US20070178115A1 - Immunization of avians by administration of non-replicating vectored vaccines - Google Patents

Immunization of avians by administration of non-replicating vectored vaccines Download PDF

Info

Publication number
US20070178115A1
US20070178115A1 US11/504,152 US50415206A US2007178115A1 US 20070178115 A1 US20070178115 A1 US 20070178115A1 US 50415206 A US50415206 A US 50415206A US 2007178115 A1 US2007178115 A1 US 2007178115A1
Authority
US
United States
Prior art keywords
avian
virus
antigens
immunogens
interest
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/504,152
Other languages
English (en)
Inventor
De-Chu Tang
Kent Kampen
Haroldo Toro
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Altimmune Inc
Original Assignee
Tang De-Chu C
Kampen Kent R V
Haroldo Toro
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tang De-Chu C, Kampen Kent R V, Haroldo Toro filed Critical Tang De-Chu C
Priority to US11/504,152 priority Critical patent/US20070178115A1/en
Publication of US20070178115A1 publication Critical patent/US20070178115A1/en
Priority to US14/020,024 priority patent/US9855328B2/en
Assigned to VAXIN INC. reassignment VAXIN INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: VAN KAMPEN, KENT R.
Assigned to ALTIMMUNE INC reassignment ALTIMMUNE INC CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: VAXIN INC
Priority to US15/824,230 priority patent/US10744195B2/en
Priority to US16/926,428 priority patent/US20200338188A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/861—Adenoviral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/235—Adenoviridae
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6075—Viral proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates generally to the fields of immunology and vaccine technology. More specifically, the invention relates to recombinant non-replicating vectors such as E1-defective human adenovirus vectors for delivery of avian immunogens and antigens, such as avian influenza virus antigens, into avians.
  • the invention also provides methods of introducing and expressing an avian immunogen in avian subjects, including avian embryos, as well as methods of eliciting an immune response in avian subjects to immunogens.
  • AI Avian influenza
  • avian influenza is a serious pathogen that infects avians, other animals, and humans. Since 1997, there have been several incidents of transmission of AI virus to humans (Subbarao et al., 1998; Ungchusak et al., 2005). Evidence also shows that genetic recombination between avian and human influenza viruses have occurred on multiple occasions in medical history (Kawaoka et al., 1989). Since avians and humans are in close contact, it is believed that the generation of new AI virus strains that could potentially cross the species barrier into the human population will continue to be a public health concern.
  • hemagglutininin (HA) of an AI virus has protected chickens against a H5N2 AI virus challenge after wing-web puncture, although the hemagglutination-inhibition (HI) serologic response was negligible (Beard et al., 1992).
  • Chickens inoculated through the wing web with a live recombinant vaccinia virus expressing HA also developed protective immunity against a lethal AI virus challenge with low levels of serum HI antibody detected (Chambers et al., 1988).
  • Avians have also been immunized by subcutaneous injection of HA proteins expressed from baculovirus vectors (Crawford et al., 1999), and inoculation of an expression plasmid encoding HA into the skin using a gene gun (Fynan et al., 1993). These AI vaccines are able to protect avians from exhibiting clinical signs and death, and reduce respiratory and intestinal replication of a challenge virus containing homologous HA.
  • the oral and aerosol AI vaccines suffer from inconsistencies in delivering a uniform dose to individual birds during mass-inoculation.
  • the replicating vectors used in some vaccines also pose a biohazard by introducing unnatural microbial forms to the environment.
  • the recombined influenza virus vaccine could even generate harmful reassortments through recombination between a reassortant influenza virus and a wild AI virus concurrently circulating in the environment (Hilleman, 2002).
  • Ad vectors are able to transduce both mitotic and postmitotic cells in situ. Additionally, preparation of Ad stocks containing high titers of virus (i.e., greater than 10 12 pfu [plaque-forming units] per ml) are easy to generate, which makes it possible to transduce cells in situ at high multiplicity of infection (MOI). Ad vectors also have a proven safety record, based on their long-term use as a vaccine. Further, the Ad virus is capable of inducing high levels of gene expression (at least as an initial burst), and replication-defective Ad vectors can be easily bioengineered, manufactured, and stored using techniques well known in the art.
  • Ad-based vaccines are more potent than DNA vaccines due to Ad vector's high affinity for specific receptors and its ability to escape the endosomal pathway (Curiel, 1994).
  • Ad vectors may transduce part of a chicken embryo through binding of its fiber to the coxsackie and adenovirus receptor (CAR) found on the surface of chicken cells (Tan et al., 2001).
  • CAR adenovirus receptor
  • at least one of the Ad components, hexon is highly immunogenic and can confer adjuvant activity to exogenous antigens (Molinier-Frenkel et al., 2002).
  • Ad-based vaccines mimic the effects of natural infections in their ability to induce major histocompatibility complex (MHC) class I restricted T-cell responses, yet eliminate the possibility of reversion back to virulence because only a subfragment of the pathogen's genome is expressed from the vector.
  • MHC major histocompatibility complex
  • This “selective expression” may solve the problem of differentiating vaccinated-but-uninfected animals from their infected counterparts, because the specific markers of the pathogen not encoded by the vector can be used to discriminate the two events.
  • propagation of the pathogen is not required for generating vectored vaccines because the relevant antigen genes can be amplified and cloned directly from field samples (Rajakumar et al., 1990).
  • E1/E3-defective human Ad serotype 5 (Ad5)-derived vectors have been extensively studied in mammals (Graham and Prevec, 1995). Although chickens have been immunized by subcutaneous or intradermal injection of an avian Ad chicken embryo lethal orphan (CELO) viral vector encoding an antigen (Francois et al., 2004), the CELO vector has a low compliance rate and could be potentially harmful due to its ability to replicate in chicken cells. Since CELO possesses no identifiable E1, E3, and E4 regions (Chiocca et al., 1996), a replication-incompetent CELO vector is not available as a carrier for immunization at this time. The present invention addresses this need by providing a safe and efficient method for gene delivery to protect avians in a wide variety of disease settings, and consequently prevent transmission of avian pathogens to humans.
  • CELO avian Ad chicken embryo lethal orphan
  • human adenovirus-vectored vaccines or immunogenic compositions does not require the propagation of lethal pathogens and does not involve transmission of antigens or immunogens by a vector that is capable of replication in avians. Furthermore, immunization by this type of vaccine or immunogenic composition allows differentiation between vaccinated and naturally infected animals.
  • the present invention provides a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest.
  • the human adenoviral sequences are derived from human adenovirus serotype 5.
  • the human adenoviral sequences can be derived from replication-defective adenovirus, non-replicating adenovirus, replication-competent adenovirus, or wild-type adenovirus.
  • the promoter sequence can be selected from the group consisting of viral promoters, avian promoters, CMV promoter, SV40 promoter, ⁇ -actin promoter, albumin promoter, EF1- ⁇ promoter, P ⁇ K promoter, MFG promoter, and Rous sarcoma virus promoter.
  • the one or more avian antigens or immunogens of interest can be derived from for example, avian influenza virus, infectious bursal disease virus, Marek's disease virus, Herpesviruses such as infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, poxviruses including avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian
  • the one or more avian antigens or immunogens of interest are derived from avian influenza, i.e., hemagglutinin, nucleoprotein, matrix, and neuraminidase.
  • the one or more avian antigens or immunogens of interest are derived from hemagglutinin subtype 3, 5, 7, or 9.
  • Another aspect of the invention provides an immunogenic composition or vaccine for in vivo delivery into an avian subject comprising a veterinarily acceptable vehicle or excipient and a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest.
  • the adenoviral DNA sequence is derived from adenovirus serotype 5 (Ad5).
  • the human adenoviral sequences are derived from human adenovirus serotype 5.
  • the human adenoviral sequences can be derived from replication-defective adenovirus.
  • the promoter sequence can be selected from the group consisting of viral promoters, avian promoters, CMV promoter, SV40 promoter, ⁇ -actin promoter, albumin promoter, EF1- ⁇ promoter, P ⁇ K promoter, MFG promoter, and Rous sarcoma virus promoter.
  • the one or more avian antigens or immunogens of interest can be derived from for example, avian influenza virus, infectious bursal disease virus, Marek's disease virus, Herpesviruses such as infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, poxviruses including avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian
  • the one or more avian antigens or immunogens of interest are derived from avian influenza, i.e., hemagglutinin, nucleoprotein, matrix, and neuraminidase.
  • the one or more avian antigens or immunogens of interest are derived from hemagglutinin subtype 3, 5, 7, or 9.
  • the immunogenic composition or vaccine may further comprise an adjuvant.
  • the immunogenic composition or vaccine may further comprise an additional vaccine.
  • Another aspect of the invention provides a method of introducing and expressing one or more avian antigens or immunogens in a cell, comprising contacting the cell with a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest, and culturing the cell under conditions sufficient to express the one or more avian antigens or immunogens in the cell.
  • the cell is a 293 cell or a PER.C6 cell.
  • the one or more avian antigens or immunogens of interest are derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rotavirus, avian
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from one or more avian viruses.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from avian influenza.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • Another aspect of the invention provides a method of introducing and expressing one or more avian influenza antigens or immunogens in an avian embryo, comprising contacting the avian embryo with a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest, thereby obtaining expression of the one or more avian influenza antigens or immunogens in the avian embryo.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from one or more avian viruses.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from avian influenza.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • the method of introducing and expressing one or more avian influenza antigens or immunogens in an avian embryo preferably can occur by by in ovo delivery.
  • Another aspect of the present invention provides a method of eliciting an immunogenic response in an avian subject, comprising administering an immunologically effective amount of the composition of the invention to the avian subject.
  • Yet another aspect of the present invention provides a method of eliciting an immunogenic response in an avian subject, comprising infecting the avian subject with an immunologically effective amount of an immunogenic composition comprising a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest, wherein the one or more avian antigens or immunogens of interest are expressed at a level sufficient to elicit an immunogenic response to the one or more avian antigens or immunogens of interest in the avian subject.
  • the one or more avian antigens or immunogens of interest are derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rotavirus, avian
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from avian influenza.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • the method may further comprise administering an additional vaccine.
  • the method of infecting occurs by in ovo delivery.
  • Another aspect of the invention provides a method of eliciting an immunogenic response in an avian subject, comprising infecting the avian subject with an immunologically effective amount of an immunogenic composition comprising a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest, wherein the one or more avian antigens or immunogens of interest are expressed at a level sufficient to elicit an immunogenic response to the one or more avian antigens or immunogens of interest in the avian subject.
  • the one or more avian antigens or immunogens of interest are derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rotavirus, avian
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from avian influenza.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • the method may further comprise administering an additional vaccine.
  • the avian subject is infected by intramuscular injection of the wing-web, wing-tip, pectoral muscle, or thigh musculature.
  • the avian subject may also be infected in ovo.
  • Another aspect of the invention provides a method for inoculation of an avian subject, comprising in ovo administration of a recombinant human adenovirus containing and expressing an heterologous nucleic acid molecule encoding an antigen of a pathogen of the avian subject.
  • the human adenovirus comprises sequences derived from adenovirus serotype 5.
  • the human adenovirus comprises sequences derived from replication-defective adenovirus, non-replicating adenovirus, replication-competent adenovirus, or wild-type adenovirus.
  • the antigen of a pathogen of the avian is derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rotavirus, avian leukos
  • the antigen of a pathogen of the avian is derived from avian influenza.
  • the avian influenza antigens or immunogens are selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • the avian influenza antigens or immunogens are selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • the method may further comprise administering an additional vaccine.
  • Another embodiment of the invention provides an in ovo administration apparatus for delivery of an immunogenic composition to an avian embryo wherein the apparatus contains a recombinant human adenovirus expression vector expressing one or more avian antigens or immunogens of interest, wherein the apparatus delivers to the recombinant human adenovirus to the avian embryo.
  • the human adenovirus expression vector comprises sequences derived from adenovirus serotype 5.
  • the human adenovirus expression vector comprises sequences derived from replication-defective adenovirus, non-replicating human adenovirus, replication-competent adenovirus, or wild-type adenovirus.
  • the one or more avian antigens or immunogens of interest are derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rotavirus, avian
  • the one or more avian antigens or immunogens of interest are derived from avian influenza.
  • the avian influenza antigens or immunogens are selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • the avian influenza antigens or immunogens of interest is selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • the method may further comprise administering an additional vaccine.
  • FIG. 1 is a graph depicting the immunization of chickens by in ovo and intramuscular injection of the recombinant adenovirus vector expressing avian influenza HA.
  • Group 1 represents 9-day-old embryonated chicken eggs and Group 2 represents 18-day-old embryonated chicken eggs, respectively, in a volume of 200 ⁇ l at a dose of 5 ⁇ 10 10 pfu per egg.
  • Group 3 the recombinant adenovirus vector expressing avian influenza HA was injected intramuscularly into three 4-week-old chickens in a volume of 100 ⁇ l at a dose of 2.5 ⁇ 10 10 pfu per animal.
  • FIG. 2 is a graph depicting the hemagglutination inhibition antibody titers (dots) detected in 28-day-old SPF chickens vaccinated with AdTW68.H5 in ovo only at days 10 or 18 of incubation, and chickens that were vaccinated in ovo at days 10 or 18 of incubation and were boosted by the nasal route at day 15 post-hatch. Bar, geometric mean log 2 [HI titer]. No HI titers were detected in na ⁇ ve control chickens (data not shown).
  • FIG. 3 is a graph depicting the hemagglutination inhibition antibodies in SPF chickens at days 23 and 29 post-hatch either vaccinated in ovo only (7 chicks) at day 18 of embryonation or vaccinated in ovo and boosted intranasally at day 15 post-hatch (12 chicks) with AdTW68.H5.
  • D23 and D29 HI titers at days 23 and 29 post-hatch, respectively; dots, log 2 [HI titer] in individual birds; bar, geometric mean log 2 [HI titer]. No HI titers were detected in 11 na ⁇ ve control chickens at days 23 and 29 post-hatch (data not shown).
  • FIG. 4 is a graph depicting in ovo vaccination of day-18 white leghorn chicken embryos.
  • In ovo vaccination was performed using 10 11 vp of AdTW68.H5 (in ovo).
  • AdTW68.H5 in ovo
  • in ovo-vaccinated birds were boosted at day 15 post-hatch by intranasal instillation of AdTW68.H5 with the same dose (in ovo+nasal booster). Na ⁇ ve embryos without immunization served as negative controls (Control).
  • Control On day 34 of age chickens were intranasally challenged through the choanal slit with a lethal dose of the highly pathogenic A/Ck/Queretaro/14588-19/95 (H5N2) AI virus strain.
  • FIG. 5 is a graph depicting A/Ck/Queretaro/14588-19/95 viral RNA quantitated by quantitative real-time RT-PCR (16) in oro-pharyngeal samples from vaccinated and control chickens after intranasal challenge with this highly pathogenic AI virus.
  • Chickens were vaccinated as described in the description of FIG. 3 .
  • Samples were collected at 2, 4, and 7 days post-infection. A significant difference (P ⁇ 0.05) in viral load was achieved at day 7 between vaccinated and unvaccinated controls.
  • FIG. 6 is a graph depicting in ovo vaccination on day-18 performed by inoculation of the AdTW68.H5 vector at a dose of 3 ⁇ 10 8 ifu.
  • the Ad5 vector was purified by the Sartobind Q5 membrane (Sartorius North America, Inc., Edgewood, N.Y.) and resuspended in A195 buffer (Evans, 2004). Pre-challenge serum HI antibodies on D25 were analyzed. Minus sign ( ⁇ ) indicates birds that succumbed to challenge; plus sign (+) indicates birds that survived challenge. Survivors had significantly elevated pre-challenge serum HI activity (P ⁇ 0.001) as compared to those that died (unpaired t-test; Prism 4.03). All na ⁇ ve control birds and birds immunized by the control vector AdCMV-tetC produced no measurable HI antibody titers.
  • FIG. 7 is a graph depicting in ovo vaccination on day-18 performed by inoculation of the AdTW68.H5 vector at a dose of 3 ⁇ 10 8 ifu.
  • the Ad5 vector was purified by the Sartobind Q5 membrane (Sartorius North America, Inc., Edgewood, N.Y.) and resuspended in A195 buffer (Evans, 2004). Control and immunized birds were challenged by intranasal administration of 10 5 EID 50 of the H5N1 AI virus A/Swan/Mongolia//244L/2005 on D31.
  • nucleic acid or “nucleic acid sequence” refers to a deoxyribonucleic or ribonucleic oligonucleotide in either single- or double-stranded form.
  • the term encompasses nucleic acids, i.e., oligonucleotides, containing known analogues of natural nucleotides.
  • the term also encompasses nucleic-acid-like structures with synthetic backbones, see e.g., Eckstein, 1991; Baserga et al., 1992; Milligan, 1993; WO 97/03211; WO 96/39154; Mata, 1997; Strauss-Soukup, 1997; and Straus, 1996.
  • “recombinant” refers to a polynucleotide synthesized or otherwise manipulated in vitro (e.g., “recombinant polynucleotide”), to methods of using recombinant polynucleotides to produce gene products in cells or other biological systems, or to a polypeptide (“recombinant protein”) encoded by a recombinant polynucleotide.
  • “Recombinant means” also encompass the ligation of nucleic acids having various coding regions or domains or promoter sequences from different sources into an expression cassette or vector for expression of, e.g., inducible or constitutive expression of polypeptide coding sequences in the vectors of invention.
  • heterologous when used with reference to a nucleic acid, indicates that the nucleic acid is in a cell or a virus where it is not normally found in nature; or, comprises two or more subsequences that are not found in the same relationship to each other as normally found in nature, or is recombinantly engineered so that its level of expression, or physical relationship to other nucleic acids or other molecules in a cell, or structure, is not normally found in nature.
  • a similar term used in this context is “exogenous”.
  • a heterologous nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged in a manner not found in nature; e.g., a human gene operably linked to a promoter sequence inserted into an adenovirus-based vector of the invention.
  • a heterologous nucleic acid of interest can encode an immunogenic gene product, wherein the adenovirus is administered therapeutically or prophylactically as a vaccine or vaccine composition.
  • Heterologous sequences can comprise various combinations of promoters and sequences, examples of which are described in detail herein.
  • an “antigen” is a substance that is recognized by the immune system and induces an immune response.
  • a similar term used in this context is “immunogen”.
  • An “avian subject” in the context of the present invention refers to any and all domestic and wild members of the class Aves, which include, but are not limited to, Neognathae and Palaeognathae.
  • the Neognathae order includes, among others, Anseriformes, Apodiformes, Buceroformes, Caprimulgiformes, Charadriiformes, Ciconiiformes, Coliiformes, Columbiformes, Coraciiformes, Cuculiformes, Falconiformes, Galbuliformes, Galliformes, Gaviiformes, Gruiformes, Musophagiformes, Opisthocomiformes, Passeriformes, Pelecaniformes, Phoenicopteriformes, Piciformes, Podicipediformes, Procellariiformes, Psittaciformes, Sphenisciformes,
  • the Palaeognathae order includes, among others, Apterygiformes, Casuariiformes, Dinornithiformes, Rheiformes, Struthioniformes, and Tiniamiformes.
  • Avian subjects can comprise adult avians, avian chicks, and avian embryos/eggs.
  • “Expression” of a gene or nucleic acid encompasses not only cellular gene expression, but also the transcription and translation of nucleic acid(s) in cloning systems and in any other context.
  • a “vector” is a tool that allows or facilitates the transfer of an entity from one environment to another.
  • some vectors used in recombinant DNA techniques allow entities, such as a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into a target cell.
  • the present invention comprehends recombinant vectors that can include viral vectors, bacterial vectors, protozoan vectors, DNA vectors, or recombinants thereof.
  • exogenous DNA for expression in a vector e.g., encoding an epitope of interest and/or an antigen and/or a therapeutic
  • documents providing such exogenous DNA as well as with respect to the expression of transcription and/or translation factors for enhancing expression of nucleic acid molecules, and as to terms such as “epitope of interest”, “therapeutic”, “immune response”, “immunological response”, “protective immune response”, “immunological composition”, “immunogenic composition”, and “vaccine composition”, inter alia, reference is made to U.S. Pat. No. 5,990,091 issued Nov.
  • immunogenic composition and “immunological composition” and “immunogenic or immunological composition” cover any composition that elicits an immune response against the antigen or immunogen of interest expressed from the adenoviral vectors and viruses of the invention; for instance, after administration into a subject, elicits an immune response against the targeted immunogen or antigen of interest.
  • vaccinal composition and “vaccine” and “vaccine composition” covers any composition that induces a protective immune response against the antigen(s) of interest, or which efficaciously protects against the antigen; for instance, after administration or injection into the subject, elicits an protective immune response against the targeted antigen or immunogen or provides efficacious protection against the antigen or immunogen expressed from the inventive adenovirus vectors of the invention.
  • veterinary composition means any composition comprising a vector for veterinary use expressing a therapeutic protein as, for example, erythropoietin (EPO) or an immunomodulatory protein, such as, for example, interferon (IFN).
  • EPO erythropoietin
  • IFN interferon
  • pharmaceutical composition means any composition comprising a vector for expressing a therapeutic protein.
  • an “immunologically effective amount” is an amount or concentration of the recombinant vector encoding the gene of interest, that, when administered to a subject, produces an immune response to the gene product of interest.
  • a “circulating recombinant form” refers to recombinant viruses that have undergone genetic reassortment among two or more subtypes or strains.
  • Other terms used in the context of the present invention is “hybrid form”, “recombined form”, and “reassortant form”.
  • “Clinical isolates” refer to, for example, frequently used laboratory strains of viruses that are isolated from infected subjects and are reasserted in laboratory cells or subjects with laboratory-adapted master strains of high-growth donor viruses.
  • Field isolates refer to viruses that are isolated from infected subjects or from the environment.
  • the methods of the invention can be appropriately applied to prevent diseases as prophylactic vaccination or provide relief against symptoms of disease as therapeutic vaccination.
  • the recombinant vectors of the present invention can be administered to a subject either alone or as part of an immunological or immunogenic composition.
  • the recombinant vectors of the invention can also be used to deliver or administer one or more proteins to a subject of interest by in vivo expression of the protein(s).
  • immunological products and/or antibodies and/or expressed products obtained in accordance with this invention can be expressed in vitro and used in a manner in which such immunological and/or expressed products and/or antibodies are typically used, and that cells that express such immunological and/or expressed products and/or antibodies can be employed in in vitro and/or ex vivo applications, e.g., such uses and applications can include diagnostics, assays, ex vivo therapy (e.g., wherein cells that express the gene product and/or immunological response are expanded in vitro and reintroduced into the host or animal), etc., see U.S. Pat. No. 5,990,091, WO 99/60164 and WO 98/00166 and documents cited therein.
  • expressed antibodies or gene products that are isolated from herein methods, or that are isolated from cells expanded in vitro following herein administration methods, can be administered in compositions, akin to the administration of subunit epitopes or antigens or therapeutics or antibodies to induce immunity, stimulate a therapeutic response and/or stimulate passive immunity.
  • human adenovirus as used herein is intended to encompass all human adenoviruses of the Adenoviridae family, which include members of the Mastadenovirus genera. To date, over fifty-one human serotypes of adenoviruses have been identified (see, e.g., Fields et al., Virology 2, Ch. 67 (3d ed., Lippincott-Raven Publishers)).
  • the adenovirus can be of serogroup A, B, C, D, E, or F.
  • the human adenovirus can be a serotype 1 (Ad1), serotype 2 (Ad2), serotype 3 (Ad3), serotype 4 (Ad4), serotype 6 (Ad6), serotype 7 (Ad7), serotype 8 (Ad8), serotype 9 (Ad9), serotype 10 (Ad10), serotype 11 (Ad11), serotype 12 (Ad12), serotype 13 (Ad13), serotype 14 (Ad14), serotype 15 (Ad15), serotype 16 (Ad16), serotype 17 (Ad17), serotype 18 (Ad18), serotype 19 (Ad19), serotype 19a (Ad19a), serotype 19p (Ad19p), serotype 20 (Ad20), serotype 21 (Ad21), serotype 22 (Ad22), serotype 23 (Ad23), serotype 24 (Ad24), serotype 25 (Ad25), serotype 26 (
  • adenovirus vectors can display an altered tropism for specific tissues or cell types (Havenga, M. J. E. et al., 2002), and therefore, mixing and matching of different adenoviral capsids, i.e., fiber, or penton proteins from various adenoviral serotypes may be advantageous.
  • adenoviral capsids including fiber and penton
  • Modification of the adenoviral capsids, including fiber and penton can result in an adenoviral vector with a tropism that is different from the unmodified adenovirus.
  • Adenovirus vectors that are modified and optimized in their ability to infect target cells can allow for a significant reduction in the therapeutic or prophylactic dose, resulting in reduced local and disseminated toxicity.
  • Adenovirus is a non-enveloped DNA virus. Vectors derived from adenoviruses have a number of features that make them particularly useful for gene transfer. As used herein, a “recombinant adenovirus vector” is an adenovirus vector that carries one or more heterologous nucleotide sequences (e.g., two, three, four, five or more heterologous nucleotide sequences).
  • the biology of the adenoviruses is characterized in detail, the adenovirus is not associated with severe human pathology, the virus is extremely efficient in introducing its DNA into the host cell, the virus can infect a wide variety of cells and has a broad host range, the virus can be produced in large quantities with relative ease, and the virus can be rendered replication defective and/or non-replicating by deletions in the early region 1 (“E1 ”) of the viral genome.
  • E1 early region 1
  • the genome of adenovirus is a linear double-stranded DNA molecule of approximately 36,000 base pairs (“bp”) with a 55-kDa terminal protein covalently bound to the 5′-terminus of each strand.
  • the Ad DNA contains identical Inverted Terminal Repeats (“ITRs”) of about 100 bp, with the exact length depending on the serotype.
  • ITRs Inverted Terminal Repeats
  • the viral origins of replication are located within the ITRs exactly at the genome ends. DNA synthesis occurs in two stages. First, replication proceeds by strand displacement, generating a daughter duplex molecule and a parental displaced strand. The displaced strand is single stranded and can form a “panhandle” intermediate, which allows replication initiation and generation of a daughter duplex molecule. Alternatively, replication may proceed from both ends of the genome simultaneously, obviating the requirement to form the panhandle structure.
  • the viral genes are expressed in two phases: the early phase, which is the period up to viral DNA replication, and the late phase, which coincides with the initiation of viral DNA replication.
  • the early phase only the early gene products, encoded by regions E1, E2, E3 and E4, are expressed, which carry out a number of functions that prepare the cell for synthesis of viral structural proteins (Berk, A. J., 1986).
  • the late phase the late viral gene products are expressed in addition to the early gene products and host cell DNA and protein synthesis are shut off. Consequently, the cell becomes dedicated to the production of viral DNA and of viral structural proteins (Tooze, J., 1981).
  • the E1 region of adenovirus is the first region of adenovirus expressed after infection of the target cell. This region consists of two transcriptional units, the E1A and E1B genes, both of which are required for oncogenic transformation of primary (embryonal) rodent cultures.
  • the main functions of the E1A gene products are to induce quiescent cells to enter the cell cycle and resume cellular DNA synthesis, and to transcriptionally activate the E1B gene and the other early regions (E2, E3 and E4) of the viral genome. Transfection of primary cells with the E1A gene alone can induce unlimited proliferation (immortalization), but does not result in complete transformation.
  • E1A results in induction of programmed cell death (apoptosis), and only occasionally is immortalization obtained (Jochemsen et al., 1987).
  • Co-expression of the E1B gene is required to prevent induction of apoptosis and for complete morphological transformation to occur.
  • high-level expression of E1A can cause complete transformation in the absence of E1B (Roberts, B. E. et al., 1985).
  • the E1B encoded proteins assist E1A in redirecting the cellular functions to allow viral replication.
  • the E1B 55 kD and E4 33 kD proteins which form a complex that is essentially localized in the nucleus, function in inhibiting the synthesis of host proteins and in facilitating the expression of viral genes. Their main influence is to establish selective transport of viral mRNAs from the nucleus to the cytoplasm, concomitantly with the onset of the late phase of infection.
  • the E1B 21 kD protein is important for correct temporal control of the productive infection cycle, thereby preventing premature death of the host cell before the virus life cycle has been completed.
  • Mutant viruses incapable of expressing the E1B 21 kD gene product exhibit a shortened infection cycle that is accompanied by excessive degradation of host cell chromosomal DNA (deg-phenotype) and in an enhanced cytopathic effect (cyt-phenotype; Telling et al., 1994).
  • the deg and cyt phenotypes are suppressed when in addition the E1A gene is mutated, indicating that these phenotypes are a function of E1A (White, E. et al., 1988).
  • the E1B 21 kDa protein slows down the rate by which E1A switches on the other viral genes. It is not yet known by which mechanisms E1B 21 kD quenches these E1A dependent functions.
  • adenoviruses do not integrate into the host cell's genome, are able to infect non-dividing cells, and are able to efficiently transfer recombinant genes in vivo (Brody et al., 1994). These features make adenoviruses attractive candidates for in vivo gene transfer of, for example, an antigen or immunogen of interest into cells, tissues or subjects in need thereof.
  • Adenovirus vectors containing multiple deletions are preferred to both increase the carrying capacity of the vector and reduce the likelihood of recombination to generate replication competent adenovirus (RCA).
  • RCA replication competent adenovirus
  • the adenovirus contains multiple deletions, it is not necessary that each of the deletions, if present alone, would result in a replication defective and/or non-replicating adenovirus.
  • the additional deletions may be included for other purposes, e.g., to increase the carrying capacity of the adenovirus genome for heterologous nucleotide sequences.
  • more than one of the deletions prevents the expression of a functional protein and renders the adenovirus replication defective and/or non-replicating and/or attenuated. More preferably, all of the deletions are deletions that would render the adenovirus replication-defective and/or non-replicating and/or attenuated.
  • the invention also encompasses adenovirus and adenovirus vectors that are replication competent and/or wild-type, i.e. comprises all of the adenoviral genes necessary for infection and replication in a subject.
  • Embodiments of the invention employing adenovirus recombinants may include E1-defective or deleted, or E3-defective or deleted, or E4-defective or deleted or adenovirus vectors comprising deletions of E1 and E3, or E1 and E4, or E3 and E4, or E1, E3, and E4 deleted, or the “gutless” adenovirus vector in which all viral genes are deleted.
  • the adenovirus vectors can comprise mutations in E1, E3, or E4 genes, or deletions in these or all adenoviral genes.
  • the E1 mutation raises the safety margin of the vector because E1-defective adenovirus mutants are said to be replication-defective and/or non-replicating in non-permissive cells, and are, at the very least, highly attenuated.
  • the E3 mutation enhances the immunogenicity of the antigen by disrupting the mechanism whereby adenovirus down-regulates MHC class I molecules.
  • the E4 mutation reduces the immunogenicity of the adenovirus vector by suppressing the late gene expression, thus may allow repeated re-vaccination utilizing the same vector.
  • the present invention comprehends adenovirus vectors of any serotype or serogroup that are deleted or mutated in E1, or E3, or E4, or E1 and E3, or E1 and E4. Deletion or mutation of these adenoviral genes result in impaired or substantially complete loss of activity of these proteins.
  • the “gutless” adenovirus vector is another type of vector in the adenovirus vector family. Its replication requires a helper virus and a special human 293 cell line expressing both E1a and Cre, a condition that does not exist in natural environment; the vector is deprived of all viral genes, thus the vector as a vaccine carrier is non-immunogenic and may be inoculated multiple times for re-vaccination.
  • the “gutless” adenovirus vector also contains 36 kb space for accommodating antigen or immunogen(s) of interest, thus allowing co-delivery of a large number of antigen or immunogens into cells.
  • AdEasy system He et al., 1998) and the subsequently modified AdEasier system (Zeng et al., 2001), which were developed to generate recombinant Ad vectors in 293 cells rapidly by allowing homologous recombination between donor vectors and Ad helper vectors to occur in Escherichia coli cells, such as BJ5183 cells, overnight.
  • pAdEasy comprises adenoviral structural sequences that, when supplied in trans with a donor vector such as pShuttle-CMV expressing an antigen or immunogen of interest, results in packaging of the antigen or immunogen (e.g., immunogens and/or antigens) in an adenoviral capsid.
  • a donor vector such as pShuttle-CMV expressing an antigen or immunogen of interest
  • the sequence of pAdEasy is well known in the art and is publicly and commercially available through Stratagene.
  • the present invention can be generated using the AdHigh system (U.S. Patent Provisional Application Ser. No. 60/683,638).
  • AdHigh is a safe, rapid, and efficient method of generating high titers of recombinant adenovirus without the risk of generating RCA, which may be detrimental or fatal to avian subjects. Further, RCA may be pathogenic to humans and undesirable to be present in the food chain.
  • the AdHigh system uses modified shuttle plasmids, such as pAdHigh, to promote the production of RCA-free adenoviruses in permissive cells, such as PER.C6 cells after generating recombinants with an adenovirus backbone plasmid in E. coli cells.
  • shuttle plasmids contain polylinkers or multiple cloning sites for easy insertion of avian immunogens or antigens such as, for example, avian influenza immunogens or antigens.
  • Recombination of the adenoviral shuttle plasmids in conjunction with an adenoviral helper plasmid such as pAdEasy in bacterial cells (i.e., BJ5183) can be easily implemented to produce the recombinant human adenoviruses expressing avian antigens or immunogens of the invention.
  • Methods of producing recombinant vectors by cloning and restriction analysis are well known to those skilled in the art.
  • RGD motif may be inserted into the H—I loop of an adenovirus vector to enhance its infectivity. This sequence has been shown to be essential for the interaction of certain extracellular matrix and adhesion proteins with a superfamily of cell-surface receptors called integrins. Insertion of the RGD motif may be advantageously useful in immunocompromised subjects.
  • An adenovirus recombinant is constructed by cloning specific antigen or immunogen or fragments thereof into any of the adenovirus vectors such as those described above. The adenovirus recombinant is used to transduce cells of a vertebrate use as an immunizing agent. (See, for example, U.S. patent application Ser. No. 10/424,409, incorporated by reference).
  • the adenovirus vectors of the present invention are useful for the delivery of nucleic acids expressing avian antigens or immunogens to cells both in vitro and in vivo.
  • the inventive vectors can be advantageously employed to deliver or transfer nucleic acids to animal, more preferably avian and mammalian cells.
  • Nucleic acids of interest include nucleic acids encoding peptides and proteins, preferably therapeutic (e.g., for medical or veterinary uses) or immunogenic (e.g., for vaccines) peptides or proteins.
  • the codons encoding the antigen or immunogen of interest are “optimized” codons, i.e., the codons are those that appear frequently in, i.e., highly expressed avian genes, instead of those codons that are frequently used by, for example, influenza.
  • Such codon usage provides for efficient expression of the antigen or immunogen in human or avian cells.
  • the codon usage pattern is altered to represent the codon bias for highly expressed genes in the organism in which the antigen or immunogen is being expressed. Codon usage patterns are known in the literature for highly expressed genes of many species (e.g., Nakamura et al., 1996; Wang et al, 1998; McEwan et al. 1998).
  • the adenovirus vectors can be used to infect a cell in culture to express a desired gene product, e.g., to produce a protein or peptide of interest.
  • the protein or peptide is secreted into the medium and can be purified therefrom using routine techniques known in the art as well as those provided herein.
  • Signal peptide sequences that direct extracellular secretion of proteins are known in the art and nucleotide sequences encoding the same can be operably linked to the nucleotide sequence encoding the peptide or protein of interest by routine techniques known in the art.
  • the cells can be lysed and the expressed recombinant protein can be purified from the cell lysate.
  • the cell is an animal cell, more preferably an avian or mammalian cell. Also preferred are cells that are competent for transduction by adenoviruses.
  • Such cells include PER.C6 cells, 911 cells, and HEK293 cells.
  • the invention also comprehends the use of avian cells, such as, but not limited to, avian embryonic fibroblasts, such as DF-1 cells, avian stem cells such as those described in U.S. Pat. Nos. 6,872,561; 6,642,042; 6,280,970; and 6,255,108, incorporated by reference, avian lymphoblasts, avian epithelial cells, among others, such as chicken embryo-derived cell strain CHCC-OU2 (Ogura, H. et al., 1987; Japanese Patent Publication No. 9-173059), quail-derived cell strain QT-35 (Japanese Patent Publication No. 9-98778). Any avian cell that is competent for infection, transfection, or any type of gene transfer can be used in the practice of the invention.
  • avian embryonic fibroblasts such as DF-1 cells
  • avian stem cells such as those described in U
  • a culture medium for culturing host cells includes a medium commonly used for tissue culture, such as M199-earle base, Eagle MEM (E-MEM), Dulbecco MEM (DMEM), SC-UCM102, UP-SFM (GIBCO BRL), EX-CELL302 (Nichirei), EX-CELL293-S (Nichirei), TFBM-01 (Nichirei), ASF104, among others.
  • Suitable culture media for specific cell types can be found at the American Type Culture Collection (ATCC) or the European Collection of Cell Cultures (ECACC).
  • Culture media can be supplemented with amino acids such as L-glutamine, salts, anti-fungal or anti-bacterial agents such as Fungizone®, penicillin-streptomycin, animal serum, and the like.
  • the cell culture medium can optionally be serum-free.
  • the present invention also provides vectors useful as vaccines.
  • the immunogen or antigen can be presented in the adenovirus capsid, alternatively, the antigen can be expressed from an antigen or immunogen introduced into a recombinant adenovirus genome and carried by the inventive adenoviruses.
  • the adenovirus vector can provide any antigen or immunogen of interest. Examples of immunogens are detailed herein.
  • Expression vectors include expression control sequences, such as an origin of replication (which can be bacterial origins, e.g., derived from bacterial vectors such as pBR322, or eukaryotic origins, e.g., autonomously replicating sequences (ARS)), a promoter, an enhancer, and necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, packaging signals, and transcriptional terminator sequences.
  • an origin of replication which can be bacterial origins, e.g., derived from bacterial vectors such as pBR322, or eukaryotic origins, e.g., autonomously replicating sequences (ARS)
  • ARS autonomously replicating sequences
  • the recombinant adenovirus vectors of the invention can contain appropriate transcription/translation control signals and polyadenylation signals (e.g., polyadenylation signals derived from bovine growth hormone, SV40 polyadenylation signal) operably associated with the antigen or immunogen sequence(s) to be delivered to the target cell.
  • polyadenylation signals e.g., polyadenylation signals derived from bovine growth hormone, SV40 polyadenylation signal
  • a variety of promoter/enhancer elements may be used depending on the level and tissue-specific expression desired.
  • the promoter can be constitutive or inducible (e.g., the metallothionein promoter), depending on the pattern of expression desired.
  • the promoter may be native or foreign and can be a natural or a synthetic sequence.
  • the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced.
  • the promoter is chosen so that it will function in the target cell(s) or tissue(s) of interest. Brain-specific, hepatic-specific, and muscle-specific (including skeletal, cardiac, smooth, and/or diaphragm-specific) promoters are contemplated by the present invention. Mammalian and avian promoters are also preferred.
  • the promoter can advantageously be an “early” promoter.
  • An “early” promoter is known in the art and is defined as a promoter that drives expression of a gene that is rapidly and transiently expressed in the absence of de novo protein synthesis.
  • the promoter can also be a “strong” or “weak” promoter.
  • strong promoter and “weak promoter” are known in the art and can be defined by the relative frequency of transcription initiation (times per minute) at the promoter.
  • a “strong” or “weak” promoter can also be defined by its affinity to RNA polymerase.
  • the antigens or immunogens are operatively associated with, for example, a human cytomegalovirus (CMV) major immediate-early promoter, a simian virus 40 (SV40) promoter, a ⁇ -actin promoter, an albumin promoter, an Elongation Factor 1- ⁇ (EF1- ⁇ ) promoter, a P ⁇ K promoter, a MFG promoter, or a Rous sarcoma virus promoter.
  • CMV human cytomegalovirus
  • SV40 simian virus 40
  • a ⁇ -actin promoter an albumin promoter
  • Elongation Factor 1- ⁇ (EF1- ⁇ ) promoter a P ⁇ K promoter
  • MFG promoter a Rous sarcoma virus promoter
  • Rous sarcoma virus promoter Rous sarcoma virus promoter.
  • Other expression control sequences include promoters derived from immunoglobin genes, adenovirus, bovine papilloma virus,
  • the promoters of immediate early (i.e., ICP4, ICP27) genes of the infectious laryngotracheitis virus (ILTV) virus early (i.e., thymidine kinase, DNA helicase, ribonucleotide reductase) or late (i.e., gB, gD, gC, gK), of the Marek's disease virus, (i.e., gB, gC, pp38, pp14, ICP4, Meq) or of the herpes virus of turkeys (i.e., gB, gC, ICP4) can be used in the methods and vectors of the present invention.
  • ICP4 immediate early genes of the infectious laryngotracheitis virus
  • ILTV infectious laryngotracheitis virus
  • early i.e., thymidine kinase, DNA helicase, ribonucleotide reductase
  • late i.e
  • the vectors of the invention can also comprise a polylinker or multiple cloning site (“MCS”), which can advantageously be located downstream of a promoter.
  • MCS multiple cloning site
  • the polylinker provides a site for insertion of the antigen or immunogen molecules that are “in-frame” with the promoter sequence, resulting in “operably linking” the promoter sequence to the antigen or immunogen of interest.
  • Multiple cloning sites and polylinkers are well known to those skilled in the art.
  • the term “operably linked” means that the components described are in a relationship permitting them to function in their intended manner.
  • selectable markers encoding antibiotic resistance may be present when used for in vitro amplification and purification of the recombinant vector, and, in the context of the commercially available AdEasy, AdEasier, and AdHigh adenoviral systems, to monitor homologous recombination between a donor vector and an adenoviral helper vector.
  • the AdEasy, AdEasier, and AdHigh systems facilitate homologous recombination between a donor vector and an adenoviral helper vector at the ITR sequences.
  • Each vector comprises a different antibiotic resistance gene, and by dual selection, recombinants expressing the recombined vector can be selected.
  • antibiotic resistance genes examples include, but are not limited to, ampicillin, tetracycline, neomycin, zeocin, kanamycin, bleomycin, hygromycin, chloramphenicol, among others.
  • the antigen or immunogen sequences may be operatively associated with a single upstream promoter and one or more downstream internal ribosome entry site (IRES) sequences (e.g., the picornavirus EMC IRES sequence).
  • IRES internal ribosome entry site
  • specific initiation signals are generally required for efficient translation of inserted protein coding sequences.
  • exogenous translational control sequences which may include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.
  • antigens or immunogens include, but are not limited to, antigens or immunogens derived from avian influenza virus, such as hemagglutinin, neuraminidase, matrix, and nucleoprotein antigens or immunogens, infectious bursal disease virus antigens such as VP1, VP1s1, VP1s2, VP2 (Heine, H. G. et al., 1991; Dormitorio, T. V. et al., 1997; and Cao, Y. C.
  • avian influenza virus such as hemagglutinin, neuraminidase, matrix, and nucleoprotein antigens or immunogens
  • infectious bursal disease virus antigens such as VP1, VP1s1, VP1s2, VP2 (Heine, H. G. et al., 1991; Dormitorio, T. V. et al., 1997; and Cao, Y. C.
  • Herpesviruses such as infectious laryngotracheitis virus antigens including gA, gB, gD, gE, gI, and gG (Veits, J. et al 2003), avian infectious bronchitis virus antigens such as spike glycoprotein, integral membrane protein M, small membrane protein E, and polyprotein (Casais, R. et al 2003), avian reovirus antigens such as capsid, sigma NS, sigma A, sigma B, and sigma C proteins (Spandidos, D. A.
  • poxviruses including avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox antigens such as thymidine kinase, avian polyomavirus antigens such as VP 1, VP2, VP3, and VP4 (Rott, O. et al 1988), Newcastle Disease virus antigens such as HN, P, NP, M, F, and L proteins (reviewed in Alexander, D. J., 1990), avian pneumovirus antigens SH, F, G and N (Seal, B.
  • poxviruses including avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox antigens such as thymidine kinase, avian polyomavirus antigens such as VP 1, VP2, VP3, and VP4 (R
  • avian rhinotracheitis virus antigens such as glycoprotein, matrix, fusion, and nucleocapsid
  • avian reticuloendotheliosis virus antigens such as p29, envelope, gag, protease, and polymerase (Dornburg, R. 1995)
  • avian retroviruses including avian carcinoma virus antigens gag, pol, and env, avian endogenous virus gag, pol, env, capsid, and protease (Rovigatti, U. G. et al, 1983), avian erythroblastosis virus gag, erbA, erbB (Graf, T.
  • avian myeloblastosis virus antigens p15, p27, envelope, gag, and polymerase, nucleocapsid, and gs-b Joliot, V. et al., 1993
  • avian myeloblastosis-associated virus Perbal, B., 1995
  • avian myelocytomatosis virus Petropoulos, C. J., 1997)
  • avian sarcoma virus antigens such as p19 and envelope (Neckameyer, W. S. et al, 1985), and avian spleen necrosis virus gag, envelope, and polymerase (Purchase, H. G. et al, 1975).
  • immunogens/antigens that can be used in the context of the present invention include avian bacterial antigens from Pasteurella multocida strains, such as the 39 kDa capsular protein (Ali, H. A. et al, 2004; Rimler, R. B. 2001), 16-kDa outer membrane protein (Kasten, R. W., et al, 1995), lipopolysaccharide (Baert, K. et al, 2005), Escherichia coli , such as type 1 fimbriae, P fimbriae, and curli (Roland, K.
  • avian bacterial antigens from Pasteurella multocida strains, such as the 39 kDa capsular protein (Ali, H. A. et al, 2004; Rimler, R. B. 2001), 16-kDa outer membrane protein (Kasten, R. W., et al, 1995), lipopolysaccharide (Ba
  • F1 pilus adhesin, P pilus adhesin, aerobactin receptor protein, and lipopolysaccharide (Kariyawasam, S. et al, 2002), Mycoplasma gallisepticum , such as the major membrane antigen pMGA (also known as P67; Jan, G. et al, 2001; Noormohammadi, A. H. et al, 2002a), TM-1 (Saito, S. et al, 1993), adhesin (Barbour, E. K. et al, 1989), P52 (Jan, G. et al, 2001) serum-plate-agglutination (SPA) antigen (Ahmad, I.
  • SPA serum-plate-agglutination
  • Mycoplasma gallinaceum Mycoplasma gallinarum, Mycoplasma gallopavonis, Mycoplasma synoviae , including antigens such as major membrane antigen MSPB (Noormohammadi, A. H. et al, 2002b) and 165-kDa protein (Ben Abdelmoumen, B. et al, 1999), Mycoplasma meleagridis, Mycoplasma iowae, Mycoplasma pullorum, Mycoplasma imitans, Salmonella enteritidis such as flagellin, porins, OmpA, SEF21 and SEF14 fimbriae (Ochoa-Reparaz, J.
  • Salmonella enterica serovars such as Gallinarum and Typhimurium that express, for example, SEF14 and SEF21 (Li, W. et al, 2004), Campylobacter jejuni , such as flagellin, 67-kDa antigen, CjaA, CjaC, and CjaD proteins (Widders, P. R. et al, 1998; Wyszynska, A. et al, 2004), Haemophilus paragallinarum such as serogroups A, B, and C antigens like hemagglutinin (Yamaguchi, T.
  • bacterin antigens Higgins, D. A. et al, 2000
  • Chlamydia psittaci strains such as serovar A and 6B and expressing, for example, major outer membrane protein (MOMP) (Vanrompay, D. et al, 1999), Erysipelothrix rhusiopathiae including 66-64 kDa protein antigen (Timoney, J. F. et al, 1993), Erysipelothrix insidiosa such as bacterin (Bigland, C. H. and Matsumoto, J.
  • MOMP major outer membrane protein
  • Brucella abortus such as antigens P39 and bacterioferrin (Al-Mariri, A. et al, 2001), Borrelia anserina such as 22-kilodalton major outer surface protein (Sambri, V. et al, 1999), outer membrane protein P66 (Bunikis, J. et al, 1998), and OspC (Marconi, R. T. et al, 1993), Alcaligenes faecalis, Streptococcus faecalis, Staphylococcus aureus , among many others.
  • the invention also comprehends the use of immunogens/antigens derived from avian protozoal antigens, such as, but not limited to Eimeria acervulina such as 3-1E antigen (Lillehoj, H. S. et al, 2005; Ding, X. et al, 2004), apical complex antigens (Constantinoiu, C. C. et al, 2004), and lactate dehydrogenase (Schaap, D. et al, 2004), Eimeria maxima such as gam56 and gam82 (Belli, S. I. et al, 2004), 56 and 82 kDa antigen proteins (Belli, S. I.
  • EmTFP250 Wood-Field, M. J.
  • Eimeria necatrix such as 35-kD protein
  • Eimeria tenella such as the TA4 and SO7 gene products
  • 12-kDa oocyst wall protein Karim, M. J.
  • Eimeria vermiformis Eimeria adenoeides
  • Leucocytozoon caulleryi such as R7 outer membrane antigen (Ito, A., et al, 2005)
  • Plasmodium relictum Plasmodium gallinaceum such as CSP protein (Grim, K. C. et al, 2004) and 17- and 32-kDa protein antigens (Langer, R. C. et al, 2002), and Plasmodium elongatum , among others.
  • a preferred embodiment of the invention utilizes avian influenza viral antigens or immunogens.
  • the invention also provides a recombinant vector expressing various avian antigens or immunogens, such as, for example, a multivalent vaccine or immunogenic composition that can protect avians against multiple avian diseases with a single injection.
  • Influenza viruses which belong to the Orthomyxoviridae family, are classified as A, B, and C based on antigenic differences in their nucleoprotein (NP) and matrix (M1) protein. All avian influenza viruses are classified as type A. Further subtyping is based on the antigenicity of two surface glycoproteins, hemagglutinin (HA) and neuraminidase (NA). Currently, 15 HA and 9 NA subtypes have been identified among influenza A viruses (Murphy, B. R. et al, 1996; Röhm, C. et al, 1996b).
  • the amino acid sequences of the HA1 region which is responsible for HA antigenicity, differ from subtype to subtype by 30% or more (Röhm, C. et al, 1996b). Although viruses with all HA and NA subtypes are found in avian species, viral subtypes of mammalian influenza viruses are limited.
  • Avian influenza A viruses are defined by their virulence; highly virulent types that can cause fowl plagues, and avirulent types that generally cause only mild disease or asymptomatic infection. In rare instances, however, viruses with low pathogenicity in the laboratory cause outbreaks of severe disease in the field. Nonetheless, the morbidity and mortality associated with these viruses tend to be much lower than those caused by lethal viruses.
  • H4 A/Chicken/Alabama/7395/75 (H4N8)] (Johnson, D. C. et al, 1976) and H10 [A/Chicken/Germany/N/49 (H10N7)] have been isolated from chickens during severe fowl plague-like outbreaks.
  • influenza A viruses are quite similar (Lamb, R. A. et al, 1996). By electron microscopy, the viruses are pleomorphic, including virions that are roughly spherical (approximately 120 nm in diameter) and filamentous. Two distinct types of spikes (approximately 16 nm in length), corresponding to the HA and NA molecules, reside on the surface of the virions. These two glycoproteins are anchored to the lipid envelope derived from the plasma membrane of host cells by short sequences of hydrophobic amino acids (transmembrane region).
  • HA is a type I glycoprotein, containing an N-terminal ectodomain and a C-terminal anchor, while NA is a type II glycoprotein, containing an N-proximal anchor and a C-terminal ectodomain.
  • HA enables the virion to attach to cell surface sialyloligosaccharides (Paulson, J. C., 1985) and is responsible for its hemagglutinating activity (Hirst, G. K., 1941).
  • HA elicits virus-neutralizing antibodies that are important in protection against infection.
  • NA is a sialidase (Gottschalk, A., 1957) that prevents virion aggregation by removing cell and virion surface sialic acid (the primary moiety in sialyloligosaccharides recognized by HA) (Paulson, J. C., 1985).
  • Antibodies to NA are also important in protecting hosts (Webster, R. G., et al, 1988).
  • M1 proteins are integrated into the virions (Zebedee, S. L. et al, 1988). They form tetramers, have H1 ion channel activity, and, when activated by the low pH in endosomes, acidify the inside of the virion, facilitating its uncoating (Pinto, L. H. et al, 1992). M1 protein that lies within the envelope is thought to function in assembly and budding.
  • RNA molecules (negative sense, or complementary to mRNA) are contained within the viral envelope, in association with NP and three subunits of viral polymerase (PB1, PB2, and PA), which together form a ribonucleoprotein (RNP) complex that participates in RNA replication and transcription.
  • RNP ribonucleoprotein
  • NS2 protein now known to exist in virions (Richardson, J. C. et al, 1991; Yasuda, J. et al, 1993), is thought to play a role in the export of RNP from the nucleus (O'Neill, R. E. et al, 1998) through interaction with M1 protein (Ward, A. C. et al, 1995).
  • NS1 protein the only nonstructural protein of influenza A viruses, has multiple functions, including regulation of splicing and nuclear export of cellular mRNAs as well as stimulation of translation (Lamb, R. A. et al, 1996). Its major function is believed to counteract the interferon activity of the host, since an NS1 knockout virus was viable although it grew less efficiently than the parent virus in interferon-non-defective cells (Garcia-Sastre, A. et al, 1988).
  • the avian influenza immunogens or antigens useful in the present invention include, but are not limited to, HA, NA, as well as M1, NS2, and NS1. Particularly preferred avian influenza immunogens or antigens are HA and NA.
  • the avian influenza immunogens or antigens can be derived from any known strain of AI, including all avian influenza A strains, clinical isolates, field isolates, and reassortments thereof.
  • strains and subtypes include, but are not limited to, H10N4, H10N5, H10N7, H10N8, H10N9, H11N1, H11N13, H1N2, H11N4, H11N6, H11N8, H11N9, H12N1, H12N4, H12N5, H12N8, H13N2, H13N3, H13N6, H13N7, H14N5, H14N6, H15N8, H15N9, H16N3, H1N1, H1N2, H1N3, H1N6, H2N1, H2N2, H2N3, H2N5, H2N7, H2N8, H2N9, H3N1, H3N2, H3N3, H3N4, H3N5, H3N6, H3N8, H4N1, H4N2, H4N3, H4N4, H4N5, H4N6, H4N8, H4N9, H5N1, H5N2, H5N3, H5N7, H5N8, H5N9, H
  • antigenicity of influenza viruses changes gradually by point mutation (antigenic drift) or drastically by genetic reassortment (antigenic shift) (Murphy, B. R. et al, 1996). Immunological pressure on HA and NA is thought to drive antigenic drift. Antigenic shift can be caused by either direct transmission of nonhuman influenza viruses to humans or the reassortment of genes from two different influenza viruses that have infected a single cell (Webster, R. G. et al, 1982). Theoretically, 256 different combinations of RNA can be produced from the shuffling of the eight different genomic segments of the virus. Genetic reassortment is well documented both in vitro and in vivo under laboratory conditions (Webster, R. G. et al, 1975).
  • the invention also concerns the use of avian influenza immunogens or antigens that have undergone antigenic drift or antigenic shift, including clinical isolates of avian influenza, field or environmental isolates of avian influenza, hybrid forms, and reassortant forms of avian influenza.
  • the invention comprehends the use of more than one avian influenza immunogen or antigen in the vectors and methods disclosed herein, delivered either in separate recombinant vectors, or together in one recombinant vector so as to provide a multivalent avian influenza vaccine or immunogenic composition that stimulates or modulates immunogenic response to one or more avian influenza strains and/or hybrids.
  • influenza viruses Many domestic and wild avian species are infected with influenza viruses. These include chickens, turkeys, ducks, guinea fowl, domestic geese, quail, pheasants, partridge, mynah birds, passerines, psittacines, budgerigars, gulls, shorebirds, seabirds, and emu (Easterday, B. C. et al, 1997; Webster, R. G. et al, 1988). Some infected birds show symptoms of influenza, while others do not. Among domestic avian species, turkeys are the most frequently involved in outbreaks of influenza; chickens have also been involved but less frequently.
  • Avian influenza A viruses produce an array of syndromes in birds, ranging from asymptomatic to mild upper respiratory infections to loss of egg production to rapidly fatal systemic disease (Eckroade, R. J. et al, 1987). The severity of disease depends on multiple factors, including the virulence of the virus, the immune status and diet of the host, accompanying bacterial infections, and stresses imposed on the host. Depending on their pathogenicity in chickens and turkeys, avian influenza A viruses are classified as virulent (capable of causing fowl plague) or avirulent (causing mild or asymptomatic disease). Even when highly pathogenic for one avian species, influenza A viruses may not be pathogenic for another avian species (Alexander, D. J. et al, 1986).
  • ducks are typically resistant to viruses that are lethal in chickens.
  • A/Turkey/Ireland/1378/85 H5N8
  • H5N8 A/Turkey/Ireland/1378/85
  • Influenza viruses are secreted from the intestinal tract into the feces of infected birds (Kida, H., et al, 1980; Webster, R. G. et al, 1978).
  • the modes of transmission can be either direct or indirect; they include contact with aerosol and other virus-contaminated materials. Since infected birds excrete large amounts of virus in their feces, many different items can become contaminated (e.g., feed, water, equipment, and cages) and contribute to dissemination of the virus. Waterborne transmission may provide a mechanism for the year-to-year perpetuation of avian influenza viruses in natural waterfowl habitats.
  • the typical signs and symptoms manifested by commercial avians, such as poultry infected with highly pathogenic avian influenza viruses include decreased egg production, respiratory signs, rales, excessive lacrimation, sinusitis, cyanosis of unfeathered skin (especially the combs and wattles), edema of the head and face, ruffled feathers, diarrhea, and nervous system disorders.
  • Some of the differences among reported cases may reflect differences in experimental conditions, including the route of inoculation, the breed and age of the chickens, and the dose of virus. Swelling of the microvascular endothelium, systemic congestion, multifocal hemorrhages, perivascular mononuclear cell infiltration, and thrombosis are commonly seen in chickens infected with highly virulent viruses. Such viruses replicate efficiently in the vascular endothelium and perivascular parenchymatous cells, a property that can be important for viral dissemination and systemic infection (Kobayashi, Y. et al, 1996; Suarez, D. L. et al, 1998). Viral antigens can also be found in necrotic cardiac myocytes in addition to cells in other organs with necrotic and inflammatory changes (Kobayashi, Y. et al, 1996).
  • the present invention also relates to methods of expressing one or more antigens or immunogens in a cell.
  • the antigen or immunogen can instead be replaced by a heterologous nucleotide sequences encoding proteins and peptides that include those encoding reporter proteins (e.g., an enzyme).
  • reporter proteins are known in the art and include, but are not limited to, Green Fluorescent Protein, ⁇ -galactosidase, ⁇ -glucuronidase, luciferase, alkaline phosphatase, and chloramphenicol acetyltransferase gene. Many of these reporter proteins and methods of their detection are included as a part of many commercially available diagnostic kits.
  • the antigen or immunogen of interest may encode an antisense nucleic acid, small interfering RNAs (siRNAs), a ribozyme, or other non-translated RNAs, such as “guide” RNAs (Gorman et al., 1998), and the like.
  • siRNAs small interfering RNAs
  • ribozyme a ribozyme
  • other non-translated RNAs such as “guide” RNAs (Gorman et al., 1998), and the like.
  • the recombinant vectors and methods of the invention also comprehend the use of therapeutic proteins or adjuvant molecules that can modulate immune responses upon delivery of recombinant vectors or immunogenic compositions.
  • therapeutic proteins or adjuvant molecules can include, but are not limited to, immunomodulatory molecules such as interleukins, interferon, and co-stimulatory molecules.
  • Avian cytokines that are known in the art to modulate immune responses in an avian subject are chicken interferon- ⁇ (IFN ⁇ ) (Karaca, K. et al, 1998; Schijns, V. E. et al, 2000), chicken interferon- ⁇ (IFN ⁇ ), chicken interleukin-1 ⁇ (ChIL-1 ⁇ ) (Karaca, K.
  • the immunomodulatory molecules can be co-administered with the inventive immunogenic compositions, or alternatively, the nucleic acid of the immunomodulatory molecule(s) can be co-expressed along with the avian immunogens or antigens in the recombinant vectors of the invention.
  • the recombinant vectors of the present invention may be used in an immunological composition or vaccine to provide a means to induce an immune response, which may, but need not be, protective.
  • the molecular biology techniques used in the context of the invention are described by Sambrook et al. (2001).
  • the nucleotide sequence encoding the antigens or immunogens can have deleted therefrom a portion encoding a transmembrane domain.
  • the vector or immunogenic composition can further contain and express in a host cell a nucleotide sequence encoding a heterologous tPA signal sequence such as human or avian tPA and/or a stabilizing intron, such as intron II of the rabbit ⁇ -globin gene.
  • the present invention also provides a method of delivering and/or administering a heterologous nucleotide sequence into a cell in vitro or in vivo.
  • a cell is infected with a recombinant human adenovirus vector according to the present invention (as described in detail herein).
  • the cell may be infected with the adenovirus vector by the natural process of viral transduction.
  • the vector may be introduced into the cell by any other method known in the art.
  • the cell may be contacted with a targeted adenovirus vector (as described below) and taken up by an alternate mechanism, e.g., by receptor-mediated endocytosis.
  • the vector may be targeted to an internalizing cell-surface protein using an antibody or other binding protein.
  • a vector can be administered to an avian subject in an amount to achieve the amounts stated for gene product (e.g., epitope, antigen, therapeutic, and/or antibody) compositions.
  • gene product e.g., epitope, antigen, therapeutic, and/or antibody
  • the invention envisages dosages below and above those exemplified herein, and for any composition to be administered to an avian subject, including the components thereof, and for any particular method of administration, it is preferred to determine therefor: toxicity, such as by determining the lethal dose (LD) and LD 50 in a suitable avian model; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable response, such as by titrations of sera and analysis thereof, e.g., by ELISA and/or seroneutralization analysis.
  • LD lethal dose
  • compositions of the invention include liquid preparations for orifice, or mucosal, e.g., oral, nasal, anal, vaginal, peroral, intragastric, etc., administration such as suspensions, solutions, sprays, syrups or elixirs; and, preparations for parenteral, epicutaneous, subcutaneous (i.e., through lower neck), intradermal, intraperitoneal, intramuscular (i.e., through wing-web, wing-tip, pectoral, and thigh musculature puncture), intranasal, or intravenous administration (e.g., injectable administration) such as sterile suspensions or emulsions.
  • parenteral epicutaneous, subcutaneous (i.e., through lower neck), intradermal, intraperitoneal, intramuscular (i.e., through wing-web, wing-tip, pectoral, and thigh musculature puncture), intranasal, or intravenous administration (e.g.,
  • administration can occur through the breast (pectoral), leg (upper thigh/lateral flank musculature), wing-web (patagium), under wings (axilla), and wing-tip.
  • the length and diameter (gauge) of the needle used should be such that it will allow delivery of the vaccine to the center of the chosen muscle.
  • a particularly preferred method of administration is in ovo delivery (Gildersleeve, R. P., 1993a; Gildersleeve, R. P. et al, 1993b; Sharma, J. M., 1985; Sharma, J. M. et al, 1984).
  • In ovo delivery is emerging as a promising method for mass immunization of avians as administration of a uniform dose of vaccines by a robotic injector is both labor- and time-saving (Johnston et al., 1997; Oshop et al., 2002).
  • a mechanized injector against Marek's disease (Wakenell et al., 2002).
  • This method is also being used increasingly to administer infectious bursal disease (IBD) and Newcastle disease (ND) vaccines.
  • Immune responses have also been elicited in chickens by in ovo delivery of DNA vaccines (Kapczynski et al., 2003; Oshop et al., 2003) and a replicating alphavirus-vectored vaccine (Schultz-Cherry et al., 2000).
  • DNA and viral vectored in ovo vaccines and immunogenic compositions are less likely to kill or harm the embryo and Ad vectors in particular have a higher compliance rate due to their incompetence to replicate in ovo.
  • INOVOJECT® gently injects compounds, vaccines, and immunogenic compositions in precisely calibrated volumes without causing trauma to the developing embryo, thereby reducing chick handling, improving hatchery manageability through automation, and reducing costs of live production.
  • INOVOJECT® and other mechanized systems, devices, or apparatuses work by gently lowering an injection head onto the top of the egg and a small diameter hollow punch pierces a small opening in the shell. A needle descends through a tube to a controlled depth (usually 2.54 cm), a small, pre-determined volume of vaccine, immunogenic composition, or compound is delivered to the embryo, and then the needle is withdrawn and cleansed in a sterilization wash.
  • the invention contemplates a device or apparatus for in ovo delivery or administration of the recombinant vectors, vaccine or immunogenic compositions described herein.
  • the device or apparatus can optionally comprise the recombinant human adenovirus vectors or immunogenic compositions of the present invention, i.e. can be pre-loaded with the vectors or immunogenic compositions for in ovo administration into an avian.
  • inventive compositions or sequential performance of herein methods, e.g., periodic administration of inventive compositions such as in the course of therapy or treatment for a condition and/or booster administration of immunological compositions and/or in prime-boost regimens; and, the time and manner for sequential administrations can be ascertained without undue experimentation.
  • compositions and methods for making and using vectors including methods for producing gene products and/or immunological products and/or antibodies in vivo and/or in vitro and/or ex vivo (e.g., the latter two being, for instance, after isolation therefrom from cells from a host that has had an administration according to the invention, e.g., after optional expansion of such cells), and uses for such gene and/or immunological products and/or antibodies, including in diagnostics, assays, therapies, treatments, and the like.
  • Vector compositions are formulated by admixing the vector with a suitable carrier or diluent; and, gene product and/or immunological product and/or antibody compositions are likewise formulated by admixing the gene and/or immunological product and/or antibody with a suitable carrier or diluent; see, e.g., U.S. Pat. No. 5,990,091, WO 99/60164, WO 98/00166, documents cited therein, and other documents cited herein, and other teachings herein (for instance, with respect to carriers, diluents and the like).
  • the recombinant vectors may be in admixture with a suitable veterinarily or pharmaceutically acceptable carrier, diluent, or excipient such as sterile water, physiological saline, glucose or the like.
  • a suitable veterinarily or pharmaceutically acceptable carrier such as sterile water, physiological saline, glucose or the like.
  • the compositions can also be lyophilized.
  • the compositions can contain auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
  • DMSO has been known to enhance the potency of vaccine and immunogenic compositions, particularly in regard to in ovo delivery of vectors or immunogenic compositions comprising vectors.
  • DMSO is thought to enhance the potency of vaccines by increasing the permeability of cellular membranes (Oshop et al, 2003).
  • Other agents or additives that are capable of permeabilizing cells, reducing the viscosity of amniotic fluid, and exhibiting a higher compliance rate as compared to DMSO can be used in the formulation of vaccines or immunogenic compositions, especially when administered by in ovo delivery.
  • TDM tetradecyl maltoside
  • TDM Formulations containing 0.125% TDM can cause moderate alterations in cell morphology, while higher concentrations of TDM (i.e., 0.5%) can transiently induce more extensive morphological changes.
  • TDM is believed to enhance vector delivery in an in ovo setting due to the viscous nasal mucus in mammals and amniotic fluid of embryonated avian eggs.
  • the safety profile of TDM as described in Arnold, et al (2004) is also particularly advantageous to promote the health of immunized avians and compliance for entering the food chain.
  • the quantity of vector to be administered will vary for the subject and condition being treated and will vary from one or a few to a few hundred or thousand micrograms of body weight per day and preferably the dose of vaccine or immunogenic composition being chosen preferably between 10 1 -10 6 plaque forming units (PFU), preferably 10 2 -10 5 PFU per bird.
  • vaccines containing the above titer should be diluted with a pharmaceutically or veterinarily acceptable liquid such as physiological saline to a final volume of approximately 0.1 ml or 0.01 ml in the case of wing web administration.
  • the vectors and methods of the present invention permit vaccination in ovo and vaccination of 1-day old-chicks, as well as vaccination of older chicks and adults.
  • a vector can be non-invasively administered to an avian subject in an amount to achieve the amounts stated for gene product (e.g., epitope, antigen, therapeutic, and/or antibody) compositions.
  • gene product e.g., epitope, antigen, therapeutic, and/or antibody
  • the invention envisages dosages below and above those exemplified herein, and for any composition to be administered to an avian subject, including the components thereof, and for any particular method of administration, it is preferred to determine therefor: toxicity, such as by determining the lethal dose (LD) and LD 50 in a suitable avian model; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable response, such as by titrations of sera and analysis thereof, e.g., by ELISA and/or seroneutralization analysis.
  • LD lethal dose
  • Recombinant vectors can be administered in a suitable amount to obtain in vivo expression corresponding to the dosages described herein and/or in herein cited documents. For instance, suitable ranges for viral suspensions can be determined empirically. If more than one gene product is expressed by more than one recombinant, each recombinant can be administered in these amounts; or, each recombinant can be administered such that there is, in combination, a sum of recombinants comprising these amounts.
  • dosages can be as described in documents cited herein or as described herein or as in documents referenced or cited in herein cited documents.
  • the dosage should be a sufficient amount of plasmid to elicit a response analogous to compositions wherein the antigen(s) are directly present; or to have expression analogous to dosages in such compositions; or to have expression analogous to expression obtained in vivo by recombinant compositions.
  • the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable immunological response can be determined by methods such as by antibody titrations of sera, e.g., by ELISA and/or seroneutralization assay analysis. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations can be likewise ascertained with methods ascertainable from this disclosure, and the knowledge in the art, without undue experimentation.
  • the immunogenic or immunological compositions contemplated by the invention can also contain an adjuvant.
  • Suitable adjuvants include fMLP (N-formyl-methionyl-leucyl-phenylalanine; U.S. Pat. No. 6,017,537) and/or acrylic acid or methacrylic acid polymer and/or a copolymer of maleic anhydride and of alkenyl derivative.
  • the acrylic acid or methacrylic acid polymers can be cross-linked, e.g., with polyalkenyl ethers of sugars or of polyalcohols. These compounds are known under the term “carbomer” ( Pharmeuropa, Vol. 8, No. 2, June 1996). A person skilled in the art may also refer to U.S.
  • a polyhydroxylated compound contains not more than 8 hydroxyl groups; in another embodiment, the hydrogen atoms of at least 3 hydroxyls are replaced with unsaturated aliphatic radicals containing at least 2 carbon atoms; in other embodiments, radicals contain from about 2 to about 4 carbon atoms, e.g., vinyls, allyls and other ethylenically unsaturated groups.
  • the unsaturated radicals can themselves contain other substituents, such as methyl.
  • Carbopol® Noveon Inc., Ohio, USA
  • Carbopol® 974P, 934P, and 971P are particularly suitable for use as an adjuvant. They are cross-linked with an allyl sucrose or with allylpentaerythritol, as to which, mention is made of the products Carbopol® 974P, 934P, and 971P.
  • copolymers of maleic anhydride and of alkenyl derivative mention is made of the EMA® products (Monsanto), which are copolymers of maleic anhydride and of ethylene, which may be linear or cross-linked, for example cross-linked with divinyl ether. Also, reference may be made to U.S. Pat. No. 6,713,068 and crizson, W. et al., 1960; incorporated by reference).
  • Cationic lipids containing a quaternary ammonium salt are described in U.S. Pat. No. 6,713,068, the contents of which are incorporated by reference, can also be used in the methods and compositions of the present invention.
  • cationic lipids preference is given to DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propane ammonium; WO96/34109), advantageously associated with a neutral lipid, advantageously DOPE (dioleoyl-phosphatidyl-ethanol amine; Behr J. P., 1994), to form DMRIE-DOPE.
  • a recombinant vaccine or immunogenic or immunological composition can also be formulated in the form of an oil-in-water emulsion.
  • the oil-in-water emulsion can be based, for example, on light liquid paraffin oil (European Pharmacopea type); isoprenoid oil such as squalane, squalene, EICOSANETM or tetratetracontane; oil resulting from the oligomerization of alkene(s), e.g., isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, such as plant oils, ethyl oleate, propylene glycol di(caprylate/caprate), glyceryl tri(caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, e.g., isostearic acid esters.
  • the oil advantageously is used in combination with emulsifiers to form the emulsion.
  • the emulsifiers can be nonionic surfactants, such as esters of sorbitan, mannide (e.g., anhydromannitol oleate), glycerol, polyglycerol, propylene glycol, and oleic, isostearic, ricinoleic, or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, such as the Pluronic® products, e.g., L121.
  • the adjuvant can be a mixture of emulsifier(s), micelle-forming agent, and oil such as that which is available under the name Provax® (IDEC Pharmaceuticals, San Diego, Calif.).
  • the recombinant adenovirus, or recombinant adenoviral vector expressing one or more antigen or immunogen of interest can be preserved and/or conserved and stored either in liquid form, at about 5° C., or in lyophilized or freeze-dried form, in the presence of a stabilizer. Freeze-drying can be according to well-known standard freeze-drying procedures.
  • the pharmaceutically acceptable stabilizers may be SPGA (sucrose phosphate glutamate albumin; Bovarnick, et al., 1950), carbohydrates (e.g., sorbitol, mannitol, lactose, sucrose, glucose, dextran, trehalose), sodium glutamate (Tsvetkov, T. et al., 1983; Israeli, E. et al., 1993), proteins such as peptone, albumin or casein, protein containing agents such as skimmed milk (Mills, C. K. et al., 1988; Wolff, E. et al., 1990), and buffers (e.g., phosphate buffer, alkaline metal phosphate buffer).
  • An adjuvant and/or a vehicle or excipient may be used to make soluble the freeze-dried preparations.
  • influenza virus strain A/Panama/2007/99 (H3N2) (SEQ ID NOs: 1, 2), selected for vaccine production in 2003-2004, was provided by the Centers for Disease Control (CDC).
  • the hemagglutinin (HA) gene was cloned by reverse transcription of the influenza RNA, followed by amplification of the HA gene with polymerase chain reaction (PCR) using the following primers in Table 1.
  • PCR polymerase chain reaction
  • These primers contain sequences that anneal to the 5′ and 3′ ends of the A/Panama/2007/99 HA gene, as well as sequences corresponding to an eukaryotic ribosomal binding site (Kozak, 1986) immediately upstream from the HA initiation ATG codon, and KpnI sites for subsequent cloning.
  • the KpnI fragment containing the full-length HA gene was inserted into the KpnI site of pShuttle-CMV (He et al., 1998) (provided by T. He) in the correct orientation under transcriptional control of the human cytomegalovirus (CMV) early promoter.
  • AdPNM2007/99.H3 An E1/E3-defective Ad5 vector encoding the A/Panama/2007/99 HA (AdPNM2007/99.H3) was generated in human 293 cells using a simplified recombination system as described (Zeng et al., 2001).
  • AdPNM2007/99.H3 vector was validated by sequencing both 5′ and 3′ junctions between the HA insert and vector. HI antibodies against A/Panama/2007/99 were elicited in mice after intranasal administration of AdPNM2007/99.H3.
  • the Ad5 vector may have transduced part of the chicken embryo through binding of its fiber to the coxsackievirus and adenovirus receptor (CAR) found on the surface of chicken cells (Tan et al., 2001).
  • CAR adenovirus receptor
  • An immune response can be elicited in chickens following transduction of only a small number of cells, because Ad is a potent vector capable of protecting the vector DNA by disrupting endosomes after internalization (Curiel, 1994).
  • at least one of the Ad components, the hexon is highly immunogenic and confers adjuvant activity to exogenous antigens (Molinier-Frenkel et al., 2002).
  • the AdPNM2007/99.H3 vector was injected into the amnion of 9-day-old (Group 1) and 18-day-old (Group 2) embryonated chicken eggs, respectively, in a volume of 200 ⁇ l at a dose of 5 ⁇ 10 10 pfu per egg. There were 6 eggs per group; however, only 2 birds hatched in Group 1 and 3 birds in Group 2. Serum HI titers were determined as described (Van Kampen et al., 2005) 2 weeks post-hatch. In Group 3, the AdPNM2007/99.H3 vector was injected intramuscularly into three 4-week-old chickens in a volume of 100 ⁇ l at a dose of 2.5 ⁇ 10 10 pfu per animal. HI titers were determined two weeks post-immunization.
  • FIG. 1 shows the HI titers on log 2 scale. The squares correspond to HI titers in individual birds in Group 1; while the triangles correlate to HI titers in individual birds in Group 2. The circles correspond to HI titers in individual birds in Group 3.
  • AdTW68.H5 Construction of an Ad Vector Encoding the A/Turkey/Wisconsin/68H Gene
  • the DNA template of the A/Turkey/WI/68 H (SEQ ID NOs: 3, 4) encoding the H of the AI virus strain, was provided by USDA Southeast Poultry Research Laboratory, Athens Ga., and was PCR amplified using the primers shown in Table 2.
  • Table 2 TABLE 2 Primers Used in Construction of Ad vectors Primer Sequence 5′ HA 5′CACACAAAGCTTGCCGCCATGGAAAGAATAGTGATTGC3′ (SEQ ID NO: 10) 3′ HA 5′CACACAGGATCCATCTGAACTCACAATCCTAGATGC3′ (SEQ ID NO: 11)
  • primers contain sequences that anneal to the 5′ and 3′ ends of the A/Turkey/Wisconsin/68H gene, an eukaryotic ribosomal binding site (Kozak, 1986) immediately upstream from the H initiation ATG codon, and unique restriction sites for subsequent cloning.
  • the fragment containing the full-length H gene was inserted into the HindIII-BamHI site of the shuttle plasmid pAdApt (provided by Crucell, Leiden, The Netherlands) in the correct orientation under transcriptional control of the human cytomegalovirus (CMV) early promoter.
  • CMV human cytomegalovirus
  • AdTW68.H5 An RCA-free, E1/E3-defective Ad vector encoding the A/Turkey/Wisconsin/68H gene (AdTW68.H5) was subsequently generated in human PER.C6 cells (provided by Crucell) by co-transfection of pAdApt-TW68.H5 with the Ad5 backbone plasmid pAdEasy1 (He et al., 1998) as described (Shi et al., 2001). The AdTW68.H5 vector was validated by sequencing both 5′ and 3′ junctions between the H insert and the vector backbone.
  • Ad-vectored in ovo AI vaccines may be produced rapidly and mass-administered into chicken populations within the context of a superb safety profile in response to an emerging AI pandemic.
  • Large-scale production of RCA-free Ad5 vectors in the well-characterized PER.C6 cell line in serum-free suspension bioreactors (Lewis, 2006) in conjunction with chromatography-mediated purification (Konz, 2005) and buffers that do not require freezers for long-term storage (Evans, 2004) should greatly reduce the production costs of Ad5 vectors.
  • the use of cultured cells instead of embryonated eggs as a substrate for AI vaccine production is significant, particularly during an AI outbreak when fertile eggs may be in short supply.
  • Ad5-vectored AI vaccine is in compliance with a DIVA strategy because the vector only encodes the viral HA.
  • analysis of serum HI antibodies together with measurement of anti-AI nucleoprotein by enzyme-linked immunosorbent assay would allow rapid determination of exposure to the AI vaccine or virus.
  • an aerosol AI vaccine may be developed by expressing HA from a Newcastle disease virus vector (Swayne, 2003) or a reassortant influenza virus containing a non-pathogenic influenza virus backbone (Lee, 2004), the RCA-free Ad5-vectored in ovo AI vaccine provides a unique platform capable of arresting HPAI virus infections in immunized birds through automated delivery of a uniform dose of non-replicating AI vaccine that is compatible with a DIVA strategy. Unlike replicating recombinant vectors that are associated with the risk of generating revertants and allow spread of genetically modified organisms in both target and non-target species in the environment, the RCA-free Ad5 vectors will not propagate in the field.
  • AI strain A/Turkey/WI/68 was passaged in SPF embryonated chicken eggs to achieve a titer of 10 6 embryo infective doses 50%/ml. Amnioallantoic fluids were tested for hemagglutinating activity. Antibody titers in individual serum samples were determined by hemagglutination inhibition using 4 hemagglutinating units of the AI virus as described (Swayne et al., 1998, Thayer et al., 1998).
  • RNA samples from individual birds were suspended in 1.0 ml of brain heart infusion medium (Difco, Detroit, Mich.) and stored at ⁇ 70° C.
  • RNA was extracted by using the RNeasy mini kit (Qiagen). Quantitative real-time RT-PCR was performed with primers specific for type A influenza virus matrix RNA, as described previously (Spackman, 2002). Viral RNA was interpolated from the cycle thresholds by using standard curves generated from known amounts of control A/Ck/Queretaro/14588-19/95 RNA (10 1.0 to 10 6.0 EID 50 /mL).
  • Immunization of chickens by inoculation was accomplished by administering 300 ⁇ of the AdTW68.H5 containing 10 11 viral particles/ml (vp/ml) into SPF embryonated eggs on days 10 or 18 of embryonation. Hatched chicks of each group were equally divided into two groups: half of the chickens were revaccinated via the nasal route with the same dose of AdTW68.H5 at day 15 post-hatch, and the remaining chickens did not receive a booster application post-hatch.
  • the HI antibody titers detected in sera obtained at day 28 post-hatch from these bird groups are shown in FIG. 2 .
  • Chicks vaccinated in ovo on day 10 of embryonation showed HI titers varying between 2 and 7 log 2 (mean of 4.2); chickens vaccinated at day 10 of embryonation with post-hatch booster application showed HI titers varying between 2 and 9 log 2 (mean of 5.5); chicks vaccinated at day 18 of embryonation showed titers varying between 2 and 9 log 2 (mean of 5.5); and chickens vaccinated at day 18 of embryonation and boosted at day 15 post-hatch showed HI values between 2 and 8 log 2 (mean of 5.7).
  • Chicks inoculated only in ovo achieved titers between 5 and 9 log 2 at day 23 post-hatch ( FIG. 3 ). Those chickens either maintained or increased their antibody titers by day 29 post-hatch. In ovo vaccination in conjunction with intranasal booster showed antibody titers varying between 3 and 9 log 2 by day 23 post-hatch ( FIG. 3 ). Similarly as in the previous group, most chicks had increased their titers by 1 or 2 log 2 steps by day 29 post-hatch.
  • Viral genomes of the A/Chicken/Queretaro/19/95 in challenged birds were quantitatively determined by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) in oropharyngeal swabs collected 2, 4, and 7 days post-challenge. There was a significant difference (P ⁇ 0.05) in the concentration of AI viral genomes between vaccinated and unvaccinated chickens 7 days after challenge ( FIG. 5 ). Absence of detectable viral RNA in immunized birds provides evidence that in ovo vaccination elicited an immune response capable of controlling AI virus shedding within a week.
  • RT-PCR real-time reverse transcriptase-polymerase chain reaction
  • AdTW68.H5-vectored AI vaccine can confer protection against a recent H5N1 HPAI virus strain
  • 31 chickens were vaccinated in ovo with the AdTW68.H5 vector at a dose of 2 ⁇ 10 8 ifu.
  • Control groups included 10 chickens vaccinated with an Ad5 vector (AdCMV-tetC) encoding an irrelevant antigen (tetanus toxin C-fragment) (Shi et al., 2001) and 10 chickens which were not exposed to Ad5 vectors.
  • control and immunized chickens were challenged with the H5N1 AI virus A/Swan/Mongolia/244L/2005 (the HA of this challenge strain has 89% deduced HA amino acid sequence similarity with the HA of the A/Turkey/Wisconsin/68 strain).
  • the HA of this challenge strain has 89% deduced HA amino acid sequence similarity with the HA of the A/Turkey/Wisconsin/68 strain.
  • FIG. 6 in ovo immunization induced antibodies within a range of 1 and 6 log 2 on D25.
  • a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest.
  • adenoviral DNA sequence is derived from adenovirus serotype 5 (Ad5).
  • adenoviral DNA sequence is selected from the group consisting of replication-defective adenovirus, non-replicating adenovirus, replication-competent adenovirus, or wild-type adenovirus.
  • the promoter sequence is selected from the group consisting of viral promoters, avian promoters, CMV promoter, SV40 promoter, ⁇ -actin promoter, albumin promoter, Elongation Factor 1- ⁇ (EF1- ⁇ ) promoter, P ⁇ K promoter, MFG promoter, or Rous sarcoma virus promoter.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus
  • An immunogenic composition or vaccine for in vivo delivery into an avian subject comprising a veterinarily acceptable vehicle or excipient and a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest.
  • adenoviral DNA sequence is derived from adenovirus serotype 5 (Ad5).
  • adenoviral DNA sequence is selected from the group consisting of replication-defective adenovirus, non-replicating adenovirus, replication-competent adenovirus, or wild-type adenovirus.
  • the promoter sequence is selected from the group consisting of viral promoters, avian promoters, CMV promoter, SV40 promoter, ⁇ -actin promoter, albumin promoter, Elongation Factor 1- ⁇ (EF1- ⁇ ) promoter, P ⁇ K promoter, MFG promoter, or Rous sarcoma virus promoter.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian par
  • the immunogenic composition or vaccine of paragraph 16 wherein the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • composition or vaccine of paragraph 10 further comprising an adjuvant.
  • composition or vaccine of paragraph 10 further comprising an additional vaccine.
  • a method of introducing and expressing one or more avian antigens or immunogens in a cell comprising contacting the cell with a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest, and culturing the cell under conditions sufficient to express the one or more avian antigens or immunogens in the cell.
  • the one or more avian antigens or immunogens of interest are derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rota
  • a method of introducing and expressing one or more avian influenza antigens or immunogens in an avian embryo comprising contacting the avian embryo with a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest, thereby obtaining expression of the one or more avian influenza antigens or immunogens in the avian embryo.
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • a method of eliciting an immunogenic response in an avian subject comprising administering an immunologically effective amount of the composition of any one of paragraphs 10-20 to the avian subject.
  • a method of eliciting an immunogenic response to avian influenza in an avian subject comprising administering an immunologically effective amount of the composition of any one of paragraphs 10-20 to the avian subject.
  • a method of eliciting an immunogenic response in an avian subject comprising infecting the avian subject with an immunologically effective amount of an immunogenic composition comprising a recombinant human adenovirus expression vector that comprises and expresses an adenoviral DNA sequence, and a promoter sequence operably linked to a foreign sequence encoding one or more avian antigens or immunogens of interest, wherein the one or more avian antigens or immunogens of interest are expressed at a level sufficient to elicit an immunogenic response to the one or more avian antigens or immunogens of interest in the avian subject.
  • the one or more avian antigens or immunogens of interest are derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rot
  • the foreign sequence encoding the one or more avian antigens or immunogens of interest is selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • a method for inoculation of an avian subject comprising in ovo administration of a recombinant human adenovirus containing and expressing an heterologous nucleic acid molecule encoding an antigen of a pathogen of the avian subject.
  • the human adenovirus comprises sequences derived from replication-defective adenovirus, non-replicating adenovirus, replication-competent adenovirus, or wild-type adenovirus.
  • the antigen of a pathogen of the avian is derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian rotavirus,
  • avian influenza antigens or immunogens are selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • avian influenza antigens or immunogens are selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • An in ovo administration apparatus for delivery of an immunogenic composition to an avian embryo wherein the apparatus contains a recombinant human adenovirus expression vector expressing one or more avian antigens or immunogens of interest, wherein the apparatus delivers to the recombinant human adenovirus to the avian embryo.
  • the human adenovirus expression vector comprises sequences derived from replication-defective adenovirus, non-replicating human adenovirus, replication-competent adenovirus, or wild-type adenovirus.
  • the one or more avian antigens or immunogens of interest are derived from avian influenza virus, infectious bursal disease virus, Marek's disease virus, avian herpesvirus, infectious laryngotracheitis virus, avian infectious bronchitis virus, avian reovirus, avipox, fowlpox, canarypox, pigeonpox, quailpox, and dovepox, avian polyomavirus, Newcastle Disease virus, avian pneumovirus, avian rhinotracheitis virus, avian reticuloendotheliosis virus, avian retroviruses, avian endogenous virus, avian erythroblastosis virus, avian hepatitis virus, avian anemia virus, avian enteritis virus, Pacheco's disease virus, avian leukemia virus, avian parvovirus, avian
  • avian influenza antigens or immunogens are selected from the group consisting of hemagglutinin, nucleoprotein, matrix, or neuraminidase.
  • avian influenza antigens or immunogens of interest is selected from the group consisting of hemagglutinin subtype 3, 5, 7, or 9.
  • a method of immunizing an avian host comprising inoculation of a non-replicating expression vector that encodes one or more pathogen-derived antigens.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Pulmonology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
US11/504,152 2005-08-15 2006-08-15 Immunization of avians by administration of non-replicating vectored vaccines Abandoned US20070178115A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US11/504,152 US20070178115A1 (en) 2005-08-15 2006-08-15 Immunization of avians by administration of non-replicating vectored vaccines
US14/020,024 US9855328B2 (en) 2005-08-15 2013-09-06 Immunization of avians by administration of non-replicating vectored vaccines
US15/824,230 US10744195B2 (en) 2005-08-15 2017-11-28 Immunization of avians by administration of non-replicating vectored vaccines
US16/926,428 US20200338188A1 (en) 2005-08-15 2020-07-10 Immunizations of avians by administration of non-replicating vectored vaccines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US70852405P 2005-08-15 2005-08-15
US11/504,152 US20070178115A1 (en) 2005-08-15 2006-08-15 Immunization of avians by administration of non-replicating vectored vaccines

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/020,024 Continuation US9855328B2 (en) 2005-08-15 2013-09-06 Immunization of avians by administration of non-replicating vectored vaccines

Publications (1)

Publication Number Publication Date
US20070178115A1 true US20070178115A1 (en) 2007-08-02

Family

ID=37758299

Family Applications (4)

Application Number Title Priority Date Filing Date
US11/504,152 Abandoned US20070178115A1 (en) 2005-08-15 2006-08-15 Immunization of avians by administration of non-replicating vectored vaccines
US14/020,024 Active US9855328B2 (en) 2005-08-15 2013-09-06 Immunization of avians by administration of non-replicating vectored vaccines
US15/824,230 Active US10744195B2 (en) 2005-08-15 2017-11-28 Immunization of avians by administration of non-replicating vectored vaccines
US16/926,428 Abandoned US20200338188A1 (en) 2005-08-15 2020-07-10 Immunizations of avians by administration of non-replicating vectored vaccines

Family Applications After (3)

Application Number Title Priority Date Filing Date
US14/020,024 Active US9855328B2 (en) 2005-08-15 2013-09-06 Immunization of avians by administration of non-replicating vectored vaccines
US15/824,230 Active US10744195B2 (en) 2005-08-15 2017-11-28 Immunization of avians by administration of non-replicating vectored vaccines
US16/926,428 Abandoned US20200338188A1 (en) 2005-08-15 2020-07-10 Immunizations of avians by administration of non-replicating vectored vaccines

Country Status (9)

Country Link
US (4) US20070178115A1 (de)
EP (1) EP1924282B1 (de)
JP (1) JP2009512421A (de)
KR (1) KR101345936B1 (de)
CN (1) CN101365484A (de)
AU (1) AU2006279612B2 (de)
CA (1) CA2619174C (de)
ES (1) ES2620789T3 (de)
WO (1) WO2007022151A2 (de)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100105110A1 (en) * 2008-10-28 2010-04-29 Xavier Danthinne Method of Adenoviral Vector Synthesis
WO2010085611A3 (en) * 2009-01-22 2010-11-25 University Of Georgia Research Foundation, Inc. Mycoplasma gallisepticum formulation
US20110110975A1 (en) * 2009-11-06 2011-05-12 Streck, Inc. Inactivated virus compositions and methods of preparing such compositions
US20110110965A1 (en) * 2009-08-26 2011-05-12 Selecta Biosciences, Inc. Compositions that induce t cell help
US20110165224A1 (en) * 2009-12-15 2011-07-07 University Of Saskatchewan Vaccines for inclusion body hepatitis
US20110195091A1 (en) * 2008-08-18 2011-08-11 The Kitasato Institute Avian Influenza Virus Antigen, and Booster Immunization Method for Avian Influenza Vaccine in Combination with Mucosal Adjuvant Which is Effective Through Oral Administration
US20110207202A1 (en) * 2008-11-03 2011-08-25 Crucell Holland Bv Method for the production of adenoviral vectors
WO2012024629A1 (en) * 2010-08-20 2012-02-23 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising proteins obtained or derived from human influenza a virus hemagglutinin
US20130230556A1 (en) * 2010-10-18 2013-09-05 Paulus Jacobus Antonius Sondermeijer Herpesvirus of turkeys vectored vaccine against avian influenza in poultry
WO2015013178A1 (en) * 2013-07-23 2015-01-29 University Of Maryland Infectious laryngotracheitis virus (iltv) vaccine using recombinant newcastle disease virus vector
US20150071964A1 (en) * 2013-09-06 2015-03-12 Vaxin Inc. Methods and compositions for viral vectored vaccines
US9956281B2 (en) 2011-05-04 2018-05-01 Streck, Inc. Inactivated virus compositions and methods of preparing such compositions
KR20190093171A (ko) * 2018-01-31 2019-08-08 서울대학교산학협력단 CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법
US20190343950A1 (en) * 2016-07-11 2019-11-14 The Board Of Trustees Of The University Of Arkansas Poutlry Probiotic Vaccine Compositions and Methods of Use Thereof
CN112996536A (zh) * 2018-10-31 2021-06-18 勃林格殷格翰动物保健有限公司 具有异源刺突蛋白的h52 ibv疫苗
US11541111B2 (en) * 2016-01-07 2023-01-03 Gavish-Galilee Bio Applications, Ltd. Optimized polypeptide for a subunit vaccine against avian reovirus

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009512421A (ja) * 2005-08-15 2009-03-26 ヴァクシン インコーポレイテッド 非複製性ベクターワクチン投与による鳥類への免疫方法
US8050871B2 (en) 2006-10-24 2011-11-01 Samuel Bogoch Method of predicting influenza outbreaks by correlating an increase in replikin count in shrimp white spot syndrome virus and/or taura syndrome virus
US20080241188A1 (en) 2007-03-30 2008-10-02 Zeon Corporation Turkey herpesvirus vectored recombinant containing avian influenza genes
JP5675348B2 (ja) 2007-05-30 2015-02-25 ボゴーク，サミュエル 水産養殖における無脊椎動物の病原性感染に対する合成レプリキンペプチド
CA2720465A1 (en) * 2008-04-23 2009-10-29 Samuel Bogoch Methods and compounds for mitigating pathogenic outbreaks using replikin count cycles
KR20110081222A (ko) * 2008-09-26 2011-07-13 어번 유니버시티 비복제성 벡터화된 백신의 점막 투여에 의한 조류의 면역화
US9233148B2 (en) 2009-01-09 2016-01-12 Samuel Bogoch Replikin-based compounds for prevention and treatment of influenza and methods of differentiating infectivity and lethality in influenza
CN101519664B (zh) * 2009-04-03 2012-05-09 西北农林科技大学 一种重组腺病毒载体制备转基因动物的方法
SG175275A1 (en) * 2009-04-23 2011-11-28 Samuel Bogoch Replikin-sequences for preventing/treating influenza and determining infectivity/lethality
US10183069B2 (en) 2011-03-21 2019-01-22 Altimmune Inc. Rapid and prolonged immunologic-therapeutic
WO2013013075A2 (en) 2011-07-20 2013-01-24 Samuel Bogoch Peptides shared among lethal cancers and therapeutic compositions comprising said peptides
CN105944096A (zh) * 2016-05-06 2016-09-21 安徽九川生物科技有限公司 一种鸡疫苗用免疫增强剂
CN106754760A (zh) * 2017-01-20 2017-05-31 华南农业大学 一种嵌合ibdv中和表位的重组人3型腺病毒的制备方法和应用
CN109806390A (zh) * 2019-01-07 2019-05-28 康希诺生物股份公司 一种SamRNA疫苗及其制备方法
CN113045670B (zh) * 2019-12-27 2022-11-01 华南农业大学 一种可溶性鸡α干扰素融合蛋白及其生产方法与应用
CN113897389A (zh) * 2020-07-06 2022-01-07 嘉兴安宇生物科技有限公司 一种复制缺陷型Ad29腺病毒载体及其构建方法和应用
EP4192519A2 (de) * 2020-08-06 2023-06-14 Regents of the University of Minnesota Multivalente impfstoffe gegen truthahn-arthritis-reovirus
CN113462659B (zh) * 2021-06-25 2023-10-20 宁夏大学 一种重组病毒及其应用
CN115656519B (zh) * 2022-10-25 2024-05-10 江苏乐聚医药科技有限公司 一种可降低非特异性影响流感疫苗血清效价的评价方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6716823B1 (en) * 1997-08-13 2004-04-06 The Uab Research Foundation Noninvasive genetic immunization, expression products therefrom, and uses thereof
WO2006127956A2 (en) * 2005-05-23 2006-11-30 Vaxin, Inc. Rapid production of adenovirus-free recombinant adenovirus vectors
US20080187557A1 (en) * 2005-04-11 2008-08-07 Suryaprakash Sambhara Vaccine Against Pandemic Strains Of Influenza Viruses

Family Cites Families (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2909462A (en) 1955-12-08 1959-10-20 Bristol Myers Co Acrylic acid polymer laxative compositions
JPS5913887B2 (ja) 1979-10-30 1984-04-02 株式会社ブリヂストン 溶融金属用濾過材
US4458630A (en) 1982-06-22 1984-07-10 The United States Of America As Represented By The Secretary Of Agriculture Disease control in avian species by embryonal vaccination
US4903635A (en) 1986-07-02 1990-02-27 Embrex, Inc. High speed automated injection system for avian embryos
US4681063A (en) 1986-07-02 1987-07-21 Embrex Inc. High speed automated injection system for avian embryos
WO1990002802A2 (en) 1988-09-13 1990-03-22 Institute For Animal Health Limited Viral nucleotide sequences
AT395893B (de) 1990-01-10 1993-03-25 Mayreder Kraus & Co Ing Befestigungsvorrichtung zum verbinden von bauteilen
US5056464A (en) 1990-01-18 1991-10-15 Embrex, Inc. Automated injection system for avian embryos with advanced fluid delivery system
US5136979A (en) 1991-09-25 1992-08-11 Embrex, Inc. Modular injection system for avian embryos
BR9305795A (pt) 1992-01-27 1997-02-18 Univ North Carolina State Transferéncia de genes em aves por introdução de dna em musculo in ovo
US5339766A (en) 1993-11-03 1994-08-23 Embrex, Inc. Method of introducing material into eggs during early embryonic development
US5438954A (en) 1993-11-03 1995-08-08 Embrex, Inc. Method and apparatus for early embryonic in ovo injection
EP0826063A1 (de) 1995-04-25 1998-03-04 Vical Incorporated Einzelfläschehene formulierungen von dna (lipid-komplexen)
JPH10510433A (ja) 1995-06-06 1998-10-13 アイシス・ファーマシューティカルス・インコーポレーテッド 高いキラル純度のホスホロチオエート結合を有するオリゴヌクレオチド
EP0748867A1 (de) 1995-06-12 1996-12-18 Duphar International Research B.V Marek-Krankheit Vakzine
US5985662A (en) 1995-07-13 1999-11-16 Isis Pharmaceuticals Inc. Antisense inhibition of hepatitis B virus replication
US5827738A (en) 1995-10-27 1998-10-27 Board Of Trustees Operating Michigan State University Sustainable chick cell line infected with Marek's disease virus
FR2749021B1 (fr) 1996-05-23 2001-10-26 Agronomique Inst Nat Rech Lignees de cellules aviaires immortalisees
FR2749022B1 (fr) 1996-05-23 2001-06-01 Rhone Merieux Cellules aviaires immortelles
WO1998000166A1 (en) 1996-07-03 1998-01-08 Merial, Inc. Recombinant canine adenovirus (cav) containing exogenous dna
US5699751A (en) 1996-10-02 1997-12-23 Embrex, Inc. Method and apparatus for in ovo injection
US6240877B1 (en) 1997-01-27 2001-06-05 Edward G. Bounds Egg injection apparatus and method
US5990091A (en) 1997-03-12 1999-11-23 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
AU737717B2 (en) 1997-08-13 2001-08-30 Uab Research Foundation, The Vaccination by topical application of genetic vectors
US6348450B1 (en) 1997-08-13 2002-02-19 The Uab Research Foundation Noninvasive genetic immunization, expression products therefrom and uses thereof
US6706693B1 (en) 1997-08-13 2004-03-16 The Uab Research Foundation Vaccination by topical application of genetic vectors
UY25347A1 (es) 1998-01-12 1999-05-14 Embrex Inc Procedimiento de inyeccion multiple para el tratamiento de embriones aviarios in ovo, y aparato automatizado para la inyeccion in ovo.
US6286455B1 (en) 1998-01-12 2001-09-11 Embrex, Inc. Automated in ovo injection apparatus
FR2775601B1 (fr) 1998-03-03 2001-09-21 Merial Sas Vaccins vivants recombines et adjuves
US6506385B1 (en) 1998-04-17 2003-01-14 Embrex, Inc. Live vaccines and methods of treatment therewith
EP1082463B1 (de) 1998-05-15 2007-01-03 Quark Biotech, Inc. Durch mechanischen stress induzierte gene, deren expressionsprodukte und deren verwendung.
US6017537A (en) 1998-12-18 2000-01-25 Connaught Laboratories, Inc. Formyl methionyl peptide vaccine adjuvant
US6244214B1 (en) 1999-01-06 2001-06-12 Embrex, Inc. Concurrent in ovo injection and detection method and apparatus
US20040009936A1 (en) * 1999-05-03 2004-01-15 Tang De-Chu C. Vaccine and drug delivery by topical application of vectors and vector extracts
CA2371766A1 (en) * 1999-05-03 2000-11-09 The Uab Research Foundation Noninvasive genetic immunization, expression products therefrom, and uses thereof
WO2001019968A1 (en) * 1999-09-17 2001-03-22 Chemogen Inc Recombinant eggs and gene cloning and expression vectors based on avian adenoviruses
US6601534B2 (en) 2002-01-09 2003-08-05 Embrex, Inc. Methods and apparatus for punching through egg shells with reduced force
US6668753B2 (en) 2002-02-13 2003-12-30 Embrex, Inc. Methods and apparatus for delivering fluid to egg injection devices
US7471402B2 (en) 2003-03-28 2008-12-30 Panasonic Corporation Printing apparatus and printing method
WO2006063101A2 (en) * 2004-12-09 2006-06-15 University Of Pittsburgh Of The Commonwealth System Of Higher Education Vaccines for the rapid response to pandemic avian influenza
JP2009512421A (ja) * 2005-08-15 2009-03-26 ヴァクシン インコーポレイテッド 非複製性ベクターワクチン投与による鳥類への免疫方法
WO2020053940A1 (ja) 2018-09-10 2020-03-19 株式会社Ｎｔｔドコモ ユーザ端末

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6716823B1 (en) * 1997-08-13 2004-04-06 The Uab Research Foundation Noninvasive genetic immunization, expression products therefrom, and uses thereof
US20080187557A1 (en) * 2005-04-11 2008-08-07 Suryaprakash Sambhara Vaccine Against Pandemic Strains Of Influenza Viruses
WO2006127956A2 (en) * 2005-05-23 2006-11-30 Vaxin, Inc. Rapid production of adenovirus-free recombinant adenovirus vectors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
He et al. (1998) PNAS, Vol. 95, 2509-2514. *

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110195091A1 (en) * 2008-08-18 2011-08-11 The Kitasato Institute Avian Influenza Virus Antigen, and Booster Immunization Method for Avian Influenza Vaccine in Combination with Mucosal Adjuvant Which is Effective Through Oral Administration
WO2010050997A1 (en) * 2008-10-28 2010-05-06 Od260, Inc. Method for adenoviral vector synthesis
US8709778B2 (en) 2008-10-28 2014-04-29 Xavier Danthinne Method of adenoviral vector synthesis
US20100105110A1 (en) * 2008-10-28 2010-04-29 Xavier Danthinne Method of Adenoviral Vector Synthesis
US20110207202A1 (en) * 2008-11-03 2011-08-25 Crucell Holland Bv Method for the production of adenoviral vectors
US10041049B2 (en) 2008-11-03 2018-08-07 Janssen Vaccines & Prevention B.V. Method for the production of adenoviral vectors
WO2010085611A3 (en) * 2009-01-22 2010-11-25 University Of Georgia Research Foundation, Inc. Mycoplasma gallisepticum formulation
KR20110123748A (ko) * 2009-01-22 2011-11-15 유니버시티 오브 죠지아 리서치 파운데이션, 인코포레이티드 미코플라스마 갈리셉티쿰 제형
CN102292432B (zh) * 2009-01-22 2013-05-22 乔治亚大学研究基金公司 鸡败血支原体制剂
US8668912B2 (en) 2009-01-22 2014-03-11 University Of Georgia Research Foundation, Inc. Mycoplasma gallisepticum formulation
KR101715159B1 (ko) 2009-01-22 2017-03-10 유니버시티 오브 죠지아 리서치 파운데이션, 인코포레이티드 미코플라스마 갈리셉티쿰 제형
US20110110965A1 (en) * 2009-08-26 2011-05-12 Selecta Biosciences, Inc. Compositions that induce t cell help
US20110110975A1 (en) * 2009-11-06 2011-05-12 Streck, Inc. Inactivated virus compositions and methods of preparing such compositions
US8524249B2 (en) 2009-12-15 2013-09-03 University Of Saskatchewan Vaccines for inclusion body hepatitis
US20110165224A1 (en) * 2009-12-15 2011-07-07 University Of Saskatchewan Vaccines for inclusion body hepatitis
US9333253B2 (en) 2009-12-15 2016-05-10 University Of Saskatchewan Vaccines for inclusion body hepatitis
WO2012024629A1 (en) * 2010-08-20 2012-02-23 Selecta Biosciences, Inc. Synthetic nanocarrier vaccines comprising proteins obtained or derived from human influenza a virus hemagglutinin
US20130230556A1 (en) * 2010-10-18 2013-09-05 Paulus Jacobus Antonius Sondermeijer Herpesvirus of turkeys vectored vaccine against avian influenza in poultry
US8986987B2 (en) * 2010-10-18 2015-03-24 Intervet Inc. Herpesvirus of turkeys vectored vaccine against avian influenza in poultry
US9956281B2 (en) 2011-05-04 2018-05-01 Streck, Inc. Inactivated virus compositions and methods of preparing such compositions
WO2015013178A1 (en) * 2013-07-23 2015-01-29 University Of Maryland Infectious laryngotracheitis virus (iltv) vaccine using recombinant newcastle disease virus vector
US20150071964A1 (en) * 2013-09-06 2015-03-12 Vaxin Inc. Methods and compositions for viral vectored vaccines
US11541111B2 (en) * 2016-01-07 2023-01-03 Gavish-Galilee Bio Applications, Ltd. Optimized polypeptide for a subunit vaccine against avian reovirus
US20190343950A1 (en) * 2016-07-11 2019-11-14 The Board Of Trustees Of The University Of Arkansas Poutlry Probiotic Vaccine Compositions and Methods of Use Thereof
US10786565B2 (en) * 2016-07-11 2020-09-29 The Board Of Trustees Of The University Of Arkansas Poultry probiotic vaccine compositions and methods of use thereof
KR20190093171A (ko) * 2018-01-31 2019-08-08 서울대학교산학협력단 CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법
KR102136132B1 (ko) 2018-01-31 2020-07-22 서울대학교 산학협력단 CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법
CN112996536A (zh) * 2018-10-31 2021-06-18 勃林格殷格翰动物保健有限公司 具有异源刺突蛋白的h52 ibv疫苗

Also Published As

Publication number Publication date
KR101345936B1 (ko) 2013-12-31
WO2007022151A3 (en) 2007-11-29
US20200338188A1 (en) 2020-10-29
AU2006279612A1 (en) 2007-02-22
EP1924282A4 (de) 2009-08-19
US9855328B2 (en) 2018-01-02
KR20080093405A (ko) 2008-10-21
US20180133306A1 (en) 2018-05-17
EP1924282B1 (de) 2017-01-11
US20140037679A1 (en) 2014-02-06
US10744195B2 (en) 2020-08-18
ES2620789T3 (es) 2017-06-29
WO2007022151A2 (en) 2007-02-22
JP2009512421A (ja) 2009-03-26
CA2619174A1 (en) 2007-02-22
CN101365484A (zh) 2009-02-11
CA2619174C (en) 2016-12-20
AU2006279612B2 (en) 2013-03-21
EP1924282A2 (de) 2008-05-28

Similar Documents

Publication Publication Date Title
US20200338188A1 (en) Immunizations of avians by administration of non-replicating vectored vaccines
US20110268762A1 (en) Immunization of avians by mucosal administration of non-replicating vectored vaccines
Li et al. Recombinant herpesvirus of turkeys as a vector-based vaccine against highly pathogenic H7N1 avian influenza and Marek's disease
JP6505593B2 (ja) 多価組換型鳥ヘルペスウイルス及び鳥類を免疫化するためのワクチン
Rahn et al. Vaccines against influenza A viruses in poultry and swine: Status and future developments
Lüschow et al. Protection of chickens from lethal avian influenza A virus infection by live-virus vaccination with infectious laryngotracheitis virus recombinants expressing the hemagglutinin (H5) gene
JP5508252B2 (ja) 鳥インフルエンザ遺伝子を含有する組み換え七面鳥ヘルペスウイルス
EP2629794B1 (de) Durch den truthahn-herpesvirus vektorisierter impfstoff gegen vogelgrippe bei geflügel
Romanutti et al. Current status of virus-vectored vaccines against pathogens that affect poultry
WO2010044921A2 (en) Intranasal administration of receptor-binding ligands or genes encoding such ligands as a therapeutic regimen for mitigating infections caused by respiratory pathogens
US10758608B2 (en) Vaccine in the form of a recombinant sero type 9 avian adenovirus vector
JP6990814B2 (ja) アヒル腸炎ウイルス及びその使用
Fingerut et al. A subunit vaccine against the adenovirus egg-drop syndrome using part of its fiber protein
JP6802813B2 (ja) アヒル腸炎ウイルス及びその使用
Toro et al. Avian influenza mucosal vaccination in chickens with replication-defective recombinant adenovirus vaccine
Toro et al. Protection of chickens against avian influenza with nonreplicating adenovirus-vectored vaccine
CN114828882A (zh) 多价hvt载体疫苗

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: VAXIN INC., MARYLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:VAN KAMPEN, KENT R.;REEL/FRAME:032475/0796

Effective date: 20140310

AS Assignment

Owner name: ALTIMMUNE INC, MARYLAND

Free format text: CHANGE OF NAME;ASSIGNOR:VAXIN INC;REEL/FRAME:036527/0502

Effective date: 20150824