
  • restriction endonuclease sites allow for identification of cells that have integration of the editing element at the target locus based upon restriction fragment length polymorphism analysis or by nucleic sequencing analysis of the target locus and its flanking regions, or a nucleic acid amplified therefrom.
  • any and all of the editing elements disclosed herein can comprise one or more nucleotide alterations that cause one or more amino acid mutations in PAH polypeptide when integrated into the target locus.
  • the mutant PAH polypeptide is a functional equivalent of the wild-type PAH polypeptide, i.e., can function as a wild-type PAH polypeptide.
  • the functionally equivalent PAH polypeptide further comprises at least one characteristic not found in the wild-type PAH polypeptide, e.g., the ability to stabilize PAH protein (e.g., dimer or tetramer), or the ability to resist protein degradation.
  • an editing element as described herein comprises at least 0, 1, 2, 10, 100, 200, 500, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides.
  • the editing element comprises or consists of 1 to 5000, 1 to 4500, 1 to 4000, 1 to 3000, 1 to 2000, 1 to 1000, 1 to 500, 1 to 200, 1 to 100, 1 to 50, or 1 to 10 nucleotides.
  • an editing element as described herein comprises or consists of a PAH coding sequence or a portion thereof (e.g., the complete human PAH coding sequence, or nucleotides 4 to 1359 of the human PAH coding sequence), a 5′ untranslated region (UTR), a 3′ UTR, a promoter, a splice donor, a splice acceptor, a sequence encoding a non-coding RNA, an insulator, a gene, or a combination thereof.
  • a PAH coding sequence or a portion thereof e.g., the complete human PAH coding sequence, or nucleotides 4 to 1359 of the human PAH coding sequence
  • UTR 5′ untranslated region
  • 3′ UTR a promoter
  • a splice donor e.g., a splice donor, a splice acceptor, a sequence encoding a non-coding RNA, an insulator, a gene, or a combination
  • the editing element comprises a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the sequence set forth in SEQ ID NO: 35, 83, or 84.
  • the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 35, 83, or 84.
  • the editing element consists of the nucleotide sequence set forth in SEQ ID NO: 35, 83, or 84.
  • the editing element comprises a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153.
  • the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153.
  • the editing element consists of the nucleotide sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153.
  • Homology arms used in the correction genomes disclosed herein can be directed to any region of the PAH gene or a gene nearby on the genome.
  • the precise identity and positioning of the homology arms are determined by the identity of the editing element and/or the target locus.
  • Homology arms employed in the correction genomes disclosed herein are substantially identical to the genome flanking a target locus (e.g., a target locus in a PAH gene).
  • the 5′ homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to a first genomic region 5′ to the target locus.
  • the 5′ homology arm has 100% nucleotide sequence identity to the first genomic region.
  • the 3′ homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to a second genomic region 3′ to the target locus. In certain embodiments, the 3′ homology arm has 100% nucleotide sequence identity to the second genomic region.
  • the 5′ and 3′ homology arms are each at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) identical to the first and second genomic regions flanking the target locus (e.g., a target locus in the PAH gene), respectively.
  • the 5′ and 3′ homology arms are each 100% identical to the first and second genomic regions flanking the target locus (e.g., a target locus in the PAH gene), respectively.
  • differences in nucleotide sequences of the 5′ homology arm and/or the 3′ homology arm and the corresponding regions the genome flanking a target locus comprise, consist essentially of or consist of non-coding differences in nucleotide sequences.
  • homology arms do not need to be 100% identical to the genomic sequence flanking the target locus to be able to mediate integration of an editing element into that target locus by homologous recombination.
  • the homology arms can comprise one or more genetic variations in the human population, and/or one or more modifications (e.g., nucleotide substitutions, insertions, or deletions) designed to improve expression level or specificity.
  • Human genetic variations include both inherited variations and de novo variations that are private to the target genome, and encompass simple nucleotide polymorphisms, insertions, deletions, rearrangements, inversions, duplications, micro-repeats, and combinations thereof.
  • the first genomic region 5′ to the target locus is located in a first editing window, wherein the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36.
  • the second genomic region 3′ to the target locus is located in a second editing window, wherein the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 45.
  • the first genomic region 5′ to the target locus is located in a first editing window, wherein the first editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36; and the second genomic region 3′ to the target locus is located in a second PAH targeting locus, wherein the second editing window consists of the nucleotide sequence set forth in SEQ ID NO: 45.
  • the first and second editing windows are different.
  • the first editing window is located 5′ to the second editing window.
  • the first genomic region consists of a sequence shorter than the sequence of the first editing window in which the first genomic region is located.
  • the first genomic region consists of the sequence of the first editing window in which the first genomic region is located.
  • the second genomic region consists of a sequence shorter than the sequence of the second editing window in which the second genomic region is located.
  • the second genomic region consists of the sequence of the second editing window in which the second genomic region is located.
  • the first genomic region 5′ to the target locus has the sequence set forth in SEQ ID NO: 36.
  • the second genomic region 3′ to the target locus has the sequence set forth in SEQ ID NO: 45.
  • the first genomic region 5′ to the target locus and the second genomic region 3′ to the target locus have the sequences set forth in SEQ ID NOs: 36 and 45, respectively.
  • the first and second editing windows are the same.
  • the target locus is an internucleotide bond or a nucleotide sequence in the editing window, wherein the first genomic region consists of a first portion of the editing window 5′ to the target locus, and the second genomic region consists of a second portion of the editing window 3′ to the target locus.
  • the first portion of the editing window consists of the sequence from the 5′ end of the editing window to the nucleotide adjacently 5′ to the target locus.
  • the second portion of the editing window consists of the sequence from the nucleotide adjacently 3′ to the target locus to the 3′ end of the editing window.
  • the first portion of the editing window consists of the sequence from the 5′ end of the editing window to the nucleotide adjacently 5′ to the target locus
  • the second portion of the editing window consists of the sequence from the nucleotide adjacently 3′ to the target locus to the 3′ end of the editing window.
  • the editing window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45.
  • the first and second portions of the editing windows have substantially equal lengths (e.g., the ratio of the length of the shorter portion to the length of the longer portion is greater than 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.96, 0.97, 0.98, or 0.99).
  • the 5′ homology arm has a length of about 50 to about 4000 nucleotides (e.g., about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 5′ homology arm has a length of about 800 nucleotides. In certain embodiments, the 5′ homology arm has a length of about 100 nucleotides. In certain embodiments, the 3′ homology arm has a length of about 50 to about 4000 nucleotides (e.g., about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 3′ homology arm has a length of about 800 nucleotides.
  • the 3′ homology arm has a length of about 100 nucleotides. In certain embodiments, each of the 5′ and 3′ homology arms independently has a length of about 50 to about 4000 nucleotides (e.g., about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 5′ and 3′ homology arm has a length of about 800 nucleotides.
  • the 5′ and 3′ homology arms have substantially equal nucleotide lengths. In certain embodiments, the 5′ and 3′ homology arms have asymmetrical nucleotide lengths. In certain embodiments, the asymmetry in nucleotide length is defined by a difference between the 5′ and 3′ homology arms of up to 90% in the length, such as up to an 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% difference in the length.
  • the 5′ homology arm comprises: C corresponding to nucleotide ⁇ 2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, G corresponding to nucleotide 9 of the PAH gene, A corresponding to nucleotide ⁇ 467 of the PAH gene, A corresponding to nucleotide ⁇ 465 of the PAH gene, A corresponding to nucleotide ⁇ 181 of the PAH gene, G corresponding to nucleotide ⁇ 214 of the PAH gene, C corresponding to nucleotide ⁇ 212 of the PAH gene, A corresponding to nucleotide ⁇ 211 of the PAH gene, G corresponding to nucleotide 194 of the PAH gene, C corresponding to nucleotide ⁇ 433 of the PAH gene, C corresponding to nucleotide ⁇ 432
  • the 5′ homology arm comprises:
  • the 5′ homology arm comprises:
  • the 5′ homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 36, optionally comprising one or more of the nucleotides at the positions set forth above.
  • the 5′ homology arm further comprises one or more genetic variations in the human population.
  • the 5′ homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 36, 37, 38, 39, 40, 41, 42, 43, or 44.
  • the 5′ homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 36, 37, 38, 39, 40, 41, 42, 43, or 44.
  • the 3′ homology arm has at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 45.
  • the 3′ homology arm further comprises one or more genetic variations in the human population.
  • the 3′ homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 45.
  • the 3′ homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 45.
  • the 5′ homology arm and the 3′ homology arm each have at least about 90% (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity to the nucleotide sequences set forth in SEQ ID NOs: 36 and 45, respectively, optionally wherein the 5′ homology arm comprises one or more of the nucleotides at the positions set forth above.
  • the 5′ homology arm and the 3′ homology arm comprise the nucleotide sequences set forth in SEQ ID NOs: 36 and 45, 37 and 45, 38 and 45, 39 and 45, 40 and 45, 41 and 45, 42 and 45, 43 and 45, or, 44 and 45, respectively.
  • the 5′ homology arm and the 3′ homology arm consist of the nucleotide sequences set forth in SEQ ID NOs: 36 and 45, 37 and 45, 38 and 45, 39 and 45, 40 and 45, 41 and 45, 42 and 45, 43 and 45, or, 44 and 45, respectively.
  • the 5′ homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 69 or 72. In certain embodiments, the 5′ homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 69 or 72. In certain embodiments, the 3′ homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 70 or 73. In certain embodiments, the 3′ homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 70 or 73. In certain embodiments, the 5′ homology arm and the 3′ homology arm comprise the nucleotide sequences set forth in SEQ ID NOs: 69 and 70, or 72 and 73, respectively. In certain embodiments, the 5′ homology arm and the 3′ homology arm consist of the nucleotide sequences set forth in SEQ ID NOs: 69 and 70, or 72 and 73, respectively.
  • the 5′ homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 111, 115, or 142. In certain embodiments, the 5′ homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 111, 115, or 142. In certain embodiments, the 3′ homology arm comprises the nucleotide sequence set forth in SEQ ID NO: 112, 117, or 144. In certain embodiments, the 3′ homology arm consists of the nucleotide sequence set forth in SEQ ID NO: 112, 117, or 144.
  • the 5′ homology arm and the 3′ homology arm comprise the nucleotide sequences set forth in SEQ ID NOs: 111 and 112, 115 and 117, or 142 and 144, respectively. In certain embodiments, the 5′ homology arm and the 3′ homology arm consist of the nucleotide sequences set forth in SEQ ID NOs: 111 and 112, 115 and 117, or 142 and 144, respectively.
  • the correction genome comprises a nucleotide sequence at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) identical to SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145.
  • the correction genome comprises the nucleotide sequence set forth in SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145.
  • the correction genome consists of the nucleotide sequence set forth in SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145
  • the correction genomes disclosed herein further comprise a 5′ inverted terminal repeat (5′ ITR) nucleotide sequence 5′ of the 5′ homology arm nucleotide sequence, and a 3′ inverted terminal repeat (3′ ITR) nucleotide sequence 3′ of the 3′ homology arm nucleotide sequence.
  • 5′ ITR 5′ inverted terminal repeat
  • 3′ ITR 3′ inverted terminal repeat
  • ITR sequences from any AAV serotype or variant thereof can be used in the correction genomes disclosed herein.
  • the 5′ and 3′ ITR can be from an AAV of the same serotype or from AAVs of different serotypes.
  • Exemplary ITRs for use in the correction genomes disclosed herein are set forth in SEQ ID NO: 18-21 herein.
  • the 5′ ITR nucleotide sequence and the 3′ ITR nucleotide sequence are substantially complementary to each other (e.g., are complementary to each other except for mismatch at 1, 2, 3, 4 or 5 nucleotide positions in the 5′ or 3′ ITR).
  • the 5′ ITR or 3′ ITR is from AAV2. In certain embodiments, both the 5′ ITR and the 3′ ITR are from AAV2. In certain embodiments, the 5′ ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:18, or the 3′ ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:19.
  • the 5′ ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:18
  • the 3′ ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:19.
  • the correction genome comprises an editing element having the nucleotide sequence set forth in SEQ ID NO: 35, a 5′ ITR nucleotide sequence having the sequence of SEQ ID NO:18, and a 3′ ITR nucleotide sequence having the sequence of SEQ ID NO:19.
  • the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, a 5′ ITR nucleotide sequence having the sequence of SEQ ID NO:18, and a 3′ ITR nucleotide sequence having the sequence of SEQ ID NO:19.
  • the correction genome consists of 5′ to 3′ a 5′ ITR nucleotide sequence having the sequence of SEQ ID NO:18, the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, and a 3′ ITR nucleotide sequence having the sequence of SEQ ID NO:19.
  • the 5′ ITR or 3′ ITR are from AAV5. In certain embodiments, both the 5′ ITR and 3′ ITR are from AAV5. In certain embodiments, the 5′ ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:20, or the 3′ ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO:21.
  • the 5′ ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:20, and the 3′ ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO:21.
  • the correction genome comprises an editing element having the nucleotide sequence set forth in SEQ ID NO: 35, a 5′ ITR nucleotide sequence having the sequence of SEQ ID NO:20, and a 3′ ITR nucleotide sequence having the sequence of SEQ ID NO:21.
  • the correction genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, a 5′ ITR nucleotide sequence having the sequence of SEQ ID NO:20, and a 3′ ITR nucleotide sequence having the sequence of SEQ ID NO:21.
  • the correction genome consists of 5′ to 3′ a 5′ ITR nucleotide sequence having the sequence of SEQ ID NO:20, the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, and a 3′ ITR nucleotide sequence having the sequence of SEQ ID NO:21.
  • the 5′ ITR nucleotide sequence and the 3′ ITR nucleotide sequence are substantially complementary to each other (e.g., are complementary to each other except for mismatch at 1, 2, 3, 4 or 5 nucleotide positions in the 5′ or 3′ ITR).
  • the 5′ ITR or the 3′ ITR is modified to reduce or abolish resolution by Rep protein (“non-resolvable ITR”).
  • the non-resolvable ITR comprises an insertion, deletion, or substitution in the nucleotide sequence of the terminal resolution site. Such modification allows formation of a self-complementary, double-stranded DNA genome of the AAV after the transfer genome is replicated in an infected cell.
  • Exemplary non-resolvable ITR sequences are known in the art (see e.g., those provided in U.S. Pat. Nos. 7,790,154 and 9,783,824, which are incorporated by reference herein in their entirety).
  • the 5′ ITR comprises a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26. In certain embodiments, the 5′ ITR consists of a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26. In certain embodiments, the 5′ ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26. In certain embodiments, the 3′ ITR comprises a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 27.
  • the 5′ ITR consists of a nucleotide sequence at least 95%, 96%, 97%, 98%, 3or 99% identical to SEQ ID NO: 27.
  • the 3′ ITR consists of the nucleotide sequence set forth in SEQ ID NO: 27.
  • the 5′ ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26 and the 3′ ITR consists of the nucleotide sequence set forth in SEQ ID NO: 27.
  • the 5′ ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26, and the 3′ ITR consists of the nucleotide sequence set forth in SEQ ID NO: 19.
  • the 3′ ITR is flanked by an additional nucleotide sequence derived from a wild-type AAV2 genomic sequence.
  • the 3′ ITR is flanked by an additional 37 bp sequence derived from a wild-type AAV2 sequence that is adjacent to a wild-type AAV2 ITR. See, e.g., Savy et al., Human Gene Therapy Methods (2017) 28(5): 277-289 (which is hereby incorporated by reference herein in its entirety).
  • the additional 37 bp sequence is internal to the 3′ ITR.
  • the 37 bp sequence consists of the sequence set forth in SEQ ID NO: 140.
  • the 3′ ITR comprises a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 141. In certain embodiments, the 3′ ITR comprises the nucleotide sequence set forth in SEQ ID NO: 141. In certain embodiments, the nucleotide sequence of the 3′ ITR consists of a nucleotide sequence at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 141. In certain embodiments, the nucleotide sequence of the 3′ ITR consists of the nucleotide sequence set forth in SEQ ID NO: 141.
  • the correction genome disclosed herein has a length of about 0.5 to about 8 kb (e.g., about 1 to about 5, about 2 to about 5, about 3 to about 5, about 4 to about 5, about 4.5 to about 4.8, or about 4.7 kb).
  • the correction genome comprises a nucleotide sequence at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) identical to SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146.
  • the correction genome comprises the nucleotide sequence set forth in SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146.
  • the correction genome consists of the nucleotide sequence set forth in SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146.
  • the replication-defective AAV comprises: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a transfer genome comprising 5′ to 3′ the following genetic elements: a 5′ ITR element (e.g., the 5′ ITR of SEQ ID NOs: 18), a 5′ homology arm (e.g., the 5′ homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3′ homology arm (e.g., the
  • the replication-defective AAV comprises: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; (b) an AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; and/or (c) an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114,
  • the AAV compositions disclosed herein are particularly advantageous in that they are capable of correcting a PAH gene in a cell with high efficiency both in vivo and in vitro.
  • the integration efficiency of the editing element into the target locus is at least 1% (e.g. at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.
  • the allelic frequency of integration of the editing element into the target locus is at least 0.5% (e.g. at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.
  • any methods of determining the efficiency of editing of the PAH gene can be employed.
  • individual cells are separated from the population of transduced cells and subject to single-cell PCR using PCR primers that can identify the presence of an editing element correctly integrated into the target locus of the PAH gene.
  • Such method can further comprise single-cell PCR of the same cells using PCR primers that selectively amplify an unmodified target locus.
  • the genotype of the cells can be determined. For example, if the single cell PCR showed that a cell has both an edited target locus and an unmodified target locus, then the cell would be considered heterozygous for the edited PAH gene.
  • linear amplification mediated PCR LAM-PCR
  • quantitative PCR qPCR
  • ddPCR digital droplet PCR
  • Such methods can further comprise an additional qPCR or ddPCR (either in the same reaction or a separate reaction) to determine the number of total genomes in the sample and the number of unedited PAH alleles. These numbers can be used to determine the allelic frequency of integration of the editing element into the target locus.
  • the PAH locus can be amplified from DNA extracted from the population of transduced cells either by PCR using primers that bind to regions of the PAH gene flanking the target locus, or by LAM-PCR using a primer that binds a region within the correction genome (e.g., a region comprising an exogenous sequence non-native to the locus).
  • the resultant PCR amplicons can be individually sequenced using single molecule next generation sequencing (NGS) techniques to determine the relative number of edited and unedited PAH alleles present in the population of transduced cells. These numbers can be used to determine the allelic frequency of integration of the editing element into the target locus.
  • NGS next generation sequencing
  • compositions comprising an AAV as disclosed herein together with a pharmaceutically acceptable excipient, adjuvant, diluent, vehicle or carrier, or a combination thereof.
  • a “pharmaceutically acceptable carrier” includes any material which, when combined with an active ingredient of a composition, allows the ingredient to retain biological activity and without causing disruptive physiological reactions, such as an unintended immune reaction.
  • Pharmaceutically acceptable carriers include water, phosphate buffered saline, emulsions such as oil/water emulsion, and wetting agents. Compositions comprising such carriers are formulated by well-known conventional methods such as those set forth in Remington's Pharmaceutical Sciences, current Ed., Mack Publishing Co., Easton Pa. 18042, USA; A.
  • the instant disclosure provides methods for correcting a mutation in the PAH gene or expressing a PAH polypeptide in a cell.
  • the methods generally comprise transducing the cell with a replication-defective AAV as disclosed herein.
  • Such methods are highly efficient at correcting mutations in the PAH gene or restoring PAH expression, and do not require cleavage of the genome at the target locus by the action of an exogenous nuclease (e.g., a meganuclease, a zinc finger nuclease, a transcriptional activator-like nuclease (TALEN), or an RNA-guided nuclease such as a Cas9) to facilitate such correction.
  • an exogenous nuclease e.g., a meganuclease, a zinc finger nuclease, a transcriptional activator-like nuclease (TALEN), or an RNA-guided nuclease such as a Cas9 to facilitate such correction
  • the methods disclosed herein involve transducing the cell with a replication-defective AAV as disclosed herein without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.
  • the methods disclosed herein can be applied to any cell harboring a mutation in the PAH gene.
  • the skilled worker will appreciate that cells that actively express PAH are of particular interest.
  • the method is applied to cells in the liver, kidney, brain, pituitary gland, adrenal gland, pancreas, urinary bladder, gallbladder, colon, small intestine, or breast.
  • the method is applied to hepatocytes and/or renal cells.
  • the methods disclosed herein can be performed in vitro for research purposes or can be performed ex vivo or in vivo for therapeutic purposes.
  • the cell to be transduced is in a mammalian subject and the AAV is administered to the subject in an amount effective to transduce the cell in the subject.
  • the instant disclosure provides a method for treating a subject having a disease or disorder associated with a PAH gene mutation, the method generally comprising administering to the subject an effective amount of a replication-defective AAV as disclosed herein.
  • the subject can be a human subject or a rodent subject (e.g., a mouse) containing human liver cells. Suitable mouse subjects include without limitation, mice into which human liver cells (e.g., human hepatocytes) have been engrafted. Any disease or disorder associated with a PAH gene mutation can be treated using the methods disclosed herein.
  • Suitable diseases or disorders include, without limitation, phenylketonuria.
  • the cell is transduced without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence that encodes an exogenous nuclease.
  • the methods disclosed herein are particularly advantageous in that they are capable of correcting a PAH gene in a cell with high efficiency both in vivo and in vitro.
  • the integration efficiency of the editing element into the target locus is at least 1% (e.g. at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.
  • the allelic frequency of integration of the editing element into the target locus is at least 0.5% (e.g. at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) when the AAV is administered to a mouse implanted with human hepatocytes in the absence of an exogenous nuclease under standard AAV administration conditions.
  • transduction of a cell with an AAV composition disclosed herein can be performed as provided herein or by any method of transduction known to one of ordinary skill in the art.
  • the cell may be contacted with the AAV at a multiplicity of infection (MOI) of 50,000; 100,000; 150,000; 200,000; 250,000; 300,000; 350,000; 400,000; 450,000; or 500,000, or at any MOI that provides for optimal transduction of the cell.
  • MOI multiplicity of infection
  • the foregoing methods employ a replication-defective AAV comprising: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a transfer genome comprising 5′ to 3′ the following genetic elements: a 5′ ITR element (e.g., the 5′ ITR of SEQ ID NOs: 18), a 5′ homology arm (e.g., the 5′ homology arm of SEQ ID NOs: 115), a splice acceptor (e.g., the splice acceptor of SEQ ID NOs: 14), a 2A element (e.g., the 2A element of SEQ ID NOs: 74), a silently altered human PAH coding sequence (e.g., the PAH coding sequence of SEQ ID NOs: 116), an SV40 polyadenylation sequence e.g., the SV40 polyadenylation sequence of SEQ ID NOs: 31), a 3′ homology
  • the foregoing methods employ a replication-defective AAV comprising: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; (b) an AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; and/or (c) an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 16, and a correction genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113,
  • An AAV composition disclosed herein can be administered to a subject by any appropriate route including, without limitation, intravenous, intraperitoneal, subcutaneous, intramuscular, intranasal, topical or intradermal routes.
  • the composition is formulated for administration via intravenous injection or subcutaneous injection.
  • the instant disclosure provides packaging systems for recombinant preparation of a replication-defective AAV disclosed herein.
  • packaging systems generally comprise: a Rep nucleotide sequence encoding one or more AAV Rep proteins; a Cap nucleotide sequence encoding one or more AAV Clade F capsid proteins as disclosed herein; and a correction genome for correction of the PAH gene or a transfer genome for expression of the PAH gene as disclosed herein, wherein the packaging system is operative in a cell for enclosing the correction genome in the capsid to form the AAV.
  • the packaging system comprises a first vector comprising the Rep nucleotide sequence and the Cap nucleotide sequence, and a second vector comprising the correction genome or transfer genome.
  • a “vector” refers to a nucleic acid molecule that is a vehicle for introducing nucleic acids into a cell (e.g., a plasmid, a virus, a cosmid, an artificial chromosome, etc.).
  • AAV Rep protein can be employed in the packaging systems disclosed herein.
  • the Rep nucleotide sequence encodes an AAV2 Rep protein.
  • Suitable AAV2 Rep proteins include, without limitation, Rep 78/68 or Rep 68/52.
  • the nucleotide sequence encoding the AAV2 Rep protein comprises a nucleotide sequence that encodes a protein having a minimum percent sequence identity to the AAV2 Rep amino acid sequence of SEQ ID NO: 22, wherein the minimum percent sequence identity is at least 70% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%) across the length of the amino acid sequence of the AAV2 Rep protein.
  • the AAV2 Rep protein has the amino acid sequence set forth in SEQ ID NO: 22.
  • the packaging system further comprises a third vector, e.g., a helper virus vector.
  • the third vector may be an independent third vector, integral with the first vector, or integral with the second vector.
  • the third vector comprises genes encoding helper virus proteins.
  • the helper virus is selected from the group consisting of adenovirus, herpes virus (including herpes simplex virus (HSV)), poxvirus (such as vaccinia virus), cytomegalovirus (CMV), and baculovirus.
  • the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4 and VA.
  • the HSV genome comprises one or more of HSV genes selected from the group consisting of UL5/8/52, ICPO, ICP4, ICP22 and UL30/UL42.
  • the first, second, and/or third vector are contained within one or more transfecting plasmids. In certain embodiments, the first vector and the third vector are contained within a first transfecting plasmid. In certain embodiments the second vector and the third vector are contained within a second transfecting plasmid.
  • the first, second, and/or third vector are contained within one or more recombinant helper viruses. In certain embodiments, the first vector and the third vector are contained within a recombinant helper virus. In certain embodiments, the second vector and the third vector are contained within a recombinant helper virus.
  • the disclosure provides a method for recombinant preparation of an AAV as described herein, wherein the method comprises transfecting or transducing a cell with a packaging system as described under conditions operative for enclosing the correction genome in the capsid to form the AAV as described herein.
  • Exemplary methods for recombinant preparation of an AAV include transient transfection (e.g., with one or more transfection plasmids containing a first, and a second, and optionally a third vector as described herein), viral infection (e.g.
  • helper viruses such as a adenovirus, poxvirus (such as vaccinia virus), herpes virus (including HSV, cytomegalovirus, or baculovirus, containing a first, and a second, and optionally a third vector as described herein), and stable producer cell line transfection or infection (e.g., with a stable producer cell, such as a mammalian or insect cell, containing a Rep nucleotide sequence encoding one or more AAV Rep proteins and/or a Cap nucleotide sequence encoding one or more AAV Clade F capsid proteins as described herein, and with a correction genome as described herein being delivered in the form of a transfecting plasmid or a recombinant helper virus).
  • a stable producer cell such as a mammalian or insect cell, containing a Rep nucleotide sequence encoding one or more AAV Rep proteins and/or a Cap nucleotide sequence encoding one or more A
  • the recombinant AAV vectors disclosed herein mediate highly efficient gene editing in vitro and in vivo.
  • the following examples provide correction vectors that can be packaged with an AAV clade F capsid (e.g., AAVHSC7, AAVHSC15 or AAVHSC17, as disclosed in U.S. Pat. No. 9,623,120, which is incorporated by reference herein in its entirety), and demonstrate the efficient restoration of the expression of the PAH gene which is mutated in certain human diseases, such as phenylketonuria.
  • PAH correction vector pHMI-hPAH-hAC-008, as shown in FIG. 1A comprises 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a targeted integration restriction cassette (“TI RE”), a 3′ homology arm, and a 3′ ITR element.
  • the sequences of these elements are set forth in Table 1.
  • the 5′ homology arm comprises a wild-type genomic sequence 800 nucleotides upstream from the human PAH start codon, and thus has the ability to correct mutations in the start codon and/or 5′ untranslated region (UTR) that affect PAH expression as observed in some PKU patients.
  • the 3′ homology arm comprises the wild-type genomic sequence 800 nucleotides downstream from the start codon.
  • Integration of the PAH correction vector pHMI-hPAH-hAC-008 into the human genome inserts the silently altered human PAH coding sequence, the SV40 polyadenylation sequence, and the targeted integration restriction cassette at the PAH start codon target locus (i.e., replacing nucleotides 1-3 of the PAH gene), thereby restoring the expression of a wild-type PAH protein that has been impaired by mutations in 5′ UTR, coding sequence, or 3′ UTR of the PAH gene.
  • PAH correction vector pHMI-hPAH-hAC-008 Genetic Element SEQ ID NO 5′ ITR element 18 5′ homology arm 69 silently altered human PAH coding sequence 25 SV40 polyadenylation sequence 31 targeted integration restriction cassette 71 3′ homology arm 70 3′ ITR element 19 Editing element 83 Correction genome from 5′ homology 85 arm to 3′ homology arm Correction genome from 5′ ITR to 3′ ITR 87 b) PAH correction vector pHMI-hPAH-h1C-007
  • PAH correction vector pHMI-hPAH-h1C-007 comprises 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a splice acceptor, a 2A element, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a targeted integration restriction cassette (“TI RE”), a 3′ homology arm, and a 3′ ITR element.
  • the sequences of these elements are set forth in Table 2.
  • the 5′ homology arm comprises the wild-type genomic sequence of 800 nucleotides upstream from nucleotide 2128 of human PAH, which is located in intron 1.
  • the 3′ homology arm comprises the wild-type genomic sequence of 800 nucleotides downstream from nucleotide 2127 of human PAH.
  • Integration of the PAH correction vector pHMI-hPAH-h1C-007 into the human genome allows transcription of the PAH locus into a pre-mRNA comprising 5′ to 3′ the following elements: exon 1 of endogenous PAH, part of intron 1 from its 5′ splice donor to nucleotide 2127, the splice acceptor in the vector pHMI-hPAH-h1C-007, the 2A element, the silently altered human PAH coding sequence, and the SV40 polyadenylation sequence.
  • mRNA comprising 5′ to 3′ the following elements: exon 1 of endogenous PAH, the 2A element (in frame with the PAH exon 1), the silently altered human PAH coding sequence (in frame with the 2A element), and the SV40 polyadenylation sequence.
  • the 2A element leads to generation of two polypeptides: a truncated PAH peptide terminated at the end of exon 1 fused with an N-terminal part of the 2A peptide, and a proline from the 2A peptide fused with a full-length PAH polypeptide. Therefore, integration of the vector pHMI-hPAH-h1C-007 can restore the expression of wild-type PAH protein that has been impaired by mutations in the coding sequence or 3′ UTR of the PAH gene.
  • the pCOH-WT-PAH vector comprises a CBA promoter operably linked to a wild-type PAH coding sequence set forth in SEQ ID NO: 24.
  • the pCOH-CO-PAH and pHMI-CO-PAH vectors each comprise a CBA promoter operably linked to a silently altered human PAH coding sequence as set forth in SEQ ID NO: 25.
  • VG-GT-CO-PAH (“CO-hPAH”) gave rise to an expression level of human PAH notably higher than VG-GT-PAH (“WT-hPAH”).
  • pHMIA-hPAH-hI1C-032.1 vector showed the highest editing efficiency in vitro. This example provides the structure of this vector and its variants.
  • PAH correction vector pHMIA-hPAH-hI1C-032.1 comprises 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a splice acceptor, a P2A element, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a 3′ homology arm, and a 3′ ITR element.
  • the sequences of these elements are set forth in Table 3.
  • the 5′ homology arm comprises the wild-type genomic sequence of nucleotides ⁇ 686 to 274 of human PAH, the 3′ end of which is located in intron 1.
  • the 3′ homology arm comprises the wild-type genomic sequence of nucleotides 415 to 1325 of human PAH.
  • Integration of the PAH correction vector pHMIA-hPAH-hI1C-032.1 into the human genome allows transcription of the PAH locus into a pre-mRNA comprising 5′ to 3′ the following elements: exon 1 of endogenous PAH, part of intron 1 from its 5′ splice donor to nucleotide 274, the splice acceptor in the vector pHMIA-hPAH-hI1C-032.1, the P2A element, the silently altered human PAH coding sequence, and the SV40 polyadenylation sequence.
  • mRNA comprising 5′ to 3′ the following elements: exon 1 of endogenous PAH, the P2A element (in frame with the PAH exon 1), the silently altered human PAH coding sequence (in frame with the P2A element), and the SV40 polyadenylation sequence.
  • the P2A element leads to generation of two polypeptides: a truncated PAH peptide terminated at the end of exon 1 fused with an N-terminal part of the P2A peptide, and a proline from the P2A peptide fused with a full-length PAH polypeptide. Therefore, integration of the vector pHMIA-hPAH-hI1C-032.1 can restore the expression of wild-type PAH protein that has been impaired by mutations in the coding sequence or 3′ UTR of the PAH gene.
  • PAH correction vector pHMIA-hPAH-hI1C-032.1 Genetic Element SEQ ID NO 5′ ITR element 18 5′ homology arm 36 Splice acceptor 14 P2A element 79 silently altered human PAH coding sequence 25 SV40 polyadenylation sequence 31 3′ homology arm 45 3′ ITR element 19 Editing element 35 Correction genome from 5′ homology arm 46 to 3′ homology arm Correction genome from 5′ ITR to 3′ ITR 55 b) Variants of PAH Correction Vector pHMIA-hPAH-hI1C-032.1
  • pHMIA-hPAH-hI1C-032.1 vector Eight variants of the pHMIA-hPAH-hI1C-032.1 vector have been designed to improve the expression of the PAH gene locus. These variants, named pHMIA-hPAH-hI1C-032.2 to pHMIA-hPAH-hI1C-032.9, differ from pHMIA-hPAH-hI1C-032.1 only in the 5′ homology arm. The sequences of the different elements are set forth in Table 4.
  • the pHMIA-hPAH-hI1C-032.2 vector was designed to optimize the Kozak sequence for improved ribosome recruitment to the transcript. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides C, G, G, G, and G at positions ⁇ 2, 4, 6, 7, and 9, respectively, of the PAH gene.
  • the pHMIA-hPAH-hI1C-032.3 vector was designed to remove a single quadruplex in 5′ UTR of the PAH gene that might suppress expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides A and A at positions ⁇ 467 and ⁇ 465, respectively, of the PAH gene.
  • the pHMIA-hPAH-hI1C-032.4 vector was designed to optimize a cyclic AMP response element to increase expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotide A at position ⁇ 181 of the PAH gene.
  • the pHMIA-hPAH-hI1C-032.5 vector was designed to optimize two cyclic AMP response elements to increase expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides G, C, A, and A at positions ⁇ 214, ⁇ 212, ⁇ 211, and ⁇ 181, respectively, of the PAH gene.
  • pHMIA-hPAH-hI1C-032.6 vector was designed to incorporate the minor allele of SNP rs1522295, which correlates with altered PAH expression in humans. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotide G at position 194 of the PAH gene.
  • the pHMIA-hPAH-hI1C-032.7 vector was designed to optimize a glucocorticoid binding site in the 5′ UTR to increase expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides C and C at positions ⁇ 433 and ⁇ 432, respectively, of the PAH gene.
  • the pHMIA-hPAH-hI1C-032.8 vector was designed to modify two glucocorticoid binding sites and a single AP2 binding site for improved expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotides C and C at positions ⁇ 433 and ⁇ 432, respectively, of the PAH gene, and having the nucleotide sequence ACGCTGTTCTTCGCC (SEQ ID NO: 68) at positions ⁇ 394 to ⁇ 388 of the PAH gene.
  • the pHMIA-hPAH-hI1C-032.9 vector was designed to disrupt three G-quadruplexes in the 5′ UTR that might suppress expression. It differs from pHMIA-hPAH-hI1C-032.1 in having the nucleotide A at each of the nucleotide positions ⁇ 467, ⁇ 465, ⁇ 341, ⁇ 339, —225, ⁇ 211, and ⁇ 203 of the PAH gene.
  • This example provides an in vitro method for examining PAH correction vectors, such as those described in the previous examples.
  • PAH correction vector pHMI-hPAH-hA-002 a variant of pHMI-hPAH-hAC-008 wherein the PAH coding sequence is wild-type (i.e., not silently altered)
  • PAH correction vector pHMI-hPAH-h1-001 a variant of pHMI-hPAH-h1C-007 wherein the PAH coding sequence is wild-type (i.e., not silently altered)
  • K562 cells were transduced with the pHMI-hPAH-hA-002 vector packaged in AAVHSC17 at an MOI of 150,000. The genomic DNA of the cells was collected after 48 hours.
  • the desired integration was detected in a sample from cells transduced with the pHMI-hPAH-hA-002 vector (“R1 ATG”), but not detected in samples from cells transduced with the pHMI-hPAH-h1-001 vector (“R1 Intron”) or untransduced cells (“R1 WT”).
  • R1 ATG pHMI-hPAH-hA-002 vector
  • R1 Intron pHMI-hPAH-h1-001 vector
  • R1 WT untransduced cells
  • PAH_Genomic Set 1 detected the unedited genome and the edited genome after the targeted integration of pHMI-hPAH-hA-002.
  • SV40_FAM Set 1 detected a sequence in the SV40 polyadenylation sequence, which was present in the edited genome and the unintegrated vectors.
  • PAH_HA Set 1 detected a region in the homology arm, which was present in both edited and unedited genomes, as well as in the unintegrated vectors.
  • DNA samples were partitioned into oil droplets.
  • the concentration of DNA was optimized to a concentration of 600 pg per 20 ⁇ L in order to significantly reduce the probability that one oil droplet randomly contains two DNA molecules (e.g., a vector particle and a genomic DNA particle) (p ⁇ 0.001).
  • the quantity of DNA identified by PAH_Genomic Set 1 (Quantity_genome) represented the total amount of unedited and edited genomes.
  • the quantity of DNA identified by SV40_FAM Set 1 (Quantity_payload) represented the total amount of edited genomes and unintegrated vectors.
  • the quantity of DNA identified by PAH_HA Set 1 (Quantity_HA) represented the total amount of unedited genomes, edited genomes, and unintegrated vectors.
  • the quantity of edited genome can be calculated by the follow formula: Quantity_genome+Quantity_payload-Quantity_HA.
  • the fraction of genome having the correct integration can be calculated as the quantity of edited genome divided by Quantity_genome.
  • PAH_Genomic Set 1 primer F GCTCCATCCTGCACATAGTT 91 PAH_Genomic Set 1, primer R CCTATGCTTTCCTGATGAGATCC 92 PAH_Genomic Set 1, probe TTGGTGCTGCTGGCAATACGGTC 93 SV40_FAM Set 1, primer F GCAATAGCATCACAAATTTCAC 94 SV40_FAM Set 1, primer R GATCCAGACATGATAAGATACATTG 95 SV40_FAM Set 1, probe TCACTGCATTCTAGTTGTGGTTTGTCCA 96 PAH_HA Set 1, primer F TCCAGTCACCAGACAGTTAGT 97 PAH_HA Set 1, primer R GGAGAGAAATGGAGCAAGTGAA 98 PAH_HA Set 1, probe ACAGCCTATATTTCACCATGCTGATCCC 99
  • This example provides animal models for examining PAH correction vectors that are capable of editing mouse PAH gene, and determining their editing efficiency in mouse liver.
  • pHMI-hPAH-mAC-006 vector in vivo editing of the mouse genome using the pHMI-hPAH-mAC-006 vector.
  • the pHMI-hPAH-mAC-006 vector was similar to the pHMI-hPAH-hAC-008 vector, but was capable of editing the mouse PAH gene rather than the human PAH gene ( FIG. 4A ).
  • pHMI-hPAH-mAC-006 comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a targeted integration restriction cassette (“TI RE”), a 3′ homology arm, and a 3′ ITR element.
  • TI RE targeted integration restriction cassette
  • the sequences of these elements are set forth in Table 6.
  • the 5′ homology arm comprised the wild-type genomic sequence upstream from and including the mouse PAH start codon, and thus had the ability to correct mutations in the start codon and/or 5′ untranslated region (UTR) of the mouse PAH gene.
  • the 3′ homology arm comprised the wild-type genomic sequence downstream from the start codon of mouse PAH.
  • Integration of the PAH correction vector pHMI-hPAH-mAC-006 into the mouse genome could insert the silently altered human PAH coding sequence, the SV40 polyadenylation sequence, and the targeted integration restriction cassette at the start codon of the mouse PAH gene (i.e., replacing nucleotides 1-3 of the mouse PAH gene), thereby expressing a wild-type human PAH protein in a mouse cell.
  • the vector alone did not include a promoter sequence, and could not drive independent PAH expression without genomic integration.
  • the pHMI-hPAH-mAC-006 vector was packaged in AAVHSC17 capsid and injected to two wild-type neonatal mice intravenously via the tail vein at a dose of 2 ⁇ 10 13 vector genomes per kg of body weight. Two control mice received saline injection via the tail vein. Liver samples were collected after 2 weeks.
  • a PCR method was developed to detect the integration of the pHMI-hPAH-mAC-006 vector into the mouse genome.
  • a first pair of primers (SEQ ID NOs: 62 and 63) were designed to amplify an 867 bp DNA from an unedited allele (“Control PCR”);
  • a second pair of primers (SEQ ID NOs: 64 and 65) were designed to specifically amplify a 2459 bp DNA from an edited allele (“Edited Allele PCR”).
  • SEQ ID NOs: 62 and 63 were designed to amplify an 867 bp DNA from an unedited allele
  • a second pair of primers (SEQ ID NOs: 64 and 65) were designed to specifically amplify a 2459 bp DNA from an edited allele (“Edited Allele PCR”).
  • liver sample from a saline treated mouse and a cell sample of 3T3 mouse fibroblasts did not generate the PCR product corresponding to the edited allele, whereas the liver samples from the two mice injected with the pHMI-hPAH-mAC-006 vector generated the PCR product corresponding to the edited allele. All four samples generated similar levels of the PCR product corresponding to the unedited allele, suggesting that the samples were comparable in quality.
  • a ddPCR method was developed to quantify the integration of the pHMI-hPAH-mAC-006 vector into the mouse genome.
  • mPAH_ATG_gDNA_FAM Set 1 detected the unedited genome and the edited genome after the targeted integration of pHMI-hPAH-mAC-006.
  • SV40_FAM Set 1 detected a sequence in the SV40 polyadenylation sequence, which was present in the edited genome and the unintegrated vectors ( FIG. 5A ).
  • DNA samples were partitioned into oil droplets.
  • concentration of DNA was optimized to 600 pg per 20 ⁇ L in order to significantly reduce the probability that one oil droplet randomly contains a vector particle and a genomic DNA particle (p ⁇ 0.001) ( FIGS. 5C and 5D ).
  • FIGS. 5C and 5D Upon integration of the vector into the genome, the rate of double positivity of the vector probe and the locus probe in the same droplet increases ( FIG. 5B ).
  • the two control mice had 0% and 0.0395% edited alleles in the liver, respectively, and the two mice treated with the pHMI-hPAH-mAC-006 vector had 2.504% and 2.783% edited alleles in the liver, respectively.
  • the overall integration efficiency of the pHMI-hPAH-mAC-006 vector in the liver under the given conditions was about 2.6%.
  • the integration efficiency for each individual cell is expected to be higher, because not all cells were transduced with the vector.
  • the relative quantity of the mRNA expressed from the edited allele was determined by ddPCR. SV40_FAM Set 1 was used to specifically detect human PAH expression from the edited allele. Each PAH expression level was normalized to the expression level of endogenous Hprt. As shown in FIG. 6 , control mice showed no expression of human PAH, suggesting that the primers and probe did not cross react with the endogenous mouse PAH. The percent PAH expression relative to wild-type levels was calculated based on the human PAH signal relative to Hprt normalized against the endogenous mouse PAH signal relative to Hprt.
  • the two mice treated with the pHMI-hPAH-mAC-006 vector had 5.378% and 4.846% mRNA levels relative to the endogenous mouse PAH levels, respectively.
  • the overall mRNA level of the pHMI-hPAH-mAC-006 vector in the liver under the given conditions was about 5%.
  • the mRNA level for each individual cell is expected to be higher, because not all cells were transduced with the vector.
  • the efficacy of the pHMI-hPAH-mAC-006 vector in phenotypic correction was determined using a PAH knock-out mouse model (PAH ENU2 ). Briefly, the hPAH-mAC-006 vector packaged in AAVHSC15 capsids was administered intravenously, in 5 consecutive days, to these mice at a dose of 1.16 ⁇ 10 14 vector genomes per kilogram of body weight. Serum phenylalanine (Phe) was measured weekly for 5 months by mass spectrometry. After 5 months, DNA was extracted from liver samples, and the numbers of vector genomes per cell were analyzed by ddPCR using primer and probe sets to measure the vector and the human PAH genomic locus copy numbers.
  • PAH ENU2 PAH knock-out mouse model
  • Transduction efficiency (measured in number of vector genomes per cell (“VG per Cell”) was the determined by ddPCR using primer and probe sets to measure the vector, and the mouse and human PAH genomic loci copy numbers. Editing frequency was measured by multiplexed ddPCR using primer probe sets to measure the frequency of the editing element DNA from the AAV vector (“payload”) integrated into the mouse PAH locus and the human PAH locus. Briefly, single DNA strands were partitioned into oil droplets. Each droplet was tested for the presence of either human or mouse PAH DNA along with the presence or absence of the payload. Editing frequency was calculated based on the detected co-partitioning of a payload and a target DNA in a single droplet in excess of expected probability of co-partitioning of a payload and a target DNA in separate nucleic acid molecules.
  • the PAH knock-out mice had a phenotype of increased phenylalanine (Phe) levels in the blood.
  • Phe phenylalanine
  • mice administered the hPAH-mAC-006 vector packaged in AAVHSC15 capsids showed a transduction efficiency of about 8 to 18 vector genomes per cell ( FIG. 7A ), and an average editing efficiency of about 4.4% relative to the number of alleles ( FIG. 7B ).
  • This editing efficiency supported an expression level of PAH sufficient to reduce Phe levels in the serum of the mice by about 50% for at least 5 months ( FIGS. 7C and 7D ), and the phenotypic changes correlated with the editing efficiency ( FIG. 7E ).
  • the correct homologous recombination of the vector at the Pah locus was verified by the length of the PCR product amplified from the edited genomic locus using a first primer that hybridized to the payload, and a second primer that hybridized to a genomic sequence downstream from the right homology arm (data not shown).
  • the untreated control animals showed an indel rate of 0.002-0.006%.
  • Treated animal 1 had an indel rate of 0.031%; treated animal 2 had no indels that passed the filters; treated animal 3 had an indel rate similar to those of the control animals. All the indels identified were located in untranslated regions.
  • RNA in situ hybridization was performed on liver tissue sections using a probe specific to >1 kb of the human PAH RNA having the silent codon alteration as described above (Advanced Cell Diagnostics, Inc., Hayward, Calif.). As shown in FIG. 7F , this probe detected human PAH RNA and possibly virus DNA comprising PAH sequence in mouse hepatocytes transduced with the hPAH-mAC-006 vector, but did not cross-hybridize to endogenous mouse Pah RNA. A liver sample of a mouse transduced with a transgene construct comprising a CMV promoter driving the expression of a human Pah RNA having the same silent codon alteration was used as a positive control.
  • the pHMI-hPAH-mAC-006 vector comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a 3′ homology arm, and a 3′ ITR element.
  • the sequences of these elements are set forth in Table 9.
  • FIG. 9A depicts a schematic of the assay used to determine editing efficiency of the PAH gene in mice that received the pHMI-hPAH-mAC-006 vector.
  • ddPCR and LAM-NGS LAM-PCR followed by next generation sequencing (NGS) was performed as described herein and as indicated in FIG. 9A .
  • FIG. 9B shows a graph of PAH gene editing efficiency as determined in cells of mice administered either the pHMI-hPAH-mAC-006 vector or vehicle control. As shown in FIG. 9B , PAH gene editing efficiency in mice administered the HMI-hPAH-mAC-006 vector was determined to be about 8% relative to the number of alleles. No errors were detected in the edited regions.
  • the efficacy of the pHMI-hPAH-mAC-006 vector in phenotypic correction was determined using a PAH knock-out mouse model (PAH ENU2 ).
  • the pHMI-hPAH-mAC-006 vector was packaged in AAVHSC15 capsids and administered intravenously to mice at a dose of 1 ⁇ 10 14 vector genomes per kilogram of body weight.
  • FIG. 10A shows p ⁇ 0.0001 by repeated measures 2-way ANOVA vs vehicle; p ⁇ 0.0001 by repeated measures 2-way ANOVA vs time) and a significant increase in serum levels of Tyr ( FIG. 10B ; * indicates p ⁇ 0.05 by repeated measures 2-way ANOVA vs vehicle; p ⁇ 0.0003 by repeated measures 2-way ANOVA vs time) were observed in mice that received the vector.
  • FIG. 10C shows the ratio between serum Phe and serum Tyr in mice that received the vector or a vehicle control (* indicates p ⁇ 0.002 by repeated measures 2-way ANOVA vs vehicle; p ⁇ 0.0004 by repeated measures 2-way ANOVA vs time).
  • FIG. 11A depicts a graph showing the PAH gene editing efficiency and transduction efficiency of cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector or a vehicle control.
  • the left y-axis of FIG. 11A indicates the percentage of editing efficiency and shows that mice administered the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) had about 5% editing efficiency relative to the number of alleles.
  • the right y-axis of FIG. 11A indicates the number of vector genomes per cell and shows that mice administered the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) had a transduction efficiency of about 140 vector genomes per cell.
  • FIG. 11B depicts a graph showing the relative quantity of PAH mRNA expressed, normalized to the expression level of mouse GAPDH, of cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) or a vehicle control.
  • AAVHSC15-mPAH the pHMI-hPAH-mAC-006 vector
  • FIG. 11B depicts a graph showing the relative quantity of PAH mRNA expressed, normalized to the expression level of mouse GAPDH, of cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) or a vehicle control.
  • AAVHSC15-mPAH the pHMI-hPAH-mAC-006 vector
  • This example provides animal models for examining PAH correction vectors, such as those described in the previous examples, in the editing of the human PAH gene in a mouse model.
  • NOD.Cg-Prkdc scid I12rg tan tWj1 /SzJ (NSG) mice were myeloblated through sublethal irradiation, and transplanted with human CD34 + hematopoietic stem cells. Engraftment levels were determined after 12 weeks by identifying the amounts of human and murine CD45 + cells in the peripheral blood by flow cytometry, and the mice having more than 50% of circulating human CD45 + cells were selected.
  • the hPAH-hAC-008 vector packaged with the AAVHSC17 capsid was administered intravenously to 12 such mice divided equally into four groups.
  • the first and second groups of mice received a dose of 1.54 ⁇ 10 13 vector genomes per kilogram of body weight, and the third and fourth groups received a dose of 2.1 ⁇ 10 12 vector genomes per kilogram of body weight.
  • the mice were euthanized 6 weeks after the injections. Samples of blood, bone marrow and spleen tissues were collected, and genomic DNA was extracted.
  • Editing frequency in mouse and human cells were measured by multiplexed droplet digital PCR (ddPCR) using primer probe sets to measure the frequency of the integrated DNA from the AAV vector (“payload”) integrating into the mouse PAH locus and the human PAH locus.
  • AAV vector AAV vector
  • single DNA strands were partitioned into oil droplets. Each droplet was tested for the presence of either human or mouse PAH DNA along with the presence or absence of the payload.
  • Editing frequency was calculated based on the detected co-partitioning of a payload and a target DNA in a single droplet in excess of expected probability of co-partitioning of a payload and a target DNA in separate nucleic acid molecules.
  • FIG. 8A shows the transduction efficiency of the hPAH-hAC-008 vector and hPAH-hAC-008-HBB vector in human and mouse hepatocytes in mice administered with the vector packaged in AAVHSC15 capsids.
  • the hPAH-hAC-008 vector comprises a complete human PAH coding sequence without any intron.
  • a modified vector hPAH-hAC-008-HBB wherein the first intron of the human HBB gene (having the nucleotide sequence of SEQ ID NO: 28) is added between nucleotides 912 and 913 of the human PAH coding sequence, was generated for improving the nuclear export and stability of RNA molecules transcribed from the vector.
  • the internucleotide bond between nucleotides 912 and 913 corresponds to the splicing site between exon 8 and exon 9 of the native PAH gene, which was not disrupted by the silent alteration of the codons.
  • the vectors were packages with AAVHSC15 capsids, and were administered into mice intravenously at a dose of 1 ⁇ 10 13 vector genomes per kilogram of body weight.
  • liver samples were collected, and the localization of the silently altered human PAH mRNA and possibly virus DNA comprising PAH sequence was examined by in situ hybridization.
  • the addition of the HBB intron substantially improved the nuclear export of the mRNA. This result demonstrated that addition of an intron in the PAH coding sequence could potentially increase the expression level of the PAH gene, and this feature can be included in the design of PAH correction vectors.
  • Fah ⁇ / ⁇ Rag2 ⁇ / ⁇ I12rg ⁇ / ⁇ mice on the C57B1/6 background commonly referred to as the FRG® Knockout mice
  • the mice were immunodeficient and lacked the tyrosine catabolic enzyme fumarylacetoacetate hydrolase (Fah).
  • Ablation of mouse hepatocytes was induced by the withdrawal of the protective drug 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC).
  • mice were then engrafted with human hepatocytes, and a urokinase-expressing adenovirus was administered to enhance repopulation of the human hepatocytes. Engraftment was sustained over the life of the animal with an appropriate regimen of CuRxTM Nitisinone (20-0026) and prophylactic treatment of SMX/TMP antibiotics (20-0037). The animals weighed 22 grams on average and had a typical lifespan of 18-24 months.
  • the hPAH-hAC-008 or hPAH-hAC-008-HBB vector was packaged with AAVHSC15 capsids, and was administered into mice intravenously at a dose of 1 ⁇ 10 13 vector genomes per kilogram of body weight.
  • liver samples were collected, the human and mouse hepatocytes were separated and purified using Miltenyi autoMACS columns following liver perfusion. DNA was extracted, and the efficiency of gene editing was measured using the same ddPCR method as described above.
  • the percentage editing efficiency in human hepatocytes was 2.2% in an animal treated with the hPAH-hAC-008 vector, and 4.3% in an animal treated with the hPAH-hAC-008-HBB vector. Editing was not detected in mouse hepatocytes from either animal. The lack of detection of editing in mouse hepatocytes from either animal is unlikely to be due to lack of transduction efficiency as mouse hepatocytes were transduced well ( FIG. 8A ).
  • Fah ⁇ / ⁇ Rag2 ⁇ / ⁇ I12rg ⁇ / ⁇ mice on the C57B1/6 background commonly referred to as the FRG® Knockout mice (also referred to herein as HuLiv mice), were used as a model for liver humanization, as described above (see FIG. 12A ).
  • the pHMIK-hPAH-hI1C-032 vector comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a splicing acceptor, a 2A element, a silently altered human PAH coding sequence, an SV40 polyadenylation sequence, a 3′ homology arm, and a 3′ ITR element.
  • the sequences of these elements are set forth in Table 11.
  • the pHMIK-hPAH-hI1C-032 vector was packaged with AAVHSC15 capsids, and was administered into mice intravenously at a dose of 1 ⁇ 10 14 vector genomes per kilogram of body weight. Liver samples from 3 mice that received the pHMIK-hPAH-hI1C-032 vector packaged with AAVHSC15 capsids were collected, the human and mouse hepatocytes were separated and purified, and DNA was extracted. The efficiency of gene editing was measured using the same ddPCR method as described above.
  • the durability of PAH gene editing in human hepatocytes was measured by determining the percentage of edited alleles out of all alleles in cells obtained from treated mice 1 week and 6 weeks post-administration of vector. As shown in FIG. 12B , about 4% PAH gene editing was measured in cells obtained from mice 1 week after administration of the vector, and about 7% editing was measured in cells obtained from mice 6 weeks after administration of the vector.
  • Genome editing mediated by the pHMIK-hPAH-hI1C-032 vector was found to be specific for human hepatocytes in the HuLiv mice.
  • PAH gene editing as determined by ddPCR and NGS
  • editing of the mouse genome in the liver sample was close to 0% relative to the number of alleles of mouse genome.
  • editing was detected at a rate of about 5% to 6.5% relative to the number of alleles of human genome.
  • pHMIK-hPAH-hI1C-032 vector was found to be ineffective in non-human cells.
  • PAH ENu2 PAH knock-out mouse
  • mice were administered intravenously the pHMIK-hPAH-hI1C-032 vector (hPAH-032) packaged with AAVHSC15 capsids at a dose of 1 ⁇ 10′′ vector genomes per kilogram of body weight
  • the level of serum phenylalanine was similar to that of mice administered a control up to 3 weeks post-injection.
  • mice administered the pHMI-hPAH-mAC-006 vector mPAH-006 vector
  • FIG. 15A shows the relationship between human PAH expression and serum Phe levels.
  • 10% of human PAH expression corrects the phenotype in PAH ENU2 mice.
  • 10% of human PAH expression relative to endogenous levels was determined to be the level required to correct phenylalaninemia (e.g., a therapeutic level).
  • Therapeutic levels of expression were detected with the pHMIK-hPAH-hI1C-032 vector.
  • Human PAH expression in human hepatocytes was measured relative to human GAPDH in HuLiv mice administered the pHMIK-hPAH-hI1C-032 vector (hPAH-032) at a dose of 1 ⁇ 10 14 vector genomes per kilogram of body weight.
  • human PAH expression was determined to be greater than 10% in human hepatocytes.
  • the PAH gene editing range in human hepatocytes of HuLiv mice administered the vector was measured to be about 5% to about 11% in 13 different mice across 3 different experiments.
  • the pHMIK-hPAH-hI1C-032 vector was found to target human PAH gene and resulted in corrected levels of edited mRNA in HuLiv mice.
  • the PAH mRNA level required for phenotypic correction was first established in a murine model (using the PAH knock-out mouse model (PAH ENU2 )). This was determined to be about 10% of PAH expression relative to endogenous levels (see FIG. 15A ). As shown in FIG. 16 , human PAH gene expression relative to GAPDH expression was determined to be about 44.9% (left), and mouse PAH gene expression relative to GAPDH expression was determined to be about 39.7% (right).
  • This example provides the human PAH correction vectors pKITR-hPAH-mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, pKITR-hPAH-mAC-006-SD.3, pHMIA2-hPAH-hI1C-032-SD.3, and pHMIA2-hPAH-mAC-006-HBB1.
  • Schematics of the vectors are depicted in FIGS. 17A, 17B, 17C, 17D, and 17E , respectively.
  • Vectors pKITR-hPAH-mAC-006-HCR and pKITR-hPAH-hI1C-032-HCR were generated by inserting an HCR intron into the PAH coding sequence.
  • Vector pHMIA2-hPAH-mAC-006-HBB1 was generated by inserting an HBB1 intron into the PAH coding sequence.
  • the HCR and HBB1 introns were selected based on their performance in intron screening experiments using a luciferase reporter to determine introns that exhibit high expression in liver and blood cell lines. The introns used in the screen are set forth in Table 12.
  • Intron sequences used in luciferase reporter screen Intron SEQ ID NO Chimeric MVM Intron (ChiMVM) 120 SV40 Intron 121 Adenovirus Tripartite Leader 122 Intron (AdTPL) Mini B-Globin Intron 123 AdV/Ig Chimeric Intron (AdVIgG) 124 B-Globin Ig Heavy Chain Intron (BGlobinIg) 125 Wu MVM Intron (Wu MVM) 126 HCR1 Intron (OptHCR) 127 B-Globin Intron 128 tFIX Intron (FIX) 129 ch2BLood Intron (BloodEnh) 130
  • pKITR-hPAH-mAC-006-HCR comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a silently altered human PAH coding sequence with HCR intron inserted therein, an SV40 polyadenylation sequence, a targeted integration restriction cassette (“TI RE”), a 3′ homology arm, and a 3′ ITR element.
  • TI RE targeted integration restriction cassette
  • pKITR-hPAH-hI1C-032-HCR comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a splice acceptor, a 2A element, a silently altered human PAH coding sequence with HCR intron inserted therein, an SV40 polyadenylation sequence, a 3′ homology arm, and a 3′ ITR element.
  • pHMIA2-hPAH-mAC-006-HBB1 comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a silently altered human PAH coding sequence with HBB intron inserted therein, an SV40 polyadenylation sequence, a targeted integration restriction cassette (“TI RE”), a 3′ homology arm, and a 3′ ITR element.
  • the sequences of these elements are set forth in Table 13.
  • Vectors pKITR-hPAH-mAC-006-SD.3 and pHMIA2-hPAH-hI1C-032-SD.3 were generated by modifying a splice donor site.
  • the splice donor was modified as indicated in FIGS. 17C and 17D , respectively.
  • pKITR-hPAH-mAC-006-SD.3 comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a silently altered human PAH coding sequence with splice donor modification, an SV40 polyadenylation sequence, a targeted integration restriction cassette (“TI RE”), a 3′ homology arm, and a 3′ ITR element.
  • TI RE targeted integration restriction cassette
  • pHMIA2-hPAH-hI1C-032-SD.3 comprised 5′ to 3′ the following genetic elements: a 5′ ITR element, a 5′ homology arm, a splicing acceptor, a 2A element, a silently altered human PAH coding sequence with splice donor modification, an SV40 polyadenylation sequence, a 3′ homology arm, and a 3′ ITR element.
  • the sequences of these elements are set forth in Table 14.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)
US16/265,684 2018-02-01 2019-02-01 Adeno-associated virus compositions for restoring pah gene function and methods of use thereof Abandoned US20190256867A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/265,684 US20190256867A1 (en) 2018-02-01 2019-02-01 Adeno-associated virus compositions for restoring pah gene function and methods of use thereof

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201862625149P 2018-02-01 2018-02-01
US201862672377P 2018-05-16 2018-05-16
US16/265,684 US20190256867A1 (en) 2018-02-01 2019-02-01 Adeno-associated virus compositions for restoring pah gene function and methods of use thereof

Publications (1)

Publication Number Publication Date
US20190256867A1 true US20190256867A1 (en) 2019-08-22

Family

ID=67478926

Family Applications (3)

Application Number Title Priority Date Filing Date
US16/265,684 Abandoned US20190256867A1 (en) 2018-02-01 2019-02-01 Adeno-associated virus compositions for restoring pah gene function and methods of use thereof
US17/073,862 Active 2042-03-07 US12203094B2 (en) 2018-02-01 2020-10-19 Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof
US17/656,562 Abandoned US20220325302A1 (en) 2018-02-01 2022-03-25 Adeno-associated virus compositions for restoring pah gene function and methods of use thereof

Family Applications After (2)

Application Number Title Priority Date Filing Date
US17/073,862 Active 2042-03-07 US12203094B2 (en) 2018-02-01 2020-10-19 Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof
US17/656,562 Abandoned US20220325302A1 (en) 2018-02-01 2022-03-25 Adeno-associated virus compositions for restoring pah gene function and methods of use thereof

Country Status (14)

Country Link
US (3) US20190256867A1 (https=)
EP (1) EP3746101A4 (https=)
JP (1) JP2021512871A (https=)
KR (1) KR20200127170A (https=)
CN (1) CN111902164A (https=)
AU (1) AU2019215152A1 (https=)
BR (1) BR112020015798A2 (https=)
CA (1) CA3090226A1 (https=)
CL (1) CL2020002008A1 (https=)
CO (1) CO2020010793A2 (https=)
IL (1) IL276368A (https=)
MX (1) MX2020008133A (https=)
PE (1) PE20212076A1 (https=)
WO (1) WO2019152843A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021207077A1 (en) * 2020-04-06 2021-10-14 Homology Medicines, Inc. Adeno-associated virus compositions for ids gene transfer and methods of use thereof
WO2021243364A1 (en) * 2020-05-27 2021-12-02 Homology Medicines, Inc. Adeno-associated virus compositions for restoring pah gene function and methods of use thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW202140791A (zh) * 2020-01-13 2021-11-01 美商霍蒙拉奇醫藥公司 治療苯酮尿症之方法
IL294713A (en) * 2020-01-16 2022-09-01 Takeda Pharmaceuticals Co Adeno associated virus based gene therapy for phenylketonuria
JP2023544165A (ja) 2020-10-01 2023-10-20 ジェンザイム・コーポレーション 肝臓に向けられた遺伝子補充療法によってpkuを処置するためのヒトpah発現カセット

Family Cites Families (172)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL71505A0 (en) 1983-04-14 1984-07-31 Hughes Howard Med Inst Phenylalanine hydroxylase cdna clones,their production and their use in the diagnosis of classical phenylketonuria
IL74761A0 (en) 1984-04-13 1985-06-30 Hughes Howard Med Inst Human phenylalanine hydroxylase cdna clones,their production and their use in diagnosing classical phenylketonuria
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
WO1991018088A1 (en) 1990-05-23 1991-11-28 The United States Of America, Represented By The Secretary, United States Department Of Commerce Adeno-associated virus (aav)-based eucaryotic vectors
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
DE4339922C1 (de) 1993-09-03 1994-10-06 Max Planck Gesellschaft Vektor für Leber-Gentherapie
US6268212B1 (en) 1993-10-18 2001-07-31 Amgen Inc. Tissue specific transgene expression
DE4407859C1 (de) 1994-03-04 1995-03-02 Max Planck Gesellschaft Vektor für die leberspezifische Gentherapie
CA2187626C (en) 1994-04-13 2009-11-03 Michael G. Kaplitt Aav-mediated delivery of dna to cells of the nervous system
AU3718595A (en) 1994-09-16 1996-03-29 Uab Research Foundation, The Transduction of genes into human hematopoietic stem cells using recombinant adeno-associated viral vectors
CA2200835A1 (en) 1994-09-23 1996-03-28 Frederick M. Boyce Use of a non-mammalian dna virus to express an exogenous gene in a mammalian cell
US6924128B2 (en) 1994-12-06 2005-08-02 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant AAV vectors
US5650309A (en) 1995-05-16 1997-07-22 The Regents Of The University Of California Viral vectors
US7001764B2 (en) 1995-06-27 2006-02-21 Cell Genesys, Inc. Compositions comprising tissue specific adenoviral vectors
DE19525900C1 (de) 1995-07-15 1996-12-12 Max Planck Gesellschaft Leberspezifischer Adenovirus-Expressionsvektor
US5622856A (en) 1995-08-03 1997-04-22 Avigen High efficiency helper system for AAV vector production
US5780447A (en) 1996-06-14 1998-07-14 St. Jude Children's Research Hospital Recombinant adeno-associated viral vectors
US6521225B1 (en) 1996-09-06 2003-02-18 Chiron Corporation AAV vectors
CA2265460A1 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services Aav4 vector and uses thereof
US6281009B1 (en) 1996-09-11 2001-08-28 The General Hospital Corporation Use of a non-mammalian DNA virus to express an exogenous gene in a mammalian cell
DE19644500C2 (de) 1996-10-25 1998-11-05 Deutsches Krebsforsch AAV-DNA mit Helfervirus-Sequenzen
FR2755699B1 (fr) 1996-11-08 1998-12-18 Rhone Poulenc Rorer Sa Nouvelles constructions et vecteurs pour l'expression ciblee et inductible des genes
FR2756297B1 (fr) 1996-11-22 1999-01-08 Centre Nat Rech Scient Procede de production de virus recombinants
AU5588298A (en) 1996-12-02 1998-06-29 Cell Genesys, Inc. Adeno-associated viral vector-mediated delivery of dna to cells of the liver
CA2269661A1 (en) 1996-12-18 1998-06-25 Targeted Genetics Corporation Recombinase-activatable aav packaging cassettes for use in the production of aav vectors
CA2275892A1 (en) 1996-12-23 1998-07-02 Gene-Cell, Inc. Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells
US6153436A (en) 1997-01-10 2000-11-28 The Board Of Trustees Of The University Of Arkansas Method of gene delivery using wildtype adeno associated viral (AAV) vectors with insertions
AU744445B2 (en) 1997-04-24 2002-02-21 University Of Washington Targeted gene modification by parvoviral vectors
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
GB9715064D0 (en) 1997-07-17 1997-09-24 Ppl Therapeutics Scotland Ltd Protein expression
WO1999018227A1 (en) 1997-10-08 1999-04-15 Advanced Research And Technology Institute Chimeric parvovirus-based recombinant vector system that specifically targets the erythroid lineage
US6346415B1 (en) 1997-10-21 2002-02-12 Targeted Genetics Corporation Transcriptionally-activated AAV inverted terminal repeats (ITRS) for use with recombinant AAV vectors
US6953690B1 (en) 1998-03-20 2005-10-11 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
US6984517B1 (en) 1998-05-28 2006-01-10 The United States Of America As Represented By The Department Of Health And Human Services AAV5 vector and uses thereof
WO1999064569A1 (en) 1998-06-10 1999-12-16 Advanced Research And Technology Institute Methods and compositions for generating recombinant adeno-associated virus vectors
US6759237B1 (en) 1998-11-05 2004-07-06 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
ES2340230T3 (es) 1998-11-10 2010-05-31 University Of North Carolina At Chapel Hill Vectores viricos y sus procedimientos de preparacion y administracion.
US6919209B1 (en) 1998-12-04 2005-07-19 City Of Hope Method of genetically modifying very primitive quiescent human hematopoietic stem cells
US6200758B1 (en) 1999-02-19 2001-03-13 New York State Office Of Mental Health Phenylalanine hydroxylase gene variants, and amino acid and pterin homeostasis, in the definition, detection, treatment and prevention of psychotic, mood and personality disorders
JP4693244B2 (ja) 1999-03-18 2011-06-01 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 組換えアデノ随伴ウイルスのヘルパー無しの生産のための組成物および方法
US6610906B1 (en) 1999-06-09 2003-08-26 The Regents Of The University Of Michigan Nucleotide sequences for gene regulation and methods of use thereof
ES2284545T3 (es) 1999-11-16 2007-11-16 Genzyme Corporation Vectores y transgenes con elementos reguladores para la administracion de genes del higado.
CA2406743A1 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
NZ522840A (en) 2000-06-01 2004-12-24 Univ North Carolina A parvovirus vector that carries a duplexed genome resulting in co-packaging of strands of plus and minus polarity tethered together
US7351813B2 (en) 2000-06-20 2008-04-01 The Board Of Trustees Of The Leland Stanford Junior University Liver-specific gene expression cassettes, and methods of use
US6329181B1 (en) 2000-08-07 2001-12-11 Neurologix, Inc. Helper functions for recombinant vector production
US7749492B2 (en) 2001-01-05 2010-07-06 Nationwide Children's Hospital, Inc. AAV vectors and methods
AU2002306539A1 (en) 2001-02-16 2002-09-04 The Board Of Trustees Of The Leland Stanford Junior University Minimal plasmid vectors that provide for persistent and high level gene expression and methods for using the same
DE10120265A1 (de) 2001-04-25 2002-11-14 Deutsches Krebsforsch AAV-Helferplasmide zur Helfervirus-freien Verpackung und Pseudotypisierung von AAV-Vektoren
ATE437221T1 (de) 2001-05-14 2009-08-15 Gbp Ip Llc Lentivirale vektoren kodierend für gerinnungsfaktoren für die gentherapie
AU2002305778A1 (en) 2001-05-31 2002-12-09 The Rockefeller University Method for generating replication defective viral vectors that are helper free
US8241622B2 (en) 2001-07-13 2012-08-14 University Of Iowa Research Foundation Adeno-associated virus vectors with intravector heterologous terminal palindromic sequences
US20030129203A1 (en) 2001-08-27 2003-07-10 Nautilus Biotech S.A. Mutant recombinant adeno-associated viruses
EP1442125A4 (en) 2001-10-04 2004-12-08 Carlos Estuard Aguilar-Cordova CHIMERAL VIRUS VECTORS FOR GENE THERAPY
CA2361462A1 (en) 2001-11-07 2003-05-08 Katherine A. High Induction of tolerance to a therapeutic polypeptide
NZ532635A (en) 2001-11-13 2007-05-31 Univ Pennsylvania A method of identifying unknown adeno-associated virus (AAV) sequences and a kit for the method
DK2359869T3 (en) * 2001-12-17 2019-04-15 Univ Pennsylvania Sequences of adeno-associated virus (AAV) serotype 8, vectors containing these, and uses thereof
AU2002359284A1 (en) 2001-12-17 2003-06-30 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) serotype 9 sequences, vectors containing same, and uses therefor
CA2369985A1 (en) 2002-01-18 2003-07-18 Duke University Generation of recombinant adeno-associated viral vectors by a complete adenovirus-mediated approach
US20030198620A1 (en) 2002-04-16 2003-10-23 Keiya Ozawa Method of treating amino acid metabolic disorders using recombinant adeno-associated virus virions
CA2426283C (en) 2002-04-29 2006-06-27 The Trustees Of The University Of Pennsylvania Method for direct rescue and amplification of integrated viruses from cellular dna of tissues
AU2003237159A1 (en) 2002-04-30 2003-11-17 University Of Florida Treatment for phenylketonuria
AU2003274397A1 (en) 2002-06-05 2003-12-22 University Of Florida Production of pseudotyped recombinant aav virions
AU2003265855A1 (en) 2002-08-28 2004-03-19 University Of Florida Modified aav
US20070202587A1 (en) 2002-09-23 2007-08-30 Applied Genetic Technologies Corporation Recombinant AAV production in mammalian cells
US7091029B2 (en) 2002-09-23 2006-08-15 Applied Genetics Technologies Corporation High titer recombinant AAV production
SI3235827T1 (sl) 2003-06-19 2021-05-31 Genzyme Corporation AAV virioni z zmanjšano imunoreaktivnostjo in uporaba za ta namen
US9441244B2 (en) 2003-06-30 2016-09-13 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
CN1856576B (zh) 2003-09-30 2011-05-04 宾夕法尼亚州立大学托管会 腺伴随病毒(aav)进化支、序列、含有这些序列的载体及它们的应用
US7482156B2 (en) 2003-10-15 2009-01-27 Cell Genesys, Inc. Hepatocellular carcinoma specific promoter and uses thereof
JP2007531537A (ja) 2004-04-06 2007-11-08 セダーズ−シナイ メディカル センター アポリポタンパク質a−iおよびアポリポタンパク質a−imilanoをコードする組換えアデノ随伴ウイルスベクターによる血管疾患の予防および処置
US8716461B2 (en) 2004-05-24 2014-05-06 Blood Systems, Inc. Human parvovirus
EP1804839B1 (en) 2004-09-22 2012-03-14 St. Jude Children's Research Hospital Improved expression of factor ix in gene therapy vectors
TWI293307B (en) 2004-09-30 2008-02-11 Ind Tech Res Inst A liver-specific chimeric regulatory sequence and use thereof
AU2006220500A1 (en) 2005-03-09 2006-09-14 Board Of Regents, The University Of Texas System Novel hTMC promoter and vectors for the tumor-selective and high-efficient expression of cancer therapeutic genes
WO2006110689A2 (en) 2005-04-07 2006-10-19 The Trustees Of The University Of Pennsylvania Method of increasing the function of an aav vector
US8283151B2 (en) 2005-04-29 2012-10-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes
EP1928504B1 (en) 2005-08-19 2013-04-24 University of Technology, Sydney Liver-directed gene therapy
EP2311967B1 (en) 2005-10-20 2017-09-20 UniQure IP B.V. Improved AAV vectors produced in insect cells
WO2007084773A2 (en) 2006-01-20 2007-07-26 University Of North Carolina At Chapel Hill Enhanced production of infectious parvovirus vectors in insect cells
WO2008016391A2 (en) 2006-01-31 2008-02-07 The Board Of Trustees Of The Leland Stanford Junior University Self-complementary parvoviral vectors, and methods for making and using the same
US7588772B2 (en) 2006-03-30 2009-09-15 Board Of Trustees Of The Leland Stamford Junior University AAV capsid library and AAV capsid proteins
US8298818B2 (en) 2006-04-28 2012-10-30 University Of Florida Research Foundation, Inc. Self-complementary adeno-associated virus having a truncated CMV-chicken β-actin promoter
US9725485B2 (en) 2012-05-15 2017-08-08 University Of Florida Research Foundation, Inc. AAV vectors with high transduction efficiency and uses thereof for gene therapy
DK2191001T3 (en) 2007-04-09 2016-09-19 Univ Florida RAAV VECTOR COMPOSITIONS WITH TYROSIN MODIFIED CAPSIDE PROTEINS AND PROCEDURES FOR USE THEREOF
WO2008150459A1 (en) 2007-05-30 2008-12-11 The Trustees Of The University Of Pennsylvania A method for transducing cells with primary cilia
EP2008656A1 (en) 2007-06-28 2008-12-31 Bergen Teknologioverforing AS Compositions for the treatment of hyperphenylalaninemia
EP2058401A1 (en) 2007-10-05 2009-05-13 Genethon Widespread gene delivery to motor neurons using peripheral injection of AAV vectors
US20090215879A1 (en) 2008-02-26 2009-08-27 University Of North Carolina At Chapel Hill Methods and compositions for adeno-associated virus (aav) with hi loop mutations
EP4154903A1 (en) 2008-04-22 2023-03-29 Vib Vzw Liver-specific nucleic acid regulatory elements and methods and use thereof
WO2009134681A2 (en) 2008-04-30 2009-11-05 The Trustees Of The University Of Pennsylvania Aav7 viral vectors for targeted delivery of rpe cells
US8632764B2 (en) 2008-04-30 2014-01-21 University Of North Carolina At Chapel Hill Directed evolution and in vivo panning of virus vectors
EP2910637A1 (en) 2008-05-20 2015-08-26 University of Florida Research Foundation, Inc. Vectors for delivery of light-sensitive proteins and methods of use
US9217155B2 (en) 2008-05-28 2015-12-22 University Of Massachusetts Isolation of novel AAV'S and uses thereof
WO2010124180A1 (en) 2009-04-23 2010-10-28 Phasebio Pharmaceuticals, Inc. Phenylalanine hydroxylase fusion protein and methods for treating phenylketonuria
ES2724122T3 (es) 2009-04-30 2019-09-06 Univ Pennsylvania Composiciones para dirigir células de las vías respiratorias de conducción que comprenden construcciones de virus adenoasociado
JP5879256B2 (ja) 2009-05-02 2016-03-08 ジェンザイム・コーポレーション 神経変性障害のための遺伝子治療
US8476418B2 (en) 2009-05-28 2013-07-02 Deutsches Krebsforschungszentrum Modified AAV capsid polypeptides
HUE028341T2 (en) 2009-06-16 2016-12-28 Genzyme Corp Improved methods for purification of recombinant aav vectors
GB0911870D0 (en) 2009-07-08 2009-08-19 Ucl Business Plc Optimised coding sequence and promoter
EP2287323A1 (en) 2009-07-31 2011-02-23 Association Institut de Myologie Widespread gene delivery to the retina using systemic administration of AAV vectors
WO2011038187A1 (en) 2009-09-25 2011-03-31 The Trustees Of The University Of Pennsylvania Controlled adeno-associated virus (aav) diversification and libraries prepared therefrom
WO2011041502A1 (en) 2009-10-01 2011-04-07 The Trustees Of The University Of Pennsylvania Aav vectors expressing sec1o for treating kidney damage
ES2683695T3 (es) 2010-01-12 2018-09-27 The University Of North Carolina At Chapel Hill Repeticiones terminales invertidas restrictivas para vectores virales
DK2529020T3 (en) 2010-01-28 2018-08-06 Childrens Hospital Philadelphia SCALABLE PREPARATION PLATF FOR CLEANING VIRAL VECTORS AND CLEANED VIRAL VECTORS FOR USE IN GENTHERAPY
WO2011117258A2 (en) 2010-03-22 2011-09-29 Association Institut De Myologie Methods of increasing efficiency of vector penetration of target tissue
US20130023033A1 (en) 2010-03-29 2013-01-24 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
WO2011133874A1 (en) 2010-04-23 2011-10-27 University Of Massachusetts Multicistronic expression constructs
US8628966B2 (en) * 2010-04-30 2014-01-14 City Of Hope CD34-derived recombinant adeno-associated vectors for stem cell transduction and systemic therapeutic gene transfer
US8927514B2 (en) 2010-04-30 2015-01-06 City Of Hope Recombinant adeno-associated vectors for targeted treatment
EP2394667A1 (en) 2010-06-10 2011-12-14 Laboratorios Del Dr. Esteve, S.A. Vectors and sequences for the treatment of diseases
US20120014932A1 (en) 2010-07-14 2012-01-19 Golden William J Methods for treating disorders of amino acid metabolism
WO2012109570A1 (en) 2011-02-10 2012-08-16 The University Of North Carolina At Chapel Hill Viral vectors with modified transduction profiles and methods of making and using the same
ES2685611T3 (es) 2011-02-14 2018-10-10 The Children's Hospital Of Philadelphia Vector VAA8 mejorado con una actividad funcional aumentada y métodos de utilización del mismo
DK2675902T3 (da) 2011-02-17 2019-06-03 Univ Pennsylvania Sammensætninger og fremgangsmåder til at ændre vævsspecificitet og forbedre aav9-medieret genoverførsel
GB201103062D0 (en) 2011-02-22 2011-04-06 Isis Innovation Method
SG10201600912SA (en) 2011-03-04 2016-03-30 Intrexon Corp Vectors conditionally expressing protein
HRP20171334T1 (hr) 2011-04-22 2017-11-17 The Regents Of The University Of California Virioni adeno-povezanog virusa s kapsid varijantom i postupci njihove upotrebe
ES2857773T5 (es) 2011-08-24 2024-06-04 Univ Leland Stanford Junior Nuevas proteínas de la cápside de AAV para la transferencia de ácidos nucleicos
JP6188703B2 (ja) 2011-10-27 2017-08-30 サンガモ セラピューティクス, インコーポレイテッド Hprt遺伝子座を修飾するための方法および組成物
JP6348064B2 (ja) 2011-11-22 2018-06-27 ザ チルドレンズ ホスピタル オブ フィラデルフィア 効率の高いトランスジーン送達のためのウイルスベクター
WO2013096955A1 (en) 2011-12-23 2013-06-27 Case Western Reserve University Targeted gene modification using hybrid recombinant adeno-associated virus
AU2013221212B2 (en) 2012-02-17 2018-08-09 The Children's Hospital Of Philadelphia AAV vector compositions and methods for gene transfer to cells, organs and tissues
AU2013249202B2 (en) 2012-04-18 2018-08-09 The Children's Hospital Of Philadelphia Composition and methods for highly efficient gene transfer using AAV capsid variants
WO2013158309A2 (en) 2012-04-18 2013-10-24 The Board Of Trustees Of The Leland Stanford Junior University Non-disruptive gene targeting
JP2016528873A (ja) * 2012-05-16 2016-09-23 ラナ セラピューティクス インコーポレイテッド 遺伝子発現を調節するための組成物及び方法
BR112015000161A2 (pt) 2012-07-06 2017-06-27 Univ Iowa Res Found composições de vetor de vírus adeno-associado modificado
AU2013296425B2 (en) 2012-08-01 2018-06-07 Nationwide Children's Hospital Intrathecal delivery of recombinant adeno-associated virus 9
US9636370B2 (en) 2012-09-28 2017-05-02 The University Of North Carolina At Chapel Hill AAV vectors targeted to oligodendrocytes
EP2911687B1 (en) 2012-10-26 2019-02-13 Vrije Universiteit Brussel Vector for liver-directed gene therapy of hemophilia and methods and use thereof
WO2014089212A1 (en) 2012-12-05 2014-06-12 Sangamo Biosciences, Inc. Methods and compositions for regulation of metabolic disorders
EP2940131B1 (en) 2012-12-25 2019-02-20 Takara Bio Inc. Aav variant
US20150352228A1 (en) 2013-01-11 2015-12-10 Bruce TORBET Methods and compositions for enhancing transduction efficiency of retroviral vectors
US9567376B2 (en) 2013-02-08 2017-02-14 The Trustees Of The University Of Pennsylvania Enhanced AAV-mediated gene transfer for retinal therapies
EP2970946A4 (en) 2013-03-13 2016-09-07 Philadelphia Children Hospital ADENOASSOZED VIRUS VECTORS AND METHOD FOR USE THEREOF
US20140271550A1 (en) 2013-03-14 2014-09-18 The Trustees Of The University Of Pennsylvania Constructs and Methods for Delivering Molecules via Viral Vectors with Blunted Innate Immune Responses
MX384795B (es) 2013-03-15 2025-03-14 Childrens Hospital Philadelphia Vectores que comprenden secuencias de polinucleotidos rellenadoras/de relleno y metodos de uso.
SI2984166T1 (sl) 2013-03-15 2020-09-30 The Trustees Of The University Of Pennsylvania Sestavki za zdravljenje MPSI
KR102234672B1 (ko) 2013-05-21 2021-04-06 유니버시티 오브 플로리다 리서치 파운데이션, 인코포레이티드 캡시드-변형된 raav3 벡터 조성물, 및 인간 간암의 유전자 요법에서의 용도
US11136557B2 (en) 2013-05-31 2021-10-05 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
HK1222673A1 (zh) 2013-07-12 2017-07-07 The Children's Hospital Of Philadelphia Aav载体和用於抗aav(腺相关病毒)中和抗体的检测
KR20240090694A (ko) 2013-07-22 2024-06-21 더 칠드런스 호스피탈 오브 필라델피아 변종 aav 및 조성물, 세포, 기관 및 조직으로의 유전자 전이를 위한 방법 및 용도
US9585971B2 (en) 2013-09-13 2017-03-07 California Institute Of Technology Recombinant AAV capsid protein
CN105899665B (zh) 2013-10-17 2019-10-22 桑格摩生物科学股份有限公司 用于核酸酶介导的基因组工程改造的递送方法和组合物
EA034103B1 (ru) 2013-10-22 2019-12-27 Транслейт Био, Инк. СПОСОБ ЛЕЧЕНИЯ ФЕНИЛКЕТОНУРИИ С ПРИМЕНЕНИЕМ мРНК
BR112016019940A2 (pt) * 2014-03-21 2017-10-24 Univ Leland Stanford Junior edição de genoma sem nucleases
WO2015164723A1 (en) 2014-04-25 2015-10-29 The Trustees Of The University Of Pennsylvania Methods and compositions for treating metastatic breast cancer and other cancers in the brain
RS60359B1 (sr) * 2014-06-06 2020-07-31 Regeneron Pharma Postupci i kompozicije za modifikovanje ciljanog lokusa
BR112017005892A2 (pt) * 2014-09-24 2017-12-12 Hope City variantes de vetor de vírus adeno-associado para edição de genoma de alta eficácia e métodos da mesma
CN107249646B (zh) 2014-12-16 2021-06-29 内布拉斯加大学董事会 用于青少年巴滕病的基因疗法
EP3233129B1 (en) 2014-12-17 2020-01-15 Fundacion para la Investigacion Medica Aplicada Nucleic acid constructs and gene therapy vectors for use in the treatment of wilson's disease and other conditions
ES2876412T3 (es) 2014-12-17 2021-11-12 Fundacion Para La Investig Medica Aplicada Construcciones de ácido nucleico y vectores de terapia génica para su uso en el tratamiento de la enfermedad de Wilson
KR102554850B1 (ko) 2015-02-06 2023-07-13 더 유니버시티 오브 노쓰 캐롤라이나 엣 채플 힐 최적화된 인간 응고 인자 viii 유전자 발현 카세트 및 그의 용도
EP3270944B1 (en) 2015-03-17 2019-10-23 Vrije Universiteit Brussel Optimized liver-specific expression systems for fviii and fix
CN115074366A (zh) 2015-04-16 2022-09-20 埃默里大学 用于肝脏中蛋白质表达的重组启动子和载体及其用途
US11046955B2 (en) 2015-04-24 2021-06-29 University Of Massachusetts Modified AAV constructs and uses thereof
WO2017015154A1 (en) 2015-07-17 2017-01-26 Children's National Medical Center Methods and compositions for treating phenyltonuria
CA3002524A1 (en) 2015-10-28 2017-05-04 Sangamo Therapeutics, Inc. Liver-specific constructs, factor viii expression cassettes and methods of use thereof
US11389546B2 (en) 2015-12-09 2022-07-19 Modernatx, Inc. Heterologous UTR sequences for enhanced mRNA expression
CA3007330A1 (en) * 2015-12-14 2017-06-22 The Trustees Of The University Of Pennsylvania Composition for treatment of crigler-najjar syndrome
PL3411484T3 (pl) 2016-02-05 2024-02-19 Emory University Wstrzykiwanie jednoniciowego lub samokomplementarnego wirusa adenosatelitarnego 9 do płynu mózgowego
GB201603577D0 (en) * 2016-03-01 2016-04-13 Oxford Genetics Ltd Promoter
EP3509628A1 (en) 2016-09-09 2019-07-17 Fondazione Telethon Combined therapy for mucopolysaccharidosis type vi (maroteaux-lamy-syndrome)
KR102738752B1 (ko) * 2016-12-30 2024-12-06 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 페닐케톤뇨증을 치료하기 위한 유전자 치료
MX2019007873A (es) 2016-12-30 2019-11-18 Univ Pennsylvania Terapia génica para tratar la enfermedad de wilson.
FI3568483T3 (fi) 2017-01-10 2025-11-21 Childrens Medical Res Institute Polynukleotideja ja vektoreita siirtogeenien ilmentämiseen
EP3596206A1 (en) 2017-03-16 2020-01-22 Pfizer Inc Tyrosine prototrophy
CA3057142A1 (en) 2017-04-03 2018-10-11 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
EP3589329B1 (en) 2017-05-11 2022-10-12 Zentrum für Forschungsförderung in der Pädiatrie GmbH Concept for the treatment of monogenetic disorders
EP3630200A4 (en) 2017-05-31 2021-02-24 Arcturus Therapeutics, Inc. THERAPEUTICS FOR PHENYLKETONURIA
JP7423521B2 (ja) * 2017-11-22 2024-01-29 モダーナティエックス・インコーポレイテッド フェニルケトン尿症の治療用のフェニルアラニンヒドロキシラーゼをコードするポリヌクレオチド

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021207077A1 (en) * 2020-04-06 2021-10-14 Homology Medicines, Inc. Adeno-associated virus compositions for ids gene transfer and methods of use thereof
CN115484975A (zh) * 2020-04-06 2022-12-16 同源药物公司 用于ids基因转移的腺相关病毒组合物和其使用方法
WO2021243364A1 (en) * 2020-05-27 2021-12-02 Homology Medicines, Inc. Adeno-associated virus compositions for restoring pah gene function and methods of use thereof
CN115803441A (zh) * 2020-05-27 2023-03-14 同源药物公司 用于恢复pah基因功能的腺相关病毒组合物和其使用方法
JP2023528371A (ja) * 2020-05-27 2023-07-04 ホモロジー・メディシンズ・インコーポレイテッド Pah遺伝子機能を回復させるためのアデノ随伴ウイルス組成物及びその使用方法
US12076420B2 (en) 2020-05-27 2024-09-03 Homology Medicines, Inc. Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof

Also Published As

Publication number Publication date
MX2020008133A (es) 2020-10-14
CL2020002008A1 (es) 2021-02-12
CN111902164A (zh) 2020-11-06
JP2021512871A (ja) 2021-05-20
CO2020010793A2 (es) 2020-11-20
US12203094B2 (en) 2025-01-21
BR112020015798A2 (pt) 2021-03-09
EP3746101A1 (en) 2020-12-09
EP3746101A4 (en) 2022-03-23
WO2019152843A1 (en) 2019-08-08
PE20212076A1 (es) 2021-10-26
US20220325302A1 (en) 2022-10-13
CA3090226A1 (en) 2019-08-08
AU2019215152A1 (en) 2020-08-20
IL276368A (en) 2020-09-30
US20210130794A1 (en) 2021-05-06
KR20200127170A (ko) 2020-11-10

Similar Documents

Publication Publication Date Title
US20230414724A1 (en) Treatment of hyperbilirubinemia
US20220325302A1 (en) Adeno-associated virus compositions for restoring pah gene function and methods of use thereof
US11951183B2 (en) Adeno-associated virus compositions for PAH gene transfer and methods of use thereof
US20040142416A1 (en) Treatment for phenylketonuria
JP7433360B2 (ja) Pah遺伝子移入のためのアデノ随伴ウイルス組成物及びそれらの使用方法
US12076420B2 (en) Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof
US12201657B2 (en) Adeno-associated virus compositions for restoring HBB gene function and methods of use thereof
CA3142932A1 (en) Adeno-associated virus compositions for arsa gene transfer and methods of use thereof
US11891619B2 (en) Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof
IL298544A (en) Adeno-associated virus compositions for restoring pah gene function and methods of use thereof
WO2026025441A1 (zh) 一种用于显性遗传的视网膜色素变性基因编辑药物载体
HK40040055A (en) Adeno-associated virus compositions for restoring pah gene function and methods of use thereof

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: EXPRESSLY ABANDONED -- DURING EXAMINATION