US20060165716A1 - Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae - Google Patents

Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae

Info

Publication number
US20060165716A1
US20060165716A1 US11/192,046 US19204605A US2006165716A1 US 20060165716 A1 US20060165716 A1 US 20060165716A1 US 19204605 A US19204605 A US 19204605A US 2006165716 A1 US2006165716 A1 US 2006165716A1
Authority
US
United States
Prior art keywords
gbs
gas
proteins
strain
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/192,046
Other languages
English (en)
Inventor
John Telford
Guido Grandi
Peter Lauer
Marirosa Mora
Immaculada Y Ros
Domenico Maione
Guiliano Bensi
Daniela Rinaudo
Vega Masignani
Michelle Barocchi
Rino Rappuoli
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US11/192,046 priority Critical patent/US20060165716A1/en
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MASIGNANI, VEGA, MORA, MARIROSA, RAPPUOLI, RINO, TELFORD, JOHN L., Y ROS, IMMACULADA MARGARIT, MAIONE, DOMINICO, GRANDI, GUIDO, BENSI, GIULIANO, RINAUDO, CIRA DANIELA, LAUER, PETER
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION RE-RECORD TO CORRECT SEVERAL ASSIGNORS NAMES ON A DOCUMENT PREVIOUSLY RECORDED AT REEL 017376, FRAME 0716. (ASSIGNMENT OF ASSIGNOR'S INTEREST) Assignors: BAROCCHI, MICHELLE, DOMENICO, MAIONE, IMMACULADA, MARGARIT Y ROS, MORA, MARIROSA, RAPPUOLI, RINO, TELFORD, JOHN L., BENSI, GIULIANO, GRANDI, GUIDO, MASIGNANI, VEGA, RINAUDO, CIRA DANIELA, LAUER, PETER
Publication of US20060165716A1 publication Critical patent/US20060165716A1/en
Assigned to NOVARTIS VACCINES AND DIAGNOSTICS, INC. reassignment NOVARTIS VACCINES AND DIAGNOSTICS, INC. MERGER (SEE DOCUMENT FOR DETAILS). Assignors: CHIRON CORPORATION
Priority to US12/906,510 priority patent/US8778358B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/09Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
    • A61K39/092Streptococcus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/0208Specific bacteria not otherwise provided for
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/05Actinobacteria, e.g. Actinomyces, Streptomyces, Nocardia, Bifidobacterium, Gardnerella, Corynebacterium; Propionibacterium
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/08Clostridium, e.g. Clostridium tetani
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/085Staphylococcus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/09Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/095Neisseria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1267Gram-positive bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to the identification of adhesin islands within the genome Streptococcus agalactiae (“GBS”) and the use of adhesin island amino acid sequences encoded by these adhesin islands in compositions for the treatment or prevention of GBS infection. Similar sequences have been identified in other Gram positive bacteria.
  • the invention further includes immunogenic compositions comprising adhesin island amino acid sequences of Gram positive bacteria for the treatment or prevention of infection of Gram positive bacteria.
  • Preferred immunogenic compositions of the invention include an adhesin island surface protein which may be formulated or purified in an oligomeric or pilus form.
  • GBS has emerged in the last 20 years as the major cause of neonatal sepsis and meningitis that affects 0.5-3 per 1000 live births, and an important cause of morbidity among older age groups affecting 5-8 per 100,000 of the population.
  • Current disease management strategies rely on intrapartum antibiotics and neonatal monitoring which have reduced neonatal case mortality from >50% in the 1970's to less than 10% in the 1990's. Nevertheless, there is still considerable morbidity and mortality and the management is expensive. 15-35% of pregnant women are asymptomatic carriers and at high risk of transmitting the disease to their babies. Risk of neonatal infection is associated with low serotype specific maternal antibodies and high titers are believed to be protective.
  • invasive GBS disease is increasingly recognized in elderly adults with underlying disease such as diabetes and cancer.
  • the “B” in “GBS” refers to the Lancefield classification, which is based on the antigenicity of a carbohydrate which is soluble in dilute acid and called the C carbohydrate.
  • Lancefield identified 13 types of C carbohydrate, designated A to 0, that could be serologically differentiated.
  • the organisms that most commonly infect humans are found in groups A, B, D, and G.
  • strains can be divided into at least 9 serotypes (Ia, Ib, Ia/c, II, III, IV, V, VI, VII and VIII) based on the structure of their polysaccharide capsule.
  • serotypes Ia, Ib, II, and III were equally prevalent in normal vaginal carriage and early onset sepsis in newborns.
  • Type V GBS has emerged as an important cause of GBS infection in the USA, however, and strains of types VI and VIII have become prevalent among Japanese women.
  • S. agalactiae is classified as a gram positive bacterium, a collection of about 21 genera of bacteria that colonize humans, have a generally spherical shape, a positive Gram stain reaction and lack endospores.
  • Gram positive bacteria are frequent human pathogens and include Staphylococcus (such as S. aureus ), Streptococcus (such as S. pyogenes (GBS), S. pyogenes (GAS), S. pneumonaie, S. mutans ), Enterococcus (such as E. faecalis and E. faecium ), Clostridium (such as C. difficile ), Listeria (such as L. monocytogenes ) and Corynebacterium (such as C. diphtheria ).
  • compositions for providing immunity against disease and/or infection of Gram positive bacteria.
  • the compositions are based on the identification of adhesin islands within Streptococcal genomes and the use of amino acid sequences encoded by these islands in therapeutic or prophylactic compositions.
  • the invention further includes compositions comprising immunogenic adhesin island proteins within other Gram positive bacteria in therapeutic or prophylactic compositions.
  • GBS Adhesin Island 1 a new adhesin island, “GBS Adhesin Island 1”, “AI-1” or “GBS AI-1”, within the genomes of several Group B Streptococcus serotypes and isolates.
  • This adhesin island is thought to encode surface proteins which are important in the bacteria's virulence.
  • surface proteins within GBS Adhesin Islands form a previously unseen pilus structure on the surface of GBS bacteria. Amino acid sequences encoded by such GBS Adhesin Islands may be used in immunogenic compositions for the treatment or prevention of GBS infection.
  • a preferred immunogenic composition of the invention comprises an AI-1 surface protein, such as GBS 80, which may be formulated or purified in an oligomeric (pilus) form.
  • the oligomeric form is a hyperoligomer.
  • Electron micrographs depicting some of the first visualizations of this pilus structure in a wild type GBS strain are shown in FIGS. 16, 17 , 49 , and 50 .
  • Applicants have transformed a GBS strain with a plasmid comprising the AI surface protein GBS 80 which resulted in increased production of that AI surface protein.
  • GBS AI-1 comprises a series of approximately five open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“AI-1 proteins”).
  • AI-1 includes polynucleotide sequences encoding for two or more of GBS 80, GBS 104, GBS 52, SAG0647 and SAG0648.
  • One or more of the AI-1 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the AI-1 open reading frames may be replaced by a sequence having sequence homology (sequence identity) to the replaced ORF.
  • AI-1 typically resides on an approximately 16.1 kb transposon-like element frequently inserted into the open reading frame for trmA.
  • One or more of the AI-1 surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the AI surface proteins of the invention may affect the ability of the GBS bacteria to adhere to and invade epithelial cells.
  • AI surface proteins may also affect the ability of GBS to translocate through an epithelial cell layer.
  • one or more AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • AI-1 may encode at least one surface protein.
  • AI-1 may encode at least two surface proteins and at least one sortase.
  • AI-1 encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif or other sortase substrate motif.
  • the GBS AI-1 protein of the composition may be selected from the group consisting of GBS 80, GBS 104, GBS 52, SAG0647 and SAG0648.
  • GBS AI-1 surface proteins GBS 80 and GBS 104 are preferred for use in the immunogenic compositions of the invention.
  • AI-1 may also include a divergently transcribed transcriptional regulator such as araC (i.e., the transcriptional regulator is located near or adjacent to the AI protein open reading frames, but it transcribed in the opposite direction). It is believed that araC may regulate the expression of the GBS AI operon. (See Korbel et al., Nature Biotechnology (2004) 22(7): 911-917 for a discussion of divergently transcribed regulators in E. coli ).
  • araC may regulate the expression of the GBS AI operon.
  • a second adhesin island “Adhesin Island-2”, “AI-2” or “GBS AI-2”, has also been identified in numerous GBS serotypes. Amino acid sequences encoded by the open reading frames of AI-2 may also be used in immunogenic compositions for the treatment or prevention of GBS infection.
  • GBS AI-2 comprises a series of approximately five open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • AI-2 includes open reading frames encoding for two or more of GBS 67, GBS 59, GBS 150, SAG1405, SAG1406, 01520, 01521, 01522, 01523, 01523, 01524 and 01525.
  • the GBS AI-2 sequences may be divided into two subgroups.
  • AI-2 includes open reading frames encoding for two or more of GBS 67, GBS 59, GBS 150, SAG1405, and SAG1406. This collection of open reading frames may be generally referred to as GBS AI-2 subgroup 1.
  • AI-2 may include open reading frames encoding for two or more of 01520, 01521, 01522, 01523, 01523, 01524 and 01525. This collection of open reading frames may be generally referred to as GBS AI-2 subgroup 2.
  • One or more of the AI-2 open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the AI-2 open reading frames may be replaced by a sequence having sequence homology (sequence identity) to the replaced ORF.
  • AI-2 surface proteins typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif. These sortase proteins are thought to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • AI-2 may encode for at least one surface protein.
  • AI-2 may encode for at least two surface proteins and at least one sortase.
  • AI-2 encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif.
  • the AI-2 protein of the composition may be selected from the group consisting of GBS 67, GBS 59, GBS 150, SAG1405, SAG1406, 01520, 01521, 01522, 01523, 01523, 01524 and 01525.
  • AI-2 surface proteins GBS 67, GBS 59, and 01524 are preferred AI-2 proteins for use in the immunogenic compositions of the invention.
  • GBS 67 or GBS 59 is particularly preferred.
  • GBS AI-2 may also include a divergently transcribed transcriptional regulator such as a RofA like protein (for example rogB). As in AI-1, rogB is thought to regulate the expression of the AI-2 operon.
  • a divergently transcribed transcriptional regulator such as a RofA like protein (for example rogB).
  • rogB is thought to regulate the expression of the AI-2 operon.
  • the GBS AI proteins of the invention may be used in immunogenic compositions for prophylactic or therapeutic immunization against GBS infection.
  • the invention may include an immunogenic composition comprising one or more GBS AI-1 proteins and one or more GBS AI-2 proteins.
  • the immunogenic compositions may also be selected to provide protection against an increased range of GBS serotypes and strain isolates.
  • the immunogenic composition may comprise a first and second GBS AI protein, wherein a full length polynucleotide sequence encoding for the first GBS AI protein is not present in a genome comprising a full length polynucleotide sequence encoding for the second GBS AI protein.
  • each antigen selected for use in the immunogenic compositions will preferably be present in the genomes of multiple GBS serotypes and strain isolates.
  • each antigen is presnt in the genomes of at least two (i.e., 3, 4, 5, 6, 7, 8, 9, 10, or more) GBS strain isolates. More preferably, each antigen is present in the genomes of at least two (i.e., at least 3, 4, 5 or more) GBS serotypes.
  • GBS AI-1 Applicants have found that Group B Streptococcus surface exposure of GBS 104 is dependent on the concurrent expression of GBS 80. It is thought that GBS 80 is involved in the transport or localization of GBS 104 to the surface of the bacteria.
  • the two proteins may be oligomerized or otherwise chemically or physically associated. It is possible that this association involves a conformational change in GBS 104 that facilitates its transition to the surface of the GBS bacteria.
  • one or more AI sortases may also be involved in this surface localization and chemical or physical association. Similar relationships are thought to exist within GBS AI-2.
  • the compositions of the invention may therefore include at least two AI proteins, wherein the two AI proteins are physically or chemically associated.
  • the two AI proteins form an oligomer.
  • one or more of the AI proteins are in a hyper-oligomeric form.
  • the associated AI proteins may be purified or isolated from a GBS bacteria or recombinant host cell.
  • compositions for providing prophylactic or therapeutic protection against disease and/or infection of Gram positive bacteria.
  • the compositions are based on the identification of adhesin islands within Streptococcal genomes and the use of amino acid sequences encoded by these islands in therapeutic or prophylactic compositions.
  • the invention further includes compositions comprising immunogenic adhesin island proteins within other Gram positive bacteria in therapeutic or prophylactic compositions.
  • Preferred Gram positive adhesin island proteins for use in the invention may be derived from Staphylococcus (such as S. aureus ), Streptococcus (such as S. agalactiae (GBS), S. pyogenes (GAS), S. pneumonaie, S.
  • the Gram positive adhesin island surface proteins are in oligomeric or hyperologimeric form.
  • adhesin islands within the genomes of several Group A Streptococcus serotypes and isolates. These adhesion islands are thought to encode surface proteins which are important in the bacteria's virulence, and Applicants have obtained the first electron micrographs revealing the presence of these adhesin island proteins in hyperoligomeric pilus structures on the surface of Group A Streptococcus.
  • Group A Streptococcus is a human specific pathogen which causes a wide variety of diseases ranging from pharyngitis and impetigo through life threatening invasive disease and necrotizing fasciitis.
  • post-streptococcal autoimmune responses are still a major cause of cardiac pathology in children.
  • Group A Streptococcal infection of its human host can generally occur in three phases.
  • the first phase involves attachment and/or invasion of the bacteria into host tissue and multiplication of the bacteria within the extracellular spaces. Generally this attachment phase begins in the throat or the skin. The deeper the tissue level infected, the more severe the damage that can be caused.
  • the bacteria secretes a soluble toxin that diffuses into the surrounding tissue or even systemically through the vasculature. This toxin binds to susceptible host cell receptors and triggers innappropropriate immune responses by these host cells, resulting in pathology. Because the toxin can diffuse throughout the host, the necrosis directly caused by the GAS toxins may be physically located in sites distant from the bacterial infection.
  • the final phase of GAS infection can occur long after the original bacteria have been cleared from the host system. At this stage, the host's previous immune response to the GAS bacteria due to cross reactivity between epitopes of a GAS surface protein, M, and host tissues, such as the heart.
  • a general review of GAS infection can be found in Principles of Bacterial Pathogeneis, Groisman ed., Chapter 15 (2001).
  • an effective vaccine against GAS will preferably facilitate host elimination of the bacteria during the initial attachment and invasion stage.
  • Isolates of Group A Streptococcus are historically classified according to the M surface protein described above.
  • the M protein is surface exposed trypsin-sensitive protein generally comprising two polypeptide chains complexed in an alpha helical formation.
  • the carboxyl terminus is anchored in the cytoplasmic membrane and is highly conserved among all group A streptococci.
  • the amino terminus which extend through the cell wall to the cell surface, is responsible for the antigenic variability observed among the 80 or more serotypes of M proteins.
  • T-antigen A second layer of classification is based on a variable, trypsin-resistant surface antigen, commonly referred to as the T-antigen.
  • T-antigen a variable, trypsin-resistant surface antigen
  • Decades of epidemiology based on M and T serological typing have been central to studies on the biological diversity and disease causing potential of Group A Streptococci. While the M-protein component and its inherent variability have been extensively characterized, even after five decades of study, there is still very little known about the structure and variability of T-antigens.
  • Antisera to define T types is commercially available from several sources, including Sevapharma (http://www.sevapharma.cz/en).
  • T-antigen T-type 6
  • M6 strain of GAS M6 strain of GAS
  • FCT Fibronectin-binding, Collagen-binding T-antigen
  • the antiserum recognized, in addition to a band corresponding to the predicted molecular mass of the product, very high molecular weight ladders ranging in mobility from about 100 kDa to beyond the resolution of the 3-8% gradient gels used.
  • Applicants have identified at least four different Group A Streptococcus Adhesin Islands. While these GAS AI sequences can be identified in numerous M types, Applicants have surprisingly discovered a correlation between the four main pilus subunits from the four different GAS AI types and specific T classifications. While other trypsin-resistant surface exposed proteins are likely also implicated in the T classification designations, the discovery of the role of the GAS adhesin islands (and the associated hyper-oligomeric pilus like structures) in T classification and GAS serotype variance has important implications for prevention and treatment of GAS infections. Applicants have identified protein components within each of the GAS adhesin islands which are associated with the pilus formation. These proteins are believed to be involved in the bacteria's initial adherence mechanisms. Immunological recognition of these proteins may allow the host immune response to slow or prevent the bacteria's transition into the more pathogenic later stages of infection.
  • GBS pili structures appear to be implicated in the formation of biofilms (populations of bacteria growing on a surface, often enclosed in an exopolysaccharide matrix).
  • Biofilms are generally associated with bacterial resistance, as antibiotic treatments and host immune response are frequently unable to erradicate all of the bacteria components of the biofilm.
  • Direction of a host immune response against surface proteins exposed during the first steps of bacterial attachment is preferable.
  • the invention therefore provides for improved immunogenic compositions against GAS infection which may target GAS bacteria during their initial attachment efforts to the host epithelial cells and may provide protection against a wide range of GAS serotypes.
  • the immunogenic compositions of the invention include GAS AI surface proteins which may be formulated in an oligomeric, or hyperoligomeric (pilus) form.
  • the immunogenic compositions of the invention may include one or more GAS AI surface proteins.
  • the invention also includes combinations of GAS AI surface proteins. Combinations of GAS AI surface proteins may be selected from the same adhesin island or they may be selected from different GAS adhesin islands.
  • Amino acid sequence encoded by such GAS Adhesin Islands may be used in immunogenic compositions for the treatment or prevention of GAS infection.
  • Preferred immunogenic compositions of the invention comprise a GAS AI surface protein which has been formulated or purified in an oligomeric (pilus) form.
  • the oligomeric form is a hyperoligomer.
  • GAS Adhesin Islands generally include a series of open reading frames within a GAS genome that encode for a collection of surface proteins and sortases.
  • a GAS Adhesin Island may encode for an amino acid sequence comprising at least one surface protein.
  • the Adhesin Island therefore, may encode at least one surface protein.
  • a GAS Adhesin Island may encode for at least two surface proteins and at least one sortase.
  • a GAS Adhesin Island encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • One or more GAS AI surface proteins may participate in the formation of a pilus structure on the surface of the Gram positive bacteria.
  • GAS Adhesin Islands of the invention preferably include a divergently transcribed transcriptional regulator.
  • the transcriptional regulator may regulate the expression of the GAS AI operon. Examples of transcriptional regulators found in GAS AI sequences include RofA and Nra.
  • the GAS AI surface proteins may bind or otherwise adhere to fibrinogen, fibronectin, or collagen.
  • One or more of the GAS AI surface proteins may comprise a fimbrial structural subunit.
  • One or more of the GAS AI surface proteins may include an LPXTG motif or other sortase substrate motif.
  • the LPXTG motif may be followed by a hydrophobic region and a charged C terminus, which are thought to retard the protein in the cell membrane to facilitate recognition by the membrane-localized sortase. See Barnett, et al., J. Bacteriology (2004) 186 (17): 5865-5875.
  • GAS AI sequences may be generally categorized as Type 1, Type 2, Type 3, or Type 4, depending on the number and type of sortase sequences within the island and the percentage identity of other proteins (with the exception of RofA and cpa) within the island.
  • Schematics of the GAS adhesin islands are set forth in FIG. 51A and FIG. 162 .
  • “GAS Adhesin Island-1 or “GAS AI-1” comprises a series of approximately five open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-1 proteins”).
  • GAS AI-1 preferably comprises surface proteins, a srtB sortase and a rofA divergently transcribed transcriptional regulator.
  • GAS AI-1 surface proteins may include a fibronectin binding protein, a collagen adhesion protein and a fimbrial structural subunit.
  • the fimbrial structural subunit also known as tee6
  • the fimbrial structural subunit is thought to form the shaft portion of the pilus like structure
  • the collagen adhesion protein (Cpa) is thought to act as an accessory protein facilitating the formation of the pilus structure, exposed on the surface of the bacterial capsule.
  • GAS AI-1 includes polynucleotide sequences encoding for two or more of M6_Spy0157, M6_Spy0158, M6_Spy0159, M6_Spy0160, M6_Spy0161.
  • the GAS AI-1 may also include polynucleotide sequences encoding for any one of CDC SS 410_fimbrial, ISS3650_fimbrial, DSM2071_fimbrial
  • a preferred immunogenic composition of the invention comprises a GAS AI-1 surface protein which may be formulated or purified in an oligomeric (pilus) form.
  • the oligomeric form is a hyperoligomer.
  • the immunogenic composition of the invention may alternatively comprise an isolated GAS AI-1 surface protein in oligomeric (pilus) form.
  • the oligomer or hyperoligomeric pilus structures comprising GAS AI-1 surface proteins may be purified or otherwise formulated for use in immunogenic compositions.
  • GAS AI-1 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-1 open reading frames may be replaced by a sequence having sequence homology (sequence identity) to the replaced ORF.
  • GAS AI-1 surface proteins typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif. These sortase proteins are thought to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-1 may encode for at least one surface protein.
  • GAS AI-1 may encode for at least two surface proteins and at least one sortase.
  • GAS AI-1 encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif.
  • GAS AI-1 preferably includes a srtB sortase.
  • GAS srtB sortases may preferably anchor surface proteins with an LPSTG motif (SEQ ID NO: 166), particularly where the motif is followed by a serine.
  • the GAS AI-1 protein of the composition may be selected from the group consisting of M6_Spy0157, M6_Spy0158, M6_Spy0159, M6_Spy0160 M6_Spy0161, CDC SS 410_fimbrial, ISS3650_fimbrial, and DSM2071_fimbrial.
  • GAS AI-1 surface proteins M6_Spy0157 (a fibronectin binding protein), M6_Spy0159 (a collagen adhesion protein, Cpa), M6_Spy0160 (a fimbrial structural subunit, tee6), CDC SS 410_fimbrial (a fimbrial structural subunit), ISS3650_fimbrial (a fimbrial structural subunit), and DSM2071_fimbrial (a fimbrial structural subunit) are preferred GAS AI-1 proteins for use in the immunogenic compositions of the invention.
  • the fimbrial structural subunit tee6 and the collagen adhesion protein Cpa are preferred GAS AI-1 surface proteins.
  • each of these GAS AI-1 surface proteins includes an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122) or LPXSG (SEQ ID NO: 134) (conservative replacement of threonine with serine).
  • LPXTG SEQ ID NO: 122
  • LPXSG SEQ ID NO: 1344
  • GAS AI-1 may also include a divergently transcribed transcriptional regulator such as rofA (i.e., the transcriptional regulator is located near or adjacent to the GAS AI protein open reading frames, but it transcribed in the opposite direction).
  • rofA a divergently transcribed transcriptional regulator
  • the GAS AI-1 surface proteins may be used alone, in combination with other GAS AI-1 surface proteins or in combination with other GAS AI surface proteins.
  • the immunogenic compositions of the invention include the GAS AI-1 fimbrial structural subunit (tee6) and the GAS AI-1 collagen binding protein. Still more preferably, the immunogenic compositions of the invention include the GAS AI-1 fimbrial structural subunit (tee6).
  • GAS Adhesin Island-2 A second GAS adhesion island, “GAS Adhesin Island-2” or “GAS AI-2,” has also been identified in GAS serotypes. Amino acid sequences encoded by the open reading frames of GAS AI-2 may also be used in immunogenic compositions for the treatment or prevention of GAS infection.
  • a preferred immunogenic composition of the invention comprises a GAS AI-2 surface protein which may be formulated or purified in an oligomeric (pilus) form.
  • the oligomeric form is a hyperoligomer.
  • a preferred immunogenic composition of the invention alternatively comprises an isolated GAS AI-2 surface protein in oligomeric (pilus) form.
  • the oligomer or hyperoligomeric pilus structures comprising GAS AI-2 surface proteins may be purified or otherwise formulated for use in immunogenic compositions.
  • GAS AI-2 comprises a series of approximately eight open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-2 proteins”).
  • GAS AI-2 preferably comprises surface proteins, a srtB sortase, a srtC1 sortase and a rofA divergently transcribed transcriptional regulator.
  • GAS AI-2 includes polynucleotide sequences encoding for two or more of GAS15, Spy0127, GAS16, GAS17, GAS18, Spy0131, Spy0133, and GAS20.
  • GAS AI-2 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-2 open reading frames may be replaced by a sequence having sequence homology (sequence identity) to the replaced ORF.
  • GAS AI-2 surface proteins typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif. These sortase proteins are thought to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-2 may encode for at least one surface protein.
  • GAS AI-2 may encode for at least two surface proteins and at least one sortase.
  • GAS AI-2 encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif.
  • GAS AI-2 preferably includes a srtB sortase and a srtC1 sortase.
  • GAS srtB sortases may preferably anchor surface proteins with an LPSTG motif (SEQ ID NO: 166), particularly where the motif is followed by a serine.
  • GAS srtC1 sortase may preferentially anchor surface proteins with a V(P/V)PTG (SEQ ID NO: 167) motif.
  • GAS srtC1 may be differentially regulated by rofA.
  • the GAS AI-2 protein of the composition may be selected from the group consisting of GAS15, Spy0127, GAS16, GAS17, GAS18, Spy0131, Spy0133, and GAS20.
  • GAS AI-2 surface proteins GAS15 (Cpa), GAS16 (thought to be a fimbrial protein, M1 — 128), GAS18 (M1_Spy0130), and GAS20 are preferred for use in the immunogenic compositions of the invention.
  • GAS 16 is thought to form the shaft portion of the pilus like structure, while GAS 15 (the collagen adhesion protein Cpa) and GAS 18 are thought to act as accessory proteins facilitating the formation of the pilus structure, exposed on the surface of the bacterial capsule.
  • each of these GAS AI-2 surface proteins includes an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122), VVXTG (SEQ ID NO: 135), or EVXTG (SEQ ID NO: 136).
  • LPXTG sortase substrate motif such as LPXTG (SEQ ID NO: 122), VVXTG (SEQ ID NO: 135), or EVXTG (SEQ ID NO: 136).
  • GAS AI-2 may also include a divergently transcribed transcriptional regulator such as rofA (i.e., the transcriptional regulator is located near or adjacent to the GAS AI protein open reading frames, but it transcribed in the opposite direction).
  • the GAS AI-2 surface proteins may be used alone, in combination with other GAS AI-2 surface proteins or in combination with other GAS AI surface proteins.
  • the immunogenic compositions of the invention include the GAS AI-2 fimbrial protein (GAS 16), the GAS AI-2 collagen binding protein (GAS 15) and GAS 18 (M1_Spy0130). More preferably, the immunogenic compositions of the invention include the GAS AI-2 fimbrial protein (GAS 16).
  • GAS Adhesin Island-3 A third GAS adhesion island, “GAS Adhesin Island-3” or “GAS AI-3,” has also been identified in numerous GAS serotypes. Amino acid sequences encoded by the open reading frames of GAS AI-3 may also be used in immunogenic compositions for the treatment or prevention of GAS infection.
  • a preferred immunogenic composition of the invention comprises a GAS AI-3 surface protein which may be formulated or purified in an oligomeric (pilus) form.
  • the oligomeric form is a hyperoligomer.
  • a preferred immunogenic composition of the invention alternatively comprises an isolated GAS AI-3 surface protein in oligomeric (pilus) form.
  • the oligomer or hyperoligomeric pilus structures comprising GAS AI-3 surface proteins may be purified or otherwise formulated for use in immunogenic compositions.
  • GAS AI-3 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-3 proteins”).
  • GAS AI-3 preferably comprises surface proteins, a srtC2 sortase, and a Negative transcriptional regulator (Nra) divergently transcribed transcriptional regulator.
  • GAS AI-3 surface proteins may include a collagen binding protein, a fimbrial protein, and a F2 like fibronectin-binding protein.
  • GAS AI-3 surface proteins may also include a hypothetical surface protein. The fimbrial protein is thought to form the shaft portion of the pilus like structure, while the collagen adhesion protein (Cpa) and the hypothetical surface protein are thought to act as accessory proteins facilitating the formation of the pilus structure, exposed on the surface of the bacterial capsule.
  • Preferred AI-3 surface proteins include the fimbrial proein, the collagen binding protein and the hypothetical protein.
  • each of these GAS AI-3 surface proteins include an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122), VPXTG (SEQ ID NO: 137), QVXTG (SEQ ID NO: 138) or LPXAG (SEQ ID NO: 139).
  • LPXTG sortase substrate motif such as LPXTG (SEQ ID NO: 122), VPXTG (SEQ ID NO: 137), QVXTG (SEQ ID NO: 138) or LPXAG (SEQ ID NO: 139).
  • GAS AI-3 includes polynucleotide sequences encoding for two or more of SpyM3 — 0098, SpyM3 — 0099, SpyM3 — 0100, SpyM3 — 0101, SpyM3 — 0102, SpyM3 — 0103, SpyM3 — 0104, Sps0100, Sps0101, Sps0102, Sps0103, Sps0104, Sps0105, Sps0106, orf78, orf79, orf80, orf81, orf82, orf83, orf84, spyM18 — 0126, spyM18 — 0127, spyM18 — 0128, spyM18 — 0129, spyM18 — 0130, spyM18 — 0131, spyM18 — 0132, SpyoM0100156, SpyoM0100155, SpyoM0100154, SpyoM01000153, SpyoM01000152, SpyoM01000
  • GAS AI-3 may include open reading frames encoding for two or more of SpyM3 — 0098, SpyM3 — 0099, SpyM3 — 0100, SpyM3 — 0101, SpyM3 — 0102, SpyM3 — 0103, and SpyM3 — 0104.
  • GAS AI-3 may include open reading frames encoding for two or more of Sps0100, Sps0101, Sps0102, Sps0103, Sps0104, Sps0105, and Sps0106.
  • GAS AI-3 may include open reading frames encoding for two or more of orf78, orf79, orf80, orf81, orf82, orf83, and orf84.
  • GAS AI-3 may include open reading frames encoding for two or more of spyM18 — 0126, spyM18 — 0127, spyM18 — 0128, spyM18 — 0129, spyM18 — 0130, spyM18 — 0131, and spyM18 — 0132.
  • GAS AI-3 may include open reading frames encoding for two or more of SpyoM01000156, SpyoM01000155, SpyoM01000154, SpyoM01000153, SpyoM01000152, SpyoM01000151, SpyoM01000150, and SpyoM01000149.
  • GAS AI-1 may also include polynucleotide sequences encoding for any one of ISS3040_fimbrial, ISS3776_fimbrial, and ISS4959_fimbrial.
  • GAS AI-3 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-3 open reading frames may be replaced by a sequence having sequence homology (sequence identity) to the replaced ORF.
  • GAS AI-3 surface proteins typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif. These sortase proteins are thought to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-3 may encode for at least one surface protein.
  • GAS AI-3 may encode for at least two surface proteins and at least one sortase.
  • GAS AI-3 encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif.
  • GAS AI-3 preferably includes a srtC2 type sortase.
  • GAS srtC2 type sortases may preferably anchor surface proteins with a QVPTG (SEQ ID NO: 140) motif, particularly when the motif is followed by a hydrophobic region and a charged C terminus tail.
  • GAS SrtC2 may be differentially regulated by Nra.
  • the GAS AI-3 protein of the composition may be selected from the group consisting of SpyM3 — 0098, SpyM3 — 0099, SpyM3 — 0100, SpyM3 — 0101, SpyM3 — 0102, SpyM3 — 0103, SpyM3 — 0104, Sps0100, Sps0101, Sps0102, Sps0103, Sps0104, Sps0105, Sps0106, orf78, orf79, orf80, orf81, orf82, orf83, orf84, spyM18 — 0126, spyM18 — 0127, spyM18 — 0128, spyM18 — 0129, spyM18 — 0130, spyM18 — 0131, spyM18 — 0132, SpyoM01000156, SpyoM01000155, SpyoM01000154, SpyoM01000153, SpyoM01000152, SpyoM01000151, SpyoM
  • GAS AI-3 may also include a transcriptional regulator such as Nra.
  • GAS AI-3 may also include a LepA putative signal peptidase I protein.
  • the GAS AI-3 surface proteins may be used alone, in combination with other GAS AI-3 surface proteins or in combination with other GAS AI surface proteins.
  • the immunogenic compositions of the invention include the GAS AI-3 fimbrial protein, the GAS AI-3 collagen binding protein, the GAS AI-3 surface protein (such as SpyM3 — 0102, M3_Sps0104, M5_orf82, or spyM18 — 0130), and fibronectin binding protein PrtF2. More preferably, the immunogenic compositions of the invention include the GAS AI-3 fimbrial protein, the GAS AI-3 collagen binding protein, and the GAS AI-3 surface protein. Still more preferably, the immunogenic compositions of the invention include the GAS AI-3 fimbrial protein.
  • GAS AI-3 fimbrial protein examples include SpyM3 — 0100, M3_Sps0102, M5_orf80, spyM18 — 128, SpyoM01000153, ISS3040_fimbrial, ISS3776_fimbrial, ISS4959_fimbrial.
  • GAS AI-3 collagen binding protein Representative examples include SpyM3 — 0098, M3_Sps0100, M5_orf 78, spyM18 — 0126, and SpyoM01000155.
  • GAS AI-3 fibronectin binding protein PrtF2 include SpyM3 — 0104, M3_Sps0106, M5_orf84 and spyM18 — 0132, and SpyoM01000149.
  • GAS Adhesin Island-4 A fourth GAS adhesion island, “GAS Adhesin Island-4” or “GAS AI-4,” has also been identified in GAS serotypes. Amino acid sequences encoded by the open reading frames of GAS AI-4 may also be used in immunogenic compositions for the treatment or prevention of GAS infection.
  • a preferred immunogenic composition of the invention comprises a GAS AI-4 surface protein which may be formulated or purified in an oligomeric (pilus) form.
  • the oligomeric form is a hyperoligomer.
  • a preferred immunogenic composition of the invention alternatively comprises an isolated GAS AI-4 surface protein in oligomeric (pilus) form.
  • the oligomer or hyperoligomeric pilus structures comprising GAS AI-3 surface proteins may be purified or otherwise formulated for use in immunogenic compositions.
  • the oligomeric or hyperoligomeric pilus structures comprising GAS AI-4 surface proteins may be purified or otherwise formulated for use in immunogenic compositions.
  • GAS AI-4 comprises a series of approximately eight open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-4 proteins”).
  • This GAS adhesin island 4 (“GAS AI-4”) comprises surface proteins, a srtC2 sortase, and a RofA regulatory protein.
  • GAS AI-4 surface proteins within may include a fimbrial protein, F1 and F2 like fibronectin-binding proteins, and a capsular polysaccharide adhesion protein (Cpa).
  • GAS AI-4 surface proteins may also include a hypothetical surface protein in an open reading frame (orf).
  • the fimbral protein (EftLSL) is thought to form the shaft portion of the pilus like structure, while the collagen adhesion protein (Cpa) and the hypothetical protein are thought to act as accessory proteins facilitating the formation of the pilus structure, exposed on the surface of the bacterial capsule.
  • each of these GAS AI-4 surface proteins include an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122), VPXTG (SEQ ID NO: 137), QVXTG (SEQ ID NO: 138) or LPXAG (SEQ ID NO: 139).
  • GAS AI-4 includes polynucleotide sequences encoding for two or more of 19224134, 19224135, 19224136, 19224137, 19224138, 19224139, 19224140, and 19224141.
  • a GAS AI-4 polynucleotide may also include polynucleotide sequences encoding for any one of 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, ISS4538_fimbrial.
  • One or more of the GAS AI-4 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-4 open reading frames may be replaced by a sequence having sequence homology (sequence identity) to the replaced ORF.
  • GAS AI-4 surface proteins typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif. These sortase proteins are thought to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-4 may encode for at least one surface protein.
  • GAS AI-4 may encode for at least two surface proteins and at least one sortase.
  • GAS AI-4 encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif.
  • GAS AI-4 includes a SrtC2 type sortase.
  • GAS SrtC2 type sortases may preferably anchor surface proteins with a QVPTG (SEQ ID NO: 140) motif, particularly when the motif is followed by a hydrophobic region and a charged C terminus tail.
  • the GAS AI-4 protein of the composition may be selected from the group consisting of 19224134, 19224135, 19224136, 19224137, 19224138, 19224139, 19224140, 19224141, 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, and ISS4538_fimbrial.
  • GAS AI-4 surface proteins 19224134, 19224135, 19224137, 19224139, 19224141, 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, ISS4538_fimbrial are preferred proteins for use in the immunogenic compositions of the invention.
  • GAS AI-4 may also include a divergently transcribed transcriptional regulator such as RofA (i.e., the transcriptional regulator is located near or adjacent to the AI protein open reading frames, but it transcribed in the opposite direction.
  • RofA a divergently transcribed transcriptional regulator
  • GAS AI-4 may also include a LepA putative signal peptidase I protein and a MsmRL protein.
  • the GAS AI-4 surface proteins may be used alone, in combination with other GAS AI-4 surface proteins or in combination with other GAS AI surface proteins.
  • the immunogenic compositions of the invention include the GAS AI-4 fimbrial protein (EftLSL or 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, or ISS4538_fimbrial), the GAS AI-4 collagen binding protein, the GAS AI-4 surface protein (such as M12 isolate A735 orf 2), and fibronectin binding protein PrtF1 and PrtF2.
  • GAS AI-4 fimbrial protein EftLSL or 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, or ISS4538_f
  • the immunogenic compositions of the invention include the GAS AI-4 fimbrial protein, the GAS AI-4 collagen binding protein, and the GAS AI-4 surface protein. Still more preferably, the immunogenic compositions of the invention include the GAS AI-4 fimbrial protein.
  • the GAS AI proteins of the invention may be used in immunogenic compositions for prophylactic or therapeutic immunization against GAS infection.
  • the invention may include an immunogenic composition comprising one or more GAS AI-1 proteins and one or more of any of GAS AI-2, GAS AI-3, or GAS AI-4 proteins.
  • the invention includes an immunogenic composition comprising at least two GAS AI proteins where each protein is selected from a different GAS adhesin island.
  • the two GAS AI proteins may be selected from one of the following GAS AI combinations: GAS AI-1 and GAS AI-2; GAS AI-1 and GAS AI-3; GAS AI-1 and GAS AI-4; GAS AI-2 and GAS AI-3; GAS AI-2 and GAS AI-4; and GAS AI 3 and GAS AI-4.
  • the combination includes fimbrial proteins from one or more GAS adhesin islands.
  • the immunogenic compositions may also be selected to provide protection against an increased range of GAS serotypes and strain isolates.
  • the immunogenic composition may comprise a first and second GAS AI protein, wherein a full length polynucleotide sequence encoding for the first GAS AI protein is not present in a genome comprising a full length polynucleotide sequence encoding for the second GAS AI protein.
  • each antigen selected for use in the immunogenic compositions will preferably be present in the genomes of multiple GAS serotypes and strain isolates.
  • each antigen is present in the genomes of at least two (i.e., 3, 4, 5, 6, 7, 8, 9, 10, or more) GAS strain isolates. More preferably, each antigen is present in the genomes of at least two (i.e., at least 3, 4, 5, or more) GAS serotypes.
  • Applicants have also identified adhesin islands within the genome of Streptococcus pneumoniae . These adhesion islands are thought to encode surface proteins which are important in the bacteria's virulence. Amino acid sequence encoded by such S. pneumoniae Adhesin Islands may be used in immunogenic compositions for the treatment or prevention of S. pneumoniae infection.
  • Preferred immunogenic compositions of the invention comprise a S. pneumoniae AI surface protein which has been formulated or purified in an oligomeric (pilus) form. In a preferred embodiment, the oligomeric form is a hyperoligomer.
  • a preferred immunogenic composition of the invention alternatively comprises an isolated S. pneumoniae surface protein in oligomeric (pilus) form. The oligomer or hyperoligomeric pilus structures comprising S. pneumoniae surface proteins may be purified or otherwise formulated for use in immunogenic compositions.
  • the S. pneumoniae Adhesin Islands generally include a series of open reading frames within a S. pneumoniae genome that encode for a collection of surface proteins and sortases.
  • a S. pneumoniae Adhesin Island may encode for an amino acid sequence comprising at least one surface protein.
  • the S. pneumoniae Adhesin Island may encode for at least two surface proteins and at least one sortase.
  • a S. pneumoniae Adhesin Island encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPTXG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • One or more S. pneumoniae AI surface proteins may participate in the formation of a pilus structure on the surface of the S. pneumoniae bacteria.
  • the S. pneumoniae Adhesin Islands of the invention preferably include a divergently transcribed transcriptional regulator.
  • the transcriptional regulator may regulate the expression of the S. pneumonaie AI operon.
  • An example of a transcriptional regulator found in S. pneumoniae AI sequences is rlrA.
  • FIG. 137 A schematic of the organization of a S. pneumoniae AI locus is provided in FIG. 137 .
  • the locus comprises open reading frames encoding a transcriptional regulator (rlrA), cell wall surface proteins (rrgA, rrgB, rrgc) and sortases (srt B, srtC, srtD).
  • rlrA transcriptional regulator
  • rrgA cell wall surface proteins
  • srtB, srtC, srtD sortases
  • S. pneumoniae AI sequences may be generally divided into two groups of homology, S. pneuamoniae AI-a and AI-b.
  • S. pneumoniae strains that comprise AI-a include 14 CSR 10, 19A Hungary 6, 23 F Tru 15, 670, 6B Finland 12, and 6B Spain 2.
  • S. pneumoniae AI strains that comprise AI-b include 19F Taiwan 14, 9V Spain 3, 23F Taiwan 15 and TIGR 4.
  • S. pneumoniae AI from TIGR4 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae AI from TIGR4 includes polynucleotide sequences encoding for two or more of SP0462, SP0463, SP0464, SP0465, SP0466, SP0467, and SP0468.
  • One or more of the S. pneumoniae AI from TIGR4 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from TIGR4 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae strain 670 AI comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae strain 670 AI includes polynucleotide sequences encoding for two or more of orf1 — 670, orf3 — 670, orf4 — 670, orf5 — 670, orf6 — 670, orf7 — 670, and orf8 — 670.
  • One or more of the S. pneumoniae strain 670 AI polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 670 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 14 CSR10 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”).
  • S. pneumoniae AI proteins include polynucleotide sequences encoding for two or more of ORF2 — 14CSR, ORF3 — 14CSR, ORF4 — 14CSR, ORF5 — 14CSR, ORF6 — 14CSR, ORF7 — 14CSR, and ORF8 — 14CSR.
  • One or more of the S. pneumoniae AI from 14 CSR10 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 14 CSR10 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 19A Hungary 6 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae AI from 19A Hungary 6 includes polynucleotide sequences encoding for two or more of ORF2 — 19AH, ORF3 — 1 gAH, ORF4 — 19AH, ORF5 — 19AH, ORF6 — 19AH, ORF7 — 19AH, and ORF8 — 19AH.
  • One or more of the S. pneumoniae AI from 19A Hungary 6 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 19A Hungary 6 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 19F Taiwan 14 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae AI from 19F Taiwan 14 includes polynucleotide sequences encoding for two or more of ORF2 — 19FTW, ORF3 — 19FTW, ORF4 — 19FTW, ORF5 — 19FTW, ORF6 — 19FTW, ORF7 — 19FTW, and ORF8 — 19FTW.
  • One or more of the S. pneumoniae AI from 19F Taiwan 14 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 19F Taiwan 14 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 23F Poland 16 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae AI from 23F Poland 16 includes polynucleotide sequences encoding for two or more of ORF2 — 23FP, ORF3 — 23FP, ORF4 — 23FP, ORF5 — 23FP, ORF6 — 23FP, ORF7 — 23FP, and ORF8 — 23FP.
  • One or more of the S. pneumoniae AI from 23F Poland 16 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 23F Poland 16 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 23F Taiwan 15 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae AI from 23F Taiwan 15 includes polynucleotide sequences encoding for two or more of ORF2 — 23FTW, ORF3 — 23FTW, ORF4 — 23FTW, ORF5 — 23FTW, ORF6 — 23FTW, ORF7 — 23FTW, and ORF8 — 23FTW.
  • One or more of the S. pneumoniae AI from 23F Taiwan 15 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 23F Taiwan 15 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 6B Finland 12 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae AI from 6B Finland 12 includes polynucleotide sequences encoding for two or more of ORF2 — 6BF, ORF3 — 6BF, ORF4 — 6BF, ORF5 — 6BF, ORF6 — 6BF, ORF7 — 6BF, and ORF8 — 6BF.
  • One or more of the S. pneumoniae AI from 6B Finland 12 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 6B Finland 12 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 6B Spain 2 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”).
  • S. pneumoniae AI proteins include polynucleotide sequences encoding for two or more of ORF2 — 6BSP, ORF3 — 6BSP, ORF4 — 6BSP, ORF5 — 6BSP, ORF6 — 6BSP, ORF7 — 6BSP, and ORF8 — 6BSP.
  • One or more of the S. pneumoniae AI from 6B Spain 2 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 6B Spain 2 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI from 9V Spain 3 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“ S. pneumoniae AI proteins”). Specifically, S. pneumoniae AI from 9V Spain 3 includes polynucleotide sequences encoding for two or more of ORF2 — 9VSP, ORF3 — 9VSP, ORF4 — 9VSP, ORF5 — 9VSP, ORF6 — 9VSP, ORF7 — 9VSP, and ORF8 — 9VSP.
  • One or more of the S. pneumoniae AI from 9V Spain 3 polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae AI from 9V Spain 3 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • S. pneumoniae AI surface proteins typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif. These sortase proteins are thought to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae AI may encode for at least one surface protein.
  • the Adhesin Island may encode at least one surface protein.
  • S. pneumoniae AI may encode for at least two surface proteins and at least one sortase.
  • S. pneumoniae AI encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif.
  • the S. pneumoniae AI protein of the composition may be selected from the group consisting of SP0462, SP0463, SP0464, SP0465, SP0466, SP0467, SP0468, orf1 — 670, orf5 — 670, orf4 — 670, orf5 — 670, orf6 — 670, orf7 — 670, orf8 — 670, ORF2 — 14CSR, ORF3 — 14CSR, ORF4 — 14CSR, ORF5 — 14CSR, ORF6 — 14CSR, ORF7 — 14CSR, ORF8 — 14CSR, ORF2 — 19AH, ORF3 — 19AH, ORF4 — 19AH, ORF5 — 9AH, ORF6 — 19AH, ORF7 — 19AH, ORF8 — 19AH, ORF2 — 19FTW, ORF3 — 19FTW, ORF4 — 19FTW, ORF5 —
  • S. pneumoniae AI surface proteins are preferred proteins for use in the immunogenic compositions of the invention.
  • the compositions of the invention comprise combinations of two or more S pneumoniae AI surface proteins. Preferably such combinations are selected from two or more of the group consisting of SP0462, SP0463, SP0464, orf3 — 670, orf4 — 670, orf5 — 670, ORF3 — 14CSR, ORF4 — 14CSR, ORF5 — 14CSR, ORF3 — 19AH, ORF4 — 19AH, ORF5 — 19AH, ORF3 — 19FTW, ORF4 — 19FTW, ORF5 — 1 gFTW, ORF3 — 23FP, ORF4 — 23FP, ORF5 — 23FP, ORF3 — 23FTW, ORF4 — 23FTW, ORF5 — 23FTW, ORF3 — 6BF, ORF4 — 6BF, ORF5 — 6BF, ORF5
  • S. pneumoniae AI may also include a transcriptional regulator.
  • the S. pneumoniae AI proteins of the invention may be used in immunogenic compositions for prophylactic or therapeutic immunization against S. pneumoniae infection.
  • the invention may include an immunogenic composition comprising one or more S. pneumoniae from TIGR4 AI proteins and one or more S. pneumoniae strain 670 proteins.
  • the immunogenic composition may comprise one or more AI proteins from any one or more of S. pneumoniae strains TIGR4, 19A Hungary 6, 6B Finland 12, 6B Spain 2, 9V Spain 3, 14 CSR 10, 19F Taiwan 14, 23F Taiwan 15, 23F Poland 16, and 670.
  • the immunogenic compositions may also be selected to provide protection against an increased range of S. pneumoniae serotypes and strain isolates.
  • the immunogenic composition may comprise a first and second S. pneumoniae AI protein, wherein a full length polynucleotide sequence encoding for the first S. pneumoniae AI protein is not present in a genome comprising a full length polynucleotide sequence encoding for the second S. pneumoniae AI protein.
  • each antigen selected for use in the immunogenic compositions will preferably be present in the genomes of multiple S. pneumoniae serotypes and strain isolates.
  • each antigen is present in the genomes of at least two (i.e., 3, 4, 5, 6, 7, 8, 9, 10, or more) S. pneumoniae strain isolates. More preferably, each antigen is present in the genomes of at least two (i.e., at least 3, 4, 5, or more) S. pneumoniae serotypes.
  • the immunogenic compositions may also be selected to provide protection against an increased range of serotypes and strain isolates of a Gram positive bacteria.
  • the immunogenic composition may comprise a first and second Gram positive bacteria AI protein, wherein a full length polynucleotide sequence encoding for the first Gram positive bacteria AI protein is not present in a genome comprising a full length polynucleotide sequence encoding for the second Gram positive bacteria AI protein.
  • each antigen selected for use in the immunogenic compositions will preferably be present in the genomes of multiple serotypes and strain isolates of the Gram positive bacteria.
  • each antigen is present in the genomes of at least two (i.e., 3, 4, 5, 6, 7, 8, 9, 10, or more) Gram positive bacteria strain isolates.
  • each antigen is present in the genomes of at least two (i.e., at least 3, 4, 5, or more) Gram positive bacteria serotypes.
  • One or both of the first and second AI proteins may preferably be in oligomeric or hyperoligomeric form.
  • Adhesin island surface proteins from two or more Gram positive bacterial genus or species may be combined to provide an immunogenic composition for prophylactic or therapeutic treatment of disease or infection of two more Gram positive bacterial genus or species.
  • the adhesin island surface proteins may be associated together in an oligomeric or hyperoligomeric structure.
  • the invention comprises adhesin island surface proteins from two or more Streptococcus species.
  • the invention includes a composition comprising a GBS AI surface protein and a GAS adhesin island surface protein.
  • the invention includes a composition comprising a GAS adhesin island surface protein and a S. pneumoniae adhesin island surface protein.
  • One or both of the GAS AI surface protein and the S. pneumoniae AI surface protein may be in oligomeric or hyperoligomeric form.
  • the invention includes a composition comprising a GBS adhesin island surface protein and a S. pneumoniae adhesin island surface protein.
  • the invention comprises an adhesin island surface protein from two or more Gram positive bacterial genus.
  • the invention includes a composition comprising a Streptococcus adhesin island protein and a Corynebacterium adhesin island protein.
  • One or more of the Gram positive bacteria AI surface proteins may be in an oligomeric or hyperoligomeric form.
  • the AI polynucleotides and amino acid sequences of the invention may also be used in diagnostics to identify the presence or absence of GBS (or a Gram positive bacteria) in a biological sample. They may be used to generate antibodies which can be used to identify the presence of absence of an AI protein in a biological sample or in a prophylactic or therapeutic treatment for GBS (or a Gram positive bacterial) infection. Further, the AI polynucleotides and amino acid sequences of the invention may also be used to identify small molecule compounds which inhibit or decrease the virulence associated activity of the AI.
  • FIG. 1 presents a schematic depiction of Adhesin Island 1 (“AI-1”) comprising open reading frames for GBS 80, GBS 52, SAG0647, SAG0648 and GBS 104.
  • AI-1 Adhesin Island 1
  • FIG. 2 illustrates the identification of AI-1 sequences in several GBS serotypes and strain isolates (GBS serotype V, strain isolate 2603; GBS serotype III, strain isolate nem316; GBS serotype II, strain isolate 18RS21; GBS serotype V, strain isolate CJB111; GBS serotype III, strain isolate COH1 and GBS serotype 1a, strain isolate A909).
  • GBS serotype V strain isolate 2603
  • GBS serotype III strain isolate nem316
  • GBS serotype II strain isolate 18RS21
  • GBS serotype V strain isolate CJB111
  • GBS serotype III strain isolate COH1 and GBS serotype 1a, strain isolate A909
  • FIG. 3 presents a schematic depiction of the correlation between AI-1 and the Adhesin Island 2 (“AI-2”) within the GBS serotype V, strain isolate 2603 genome.
  • AI-2 comprises open reading frames for GBS 67, GBS 59, SAG1406, SAG1405 and GBS 150).
  • FIG. 4 illustrates the identification of AI-2 comprising open reading frames encoding for GBS 67, GBS 59, SAG1406, SAG1404 and GBS 150 (or sequences having sequence homology thereto) in several GBS serotypes and strain isolates (GBS serotype V, strain isolate 2603; GBS serotype III, strain isolate NEM316; GBS serotype 1b, strain isolate H36B; GBS serotype V, strain isolate CJB111; GBS serotype II, strain isolate 18RS21; and GBS serotype 1a, strain isolate 515).
  • GBS serotype V strain isolate 2603
  • GBS serotype III strain isolate NEM316
  • GBS serotype 1b strain isolate H36B
  • GBS serotype V strain isolate CJB111
  • GBS serotype II strain isolate 18RS21
  • GBS serotype 1a strain isolate 515
  • FIG. 4 also illustrates the identification of AI-2 comprising open reading frames encoding for 01520 (a sortase), 01521, 01522 (a sortase), 01523 (spb1), 01524 and 01525 (or sequences having sequence homology thereto).
  • FIG. 5 presents data showing that GBS 80 binds to fibronectin and fibrinogen in ELISA.
  • FIG. 6 illustrates that all genes in AI-1 are co-transcribed as an operon.
  • FIG. 7 presents schematic depictions of in-frame deletion mutations within AI-1.
  • FIG. 8 presents FACS data showing that GBS 80 is required for surface localization of GBS 104.
  • FIG. 9 presents FACS data showing that sortases SAG0647 and SAG0648 play a semi-redundant role in surface exposure of GBS 80 and GBS 104.
  • FIG. 10 presents Western Blots of the in-frame deletion mutants probed with anti-GBS80 and anti-GBS 104 antisera.
  • FIG. 11 Electron micrograph of surface exposed pili structures in Streptococcus agalactiae containing GBS 80.
  • FIG. 12 PHD predicted secondary structure of GBS 067.
  • FIGS. 13, 14 and 15 Electron micrograph of surface exposed pili structures of strain isolate COH1 of Streptococcus agalactiae containing a plasmid insert encoding GBS 80.
  • FIGS. 16 and 17 Electron micrograph of surface exposed pili structure of wild type strain isolate COH1 of Streptococcus agalactiae.
  • FIG. 18 Alignment of polynucleotide sequences of AI-1 from serotype V, strain isolates 2603 and CJB111; serotype II, strain isolate 18RS21; serotype HI, strain isolates COH1 and NEM316; and serotype 1a, strain isolate A909.
  • FIG. 19 Alignment of polynucleotide sequences of AI-2 from serotype V, strain isolates 2603 and CJB111; serotype II, strain isolate 18RS21; serotype 1b, strain isolate H36B; and serotype 1a, strain isolate 515.
  • FIG. 20 Alignment of polynucleotide sequences of AI-2 from serotype V, strain isolate 2603 and serotype III, strain isolate NEM316.
  • FIG. 21 Alignment of polynucleotide sequences of AI-2 from serotype III, strain isolate COH1 and serotype Ia, strain isolate A909.
  • FIG. 22 Alignment of amino acid sequences of AI-1 surface protein GBS 80 from serotype V, strain isolates 2603 and CJB111; serotype 1a, strain isolate A909; serotype III, strain isolates COH1 and NEM316.
  • FIG. 23 Alignment of amino acid sequences of AI-1 surface protein GBS 104 from serotype V, strain isolates 2603 and CJB111; serotype III, strain isolates COH1 and NEM316; and serotype II, strain isolate 18RS21.
  • FIG. 24 Alignment of amino acid sequences of AI-2 surface protein GBS 067 from serotype V, strain isolates 2603 and CJB111; serotype 1a, strain isolate 515; serotype II, strain isolate 18RS21; serotype Ib, strain isolate H36B; and serotype III, strain isolate NEM316.
  • FIG. 25 Illustrates that GBS closely associates with tight junctions and cross the monolayer of ME180 cervical epithelial cells by a paracellular route.
  • FIG. 26 Illustrates GBS infection of ME180 cells.
  • FIG. 27 Illustrates that GBS 80 recombinant protein does not bind to epithelial cells.
  • FIG. 28 Illustrates that deletion of GBS 80 does not effect the capacity of GBS strain 2603 V/R to adhere and invade ME180 cervical epithelial cells.
  • FIG. 29 Illustrates binding of recombinant GBS 104 protein to epithelial cells.
  • FIG. 30 Illustrates that deletion of GBS 104 in the GBS strain COH1, reduces the capacity of GBS to adhere to ME180 cervical epithelial cells.
  • FIG. 31 Illustrates that GBS 80 knockout mutant strain partially loses the ability to translocate through an epithelial cell monolayer.
  • FIG. 32 Illustrates that deletion of GBS 104, but not GBS 80, reduces the capacity of GBS to invade J774 macrophage-like cell line.
  • FIG. 33 Illustrates that GBS 104 knockout mutant strain translocates through an epithelial monolayer less efficiently than the isogenic wild type.
  • FIG. 34 Negative stained electron micrographs of GBS serotype III, strain isolate COH1, containing a plasmid insert to over-express GBS 80.
  • FIG. 35 Electron micrographs of surface exposed pili structures on GBS serotype III, strain isolate COH1, containing a plasmid insert to over-express GBS 80, stained with anti-GBS 80 antibodies (visualized with 10 nm gold particles).
  • FIG. 36 Electron micrographs of surface exposed pili structures on GBS serotype III, strain isolate COH1, containing a plasmid insert to over-express GBS 80, stained with anti-GBS 80 antibodies (visualized with 10 nm gold particles).
  • FIG. 37 Electron micrographs of surface exposed pili structures on GBS serotype III, strain isolate COH1, containing a plasmid insert to over-express GBS 80, stained with anti-GBS 80 antibodies (visualized with 20 nm gold particles).
  • FIG. 38 Electron micrographs of surface exposed pili structures on GBS serotype III, strain isolate COH1, containing a plasmid insert to over-express GBS 80, stained with anti-GBS 104 antibodies or preimmune sera (visualized with 10 nm gold particles).
  • FIG. 39 Electron micrographs of surface exposed pili structures on GBS serotype III, strain isolate COH1, containing a plasmid insert to over-express GBS 80, stained with anti-GBS 80 antibodies (visualized with 20 nm gold particles) and anti-GBS 104 antibodies (visualized with 10 nm gold particles).
  • FIG. 40 Electron micrographs of surface exposed pili structures on GBS serotype III, strain isolate COH1, containing a plasmid insert to over-express GBS 80, stained with anti-GBS 80 antibodies (visualized with 20 nm gold particles) and anti-GBS 104 antibodies (visualized with 10 nm gold particles).
  • FIG. 41 Illustrates that GBS 80 is necessary for polymer formation and GBS104 and sortase SAG0648 are necessary for efficient assembly of pili.
  • FIG. 42 Illustrates that GBS 67 is part of a second pilus and that GBS 80 is polymerized in strain 515.
  • FIG. 43 Illustrates that two macro-molecules are visible in Coh1, one of which is the GBS 80 pilin.
  • FIG. 44 Illustrates pilin assembly.
  • FIG. 45 Illustrates that GBS 52 is a minor component of the GBS pilus.
  • FIG. 46 Illustrates that the pilus is found in the supernatant of a bacterial culture.
  • FIG. 47 Illustrates that the pilus is found in the supernatant of bacterial cultures in all phases.
  • FIG. 48 Illustrates that in Coh1, only the GBS 80 protein and one sortase (sag0647 or sag0648) is required for polymerization.
  • FIG. 49 IEM image of GBS 80 staining of a GBS serotype VIII strain JM9030013 that express pili.
  • FIG. 50 IEM image of GBS 104 staining of a GBS serotype VIII strain JM9030013 that express pili.
  • FIG. 51A Schematic depiction of open reading frames comprising a GAS AI-2 serotype M1 isolate, GAS AI-3 serotype M3, M5, M18, and M49 isolates, a GAS AI-4 serotype M12 isolate, and an GAS AI-1 serotype M6 isolate.
  • FIG. 51B Amino acid alignment of SrtC1-type sortase of a GAS AI-2 serotype M1 isolate, SrtC2-type sortases of serotype M3, M5, M118, and M49 isolates, and a SrtC2-type sortase of a GAS AI-4 serotype M12 isolate.
  • FIG. 52 Amino acid alignment of the capsular polysaccharide adhesion proteins of GAS AI-4 serotype M12 (A735), GAS AI-3 serotype M5 (Manfredo), S. pyogenes strain MGAS315 serotype M3, S. pyogenes strain SSI-1 serotype M3, S. pyogenes strain MGAS8232 serotype M3, and GAS AI-2 serotype M1.
  • FIG. 53 Amino acid alignment of F-like fibronectin-binding proteins of GAS AI-4 serotype M12 (A735) and S. pyogenes strain MGAS10394 serotype M6.
  • FIG. 54 Amino acid alignment of F2-like fibronectin-binding proteins of GAS AI-4 serotype M12 (A735), S. pyogenes strain MGAS8232 serotype M3, GAS AI-3 strain M5 (Manfredo), S. pyogenes strain SSI serotype M3, and S. pyogenes strain MGAS315 serotype M3.
  • FIG. 55 Amino acid alignment of fimbrial proteins of GAS AI-4 serotype M12 (A735), GAS AI-3 serotype M5 (Manfredo), S. pyogenes strain MGAS315 serotype M3, S. pyogenes strain SSI serotype M3, S. pyogenes strain MGAS8232 serotype M3, and S. pyogenes M1 GAS serotype M1.
  • FIG. 56 Amino acid alignment of hypothetical proteins of GAS AI-4 serotype M12 (A735), S. pyogenes strain MGAS315 serotype M3, S. pyogenes strain SSI-1 serotype M3, GAS AI-3 serotype M5 (Manfredo), and S. pyogenes strain MGAS8232 serotype M3.
  • FIG. 57 Results of FASTA homology search for amino acid sequences that align with the collagen adhesion protein of GAS AI-1 serotype M6 (MGAS10394).
  • FIG. 58 Results of FASTA homology search for amino acid sequences that align with the fimbrial structural subunit of GAS AI-1 serotype M6 (MGAS10394).
  • FIG. 59 Results of FASTA homology search for amino acid sequences that align with the hypothetical protein of GAS AI-2 serotype M1 (SF370).
  • FIG. 60 Specifies pilin and E box motifs present in GAS type 3 and 4 adhesin islands.
  • FIG. 61 Illustrates that surface expression of GBS 80 protein on GBS strains COH and JM9130013 correlates with formation of pili structures.
  • Surface expression of GBS 80 was determined by FACS analysis using an antibody that cross-hybridizes with GBS 80. Formation of pili structures was determined by immunogold electron microscopy using gold-labelled anti-GBS 80 antibody.
  • FIG. 62 Illustrates that surface exposure is capsule-dependent for GBS 322 but not for GBS 80.
  • FIG. 63 Illustrates the amino acid sequence identity of GBS 59 proteins in GBS strains.
  • FIG. 64 Western blotting of whole GBS cell extracts with anti-GBS 59 antibodies.
  • FIG. 65 Western blotting of purified GBS 59 and whole GBS cell extracts with anti-GBS 59 antibodies.
  • FIG. 66 FACS analysis of GBS strains CJB111, 7357B, 515 using GBS 59 antiserum.
  • FIG. 67 Illustrates that anti-GBS 59 antibodies are opsonic for CJB111 GBS strain serotype V.
  • FIG. 68 Western blotting of GBS strain JM9130013 total extracts.
  • FIG. 69 Western blotting of GBS stain 515 total extracts shows that GBS 67 and GBS 150 are parts of a pilus.
  • FIG. 70 Western blotting of GBS strain 515 knocked out for GBS 67 expression
  • FIG. 71 FACS analysis of GBS strain 515 and GBS strain 515 knocked out for GBS 67 expression using GBS 67 and GBS 59 antiserum.
  • FIG. 72 Illustrates complementation of GBS 515 knocked out for GBS 67 expression with a construct overexpressing GBS 80.
  • FIG. 73 FACS analysis of GAS serotype M6 for spyM6 — 0159 surface expression.
  • FIG. 74 FACS analysis of GAS serotype M6 for spyM6 — 0160 surface expression.
  • FIG. 75 FACS analysis of GAS serotype M1 for GAS 15 surface expression.
  • FIG. 76 FACS analysis of GAS serotype M1 for GAS 16 surface expression using a first anti-GAS 16 antiserum.
  • FIG. 77 FACS analysis of GAS serotype M1 for GAS 18 surface expression using a first anti-GAS 18 antiserum.
  • FIG. 78 FACS analysis of GAS serotype M1 for GAS 18 surface expression using a second anti-GAS 18 antiserum.
  • FIG. 79 FACS analysis of GAS serotype M1 for GAS 16 surface expression using a second anti-GAS 16 antisera.
  • FIG. 80 FACS analysis of GAS serotype M3 for spyM3 — 0098 surface expression.
  • FIG. 81 FACS analysis of GAS serotype M3 for spyM3 — 0100 surface expression.
  • FIG. 82 FACS analysis of GAS serotype M3 for spyM3 — 0102 surface expression.
  • FIG. 83 FACS analysis of GAS serotype M3 for spyM3 — 0104 surface expression.
  • FIG. 84 FACS analysis of GAS serotype M3 for spyM3 — 0106 surface expression.
  • FIG. 85 FACS analysis of GAS serotype M12 for 19224134 surface expression.
  • FIG. 86 FACS analysis of GAS serotype M12 for 19224135 surface expression.
  • FIG. 87 FACS analysis of GAS serotype M12 for 19224137 surface expression.
  • FIG. 88 FACS analysis of GAS serotype M12 for 19224141 surface expression.
  • FIG. 89 Western blot analysis of GAS 15 expression on GAS M1 bacteria.
  • FIG. 90 Western blot analysis of GAS 15 expression using GAS 15 immune sera.
  • FIG. 91 Western blot analysis of GAS 15 expression using GAS 15 pre-immune sera.
  • FIG. 92 Western blot analysis of GAS 16 expression on GAS M1 bacteria.
  • FIG. 93 Western blot analysis of GAS 16 expression using GAS 16 immune sera.
  • FIG. 94 Western blot analysis of GAS 16 expression using GAS 16 pre-immune sera.
  • FIG. 95 Western blot analysis of GAS 18 on GAS M1 bacteria.
  • FIG. 96 Western blot analysis of GAS 18 using GAS 18 immune sera.
  • FIG. 97 Western blot analysis of GAS 18 using GAS 18 pre-immune sera.
  • FIG. 98 Western blot analysis of M6_Spy0159 expression on GAS bacteria.
  • FIG. 99 Western blot analysis of 19224135 expression on M12 GAS bacteria.
  • FIG. 100 Western blot analysis of 19224137 expression on M12 GAS bacteria.
  • FIG. 101 Full length nucleotide sequence of an S. pneumoniae strain 670 ⁇ l.
  • FIG. 102 Western blot analysis of GAS 15, GAS 16, and GAS 18 in GAS M1 strain 2580.
  • FIG. 103 Western blot analysis of GAS 15, GAS 16, and GAS 18 in GAS M1 strain 2913.
  • FIG. 104 Western blot analysis of GAS 15, GAS 16, and GAS 18 in GAS M1 strain 3280.
  • FIG. 105 Western blot analysis of GAS 15, GAS 16, and GAS 18 in GAS M1 strain 3348.
  • FIG. 106 Western blot analysis of GAS 15, GAS 16, and GAS 18 in GAS M1 strain 2719.
  • FIG. 107 Western blot analysis of GAS 15, GAS 16, and GAS 18 in GAS M1 strain SF370.
  • FIG. 108 Western blot analysis of 19224135 and 19224137 in GAS M12 strain 2728.
  • FIG. 109 Western blot analysis of 19224139 in GAS M12 strain 2728 using antisera raised against SpyM3 — 0102.
  • FIG. 110 Western blot analysis of M6_Spy0159 and M6_Spy0160 in GAS M6 strain 2724.
  • FIG. 111 Western blot analysis of M6 Spy0159 and M6 Spy0160 in GAS M6 strain SF370.
  • FIG. 112 Western blot analysis of M6_Spy160 in GAS M6 strain 2724.
  • FIGS. 113 - 115 Electron micrographs of surface exposed GAS 15 on GAS M1 strain SF370.
  • FIGS. 116 - 121 Electron micrographs of surface exposed GAS 16 on GAS M1 strain SF370.
  • FIGS. 122 - 125 Electron micrographs of surface exposed GAS 18 on GAS M1 strain SF370 detected using anti-GAS 18 antisera.
  • FIG. 126 IEM image of a hyperoligomer on GAS M1 strain SF370 detected using anti-GAS 18 antisera.
  • FIGS. 127 - 132 IEM images of oligomeric and hyperoligomeric structures containing M6_Spy0160 extending from the surface of GAS serotype M6 3650.
  • FIGS. 133A and B Western blot analysis of L. lactis transformed to express GBS 80 with anti-GBS 80 antiserum.
  • FIG. 134 Western blot analyses of L. lactis transformed to express GBS AI-1 with anti-GBS 80 antiserum.
  • FIG. 135 Ponceau staining of same acrylamide gel as used in FIG. 134 .
  • FIG. 136A Western blot analysis of sonicated pellets and supernatants of cultured L. lactis transformed to express GBS AI-1 polypeptides using anti-GBS 80 antiserum.
  • FIG. 136B Polyacrylamide gel electrophoresis of sonicated pellets and supernatants of cultured L. lactis transformed to express GBS AI polypeptides.
  • FIG. 137 Depiction of an example S. pneumoniae AI locus.
  • FIG. 138 Schematic of primer hybridization sites within the S. pneumoniae AI locus of FIG. 137 .
  • FIG. 139A The set of amplicons produced from the S. pneumoniae strain TIGR4 AI locus.
  • FIG. 139B Base pair lengths of amplicons produced from FIG. 139A primers in S. pneumoniae strain TIGR4.
  • FIG. 140 CGH analysis of S. pneumoniae strains for the AI locus.
  • FIG. 141 Amino acid sequence alignment of polypeptides encoded by AI orf 2 in S. pneumoniae AI-positive strains.
  • FIG. 142 Amino acid sequence alignment of polypeptides encoded by AI orf 3 in S. pneumoniae AI-positive strains.
  • FIG. 143 Amino acid sequence alignment of polypeptides encoded by AI orf 4 in S. pneumoniae AI-positive strains.
  • FIG. 144 Amino acid sequence alignment of polypeptides encoded by AI orf 5 in S. pneumoniae AI-positive strains.
  • FIG. 145 Amino acid sequence alignment of polypeptides encoded by AI orf 6 in S. pneumoniae AI-positive strains.
  • FIG. 146 Amino acid sequence alignment of polypeptides encoded by AI orf 7 in S. pneumoniae AI-positive strains.
  • FIG. 147 Amino acid sequence alignment of polypeptides encoded by AI orf 8 in S. pneumoniae AI-positive strains.
  • FIG. 148 Diagram comparing amino acid sequences of RrgA in S. pneumoniae strains.
  • FIG. 149 Amino acid sequence comparison of RrgB S. pneumoniae strains.
  • FIG. 150A Sp0462 amino acid sequence.
  • FIG. 150B Primers used to produce a clone encoding the Sp0462 polypeptide.
  • FIG. 151A Schematic depiction of recombinant Sp0462 polypeptide.
  • FIG. 151B Schematic depiction of full-length Sp0462 polypeptide.
  • FIG. 152A Western blot probed with serum obtained from S. pneumoniae -infected patients for Sp0462.
  • FIG. 152B Western blot probed with GBS 80 serum for Sp0462.
  • FIG. 153A Sp0463 amino acid sequence.
  • FIG. 153B Primers used to produce a clone encoding the Sp0463 polypeptide.
  • FIG. 154A Schematic depiction of recombinant Sp0463 polypeptide.
  • FIG. 154B Schematic depiction of full-length Sp0463 polypeptide.
  • FIG. 155 Western blot detection of recombinant Sp0463 polypeptide.
  • FIG. 156 Western blot detection of high molecular weight Sp0463 polymers.
  • FIG. 157A Sp0464 amino acid sequence.
  • FIG. 157B Primers used to produce a clone encoding the Sp0464 polypeptide.
  • FIG. 158A Schematic depiction of recombinant Sp0464 polypeptide.
  • FIG. 158B Schematic depiction of full-length Sp0464 polypeptide.
  • FIG. 159 Western blot detection of recombinant Sp0464 polypeptide.
  • FIG. 160 Amplification products prepared for production of Sp0462, Sp0463, and Sp0464 clones.
  • FIG. 161 Opsonic killing by anti-sera raised against L. lactis expressing GBS AI
  • FIG. 162 Schematic depicting GAS adhesin islands GAS AI-1, GAS AI-2, GAS AI-3 and GAS AI-4.
  • FIGS. 163 A-D Immunoblots of cell-wall fractions of GAS strains with antisera specific for LPXTG proteins of M6_ISS3650 (A), M1_SF370 (B), M5_ISS4883 (C) and M12 — 20010296 (D).
  • FIGS. 163 E-H Immunoblots of cell-wall fractions of deletion mutants M1_SF370 ⁇ 128 (E) M1_SF370 ⁇ 130 (F) M1_SF370 ⁇ SrtC1 (G) and the M1 — 128 deletion strain complemented with plasmid pAM::128 which contains the M1 — 128 gene (H) with antisera specific for the pilin components of M1_SF370.
  • FIGS. 163 I-N Immunogold labelling and transmission electron microscopy of: T6 (I) and Cpa (J) in M6_ISS3650; M1 — 128 in M1_SF370 (K) and deletion strain M1_SF370 ⁇ 128 (N); M5_orf80 in M5_ISS4883 (L); M12_EftLSL.A in M12 — 20010296 (M).
  • FIG. 164 Schematic representation of the FCT region from 7 GAS strains
  • FIGS. 165 A-H Flow cytometry of GAS bacteria treated or not with trypsin and stained with sera specific for the major pilus component. Preimmune staining; black lines, untreated bacteria; green lines and trypsin treated bacteria; blue lines.
  • FIGS. 166 A-C Immunoblots of recombinant pilin components with polyvalent Lancefield T-typing sera. The recombinant proteins are shown above the blot and the sera pool used is shown below the blot.
  • FIGS. 166 D-G Immunoblots of pilin proteins with monovalent T-typing sera. The recombinant proteins are shown below the blot and the sera used above the blot.
  • FIG. 166 H and I Flow cytometry analysis of strain M1_SF370 (H) and the deletion strain M1_SF370 ⁇ 128 (I) with T-typing antisera pool T.
  • FIG. 167 Chart describing the number and type of sortase sequences identified within GAS AIs.
  • FIG. 168 A Immunogold-electronmicroscopy of L. lactis lacking an expression construct for GBS AI-1 using anti-GBS 80 antibodies.
  • FIG. 168 B and C Immunogold-electronmicroscopy detects GBS 80 in oligomeric (pilus) structures on surface of L. lactis transformed to express GBS AI-1
  • FIG. 169 FACS analysis detects expression of GBS 80 and GBS 104 on the surface of L. lactis transformed to express GBS AI-1.
  • FIG. 170 Phase contrast microscopy and immuno-electronmicroscopy shows that expression of GBS AI-1 in L. lactis induces L. lactis aggregation.
  • FIG. 171 Purification of GBS pili from L. lactis transformed to express GBS AI-1.
  • FIG. 172 Schematic depiction of GAS M6 (AI-1), M1 (AI-2), and M12 (AI-4) adhesin islands and portions of the adhesin islands inserted in the pAM401 construct for expression in L. lactis.
  • FIG. 173 A-C Western blot analysis showing assembly of GAS pili in L. lactis expressing GAS AI-2 (M1) (A), GAS AI-4 (M12) (B), and GAS AI-1(M6) (C).
  • FIG. 174 FACS analysis of GAS serotype M6 for M6_Spy0157 surface expression.
  • FIG. 175 FACS analysis of GAS serotype M12 for 19224139 surface expression.
  • FIG. 176 A-E Immunogold electron microscopy using antibodies against M6_Spy0160 detects pili on the surface of M6 strain 2724.
  • FIG. 176 F Immunogold electron microscopy using antibodies against M6_Spy0159 detects M6_Spy0159 surface expression on M6 strain 2724.
  • FIG. 177 A-C Western blot analysis of M1 strain SF370 GAS bacteria individually deleted for M1 — 130, SrtC1, or M1 — 128 using anti-M1 — 130 serum (A), anti-M1 — 128 serum (B), and anti-M1 — 126 serum (C).
  • FIG. 178 A-C Immunogold electron microscopy using antibodies against M1 — 128 to detect surface expression on wildtype strain SF370 bacteria (A), M1 — 128 deleted SF370 bacteria (B), and SrtC1 deleted SF370 bacteria (C).
  • FIG. 179 A-C FACS analysis to detect expression of M1 — 1126 (A), M1 — 128 (B), and M1 — 130 (C) on the surface of wildtype SF370 GAS bacteria.
  • FIG. 179 D-F FACS analysis to detect expression of M1 — 126 (D), M1 — 128 (E), and M1 — 130 (F) on the surface of M1 — 128 deleted SF370 GAS bacteria.
  • FIG. 179 G-I FACS analysis to detect expression of M1 — 126 (G), M1 — 128 (H), and M1 — 130 (I) on the surface of SrtC1 deleted SF370 GAS bacteria.
  • FIG. 180 A and B FACS analysis of wildtype (A) and LepA deletion mutant (B) strains of SF370 bacteria for M1 surface expression.
  • FIG. 181 Western blot analysis detects high molecular weight polymers in S. pneumoniae TIGR4 using anti-RrgB antisera.
  • FIG. 182 Detection of high molecular weight polymers in S. pnuemoniae rlrA positive strains.
  • FIG. 183 Detection of high molecular weight polymers in S. pneumoniae TIGR4 by silver staining and Western blot analysis using anti-RrgB antisera.
  • FIG. 184 Deletion of S. pneumoniae TIGR4 adhesin island sequences interferes with the ability of S. pneumoniae to adhere to A549 alveolar cells.
  • FIG. 185 Negative staining of S. pneumoniae strain TIGR4 showing abundant pili on the bacterial surface.
  • FIG. 186 Negative staining of strain TIGR4 deleted for rrgA-srtD adhesin island sequences showing no pili on the bacterial surface
  • FIG. 187 Negative staining of the TIGR4 mgrA mutant showing abundant pili on the bacterial surface.
  • FIG. 188 Negative staining of the negative control TIGR4 mgrA mutant deleted for adhesin island sequences rrgA-srtD showing no pili on the bacterial surface.
  • FIG. 189 Immuno-gold labelling of S. pneumoniae strain TIGR4 grown on blood agar solid medium using ⁇ -RrgB (5 nm) and ⁇ -RrgC (10 nm). Bar represents 200 nm.
  • FIG. 190 A and B Detection of expression and purification of S. pneumoniae RrgA protein by SDS-PAGE (A) and Western blot analysis (B).
  • FIG. 191 Detection of RrgB by antibodies produced in mice.
  • FIG. 192 Detection of RrgC by antibodies produced in mice.
  • FIG. 193 Purification of S. pneumoniae TIGR 4 pili by a cultivation and digestion method and detection of the purified TIGR4 pili.
  • FIG. 194 Purification of S. pneumoniae TIGR 4 pili by a sucrose gradient centrifugation method and detection of the purified TIGR4 pili.
  • FIG. 195 Purification of S. pneumoniae TIGR 4 pili by a gel filtration method and detection of the purified TIGR4 pili.
  • FIG. 196 Alignment of full length S. pneumoniae adhesin island sequences from ten S. pneumoniae strains.
  • FIG. 197 A Schematic of GBS AI-1 coding sequences.
  • FIG. 197 B Nucleotide sequence of intergenic region between AraC and GBS 80 (SEQ ID NO: 273.
  • FIG. 197 C FACS analysis results for GBS 80 expression in GBS strains having different length polyA tracts in the intergenic region between AraC and GBS 80.
  • FIG. 198 Table comparing the percent identity of surface proteins encoded by a serotype M6 (harbouring a GAS AI-1) adhesin island relative to other GAS serotypes harbouring an adhesin island.
  • FIG. 199 Table comparing the percent identity of surface proteins encoded by a serotype M1 (harbouring a GAS AI-2) adhesin island relative to other GAS serotypes harbouring an adhesin island.
  • FIG. 200 Table comparing the percent identity of surface proteins encoded by serotypes M3, M18, M5, and M49 (harbouring GAS AI-3) adhesin islands relative to other GAS serotypes harbouring an adhesin island.
  • FIG. 201 Table comparing the percent identity of surface proteins encoded by a serotype M12 (harbouring a GAS AI-1) adhesin island-relative to other GAS serotypes harbouring an adhesin island.
  • FIG. 202 GBS 80 recombinant protein does not bind to epithelial cells.
  • FIG. 203 Deletion of GBS 80 protein does not affect the ability of GBS to adhere and invade ME180 cervical epithelial cells.
  • FIG. 204 GBS 80 binds to extracellular matrix proteins.
  • FIG. 205 Deletion of GBS 104 protein, but not GBS 80, reduces the capacity of GBS to invade J774 macrophage-like cells
  • FIG. 206 GBS 104 knockout mutant strains of bacteria translocate through an epithelial monolayer less efficiently that the isogenic wild type strain.
  • FIG. 207 GBS 80 knockout mutant strains of bacteria partially lose the ability to translocate through an epithelial monolayer.
  • FIG. 208 GBS adherence to HUVEC endothelial cells.
  • FIG. 209 Strain growth rate of wildtype, GBS 80-deleted, or GBS 104 deleted COH1 GBS.
  • FIG. 210 Binding of recombinant GBS 104 protein to epithelial cells by FACS analysis.
  • FIG. 211 Deletion of GBS 104 protein in the GBS strain COH1 reduces the ability of GBS to adhere to ME180 cervical epithelial cells.
  • FIG. 212 COH1 strain GBS overexpressing GBS 80 protein has an impaired capacity to translocate through an epithelial monolayer.
  • FIG. 213 Scanning electron microscopy shows that overexpression of GBS 80 protein on COH1 strain GBS enhances the capacity of the COH1 bacteria to form microcolonies on epithelial cells.
  • FIG. 214 Confocal imaging shows that overexpression of GBS 80 proteins on COH1 strain GBS enhances the capacity of the COH1 bacteria to form microcolonies on epithelial cells.
  • FIG. 215 Detection of GBS 59 on the surface of GBS strain 515 by immuno-electron microscopy.
  • FIG. 216 Detection of GBS 67 on the surface of GBS strain 515 by immuno-electron microscopy.
  • FIG. 217 GBS 67 binds to fibronectin.
  • FIG. 218 Western blot analysis shows that deletion of both GBS AI-2 sortase genes abolishes assembly of the pilus.
  • FIG. 219 FACS analysis shows that deletion of both GBS AI-2 sortase genes abolishes assembly of the pilus.
  • FIG. 220 A-C Western blot analysis shows that GBS 59, GBS 67, and GBS 150 form high molecular weight complexes.
  • FIG. 221 A-C Western blot analysis shows that GBS 59 is required for polymer formation of GBS 67 and GBS 150.
  • FIG. 222 FACS analysis shows that GBS 59 is required for surface exposure of GBS 67.
  • FIG. 223 Summary Western blots for detection of GBS 59, GBS 67, or GBS 150 in GBS 515 and GBS 515 mutant strain.
  • FIG. 224 Description of GBS 59 Allelic variants.
  • FIG. 225 GBS 59 is opsonic only against a strain of GBS expressing a homologous GBS 59.
  • FIG. 226 A and B Results of FACS analysis for surface expression of GBS 59 using antibodies specific for different GBS 59 isoforms.
  • FIG. 227 A and B Results of FACS analysis for surface expression of GBS 80, GBS 104, GBS 322, GBS 67, and GBS 59 on 41 various strains of GBS bacteria.
  • FIG. 228 Results of FACS analysis for surface expression of GBS 80, GBS 104, GBS 322, GBS 67, and GBS 59 on 41 strains of GBS bacteria obtained from the CDC.
  • FIG. 229 Expected immunogenicity coverage of different combinations of GBS 80, GBS 104, GBS 322, GBS 67, and GBS 59 across strains of GBS bacteria.
  • FIG. 230 GBS 59 opsonophagocytic activity is comparable to that of a mixture of GBS 80, GBS 104, GBS 322 and GBS 67.
  • FIG. 231 A-C Schematic presentation of example hybrid GBS AIs.
  • FIG. 232 Schematic presentation of an example hybrid GBS AI.
  • FIG. 233 A and B Western blot and FACS analysis detect expression of GBS 80 and GBS 67 on the surface of L. lactis transformed with a hybrid GBS AI.
  • FIG. 234 A-E Hybrid GBS AI cloning strategy.
  • FIG. 235 High magnification of S. pneumoniae strain TIGR4 pili double labeled with ⁇ -RrgB (5 nm) and ⁇ -RrgC (10 nm). Bar represents 100 nm.
  • FIG. 236 Immuno-gold labeling of the S. pneumoniae TIGR4 rrgA-srtD deletion mutant with no visible pili on the surface detectable by ⁇ -RrgB- and ⁇ -RrgC. Bar represents 200 nm.
  • FIG. 237 Variability in GBS 67 amino acid sequences between strains 2603 and H36B.
  • FIG. 238 Strain variability in GBS 67 amino acid sequences of allele I (2603).
  • FIG. 239 Stran variability in GBS 67 amino acid sequence of allele II (H36B).
  • an “Adhesin Island” or “AI” refers to a series of open reading frames within a bacterial genome, such as the genome for Group A or Group B Streptococcus or other gram positive bacteria, that encodes for a collection of surface proteins and sortases.
  • An Adhesin Island may encode for amino acid sequences comprising at least one surface protein.
  • the Adhesin Island may encode at least one surface protein.
  • an Adhesin Island may encode for at least two surface proteins and at least one sortase.
  • an Adhesin Island encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • One or more AI surface proteins may participate in the formation of a pilus structure on the surface of the gram positive bacteria.
  • Adhesin Islands of the invention preferably include a divergently transcribed transcriptional regulator (i.e., the transcriptional regulator is located near or adjacent to the AI protein open reading frames, but it transcribed in the opposite direction).
  • the transcriptional regulator may regulate the expression of the AI operon.
  • AI-1 comprises a series of approximately five open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“AI-1 proteins”). Specifically, AI-1 includes open reading frames encoding for two or more (i.e., 2, 3, 4 or 5) of GBS 80, GBS 104, GBS 52, SAG0647 and SAG0648.
  • One or more of the AI-1 open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the AI-1 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • AI-1 typically resides on an approximately 16.1 kb transposon-like element frequently inserted into the open reading frame for trmA.
  • One or more of the AI-1 surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) motif or other sortase substrate motif.
  • the AI surface proteins of the invention may affect the ability of the GBS bacteria to adhere to and invade epithelial cells.
  • AI surface proteins may also affect the ability of GBS to translocate through an epithelial cell layer.
  • one or more AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • AI-1 sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • AI-1 may encode for at least one surface protein.
  • AI-1 may encode for at least two surface exposed proteins and at least one sortase.
  • AI-1 encodes for at least three surface exposed proteins and at least two sortases.
  • the AI-1 protein preferably includes GBS 80 or a fragment thereof or a sequence having sequence identity thereto.
  • an LPXTG motif represents an amino acid sequence comprising at least five amino acid residues.
  • the motif includes a leucine (L) in the first amino acid position, a proline (P) in the second amino acid position, a threonine (T) in the fourth amino acid position and a glycine (G) in the fifth amino acid position.
  • the third position, represented by X may be occupied by any amino acid residue.
  • the X is occupied by lysine (K), Glutamate (E), Asparagine (N), Glutamine (Q) or Alanine (A).
  • the X position is occupied by lysine (K).
  • one of the assigned LPXTG amino acid positions is replaced with another amino acid.
  • such replacements comprise conservative amino acid replacements, meaning that the replaced amino acid residue has similar physiological properties to the removed amino acid residue.
  • Genetically encoded amino acids may be divided into four families based on physiological properties: (1) acidic (asparatate and glutamate), (2) basic (lysine, arginine, histitidine), (3) non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophane) and (4) uncharged polar (glycine, asparagines, glutamine, cysteine, serine, threonine, and tyrosine).
  • Phenylalanine, tryptophan and tyrosine are sometimes classified jointly as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of a leucine with an isoleucine or valine, an asparate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on the biological activity.
  • the first amino acid position of the LPXTG motif may be replaced with another amino acid residue.
  • the first amino acid residue (leucine) is replaced with an alanine (A), valine (V), isoleucine (I), proline (P), phenylalanine (F), methionine (M), glutamic acid (E), glutamine (Q), or tryptophan (Y) residue.
  • the first amino acid residue is replaced with an isoleucine (I).
  • the second amino acid residue of the LPXTG motif may be replaced with another amino acid residue.
  • the second amino acid residue praline (P) is replaced with a valine (V) residue.
  • the fourth amino acid residue of the LPXTG motif may be replaced with another amino acid residue.
  • the fourth amino acid residue (threonine) is replaced with a serine (S) or an alanine (A).
  • an LPXTG motif may be represented by the amino acid sequence XXXXG, in which X at amino acid position 1 is an L, a V, an E, an I, an F, or a Q; X at amino acid position 2 is a P if X at amino acid position 1 is an L, an I, or an F; X at amino acid position 2 is a V if X at amino acid position 1 is a E or a Q; X at amino acid position 2 is a V or a P if X at amino acid position 1 is a V; X at amino acid position 3 is any amino acid residue; X at amino acid position 4 is a T if X at amino acid position 1 is a V, E, I, F, or Q; and X at amino acid position 4 is a T, S, or A if X at amino acid position 1 is an L.
  • the LPXTG motif of a GBS AI protein may be represented by the amino acid sequence XPXTG, in which X at amino acid position 1 is L, I, or F, and X at amino acid position 3 is any amino acid residue.
  • Specific examples of LPXTG motifs in GBS AI proteins may include LPXTG (SEQ ID NO: 122) or IPXTG (SEQ ID NO: 133).
  • the threonine in the fourth amino acid position of the LPXTG motif may be involved in the formation of a bond between the LPXTG containing protein and a cell wall precursor. Accordingly, in preferred LPXTG motifs, the threonine in the fourth amino acid position is not replaced with another amino acid or, if the threonine is replaced, the replacement amino acid is preferably a conservative amino acid replacement, such as serine.
  • the AI surface proteins of the invention may contain alternative sortase substrate motifs such as NPQTN (SEQ ID NO: 142), NPKTN (SEQ ID NO: 168), NPQTG (SEQ ID NO: 169), NPKTG (SEQ ID NO: 170), XPXTGG (SEQ ID NO: 143), LPXTAX (SEQ ID NO: 144), or LAXTGX (SEQ ID NO: 145). (Similar conservative amino acid substitutions can also be made to these membrane motifs).
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the AI surface proteins may be polymerized into pili by sortase-catalysed transpeptidation. (See FIG. 44 .) Cleavage of AI surface proteins by sortase between the threonine and glycine residues of an LPXTG motif yields a thioester-linked acyl intermediate of sortase.
  • Many AI surface proteins include a pilin motif amino acid sequence which interacts with the sortase and LPXTG amino acid sequence. The first lysine residue in a pilin motif can serve as an amino group acceptor of the cleaved LPXTG motif and thereby provide a covalent linkage between AI subunits to form pili.
  • the pilin motif can make a nucleophilic attack on the acyl enzyme providing a covalent linkage between AI subunits to form pili and regenerate the sortase enzyme.
  • pilin motifs may include ((YPKN(X 10 )K; SEQ ID NO: 146), (YPKN(X 9 )K; SEQ ID NO: 147), (YPK(X 7 )K; SEQ ID NO: 148), (YPK(X 11 )K; SEQ ID NO: 149), or (PKN(X 9 )K; SEQ ID NO: 150)).
  • the AI surface proteins of the invention include a pilin motif amino acid sequence.
  • AI surface proteins of the invention will contain an N-terminal leader or secretion signal to facilitate translocation of the surface protein across the bacterial membrane.
  • Group B Streptococci are known to colonize the urinary tract, the lower gastrointestinal tract and the upper respiratory tract in humans.
  • Electron micrograph images of GBS infection of a cervical epithelial cell line (ME180) are presented in FIG. 25 . As shown in these images, the bacteria closely associate with tight junctions between the cells and appear to cross the monolayer by a paracellular route. Similar paracellular invasion of ME180 cells is also shown in the contrast images in FIG. 26 .
  • the AI surface proteins of the invention may effect the ability of the GBS bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of GBS to translocate through an epithelial cell layer. Preferably, one or more AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • AI-1 surface protein GBS 104 can bind epithelial cells such as ME180 human cervical cells, A549 human lung cells and Caco2 human intestinal cells (See FIGS. 29 and 210 ). Further, deletion of the GBS 104 sequence in a GBS strain reduces the capacity of GBS to adhere to ME180 cervical epithelial cells. (See FIGS. 30 and 211 ). Deletion of GBS 104 also reduces the capacity of GBS to invade J774 macrophage-like cells. (See FIGS. 32 and 205 ). Deletion of GBS 104 also causes GBS to translocate through epithelial monolayers less efficiently. See FIG. 206 . GBS 104 protein therefore appears to bind to ME180 epithelial cells and to have a role in adhesion to epithelial cells and macrophage cell lines.
  • GBS 80 knockout mutant strains also partially lose the ability to translocate through an epithelial monolayer. See FIG. 207 . Deletion of either GBS 80 or GBS 104 in COH1 cells diminishes adherence to HUVEC endothelial cells. See FIG. 208 . Deletion of GBS 80 or GBS 104 in COH1 does not, however, affect growth of COH1 either with ME180 cells or in incubation medium (IM). See FIG. 209 . Both GBS 80 and GBS 104, therefore, appear to be involved in translocation of GBS through epithelial cells.
  • IM incubation medium
  • GBS 80 does not appear to bind to epithelial cells. Incubation of epithelial cells in the presence of GBS 80 protein followed by FACS analysis using an anti-GBS 80 polyclonal antibody did not detect GBS 80 binding to the epithelial cells. See FIG. 202 . Furthermore, deletion of GBS 80 protein does not affect the ability of GBS to adhere and invade ME180 cervical epithelial cells. See FIG. 203
  • one or more of the surface proteins may bind to one or more extracellular matrix (ECM) binding proteins, such as fibrinogen, fibronectin, or collagen.
  • ECM extracellular matrix
  • GBS 80 one of the AI-1 surface proteins, can bind to the extracellular matrix binding proteins fibronectin and fibrinogen. While GBS 80 protein apparently does not bind to certain epithelial cells or affect the capacity of a GBS bacteria to adhere to or invade cervical epithelial cells (See FIGS. 27 and 28 ), removal of GBS 80 from a wild type strain decreases the ability of that strain to translocate through an epithelial cell layer (see FIG. 31 ).
  • GBS 80 may also be involved in formation of biofilms.
  • COH1 bacteria overexpressing GBS 80 protein have an impaired ability to translocate through an epithelial monolayer. See FIG. 212 . These COH1 bacteria overexpressing GBS 80 form microcolonies on epithelial cells. See FIGS. 213 and 214 . These microcolonies may be the initiation of biofilm development.
  • AI Surface proteins may also demonstrate functional homology to previously identified adhesion proteins or extracellular matrix (ECM) binding proteins.
  • GBS 80 a surface protein in AI-1, exhibits some functional homology to FimA, a major fimbrial subunit of a Gram positive bacteria A. naeslundii .
  • FimA is thought to be involved in binding salivary proteins and may be a component in a fimbrae on the surface of A. naeslundii . See Yeung et al. (1997) Infection & Immunity 65:2629-2639; Yeunge et al (1998) J. Bacteriol 66:1482-1491; Yeung et al. (1988) J. Bacteriol 170:3803-3809; and Li et al. (2001) Infection & Immunity 69:7224-7233.
  • diphtheriae pilus proteins and is thought to be involved in sortase catalized oligomerization of the subunits involved in the C. diphtheriae pilus structure.
  • the C. diphtheriae pilin subunit SpaA is thought to occur by sortase-catalyzed amide bond cross-linking of adjacent pilin subunits.
  • the conserved lysine within the SpaA pilin motif might function as an amino group acceptor of cleaved sorting signals, thereby providing for covalent linkages of the C. diphtheria pilin subunits. See FIG. 6 ( d ) of Ton-That et al., Molecular Microbiology (2003) 50(4): 1429-1438.)
  • E box comprising a conserved glutamic acid residue has also been identified in the C. diphtheria pilin associated proteins as important in C. diphtheria pilin assembly.
  • the E box motif generally comprises YxLxETxAPxGY (SEQ ID NO: 152; where x indicates a varying amino acid residue).
  • the conserved glutamic acid residue within the E box is thought necessary for C. diphtheria pilus formation.
  • the AI-1 polypeptides of the immunogenic compositions comprise an E box motif.
  • E box motifs in the AI-1 polypeptides may include the amino acid sequences YxLxExxxxxGY (SEQ ID NO: 153), YxLxExxxPxGY (SEQ ID NO: 154), or YxLxETxAPxGY (SEQ ID NO: 152).
  • the E box motif of the polypeptides may comprise the amino acid sequences YKLKETKAPEGY (SEQ ID NO: 155), YVLKEIETQSGY (SEQ ID NO: 156), or YKLYEISSPDGY (SEQ ID NO: 157).
  • GBS 80 As discussed in more detail below, a pilin motif containing a conserved lysine residue and an E box motif containing a conserved glutamic acid residue have both been identified in GBS 80.
  • FIG. 34 presents electron micrographs of GBS serotype III, strain isolate COH1 with a plasmid insert to facilitate the overexpression of GBS 80. This EM photo was produced with a standard negative stain—no pilus structures are distinguishable.
  • the use of such AI surface proteins in immunogenic compositions for the treatment or prevention of infection against a Gram positive bacteria has not been previously described.
  • FIGS. 11, 16 and 17 show the presence of pilus structures in wild type COH1 Streptococcus agalactiae .
  • FIG. 49 shows that GBS 80 is associated with pili in a wild type clinical isolate of S. agalactiae , JM9030013. (See FIG. 49 .)
  • mutant GBS strains containing a plasmid comprising the GBS 80 sequence resulting in the overexpression of GBS 80 within this mutant The electron micrographs of FIGS. 13-15 are also stained against GBS 80 and reveal long, oligomeric structures containing GBS 80 which appear to cover portions of the surface of the bacteria and stretch far out into the supernatant.
  • FIG. 61 provides FAC analysis of GBS 80 surface levels on bacterial strains COH1 and JM9130013 using an anti-GBS 80 antisera. Immunogold electron microscopy of the COH1 and JM9130013 bacteria using anti-GBS 80 antisera demonstrates that JM9130013 bacteria, which have higher values for GBS 80 surface expression, also form longer pili structures.
  • FIG. 62 provides FACS analysis of capsulated and uncapsulated GBS analyzed with anti-GBS 80 and anti-GBS 322 antibodies. Surface exposure of GBS 80, unlike GBS 322, is not capsule dependent.
  • Adhesin Island surface protein such as GBS 80 appears to be required for pili formation, as well as an Adhesin Island sortase.
  • Pili are formed in Coh1 bacterial clones that overexpress GBS 80, but lack GBS 104, or one of the AI-1 sortases sag0647 or sag0648.
  • pili are not formed in Coh1 bacterial clones that overexpress GBS 80 and lack both sag0647 and sag0648.
  • GBS 80 in GBS strain 515 which lacks an AI-1, also assembles GBS 80 into pili.
  • GBS strain 515 contains an AI-2, and thus AI-2 sortases.
  • the AI-2 sortases in GBS strain 515 apparently polymerize GBS 80 into pili.
  • FIG. 42 Overexpression of GBS 80 in GBS strain 515 cell knocked out for GBS 67 expression also apparently polymerizes GBS 80 into pili. (See FIG. 72 .)
  • GBS 80 appears to be required for GBS AI-1 pili formation
  • GBS 104 and sortase SAG0648 appears to be important for efficent AI-1 pili assembly.
  • high-molecular structures are not assembled in isogenic COH1 strains which lack expression of GBS 80 due to gene disruption and are less efficiently assembled in isogenic COH1 strains which lack the expression of GBS 104 (see FIG. 41 ).
  • This GBS strain comprises high molecular weight pili structures composed of covalently linked GBS 80 and GBS 104 subunits.
  • deleting SAG0648 in COH1 bacteria interferes with assembly of some of the high molecular weight pili structures. Thus, indicating that SAG0648 plays a role in assembly of these pilin species. (See FIG. 41 ).
  • GBS 52 also appears to be a component of the GBS pili. Immunoblots using an anti-GBS 80 antisera on total cell extracts of Coh1 and a GBS 52 null mutant Coh1 reveal a shift in detected proteins in the Coh1 wild type strain relative to the GBS 52 null mutant Coh1 strain. The shifted proteins were also detected in the wild type Coh1 bacteria with an anti-GBS 52 antisera, indicating that the GBS 52 may be present in the pilus. (See FIG. 45 .)
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as GBS 80.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine amino acid residue.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include one or both of a pilin motif comprising a conserved lysine residue and an E box motif comprising a conserved glutamic acid residue.
  • More than one AI surface protein may be present in the oligomeric, pilus-like structures of the invention.
  • GBS 80 and GBS 104 may be incorporated into an oligomeric structure.
  • GBS 80 and GBS 52 may be incorporated into an oligomeric structure, or GBS 80, GBS 104 and GBS 52 may be incorporated into an oligomeric structure.
  • the invention includes compositions comprising two or more AI surface proteins.
  • the composition may include surface proteins from the same adhesin island.
  • the composition may include two or more GBS AI-1 surface proteins, such as GBS 80, GBS 104 and GBS 52.
  • the surface proteins may be isolated from Gram positve bacteria or they may be produced recombinantly.
  • the invention comprises a GBS Adhesin Island protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more GBS Adhesin Island 1 (“AI-1”) proteins and one or more GBS Adhesin Island 2 (“AI-2”) proteins, wherein one or more of the Adhesin Island proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • AI-1 GBS Adhesin Island 1
  • AI-2 GBS Adhesin Island 2
  • the oligomeric, pilus-like structures of the invention may be combined with one or more additional GBS proteins.
  • the oligomeric, pilus-like structures comprise one or more AI surface proteins in combination with a second GBS protein.
  • the second GBS protein may be a known GBS antigen, such as GBS 322 (commonly referred to as “sip”) or GBS 276.
  • GBS 322 commonly referred to as “sip”
  • GBS 276 GBS antigen
  • Nucleotide and amino acid sequences of GBS 322 sequenced from serotype V isolated strain 2603 V/R are set forth in WO 02/35771 as SEQ ID 8539 and SEQ ID 8540 and in the present specification as SEQ ID NOs: 38 and 39.
  • a particularly preferred GBS 322 polypeptide lacks the N-terminal signal peptide, amino acid residues 1-24.
  • An example of a preferred GBS 322 polypeptide is a 407 amino acid fragment and is shown in SEQ ID NO: 40. Examples of preferred GBS 322 polypeptides are further described in PCTUS04/______, attorney docket number PP20665.002 filed Sep. 15, 2004, hereby incorporated by reference, published as WO 2005/002619.
  • GBS proteins which may be combined with the GBS AI surface proteins of the invention are also described in WO 2005/002619. These GBS proteins include GBS 91, GBS 184, GBS 305, GBS 330, GBS 338, GBS 361, GBS 404, GBS 690, and GBS 691.
  • GBS proteins which may be combined with the GBS AI surface proteins of the invention are described in WO 02/34771.
  • GBS polysaccharides which may be combined with the GBS AI surface proteins of the invention are described in WO 2004/041157.
  • the GBS AI surface proteins of the invention may be combined with a GBS polysaccharides selected from the group consisting of serotype Ia, Ib, Ia/c, II, III, IV, V, VI, VII and VIII.
  • the oligomeric, pilus-like structures may be isolated or purified from bacterial cultures in which the bacteria express an AI surface protein.
  • the invention therefore includes a method for manufacturing an oligomeric AI surface antigen comprising culturing a GBS bacterium that expresses the oligomeric AI protein and isolating the expressed oligomeric AI protein from the GBS bacteria.
  • the AI protein may be collected from secretions into the supernatant or it may be purified from the bacterial surface.
  • the method may further comprise purification of the expressed AI protein.
  • the AI protein is in a hyperoligomeric form. Macromolecular structures associated with oligomeric pili are observed in the supernatant of cultured GBS strain Coh1. (See FIG. 46 .) These pili are found in the supernatant at all growth phases of the cultured Coh1 bacteria. (See FIG. 47 .)
  • the oligomeric, pilus-like structures may be isolated or purified from bacterial cultures overexpressing an AI surface protein.
  • the invention therefore includes a method for manufacturing an oligomeric Adhesin Island surface antigen comprising culturing a GBS bacterium adapted for increased AI protein expression and isolation of the expressed oligomeric Adhesin Island protein from the GBS bacteria.
  • the AI protein may be collected from secretions into the supernatant or it may be purified from the bacterial surface.
  • the method may further comprise purification of the expressed Adhesin Island protein.
  • the Adhesin Island protein is in a hyperoligomeric form.
  • the GBS bacteria are preferably adapted to increase AI protein expression by at least two (e.g., 2, 3, 4, 5, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150 or 200) times wild type expression levels.
  • GBS bacteria may be adapted to increase AI protein expression by any means known in the art, including methods of increasing gene dosage and methods of gene upregulation. Such means include, for example, transformation of the GBS bacteria with a plasmid encoding the AI protein.
  • the plasmid may include a strong promoter or it may include multiple copies of the sequence encoding the AI protein.
  • the sequence encoding the AI protein within the GBS bacterial genome may be deleted.
  • the promoter regulating the GBS Adhesin Island may be modified to increase expression.
  • GBS bacteria harbouring a GBS AI-1 may also be adapted to increase AI protein expression by altering the number adenosine nucleotides present at two sites in the intergenic region between AraC and GBS 80.
  • FIG. 197 A which is a schematic showing the organization of GBS AI-1 and FIG. 197 B , which provides the sequence of the intergenic region between AraC and GBS 80 in the AI.
  • the adenosine tracts which applicants have identified as influencing GBS 80 surface expression are at nucleotide positions 187 and 233 of the sequence shown in FIG. 197 B (SEQ ID NO: 273).
  • FACS analysis of these strains using anti GBS 80 antiserum determined that an intergenic region with five adenosines at position 187 and six adenosines at position 233 had higher expression levels of GBS 80 on their surface than other stains. See FIG. 197 C for results obtained from the FACS analysis. Therefore, manipulating the number of adenosines present at positions 187 and 233 of the AraC and GBS 80 intergenic region may further be used to adapt GBS to increase AI protein expression.
  • the invention further includes GBS bacteria which have been adapted to produce increased levels of AI surface protein.
  • the invention includes GBS bacteria which have been adapted to produce oligomeric or hyperoligomeric AI surface protein, such as GBS 80.
  • the Gram positive bacteria of the invention are inactivated or attenuated to permit in vivo delivery of the whole bacteria, with the AI surface protein exposed on its surface.
  • the invention further includes GBS bacteria which have been adapted to have increased levels of expressed AI protein incorporated in pili on their surface.
  • the GBS bacteria may be adapted to have increased exposure of oligomeric or hyperoligomeric AI proteins on its surface by increasing expression levels of a signal peptidase polypeptide.
  • Increased levels of a local signal peptidase expression in Gram positive bacteria (such us LepA in GAS) are expected to result in increased exposure of pili proteins on the surface of Gram positive bacteria.
  • Increased expression of a leader peptidase in GBS may be achieved by any means known in the art, such as increasing gene dosage and methods of gene upregulation.
  • the GBS bacteria adapted to have increased levels of leader peptidase may additionally be adapted to express increased levels of at least one pili protein.
  • the AI proteins of the invention may be expressed on the surface of a non-pathogenic Gram positive bacteria, such as Streptococus gordonii (See, e.g., Byrd et al., “Biological consequences of antigen and cytokine co-expression by recombinant Streptococcus gordonii vaccine vectors”, Vaccine (2002) 20:2197-2205) or Lactococcus lactis (See, e.g., Mannam et al., “Mucosal Vaccine Made from Live, Recombinant Lactococcus lactis Protects Mice against Pharangeal Infection with Streptococcus pyogenes ” Infection and Immunity (2004) 72(6):3444-3450).
  • Streptococus gordonii See, e.g., Byrd et al., “Biological consequences of antigen and cytokine co-expression by recombinant Streptococcus gordonii vaccine
  • non-pathogenic Gram positive bacteria refer to Gram positive bacteria which are compatible with a human host subject and are not associated with human pathogenisis.
  • the non-pathogenic bacteria are modified to express the AI surface protein in oligomeric, or hyper-oligomeric form. Sequences encoding for an AI surface protein and, optionally, an AI sortase, may be integrated into the non-pathogenic Gram positive bacterial genome or inserted into a plasmid.
  • the non-pathogenic Gram positive bacteria may be inactivated or attenuated to facilitate in vivo delivery of the whole bacteria, with the AI surface protein exposed on its surface.
  • the AI surface protein may be isolated or purified from a bacterial culture of the non-pathogenic Gram positive bacteria.
  • the AI surface protein may be isolated from cell extracts or culture supernatants.
  • the AI surface protein may be isolated or purified from the surface of the non-pathogenic Gram positive bacteria.
  • the non-pathogenic Gram positive bacteria may be used to express any of the Gram positive bacterial Adhesin Island proteins described herein, including proteins from a GBS Adhesin Island, a GAS Adhesin Island, or a S pneumo Adhesin Island.
  • the non-pathogenic Gram positive bacteria are transformed to express an Adhesin Island surface protein.
  • the non-pathogenic Gram positive bacteria also express at least one Adhesin Island sortase.
  • the AI transformed non-pathogenic Gram positive bacteria of the invention may be used to prevent or treat infection with a pathogenic Gram positive bacteria, such as GBS, GAS or Streptococcus pneumoniae .
  • the non-pathogenic Gram positive bacteria may express the Gram positive bacterial Adheshin Island proteins in oligomeric forms that further comprise adhesin island proteins encoded within the genome of the non-pathogenic Gram positive bacteria.
  • L. lactis was transformed with a construct encoding GBS 80 under its own promoter and terminator sequences.
  • the transformed L. lactis appeared to express GBS 80 as shown by Western blot analysis using anti-GBS 80 antiserum. See lanes 6 and 7 of the Western Blots provided in FIGS. 133A and 133B ( 133 A and 133 B are two different exposures of the same Western blot). See also Example 13.
  • L. lactis with a construct encoding GBS AI-1 polypeptides GBS 80, GBS 52, SAG0647, SAG0648, and GBS 104 under the GBS 80 promoter and terminator sequences.
  • These L. lactis expressed high molecular weight structures that were immunoreactive with anti-GBS 80 in immunoblots. See FIG. 134 , lane 2, which shows detection of a GBS 80 monomer and higher molecular weight polymers in total transformed L. lactis extracts.
  • L. lactis is capable of expressing GBS 80 in oligomeric form.
  • the high molecular weight polymers were not only detected in L. lactis extracts, but also in the culture supernatants. See FIG.
  • the GBS AI polypeptides in oligomeric form can be isolated and purified from either L. lactis cell extracts or culture supernatants. These oligomeric forms can, for instance, be isolated from cell extracts or culture supernatants by release by sonication. See FIGS. 136A and B. See also FIG. 171 , which shows purification of GBS pili from whole extracts of L. lactis expressing the GBS AI-1 following sonication and gel filtration on a Sephacryl HR 400 column.
  • FACS analysis of these transformed L. lactis detected cell surface expression of both GBS 80 and GBS 104.
  • the surface expression levels of GBS 80 and GBS 104 on the transformed L. lactis were similar to the surface expression levels of GBS 80 and GBS 104 on GBS strains COH1 and JM9130013, which naturally express GBS AI-1.
  • FIG. 169 for FACS analysis data for L. lactis transformed with GBS AI-1 and wildtype JM9130013 bacteria using anti-GBS 80 and GBS 104 antisera.
  • Table 40 provides the results of FACS analysis of transformed L. lactis , COH1, and JM9130013 bacteria using anti-GBS 80 and anti-GBS 104 antisera. The numbers provided represent the mean fluorescence value difference calculated for immune versus pre-immune sera obtained for each bacterial strain. TABLE 40 FACS analysis of L. lactis and GBS bacteria strains expressing GBS AI-1 Anti-GBS 80 Anti-GBS 104 antiserum antiserum GBS AI-1 transformed 298 251 L.
  • mice with L. lactis transformed with GBS AI-1 were immunized with L. lactis transformed with GBS AI-1.
  • the immunized female mice were bred and their pups were challenged with a dose of GBS sufficient to kill 90% of non-immunized pups.
  • Detailed protocols for intranasal and subcutaneous immunization of mice with transformed L. lactis can be found in Examples 18 and 19, respectively.
  • Table 43 provides data showing that immunization of the female mice with L. lactis expressing GBS AI-1(LL-AI 1) greatly increased survival rate of challenged pups relative to both a negative PBS control (PBS) and a negative L.
  • PBS negative PBS control
  • lactis control (LL 10 E9, which is wild type L. lactis not transformed to express GBS AI-1). TABLE 43 Protection of Mice Immunized with L. lactis expressing GBS AI-1 Immunization Survival Route Antigen Alive/Treated Survival % % Range p value Intraperitoneum Recombinant GBS 80 16/18 89 80-100 ⁇ 0.001 Subcutaneous LL-AI 1 10 E9 40/49 82 70-90 ⁇ 0.001 LL-AI 1 10 E10 50/60 83 60-100 ⁇ 0.001 PBS 4/30 13 0-30 LL 10 E9 3/57 5 0-20 Intranasal LL-AI 1 10 E9 22/60 37 0-100 0.02 LL-AI 1 10 E10 31/49 63 30-90 ⁇ 0.001 LL 10 E9 2/27 7 0-20
  • mice with L. lactis expressing the GBS AI-1 Protection of immunized mice with L. lactis expressing the GBS AI-1 is at least partly due to a newly raised antibody response.
  • Table 46 provides anti-GBS 80 antibody titers detected in serum of the mice immunized with L. lactis expressing the GBS AI-1 as described above. Mice immunized with L. lactis expressing the GBS AI-1 have anti-GBS 80 antibody titres, which are not observed in mice immunized with L. lactis not transformed to express the GBS AI-1. Further, as expected from the survival data, mice subcutaneously immunized with L. lactis transformed to express the GBS AI-1 have significantly higher serum anti-GBS 80 antibody titers than mice intranasally immunized with L.
  • Anti-GBS 80 antibodies of the IgA isotype were specifically detected in various body fluids of the mice subcutaneously or intranasally immunized with L. lactis expressing the GBS AI-1. TABLE 47 Anti-GBS 80 IgA Antibodies Detected in Mouse Tissues Following Immunization with L. lactis Expressing GBS AI-1 Anti-GBS 80 IgA Antibodies Detected in Antigen Immunization route Serum Vaginal Wash Nasal Wash LL 10 E9 0 0 0 LL-AI 1 Subcutaneous 0 25 20 LL-AI 1 Intranasal 140 0 150 GBS 80 Intraperitoneal 60 0
  • opsonophagocytosis assays also demonstrated that at least some of the antiserum produced against the L. lactis expressing GBS AI 1 is opsonic for GBS. See FIG. 161 .
  • a hybrid GBS AI may be a GBS AI-1 with a replacement of the GBS 104 gene with a GBS 67 gene.
  • a schematic of such a hybrid GBS AI is depicted in FIG. 231 A .
  • a hybrid GBS AI may alternatively be a GBS AI-1 with a replacement of the GBS 52 gene with a GBS 59 gene. See the schematic at FIG. 231 B .
  • a hybrid GBS AI may be a GBS AI-1 with a substitution of a GBS 59 polypeptide for the GBS 52 gene and a substitution of the GBS 104 gene for genes encoding GBS 59 and the two GBS AI-2 sortases.
  • Another example of a hybrid GBS AI is a GBS AI-1 with the substitution of a GBS 59 gene for the GBS 52 gene and a GBS 67 for the GBS 104 gene. See the schematic at FIG. 232 .
  • a further example of a hybrid GBS AI is a GBS AI-1 having a GBS 59 gene and genes encoding the GBS AI-2 sortases in place of the GBS 52 gene.
  • hybrid GBS AI is a GBS AI-1 with a substitution of either GBS 52 or GBS 104 with a fusion protein comprising GBS 322 and one of GBS 59, GBS 67, or GBS 150.
  • Some of these hybrid GBS AIs may be prepared as briefly outlined in FIG. 234 A-F.
  • FIG. 231 A Applicants have prepared a hybrid GBS AI having a GBS AI-1 sequence with a substitution of a GBS 67 coding sequence for the GBS 104 gene as depicted in FIG. 231 A . Transformation of L. lactis with the hybrid GBS AI-1 resulted in L. lactis expression of high molecular weight polymers containing the GBS 80 and GBS 67 proteins. See FIG. 233 A , which provides Western blot analysis of L. lactis transformed with the hybrid GBS AI depicted in FIG. 231 A . When L. lactis transformed with the hybrid GBS AI were probed with antibodies to GBS 80 or GBS 67, high molecular weight structures were detected.
  • the oligomeric, pilus-like structures may be produced recombinantly. If produced in a recombinant host cell system, the AI surface protein will preferably be expressed in coordination with the expression of one or more of the AI sortases of the invention. Such AI sortases will facilitate oligomeric or hyperoligomeric formation of the AI surface protein subunits.
  • AI Sortases of the invention will typically have a signal peptide sequence within the first 70 amino acid residues. They may also include a transmembrane sequence within 50 amino acid residues of the C terminus. The sortases may also include at least one basic amino acid residue within the last 8 amino acids. Preferably, the sortases have one or more active site residues, such as a catalytic cysteine and histidine.
  • AI-1 includes the surface exposed proteins of GBS 80, GBS 52 and GBS 104 and the sortases SAG0647 and SAG0648. AI-1 typically appears as an insertion into the 3′ end of the trmA gene.
  • AI-1 may also include a divergently transcribed transcriptional regulator such as araC (i.e., the transcriptional regulator is located near or adjacent to the AI protein open reading frames, but it transcribed in the opposite direction). It is believed that araC may regulate the expression of the AI operon. (See Korbel et al., Nature Biotechnology (2004) 22(7): 911-917 for a discussion of divergently transcribed regulators in E. coli ).
  • araC may regulate the expression of the AI operon.
  • AI-1 may also include a sequence encoding a rho independent transcriptional terminator (see hairpin structure in FIG. 1 ). The presence of this structure within the adhesin island is thought to interrupt transcription after the GBS 80 open reading frame, leading to increased expression of this surface protein.
  • FIG. 2 A schematic identifying AI-1 within several GBS serotypes is depicted in FIG. 2 .
  • AI-1 sequences were identified in GBS serotype V, strain isolate 2603; GBS serotype III, strain isolate NEM316; GBS serotype II, strain isolate 18RS21; GBS serotype V, strain isolate CJB111; GBS serotype III, strain isolate COH1 and GBS serotype 1a, strain isolate A909. (Percentages shown are amino acid identity to the 2603 sequence). (An AI-1 was not identified in GBS serotype 1b, strain isolate H36B or GBS serotype 1a, strain isolate 515).
  • FIG. 18 An alignment of AI-1 polynucleotide sequences from serotype V, strain isolates 2603 and CJB111; serotype II, strain isolate 18RS21; serotype III, strain isolates COH1 and NEM316; and serotype 1a, strain isolate A909 is presented in FIG. 18 .
  • An alignment of amino acid sequences of AI-1 surface protein GBS 80 from serotype V, strain isolates 2603 and CJB111; serotype 1a, strain isolate A909; serotype III, strain isolates COH1 and NEM316 is presented in FIG. 22 .
  • AI-1 surface protein GBS 104 from serotype V, strain isolates 2603 and CJB111; serotype III, strain isolates COH1 and NEM316; and serotype II, strain isolate 18RS21 is presented in FIG. 23 .
  • Preferred AI-1 polynucleotide and amino acid sequences are conserved among two or more GBS serotypes or strain isolates.
  • GBS 80 As shown in this figure, the full length of surface protein GBS 80 is particularly conserved among GBS serotypes V (strain isolates 2603 and CJBIII), III (strain isolates NEM316 and COH1), and Ia (strain isolate A909).
  • the GBS 80 surface protein is missing or fragmented in serotypes II (strain isolate 18RS21), Ib (strain isolate H36B) and Ia (strain isolate 515).
  • Polynucleotide and amino acid sequences for AraC are set forth in FIG. 30 .
  • a second adhesin island “Adhesin Island 2” or “AI-2” or GBS AI-2” has also been identified in numerous GBS serotypes.
  • a schematic depicting the correlation between AI-1 and AI-2 within the GBS serotype V, strain isolate 2603 is shown in FIG. 3 .
  • Homology percentages in FIG. 3 represent amino acid identity of the AI-2 proteins to the AI-1 proteins).
  • Alignments of AI-2 polynucleotide sequences are presented in FIGS. 20 and 21 ( FIG. 20 includes sequences from serotype V, strain isolate 2603 and serotype III, strain isolate NEM316.
  • FIG. 21 includes sequences from serotype III, strain isolate COH1 and serotype Ia, strain isolate A909).
  • AI-2 surface protein GBS 067 from serotype V, strain isolates 2603 and CJB111; serotype 1a, strain isolate 515; serotype II, strain isolate 18RS21; serotype Ib, strain isolate H36B; and serotype III, strain isolate NEM316 is presented in FIG. 24 .
  • Preferred AI-2 polynucleotide and amino acid sequences are conserved among two or more GBS serotypes or strain isolates.
  • AI-2 comprises a series of approximately five open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • AI-2 includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5 or more) of GBS 67, GBS 59, GBS 150, SAG1405, SAG1406, 01520, 01521, 01522, 01523, 01523, 01524 and 01525.
  • AI-2 includes open reading frames encoding for two or more of GBS 67, GBS 59, GBS 150, SAG1405, and SAG1406.
  • AI-2 may include open reading frames encoding for two or more of 01520, 01521, 01522, 01523, 01523, 01524 and 01525.
  • One or more of the surface proteins typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the GBS AI-2 sortase proteins are thought to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GBS AI-2 may encode for at least one surface protein.
  • AI-2 may encode for at least two surface proteins and at least one sortase.
  • GBS AI-2 encodes for at least three surface proteins and at least two sortases.
  • One or more of the AI-2 surface proteins may include an LPXTG or other sortase substrate motif.
  • One or more of the surface proteins may also typically include pilin motif.
  • the pilin motif may be involved in pili formation. Cleavage of AI surface proteins by sortase between the threonine and glycine residue of an LPXTG motif yields a thioester-linked acyl intermediate of sortase.
  • the first lysine residue in a pilin motif can serve as an amino group acceptor of the cleaved LPXTG motif and thereby provide a covalent linkage between AI subunits to form pili.
  • the pilin motif can make a nucleophilic attack on the acyl enzyme providing a covalent linkage between AI subunits to form pili and regenerate the sortase enzyme.
  • pilin motifs that may be present in the GBS AI-2 proteins include ((YPKN(X 8 )K; SEQ ID NO: 158), (PK(X 8 )K; SEQ ID NO: 159), (YPK(X 9 )K; SEQ ID NO: 160), (PKN(X 8 )K; SEQ ID NO: 161), or (PK(X 10 )K; SEQ ID NO: 162)).
  • One or more of the surface protein may also include an E box motif.
  • the E box motif contains a conserved glutamic acid residue that is believed to be necessary for pilus formation.
  • Some examples of E box motifs may include the amino acid sequences YxLxETxAPxG (SEQ ID NO: 163), YxxxExxAxxGY (SEQ ID NO: 164), YxLxExxxPxDY (SEQ ID NO: 165), or YxLxETxAPxGY (SEQ ID NO: 152).
  • GBS AI-2 may include the surface exposed proteins of GBS 67, GBS 59 and GBS 150 and the sortases of SAG1406 and SAG1405.
  • GBS AI-2 may include the proteins 01521, 01524 and 01525 and sortases 01520 and 01522.
  • GBS 067 and 01524 are preferred AI-2 surface proteins.
  • AI-2 may also include a divergently transcribed transcriptional regulator such as a RofA like protein (for example rogB). As in AI-1, rogB is thought to regulate the expression of the AI-2 operon.
  • a divergently transcribed transcriptional regulator such as a RofA like protein (for example rogB).
  • rogB is thought to regulate the expression of the AI-2 operon.
  • FIG. 4 A schematic depiction of AI-2 within several GBS serotypes is depicted in FIG. 4 . (Percentages shown are amino acid identity to the 2603 sequence). While the AI-2 surface proteins GBS 59 and GBS 67 are more variable across GBS serotypes than the corresponding AI-1 surface proteins, AI-2 surface protein GBS 67 appears to be conserved in GBS serotypes where the AI-1 surface proteins are disrupted or missing.
  • the AI-1 GBS 80 surface protein is fragmented in GBS serotype II, strain isolate 18RS21.
  • the GBS 67 surface protein has 99% amino acid sequence homology with the corresponding sequence in strain isolate 2603.
  • the AI-1 GBS 80 surface protein appears to be missing in GBS serotype Ib, strain isolate H36B and GBS serotype Ia, strain isolate 515.
  • the GBS 67 surface protein has 97-99% amino acid sequence homology with the corresponding sequence in strain isolate 2603.
  • GBS 67 appears to have two allelic variants, which can be divided according to percent homology with strains 2603 and H36B. See FIGS. 237-239 .
  • GBS 59 of GBS strain isolate 2603 shares 100% amino acid residue homology with GBS strain 18RS21, 62% amino acid sequence homology with GBS strain H36B, 48% amino acid residue homology with GBS strain 515 and GBS strain CJB111, and 47% amino acid residue homology with GBS strain NEM316.
  • the amino acid sequence homologies of the different GBS strains suggest that there are two isoforms of GBS 59. The first isoform appears to include the GBS 59 protein of GBS strains CJB111, NEM316, and 515.
  • the second isoform appears to include the GBS 59 protein of GBS strains 18RS21, 2603, and H36B. (See FIGS. 63 and 224 .) As expected from the variability in GBS 59 isoforms, antibodies specific for the first GBS 59 isoform detect the first but not the second GBS 59 isoform and antibodies specific for the second GBS 59 isoform detect the second but not the first GBS 59 isoform. See FIG. 226A , which shows FACS analysis of 28 GBS strains having a GBS 59 gene detected using PCR for GBS 59 surface expression.
  • GBS 59 isoform 1 ⁇ -Cjb111
  • GBS 59 isoform 2 ⁇ -2603
  • GBS 59 is opsonic only against GBS strains expressing a homologous GBS 59 protein. See FIG. 225 .
  • the immunogenic composition of the invention comprises a first and a second isoform of the GBS 59 protein to provide protection across a wide range of GBS serotypes that express polypeptides from a GBS AI-2.
  • the first isoform may be the GBS 59 protein of GBS strain CJB111, NEM316, or 515.
  • the second isoform may be the GBS 59 protein of GBS strain 18RS21, 2603, or H36B.
  • FIG. 64 shows detection of high molecular weight GBS 59 polymers in whole extracts of GBS strains CJB111, 7357B, COH31, D1363C, 5408, 1999, 5364, 5518, and 515 using antiserum raised against GBS 59 of GBS strain CJB111.
  • FIG. 64 shows detection of high molecular weight GBS 59 polymers in whole extracts of GBS strains CJB111, 7357B, COH31, D1363C, 5408, 1999, 5364, 5518, and 515 using antiserum raised against GBS 59 of GBS strain CJB111.
  • FIG. 65 also shows detection of these high molecular weight GBS 59 polymers in whole extracts of GBS strains D136C, 515, and CJB111 with anti-GBS 59 antiserum. (See also FIG. 220 A for detection of GBS 59 high molecular weight polymers in strain 515.)
  • FIG. 65 confirms the presence of different isoforms of GBS 59. Antisera raised against two different GBS 59 isoforms results in different patterns of immunoreactivity depending on the GBS strain origin of the whole extract.
  • FIG. 65 further shows detection of GBS 59 monomers in purified GBS 59 preparations.
  • GBS 59 is also highly expressed on the surface of GBS strains.
  • GBS 59 was detected on the surface of GBS strains CJB111, DK1, DK8, Davis, 515, 2986, 5551, 1169, and 7357B by FACS analysis using mouse antiserum raised against GBS 59 of GBS CJB111. FACS analysis did not detect surface expression of GBS 59 in GBS strains SMU071, JM9130013, and COH1, which do not contain a GBS 59 gene. (See FIG. 66 .) Further confirmation that GBS 59 is expressed on the surface of GBS is detection of GBS 59 by immuno-electron microscopy on the surface of GBS strain 515 bacteria. See FIG. 215 .
  • GBS 67 and GBS 150 also appear to be included in high molecular weight structures, or pili.
  • FIG. 69 shows that anti-GBS 67 and anti-GBS 150 immunoreact with high molecular weight structures in whole GBS strain 515 extracts. (See also FIG. 220 B and C.) It is also notable in FIG. 69 that the anti-GBS 59 antisera, raised in a mouse following immunization with GBS 59 of GBS strain 2603, does not cross-hybridize with GBS 59 in GBS strain 515. GBS 59 of GBS stain 515 is of a different isotype than GBS 59 of GBS stain 2603. See FIG.
  • FIG. 65 which confirms that GBS 59 antisera raised against GBS strain 2603 does not cross-hybridize with GBS 59 of GBS strain 515.
  • FIG. 70 provides Western blots showing that higher molecular weight structures in GBS strain 515 total extracts immunoreact with anti-GBS 67 and anti-GBS 150 antiserum.
  • anti-GBS 67 antiserum no longer immunoreacts with polypeptides in total extracts, while anti-GBS 150 antiserum is still able to cross-hybridze with high molecular weight structures.
  • GBS 67 cell surface expression is detected on GBS stain 515 cells regardless of GBS 67 expression.
  • GBS 67 while present in pili, appears to be localized around the surface of GBS strain 515 cells. See the immuno-electron micrographs presented in FIG. 216 . GBS 67 binds to fibronectin. See FIG. 217 .
  • GBS AI-2 Formation of pili encoded by GBS AI-2 does require expression of GBS 59.
  • Deletion of GBS 59 from strain 515 bacteria eliminates detection of high molecular weight structures by antibodies that bind to GBS 59 ( FIG. 221 A , lane 3), GBS 67 ( FIG. 221 B , lane 3), and GBS 150 ( FIG. 221 C , lane 3).
  • Western blot analysis of 515 bacteria with a deletion of the GBS 67 gene detects high molecular weight structures using GBS 59 ( FIG. 221 A , lane 2) and GBS 150 ( FIG. 221 C , lane 2) antisera.
  • GBS AI-2 Formation of pili encoded by GBS AI-2 also requires expression of both GBS adhesin island-2 encoded sortases. See FIG. 218 , which provides Western blot analysis of strain 515 bacteria lacking Srt1, Srt2, or both Srt1 and Srt2. Only deletion of both Srt1 and Srt2 abolishes pilus assembly as detected by antibodies that cross-hybridize with each of GBS 59, GBS 67 and GBS 150. The results of the Western blot analysis were verified by FACS, which provided similar results. See FIG. 219 .
  • More than one AI surface protein may be present in the oligomeric, pilus-like structures of the invention.
  • GBS 59 and GBS 67 may be incorporated into an oligomeric structure.
  • GBS 59 and GBS 150 may be incorporated into an oligomeric structure, or GBS 59, GBS 150 and GBS 67 may be incorporated into an oligomeric structure.
  • the invention includes compositions comprising two or more AI surface proteins.
  • the composition may include surface proteins from the same adhesin island.
  • the composition may include two or more GBS AI-2 surface proteins, such as GBS 59, GBS 67 and GBS 150.
  • the surface proteins may be isolated from Gram positve bacteria or they may be produced recombinantly.
  • adhesion islands are thought to encode surface proteins which are important in the bacteria's virulence, and Applicants have obtained the first electron micrographs revealing the presence of these adhesin island proteins in hyperoligomeric pilus structures on the surface of Group A Streptococcus.
  • Group A Streptococcus is a human specific pathogen which causes a wide variety of diseases ranging from pharyngitis and impetigo through life threatening invasive disease and necrotizing fascilitis.
  • post-streptococcal autoimmune responses are still a major cause of cardiac pathology in children.
  • Group A Streptococcal infection of its human host can generally occur in three phases.
  • the first phase involves attachment and/or invasion of the bacteria into host tissue and multiplication of the bacteria within the extracellular spaces. Generally this attachment phase begins in the throat or the skin. The deeper the tissue level infected, the more severe the damage that can be caused.
  • the bacteria secretes a soluble toxin that diffuses into the surrounding tissue or even systemically through the vasculature. This toxin binds to susceptible host cell receptors and triggers innappropropriate immune responses by these host cells, resulting in pathology. Because the toxin can diffuse throughout the host, the necrosis directly caused by the GAS toxins may be physically located in sites distant from the bacterial infection.
  • the final phase of GAS infection can occur long after the original bacteria have been cleared from the host system. At this stage, the host's previous immune response to the GAS bacteria due to cross reactivity between epitopes of a GAS surface protein, M, and host tissues, such as the heart.
  • a general review of GAS infection can be found in Principles of Bacterial Pathogeneis, Groisman ed., Chapter 15 (2001).
  • an effective vaccine against GAS will preferably facilitate host elimination of the bacteria during the initial attachment and invasion stage.
  • Isolates of Group A Streptococcus are historically classified according to the M surface protein described above.
  • the M protein is surface exposed trypsin-sensitive protein generally comprising two polypeptide chains complexed in an alpha helical formation.
  • the carboxyl terminus is anchored in the cytoplasmic membrane and is highly conserved among all group A streptococci.
  • the amino terminus which extend through the cell wall to the cell surface, is responsible for the antigenic variability observed among the 80 or more serotypes of M proteins.
  • T-antigen A second layer of classification is based on a variable, trypsin-resistant surface antigen, commonly referred to as the T-antigen.
  • T-antigen a variable, trypsin-resistant surface antigen
  • Decades of epidemiology based on M and T serological typing have been central to studies on the biological diversity and disease causing potential of Group A Streptococci. While the M-protein component and its inherent variability have been extensively characterized, even after five decades of study, there is still very little known about the structure and variability of T-antigens.
  • Antisera to define T types is commercially available from several sources, including Sevapharma (http://www.sevapharma.cz/en).
  • T-antigen T-type 6
  • M6 strain of GAS M6 strain of GAS
  • FCT Fibronectin-binding, Collagen-binding T-antigen
  • the antiserum recognized, in addition to a band corresponding to the predicted molecular mass of the product, very high molecular weight ladders ranging in mobility from about 100 kDa to beyond the resolution of the 3-8% gradient gels used.
  • Applicants have identified at least four different Group A Streptococcus Adhesin Islands. While these GAS AI sequences can be identified in numerous M types, Applicants have surprisingly discovered a correlation between the four main pilus subunits from the four different GAS AI types and specific T classifications. While other trypsin-resistant surface exposed proteins are likely also implicated in the T classification designations, the discovery of the role of the GAS adhesin islands (and the associated hyper-oligomeric pilus like structures) in T classification and GAS serotype variance has important implications for prevention and treatment of GAS infections. Applicants have identified protein components within each of the GAS adhesin islands which are associated with the pilus formation. These proteins are believed to be involved in the bacteria's initial adherence mechanisms. Immunological recognition of these proteins may allow the host immune response to slow or prevent the bacteria's transition into the more pathogenic later stages of infection.
  • GBS pili structures appear to be implicated in the formation of biofilms (populations of bacteria growing on a surface, often enclosed in an exopolysaccharide matrix).
  • Biofilms are generally associated with bacterial resistance, as antibiotic treatments and host immune response are frequently unable to erradicate all of the bacteria components of the biofilm.
  • Direction of a host immune response against surface proteins exposed during the first steps of bacterial attachment is preferable.
  • the invention therefore provides for improved immunogenic compositions against GAS infection which may target GAS bacteria during their initial attachment efforts to the host epithelial cells and may provide protection against a wide range of GAS serotypes.
  • the immunogenic compositions of the invention include GAS AI surface proteins which may be formulated in an oligomeric, or hyperoligomeric (pilus) form.
  • the invention also includes combinations of GAS AI surface proteins. Combinations of GAS AI surface proteins may be selected from the same adhesin island or they may be selected from different GAS adhesin islands.
  • GAS AI sequences may be generally characterized as Type 1, Type 2, Type 3, and Type 4, depending on the number and type of sortase sequence within the island and the percentage identity of other proteins within the island.
  • Schematics of the GAS adhesin islands are set forth in FIG. 51A and FIG. 162 . In all strains identified so far, the adhesin island region is flanked by highly conserved open reading frames M1 — 123 and M1 — 136. Between three and five genes in each GAS adhesin island code for ECM binding adhesin proteins containing LPXTG motifs.
  • GAS AI-1 comprises a series of approximately five open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-1 proteins”).
  • GAS AI-1 preferably comprises surface proteins, a srtB sortase, and a rofA divergently transcribed transcriptional regulator.
  • GAS AI-1 surface proteins may include a fibronectin binding protein, a collagen adhesion protein and a fimbrial structural subunit.
  • each of these GAS AI-1 surface proteins includes an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122) or LPXSG (SEQ ID NO: 134) (conservative replacement of threonine with serine).
  • GAS AI-1 includes open reading frames encoding for two or more (i.e., 2, 3, 4 or 5) of M6_Spy0157, M6_Spy0158, M6_Spy0159, M6_Spy0160, M6_Spy0161.
  • a GAS AI-1 may comprise a polynucleotide encoding any one of CDC SS 410_fimbrial, ISS3650_fimbrial, and DSM2071_fimbrial.
  • the hyper-oligomeric pilus structure of GAS AI-1 appears to be responsible for the T-antigen type 6 classification, and GAS AI-1 corresponds to the FCT region previously identified for tee6.
  • the tee6 FCT region includes open reading frames encoding for a collagen adhesion protein (cpa, capsular polysaccharide adhesion) and a fibronectin binding protein (prtF1).
  • cpa collagen adhesion protein
  • prtF1 fibronectin binding protein
  • Immunoblots of tee6, a GAS AI-1 fimbrial structural subunit corresponding to M6_Spy160 reveal high molecular weight structures indicative of the hyper-oligomeric pilus structures.
  • Immunoblots with antiserum specific for Cpa also recognize a high molecular weight ladder structure, indicating Cpa involvement in the GAS AI-1 pilus structure or formation.
  • Cpa antiserum reveals abundant staining on the surface of the bacteria and occasional gold particles extended from the surface of the bacteria.
  • immunoblots with antiserum specific for PrtF1 recognize only a single molecular species with electrophoretic mobility corresponding to its predicted molecular mass, indicating that PrtF1 may not be associated with the oligomeric pilus structure.
  • a preferred immunogenic composition of the invention comprises a GAS AI-1 surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • the oligomeric form is a hyperoligomer.
  • Another preferred immunogenic composition of the invention comprises a GAS AI-1 surface protein which has been isolated in an oligomeric (pilis) form.
  • the oligomer or hyperoligomeric pilus structures comprising the GAS AI-1 surface proteins may be purified or otherwise formulate for use in immunogenic compositions.
  • GAS AI-1 open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-1 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the GAS AI-1 surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the LPXTG sortase substrate motif of a GAS AI surface protein may be generally represented by the formula XXXXG, wherein X at amino acid position 1 is an L, a V, an E, or a Q, wherein X at amino acid position 2 is a P if X at amino acid position 1 is an L, wherein X at amino acid position 2 is a V if X at amino acid position 1 is a E or a Q, wherein X at amino acid position 2 is a V or a P if X at amino acid position 1 is a V, wherein X at amino acid position 3 is any amino acid residue, wherein X at amino acid position 4 is a T if X at amino acid position 1 is a V, E, or Q, and wherein X at amino acid position 4 is a T, S, or A if X at amino acid position 1 is an L.
  • LPXTG motifs present in GAS AI surface proteins include LPSXG (SEQ ID NO: 134), VVXTG (SEQ ID NO: 135), EVXTG (SEQ ID NO: 136), VPXTG (SEQ ID NO: 137), QVXTG (SEQ ID NO: 138), LPXAG (SEQ ID NO: 139), QVPTG (SEQ ID NO: 140), and FPXTG (SEQ ID NO: 141).
  • the GAS AI surface proteins of the invention may affect the ability of the GAS bacteria to adhere to and invade epithelial cells.
  • AI surface proteins may also affect the ability of GAS to translocate through an epithelial cell layer.
  • one or more GAS AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • GAS AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • GAS AI-1 sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-1 may encode for at least one surface protein.
  • GAS AI-1 may encode for at least two surface exposed proteins and at least one sortase.
  • GAS AI-1 encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • GAS AI-1 preferably includes a srtB sortase.
  • GAS srtB sortases may preferably anchor surface proteins with an LPSTG motif (SEQ ID NO: 166), particularly where the motif is followed by a serine.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a GAS AI-1 surface protein such as M6_Spy0157, M6_Spy0159, M6_Spy0160, CDC SS 410_fimbrial, ISS3650_fimbrial, or DSM2071_fimbrial.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively:
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a GAS Adhesin Island protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more GAS Adhesin Island 1 (“GAS AI-1”) proteins and one or more GAS Adhesin Island 2 (“GAS AI-2”), GAS Adhesin Island 3 (“GAS AI-3”), or GAS Adhesin Island 4 (“GAS AI-4”) proteins, wherein one or more of the GAS Adhesin Island proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • GAS Adhesin Island 1 (“GAS AI-1”) proteins
  • GAS Adhesin Island 2”) GAS Adhesin Island 3
  • GAS Adhesin Island 4 GAS Adhesin Island 4
  • GAS AI-1 may also include a divergently transcribed transcriptional regulator such as RofA (i.e., the transcriptional regulator is located near or adjacent to the AI protein open reading frames, but it transcribed in the opposite direction).
  • RofA a divergently transcribed transcriptional regulator
  • GAS Adhesin Island 2 A second adhesin island, “GAS Adhesin Island 2” or “GAS AI-2” has also been identified in Group A Streptococcus serotypes and isolates.
  • GAS AI-2 comprises a series of approximately eight open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-2 proteins”).
  • GAS AI-2 proteins include open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, 7, or 8) of GAS15, Spy0127, GAS16, GAS17, GAS18, Spy0131, Spy0133, and GAS20.
  • a preferred immunogenic composition of the invention comprises a GAS AI-2 surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • the oligomeric form is a hyperoligomer.
  • Another preferred immunogenic composition of the invention comprises a GAS AI-2 surface protein which has been isolated in an oligomeric (pilis) form.
  • the oligomer or hyperoligomeric pilus structures comprising the GAS AI-2 surface proteins may be purified or otherwise formulate for use in immunogenic compositions.
  • One or more of the GAS AI-2 open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-2 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the GAS AI-2 surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the AI surface proteins of the invention may affect the ability of the GAS bacteria to adhere to and invade epithelial cells.
  • AI surface proteins may also affect the ability of GAS to translocate through an epithelial cell layer.
  • one or more AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • GAS AI-2 sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-2 may encode for at least one surface protein.
  • GAS AI-2 may encode for at least two surface exposed proteins and at least one sortase.
  • GAS AI-2 encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as GAS 15, GAS 16, or GAS 18.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine amino acid residue.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a GAS Adhesin Island protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more GAS Adhesin Island 2 (“GAS AI-2”) proteins and one or more GAS Adhesin Island 1 (“GAS AI-1”), GAS Adhesin Island 3 (“GAS AI-3”), or GAS Adhesin Island 4 (“GAS AI-4”) proteins, wherein one or more of the Adhesin Island proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • GAS AI-2 may also include a divergently transcribed transcriptional regulator such as rofA (i.e., the transcriptional regulator is located near or adjacent to the AI protein open reading frames, but it transcribed in the opposite direction).
  • rofA a divergently transcribed transcriptional regulator
  • GAS Adhesin Island 3 A third adhesin island, “GAS Adhesin Island 3” or “GAS AI-3” has also been identified in several Group A Streptococcus serotypes and isolates.
  • GAS AI-3 comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-3 proteins”).
  • GAS AI-3 includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of SpyM3 — 0098, SpyM3 — 0099, SpyM3 — 0100, SpyM3 — 0101, SpyM3 — 0102, SpyM3 — 0103, SpyM3 — 0104, SPs0100, SPs0101, SPs0102, SPs0103, SPs0104, SPs0105, SPs0106, orf78, orf79, orf80, orf81, orf82, orf83, orf84, spyM18 — 0126, spyM18 — 0127, spyM18 — 0128, spyM18 — 0129, spyM18 — 0130, spyM18 — 0131, spyM18 — 0132, SpyoM01000156, SpyoM01000155, SpyoM01000154, SpyoM01000153, SpyoM01000
  • GAS AI-3 includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of SpyM3 — 0098, SpyM3 — 0099, SpyM3 — 0100, SpyM3 — 0101, SpyM3 — 0102, SpyM3 — 0103, and SpyM3 — 0104.
  • GAS AI-3 includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of SPs0100, SPs0101, SPs0102, SPs0103, SPs0104, SPs0105, and SPs0106.
  • GAS AI-3 includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of orf78, orf79, orf80, orf81, orf82, orf83, and orf84.
  • GAS AI-3 includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of spyM18 — 0126, spyM18 — 0127, spyM18 — 0128, spyM18 — 0129, spyM18 — 0130, spyM18 — 0131, and spyM18 — 0132.
  • GAS AI-3 includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of SpyoM01000156, SpyoM01000155, SpyoM01000154, SpyoM01000153, SpyoM01000152, SpyoM01000151, SpyoM01000150, and SpyoM01000149.
  • a GAS AI-3 may comprise a polynucleotide encoding any one of ISS3040_fimbrial, ISS3776_fimbrial, and ISS4959_fimbrial.
  • GAS AI-3 open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-3 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • a preferred immunogenic composition of the invention comprises a GAS AI-3 surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • the oligomeric form is a hyperoligomer.
  • Another preferred immunogenic composition of the invention comprises a GAS AI-3 surface protein which has been isolated in an oligomeric (pilis) form.
  • the oligomer or hyperoligomeric pilus structures comprising the GAS AI-3 surface proteins may be purified or otherwise formulate for use in immunogenic compositions.
  • One or more of the GAS AI-3 surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the AI surface proteins of the invention may affect the ability of the GAS bacteria to adhere to and invade epithelial cells.
  • AI surface proteins may also affect the ability of GAS to translocate through an epithelial cell layer.
  • one or more AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • GAS AI-3 sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-3 may encode for at least one surface protein.
  • GAS AI-3 may encode for at least two surface exposed proteins and at least one sortase.
  • GAS AI-3 encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine or alanine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as SpyM3 — 0098, SpyM3 — 0100, SpyM3 — 0102, SpyM3 — 0104, SPs0100, SPs0102, SPs0104, SPs0106, orf78, orf80, orf82, orf84, spyM18 — 0126, spyM18 — 0128, spyM18 — 0130, spyM18 — 0132, SpyoM01000155, SpyoM01000153, SpyoM01000151, SpyoM01000149, ISS3040_fimbrial, ISS3776_fimbrial, and ISS4959_fimbrial.
  • an AI surface protein such as SpyM3 — 0098, SpyM3 — 0100, SpyM3 — 0102, SpyM3 — 0104, SPs0100, SPs0102, SPs0104,
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as SpyM3 — 0098, SpyM3 — 0100, SpyM3 — 0102, and SpyM3 — 0104.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as SPs0100, SPs0102, SPs0104, and SPs0106.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as orf78, orf80, orf82, and orf84.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as spyM18 — 0126, spyM18 — 0128, spyM18 — 0130, and spyM18 — 0132.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as SpyoM01000155, SpyoM01000153, SpyoM0000151, and SpyoM1000149.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as ISS3040_fimbrial, ISS3776_fimbrial, and ISS4959_fimbrial.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine amino acid residue.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a GAS Adhesin Island protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more GAS Adhesin Island 3 (“GAS AI-3”) proteins and one or more GAS Adhesin Island 1 (“GAS AI-1”), GAS Adhesin Island 2 (“GAS AI-2”), or GAS Adhesin Island 4 (“GAS AI-4”) proteins, wherein one or more of the Adhesin Island proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • GAS AI-3 may also include a transcriptional regulator such as Nra.
  • GAS Adhesin Island 4 or “GAS AI-4” has also been identified in Group A Streptococcus serotypes and isolates.
  • GAS AI-4 comprises a series of approximately eight open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases (“GAS AI-4 proteins”).
  • GAS AI-4 proteins include open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, 7, or 8) of 19224134, 19224135, 19223136, 19223137, 19224138, 19224139, 19224140, and 19224141.
  • a GAS AI-4 may comprise a polynucleotide encoding any one of 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, and ISS4538_fimbrial.
  • GAS AI-4 open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the GAS AI-4 open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • a preferred immunogenic composition of the invention comprises a GAS AI-4 surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • the oligomeric form is a hyperoligomer.
  • Another preferred immunogenic composition of the invention comprises a GAS AI-4 surface protein which has been isolated in an oligomeric (pilis) form.
  • the oligomer or hyperoligomeric pilus structures comprising the GAS AI-4 surface proteins may be purified or otherwise formulate for use in immunogenic compositions.
  • One or more of the GAS AI-4 surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the AI surface proteins of the invention may effect the ability of the GAS bacteria to adhere to and invade epithelial cells.
  • AI surface proteins may also affect the ability of GAS to translocate through an epithelial cell layer.
  • one or more AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • GAS AI-4 sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • GAS AI-4 may encode for at least one surface protein.
  • GAS AI-4 may encode for at least two surface exposed proteins and at least one sortase.
  • GAS AI-4 encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising an AI surface protein such as 19224134, 19224135, 19224137, 19224139, 19224141, 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, and ISS4538_fimbrial.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine amino acid residue.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a GAS Adhesin Island protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more GAS Adhesin Island 4 (“GAS AI-4”) proteins and one or more GAS Adhesin Island 1 (“GAS AI-1”), GAS Adhesin Island 2 (“GAS AI-2”), or GAS Adhesin Island 3 (“GAS AI-3”) proteins, wherein one or more of the Adhesin Island proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • GAS Adhesin Island 4 (“GAS AI-4”) proteins and one or more GAS Adhesin Island 1 (“GAS AI-1”), GAS Adhesin Island 2 (“GAS AI-2”), or GAS Adhesin Island 3 (“GAS AI-3”) proteins, wherein one or more of the Adhesin Island proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • GAS AI-4 may also include a divergently transcribed transcriptional regulator such as rofA (i.e., the transcriptional regulator is located near or adjacent to the AI protein open reading frames, but it transcribed in the opposite direction).
  • rofA a divergently transcribed transcriptional regulator
  • the oligomeric, pilus-like structures of the invention may be combined with one or more additional GAS proteins.
  • the oligomeric, pilus-like structures comprise one or more AI surface proteins in combination with a second GAS protein.
  • the oligomeric, pilus-like structures may be isolated or purified from bacterial cultures in which the bacteria express an AI surface protein.
  • the invention therefore includes a method for manufacturing an oligomeric AI surface antigen comprising culturing a GAS bacterium that expresses the oligomeric AI protein and isolating the expressed oligomeric AI protein from the GAS bacteria.
  • the AI protein may be collected from secretions into the supernatant or it may be purified from the bacterial surface.
  • the method may further comprise purification of the expressed AI protein.
  • the AI protein is in a hyperoligomeric form.
  • the oligomeric, pilus-like structures may be isolated or purified from bacterial cultures overexpressing an AI surface protein.
  • the invention therefore includes a method for manufacturing an oligomeric Adhesin Island surface antigen comprising culturing a GAS bacterium adapted for increased AI protein expression and isolation of the expressed oligomeric Adhesin Island protein from the GAS bacteria.
  • the AI protein may be collected from secretions into the supernatant or it may be purified from the bacterial surface.
  • the method may further comprise purification of the expressed Adhesin Island protein.
  • the Adhesin Island protein is in a hyperoligomeric form.
  • the GAS bacteria are preferably adapted to increase AI protein expression by at least two (e.g., 2, 3, 4, 5, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150 or 200) times wild type expression levels.
  • GAS bacteria may be adapted to increase AI protein expression by any means known in the art, including methods of increasing gene dosage and methods of gene upregulation. Such means include, for example, transformation of the GAS bacteria with a plasmid encoding the AI protein.
  • the plasmid may include a strong promoter or it may include multiple copies of the sequence encoding the AI protein.
  • the sequence encoding the AI protein within the GAS bacterial genome may be deleted.
  • the promoter regulating the GAS Adhesin Island may be modified to increase expression.
  • the invention further includes GAS bacteria which have been adapted to produce increased levels of AI surface protein.
  • the invention includes GAS bacteria which have been adapted to produce oligomeric or hyperoligomeric AI surface protein.
  • the Gram positive bacteria of the invention are inactivated or attenuated to permit in vivo delivery of the whole bacteria, with the AI surface protein exposed on its surface.
  • the invention further includes GAS bacteria which have been adapted to have increased levels of expressed AI protein incorporated in pili on their surface.
  • the GAS bacteria may be adapted to have increased exposure of oligomeric or hyperoligomeric AI proteins on its surface by increasing expression levels of LepA polypeptide, or an equivalent signal peptidase, in the GAS bacteria.
  • Applicants have shown that deletion of LepA in strain SF370 bacteria, which harbour a GAS AI-2, abolishes surface exposure of M and pili proteins on the GAS.
  • Increased levels of LepA expression in GAS are expected to result in increased exposure of M and pili proteins on the surface of GAS.
  • Increased expression of LepA in GAS may be achieved by any means known in the art, such as increasing gene dosage and methods of gene upregulation.
  • the GAS bacteria adapted to have increased levels of LepA expression may additionally be adapted to express increased levels of at least one pili protein.
  • the AI proteins of the invention may be expressed on the surface of a non-pathogenic Gram positive bacteria, such as Streptococus gordonii (See, e.g., Byrd et al., “Biological consequences of antigen and cytokine co-expression by recombinant Streptococcus gordonii vaccine vectors”, Vaccine (2002) 20:2197-2205) or Lactococcus lactis (See, e.g., Mannam et al., “Mucosal Vaccine Made from Live, Recombinant Lactococcus lactis Protects Mice against Pharangeal Infection with Streptococcus pyogenes ” Infection and Immunity (2004) 72(6):3444-3450).
  • Streptococus gordonii See, e.g., Byrd et al., “Biological consequences of antigen and cytokine co-expression by recombinant Streptococcus gordonii vaccine
  • non-pathogenic Gram positive bacteria refer to Gram positive bacteria which are compatible with a human host subject and are not associated with human pathogenisis.
  • the non-pathogenic bacteria are modified to express the AI surface protein in oligomeric, or hyper-oligomeric form. Sequences encoding for an AI surface protein and, optionally, an AI sortase, may be integrated into the non-pathogenic Gram positive bacterial genome or inserted into a plasmid.
  • the non-pathogenic Gram positive bacteria may be inactivated or attenuated to facilitate in vivo delivery of the whole bacteria, with the AI surface protein exposed on its surface.
  • the AI surface protein may be isolated or purified from a bacterial culture of the non-pathogenic Gram positive bacteria.
  • the AI surface protein may be isolated from cell extracts or culture supernatants.
  • the AI surface protein may be isolated or purified from the surface of the non-pathogenic Gram positive bacteria.
  • the non-pathogenic Gram positive bacteria may be used to express any of the GAS Adhesin Island proteins described herein.
  • the non-pathogenic Gram positive bacteria are transformed to express an Adhesin Island surface protein.
  • the non-pathogenic Gram positive bacteria also express at least one Adhesin Island sortase.
  • the AI transformed non-pathogenic Gram positive bacteria of the invention may be used to prevent or treat infection with pathogenic GAS.
  • L. lactis was transformed with pAM401 constructs encoding entire pili gene clusters of AI-1, AI-2, and AI-4 adhesin islands.
  • the pAM401 is a promoterless high-copy plasmid.
  • the entire pili gene clusters of an M6 (AI-1), M1 (AI-2), and M12 (AI-4) bacteria were inserted into the pAM401 construct.
  • the gene clusters were transcribed under the control their own (M6, M1, or M12) promoter or the GBS promoter that successfully initiated expression of the GBS AI-1 adhesin islands in L. lactis , described above.
  • FIG. 172 provides a schematic depiction of GAS M6 (AI-1), M1 (AI-2), and M12 (AI-4) adhesin islands and indicates the portions of the adhesin island sequences inserted in the pAM401 construct.
  • FIGS. 173 A-C provide results of Western blot analysis of surface protein-enriched extracts of L. lactis transformed with M6 ( FIG. 173 A ), M1 ( FIG. 173 B ), or M12 ( FIG. 173 C ) adhesin island gene clusters using antibodies that bind to the fimbrial structural subunit encoded by each cluster.
  • FIG. 173A at lanes 3 and 4 shows detection of high molecular structures in L.
  • FIG. 173B at lanes 3 and 4 shows detection of high molecular weight structures in L. lactis transformed with an adhesin island pilus gene cluster from an M12 AI-4 using an antibody that binds to fimbrial structural subunit EftLSL.A.
  • FIG. 173C at lane 3 shows detection of high molecular weight structures in L. lactis transformed with an adhesin island pilus gene cluster from an M6 AI-1 using an antibody that binds to fimbrial structural subunit M6_Spy0160.
  • L. lactis is capable of expressing the fimbrial structural subunits encoded by GAS adhesin islands in an oligomeric form.
  • the oligomeric, pilus-like structures may be produced recombinantly. If produced in a recombinant host cell system, the AI surface protein will preferably be expressed in coordination with the expression of one or more of the AI sortases of the invention. Such AI sortases will facilitate oligomeric or hyperoligomeric formation of the AI surface protein subunits.
  • the S. pneumoniae from TIGR4 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae from TIGR4 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of SP0462, SP0463, SP0464, SP0465, SP0466, SP0467, and SP0468.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae from TIGR4 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • the oligomeric form is a hyperoligomer.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae from TIGR4 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • the oligomer or hyperoligomer pilus structures comprising S. pneumoniae surface proteins may be purified or otherwise formulated for use in immunogenic compositions.
  • One or more of the S. pneumoniae from TIGR4 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae from TIGR4 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae from TIGR4 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae from TIGR4 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells.
  • AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer.
  • one or more S. pneumoniae from TIGR4 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface.
  • S. pneumoniae from TIGR4 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae from TIGR4 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae from TIGR4 AI may encode for at least one surface protein.
  • S. pneumoniae from TIGR4 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae from TIGR4 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae from TIGR4 AI surface protein such as SP0462, SP0463, SP0464, or SP0465.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae from TIGR4 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae from TIGR4 AI proteins and one or more S. pneumoniae strain 670 AI proteins, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae from TIGR4 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 670 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 670 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of orf1 — 670, orf3 — 670, orf4 — 670, orf5 — 670, orf6 — 670, orf7 — 670, orf8 — 670.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 670 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 670 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 670 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 670 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 670 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 670 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 670 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 670 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 670 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 670 AI may encode for at least one surface protein.
  • S. pneumoniae strain 670 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 670 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 670 AI surface protein such as orf3 — 670, orf4 — 670, or orf5 — 670.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 670 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 670 AI proteins and one or more S. pneumoniae from TIGR4 AI proteins, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 670 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 14 CSR 10 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 14 CSR 10 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 14CSR, ORF3 — 14CSR, ORF4 — 14CSR, ORF5 — 14CSR, ORF6 — 14CSR, ORF7 — 14CSR, ORF8 — 14CSR.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 14 CSR 10 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 14 CSR 10 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 14 CSR 10 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 14 CSR 10 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 14 CSR 10 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 14 CSR 10 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 14 CSR 10 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 14 CSR 10 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 14 CSR 10 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 14 CSR 10 AI may encode for at least one surface protein.
  • S. pneumoniae strain 14 CSR 10 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 14 CSR 10 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 14 CSR 10 AI surface protein such as orf3_CSR, orf4_CSR, or orf5_CSR.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 14 CSR 10 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 14 CSR 10 AI proteins, and one or more AI proteins of any of S. pneumoniae from TIGR4, 670, 19A Hungary 6, 6B Finland 12, 6B Spain 2, 9V Spain 3, 19F Taiwan 14, 23F Taiwan 15, or 23F Poland 16, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 14 CSR 10 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 19A Hungary 6 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 19A Hungary 6 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 19AH, ORF3 — 19AH, ORF4 — 19AH, ORF5 — 1 gAH, ORF6 — 1 gAH, ORF7 — 19AH, ORF8 — 19AH.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 19A Hungary 6 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 19A Hungary 6 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 19A Hungary 6 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 19A Hungary 6 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 19A Hungary 6 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 19A Hungary 6 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 19A Hungary 6 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 19A Hungary 6 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 19A Hungary 6 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 19A Hungary 6 AI may encode for at least one surface protein.
  • S. pneumoniae strain 19A Hungary 6 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 19A Hungary 6 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 19A Hungary 6 AI surface protein such as orf3 — 19AH, orf4 — 19AH, or orf5 — 19AH.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 19A Hungary 6 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 19A Hungary 6 AI proteins and one or more AI proteins from one of any one of S. pneumoniae from TIGR4, 670, 14 CSR 10, 6B Finland 12, 6B Spain 2, 9V Spain 3, 19F Taiwan 14, 23F Taiwan 15, or 23F Poland 16 AI GR4 AI proteins, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 19A Hungary 6 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 19F Taiwan 14 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 19F Taiwan 14 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 19FTW, ORF3 — 19FTW, ORF4 — 19FTW, ORF5 — 19FTW, ORF6 — 19FTW, ORF7 — 19FTW, ORF8 — 19FTW.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 19F Taiwan 14 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 19F Taiwan 14 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 19F Taiwan 14 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 19F Taiwan 14 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • Taiwan 14 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 19F Taiwan 14 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 19F Taiwan 14 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 19F Taiwan 14 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • the S. pneumoniae strain 19F Taiwan 14 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 19F Taiwan 14 ⁇ l may encode for at least one surface protein.
  • S. pneumoniae strain 19F Taiwan 14 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 19F Taiwan 14 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 19F Taiwan 14 AI surface protein such as orf3 — 19FTW, orf4 — 19FTW, or orf5 — 19FTW.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 19F Taiwan 14 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 19F Taiwan 14 AI proteins and one or more AI proteins of any one or more of S. pneumoniae from TIGR4, 670, 19A Hungary 6, 6B Finland 12, 6B Spain 2, 9V Spain 3, 14 CSR 10, 23F Taiwan 15, or 23F Poland 16, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 19F Taiwan 14 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 23F Tru 16 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 23F Tru 16 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 23FP, ORF3 — 23FP, ORF4 — 23FP, ORF5 — 23FP, ORF6 — 23FP, ORF7 — 23FP, and ORF8 — 23FP.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 23F Tru 16 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 23F Tru 16 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 23F Tru 16 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 23F Tru 16 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 23F Tru 16 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 23F Tru 16 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 23F Tru 16 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 23F Tru 16 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 23F Tru 16 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 23F Poland 16 AI may encode for at least one surface protein.
  • S. pneumoniae strain 23F Poland 16 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 23F Poland 16 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 23F Tru 16 AI surface protein such as orf3 — 23FP, orf4 — 23FP, or orf5 — 23FP.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 23F Tru 16 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 23F Tru 16 AI proteins and one or more AI proteins from any one or more S. pneumoniae strains of TIGR4, 670, 19A Hungary 6, 6B Finland 12, 6B Spain 2, 9V Spain 3, 19F Taiwan 14, 23F Taiwan 15, or 14 CSR 10, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 23F Poland 16 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 23F Taiwan 15 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 23F Taiwan 15 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 23FTW, ORF3 — 23FTW, ORF4 — 23FTW, ORF5 — 23FTW, ORF6 — 23FTW, ORF7 — 23F[W, ORF8 — 23FTW.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 23F Taiwan 15 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 23F Taiwan 15 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 23F Taiwan 15 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 23F Taiwan 15 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 23F Taiwan 15 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 23F Taiwan 15 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 23F Taiwan 15 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 23F Taiwan 15 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 23F Taiwan 15 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 23F Taiwan 15 AI may encode for at least one surface protein.
  • S. pneumoniae strain 23F Taiwan 15 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 23F Taiwan 15 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 23F Taiwan 15 AI surface protein such as orf3 — 23FTW, orf4 — 23FTW, or orf5 — 23FTW.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 23F Taiwan 15 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 23F Taiwan 15 AI proteins and one or more AI proteins from any one or more of S. pneumoniae from TIGR4, 670, 19A Hungary 6, 6B Finland 12, 6B Spain 2, 9V Spain 3, 19F Taiwan 14, 14 CSR 10, or 23F Poland 16 AI, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 23F Taiwan 15 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 6B Finland 12 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 6B Finland 12 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 6BF, ORF3 — 6BF, ORF4 — 6BF, ORF5 — 6BF, ORF6 — 6BF, ORF7 — 6BF, ORF8 — 6BF.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 6B Finland 12 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 6B Finland 12 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 6B Finland 12 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 6B Finland 12 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 6B Finland 12 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 6B Finland 12 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 6B Finland 12 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 6B Finland 12 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 6B Finland 12 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 6B Finland 12 AI may encode for at least one surface protein.
  • S. pneumoniae strain 6B Finland 12 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 6B Finland 12 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 6B Finland 12 AI surface protein such as orf3 — 6BF, orf4 — 6BF, or orf5 — 6BF.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 6B Finland 12 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 6B Finland 12 AI proteins and one or more AI proteins of any one or more of S. pneumoniae from TIGR4, 670, 19A Hungary 6, 6B Finland 12, 6B Spain 2, 9V Spain 3, 19F Taiwan 14, 23F Taiwan 15, or 23F Poland 16 AI, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 6B Finland 12 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 6B Spain 2 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 6B Spain 2 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 6BSP, ORF3 — 6BSP, ORF4 — 6BSP, ORF5 — 6BSP, ORF6 — 6BSP, ORF7 — 6BSP, and ORF8 — 6BSP.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 6B Spain 2 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 6B Spain 2 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 6B Spain 2 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 6B Spain 2 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 6B Spain 2 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 6B Spain 2 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 6B Spain 2 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 6B Spain 2 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 6B Spain 2 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 6B Spain 2 AI may encode for at least one surface protein.
  • S. pneumoniae strain 6B Spain 2 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 6B Spain 2 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 6B Spain 2 AI surface protein such as orf3 — 6BSP, orf4 — 6BSP, or orf5 — 6BSP.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 6B Spain 2 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 6B Spain 2 AI proteins and one or more AI proteins of any one or more of S. pneumoniae from TIGR4, 670, 19A Hungary 6, 6B Finland 12, 14 CSR 10, 9V Spain 3, 19F Taiwan 14, 23F Taiwan 15, or 23F Poland 16 AI, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 6B Spain 2 AI may also include a transcriptional regulator.
  • the S. pneumoniae strain 9V Spain 3 Adhesin Island comprises a series of approximately seven open reading frames encoding for a collection of amino acid sequences comprising surface proteins and sortases.
  • the S. pneumoniae strain 9V Spain 3 AI proteins includes open reading frames encoding for two or more (i.e., 2, 3, 4, 5, 6, or 7) of ORF2 — 9VSP, ORF3 — 9VSP, ORF4 — 9VSP, ORF5 — 9VSP, ORF6 — 9VSP, ORF7 — 9VSP, and ORF8 — 9VSP.
  • a preferred immunogenic composition of the invention comprises a S. pneumoniae strain 9V Spain 3 AI surface protein which may be formulated or purified in an oligomeric (pilis) form.
  • Another preferred immunogenic composition of the invention comprises a S. pneumoniae strain 9V Spain 3 AI surface protein which has been isolated in an oligomeric (pilis) form.
  • One or more of the S. pneumoniae strain 9V Spain 3 AI open reading frame polynucleotide sequences may be replaced by a polynucleotide sequence coding for a fragment of the replaced ORF.
  • one or more of the S. pneumoniae strain 9V Spain 3 AI open reading frames may be replaced by a sequence having sequence homology to the replaced ORF.
  • One or more of the S. pneumoniae strain 9V Spain 3 AI surface protein sequences typically include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • the S. pneumoniae strain 9V Spain 3 AI surface proteins of the invention may affect the ability of the S. pneumoniae bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of S. pneumoniae to translocate through an epithelial cell layer. Preferably, one or more S. pneumoniae strain 9V Spain 3 AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. S. pneumoniae strain 9V Spain 3 AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • S. pneumoniae strain 9V Spain 3 AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • S. pneumoniae strain 9V Spain 3 AI may encode for at least one surface protein.
  • S. pneumoniae strain 9V Spain 3 AI may encode for at least two surface exposed proteins and at least one sortase.
  • S. pneumoniae strain 9V Spain 3 AI encodes for at least three surface exposed proteins and at least two sortases.
  • the AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a S. pneumoniae strain 9V Spain 3 AI surface protein such as orf3 — 9VSP, orf4 — 9VSP, or orf5 — 9VSP.
  • the oligomeric, pilus-like structure may comprise numerous units of AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine or serine amino acid residue, respectively.
  • AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include a pilin motif.
  • the invention comprises a S. pneumoniae strain 9V Spain 3 AI protein in oligomeric form, preferably in a hyperoligomeric form.
  • the invention comprises a composition comprising one or more S. pneumoniae strain 9V Spain 3 AI proteins and one or more AI proteins from any one or more of S. pneumoniae from TIGR4, 670, 19A Hungary 6, 6B Finland 12, 6B Spain 2, 14 CSR 10, 19F Taiwan 14, 23F Taiwan 15, or 23F Poland 16 AI, wherein one or more of the S. pneumoniae AI proteins is in the form of an oligomer, preferably in a hyperoligomeric form.
  • S. pneumoniae strain 9V Spain 3 AI may also include a transcriptional regulator.
  • the S. pneumoniae oligomeric, pilus-like structures may be isolated or purified from bacterial cultures in which the bacteria express an S. pneumoniae AI surface protein.
  • the invention therefore includes a method for manufacturing an oligomeric AI surface antigen comprising culturing a S. pneumoniae bacterium that expresses the oligomeric AI protein and isolating the expressed oligomeric AI protein from the S. pneumoniae bacteria.
  • the AI protein may be collected from secretions into the supernatant or it may be purified from the bacterial surface.
  • the method may further comprise purification of the expressed AI protein.
  • the AI protein is in a hyperoligomeric form.
  • the oligomeric, pilus-like structures may be isolated or purified from bacterial cultures overexpressing an AI surface protein.
  • the invention therefore includes a method for manufacturing an S. pneumoniae oligomeric Adhesin Island surface antigen comprising culturing a S. pneumoniae bacterium adapted for increased AI protein expression and isolation of the expressed oligomeric Adhesin Island protein from the S. pneumoniae bacteria.
  • the AI protein may be collected from secretions into the supernatant or it may be purified from the bacterial surface.
  • the method may further comprise purification of the expressed Adhesin Island protein.
  • the Adhesin Island protein is in a hyperoligomeric form.
  • the S. pneumoniae bacteria are preferably adapted to increase AI protein expression by at least two (e.g., 2, 3, 4, 5, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150 or 200) times wild type expression levels.
  • S. pneumoniae bacteria may be adapted to increase AI protein expression by any means known in the art, including methods of increasing gene dosage and methods of gene upregulation. Such means include, for example, transformation of the S. pneumoniae bacteria with a plasmid encoding the AI protein.
  • the plasmid may include a strong promoter or it may include multiple copies of the sequence encoding the AI protein.
  • the sequence encoding the AI protein within the S. pneumoniae bacterial genome may be deleted.
  • the promoter regulating the S. pneumoniae Adhesin Island may be modified to increase expression.
  • the invention further includes S. pneumoniae bacteria which have been adapted to produce increased levels of AI surface protein.
  • the invention includes S. pneumoniae bacteria which have been adapted to produce oligomeric or hyperoligomeric AI surface protein.
  • the S. pneumoniae of the invention are inactivated or attenuated to permit in vivo delivery of the whole bacteria, with the AI surface protein exposed on its surface.
  • the invention further includes S. pneumoniae bacteria which have been adapted to have increased levels of expressed AI protein incorporated in pili on their surface.
  • the S. pneumoniae bacteria may be adapted to have increased exposure of oligomeric or hyperoligomeric AI proteins on its surface by increasing expression levels of a signal peptidase polypeptide.
  • Increased levels of a local signal peptidase expression in Gram positive bacteria (such us LepA in GAS) are expected to result in increased exposure of pili proteins on the surface of Gram positive bacteria.
  • Increased expression of a leader peptidase in S. pneumoniae may be achieved by any means known in the art, such as increasing gene dosage and methods of gene upregulation.
  • the S. pneumoniae bacteria adapted to have increased levels of leader peptidase may additionally be adapted to express increased levels of at least one pili protein.
  • the AI proteins of the invention may be expressed on the surface of a non-pathogenic Gram positive bacteria, such as Streptococus gordonii (See, e.g., Byrd et al., “Biological consequences of antigen and cytokine co-expression by recombinant Streptococcus gordonii vaccine vectors”, Vaccine (2002) 20:2197-2205) or Lactococcus lactis (See, e.g., Mannam et al., “Mucosal Vaccine Made from Live, Recombinant Lactococcus lactis Protects Mice against Pharangeal Infection with Streptococcus pyogenes ” Infection and Immunity (2004) 72(6):3444-3450).
  • Streptococus gordonii See, e.g., Byrd et al., “Biological consequences of antigen and cytokine co-expression by recombinant Streptococcus gordonii vaccine
  • non-pathogenic Gram positive bacteria refer to Gram positive bacteria which are compatible with a human host subject and are not associated with human pathogenisis.
  • the non-pathogenic bacteria are modified to express the AI surface protein in oligomeric, or hyper-oligomeric form. Sequences encoding for an AI surface protein and, optionally, an AI sortase, may be integrated into the non-pathogenic Gram positive bacterial genome or inserted into a plasmid.
  • the non-pathogenic Gram positive bacteria may be inactivated or attenuated to facilitate in vivo delivery of the whole bacteria, with the AI surface protein exposed on its surface.
  • the AI surface protein may be isolated or purified from a bacterial culture of the non-pathogenic Gram positive bacteria.
  • the AI surface protein may be isolated from cell extracts or culture supernatants.
  • the AI surface protein may be isolated or purified from the surface of the non-pathogenic Gram positive bacteria.
  • the non-pathogenic Gram positive bacteria may be used to express any of the S. pneumoniae Adhesin Island proteins described herein.
  • the non-pathogenic Gram positive bacteria are transformed to express an Adhesin Island surface protein.
  • the non-pathogenic Gram positive bacteria also express at least one Adhesin Island sortase.
  • the AI transformed non-pathogenic Gram positive bacteria of the invention may be used to prevent or treat infection with pathogenic S. pneumoniae.
  • FIGS. 190 A and B, and 193 - 195 provide examples of three methods successfully practiced by applicants to purify pili from S. pneumoniae TIGR4.
  • the Gram positive bacteria AI proteins described herein are useful in immunogenic compositions for the prevention or treatment of Gram positive bacterial infection.
  • the GBS AI surface proteins described herein are useful in immunogenic compositions for the prevention or treatment of GBS infection.
  • the GAS AI surface proteins described herein may be useful in immunogenic compositions for the prevention or treatment of GAS infection.
  • the S. pneumoniae AI surface proteins may be useful in immunogenic cojmpositions for the prevention or treatment of S. pneumoniae infection.
  • Gram positive bacteria AI surface proteins that can provide protection across more than one serotype or strain isolate may be used to increase immunogenic effectiveness.
  • a particular GBS AI surface protein having an amino acid sequence that is at least 50% (i.e., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) homologous to the particular GBS AI surface protein of at least 2 (i.e., at least 3, 4, 5, 6, 7, 8, 9, 10, or more) other GBS serotypes or strain isolates may be used to increase the effectiveness of such compositions.
  • fragments of Gram positive bacteria AI surface proteins that can provide protection across more than one serotype or strain isolate may be used to increase immunogenic effectiveness.
  • a fragment may be identified within a consensus sequence of a full length amino acid sequence of a Gram positive bacteria AI surface protein.
  • Such a fragment can be identified in the consensus sequence by its high degree of homology or identity across multiple (i.e, at least 3, 4, 5, 6, 7, 8, 9, 10, or more) Gram positive bacteria serotypes or strain isolates.
  • a high degree of homology is a degree of homology of at least 90% (i.e., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) across Gram positive bacteria serotypes or strain isolates.
  • a high degree of identity is a degree of identity of at least 90% (i.e., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) across Gram positive bacteria serotypes or strain isolates.
  • such a fragment of a Gram positive bacteria AI surface protein may be used in the immunogenic compositions.
  • AI surface protein oligomeric pilus structures may be formulated or purified for use in immunization. Isolated AI surface protein oligomeric pilus structures may also be used for immunization.
  • the invention includes an immunogenic composition comprising a first Gram positive bacteria AI protein and a second Gram positive bacterial AI protein.
  • One or more of the AI proteins may be a surface protein.
  • Such surface proteins may contain an LPXTG motif or other sortase substrate motif.
  • the first and second AI proteins may be from the same or different genus or species of Gram positive bacteria. If within the same species, the first and second AI proteins may be from the same or different AI subtypes. If two AIs are of the same subtype, the AIs have the same numerical designation. For example, all AIs designated as AI-1 are of the same AI subtype. If two AIs are of a different subtype, the AIs have different numerical designations. For example, AI-1 is of a different AI subtype from AI-2, AI-3, AI-4, etc. Likewise, AI-2 is of a different AI subtype from AI-1, AI-3, and AI-4, etc.
  • the invention includes an immunogenic composition comprising one or more GBS AI-1 proteins and one or more GBS AI-2 proteins.
  • One or more of the AI proteins may be a surface protein.
  • Such surface proteins may contain an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) and may bind fibrinogen, fibronectin, or collagen.
  • One or more of the AI proteins may be a sortase.
  • the GBS AI-1 proteins may be selected from the group consisting of GBS 80, GBS 104, GBS 52, SAG0647 and SAG0648.
  • the GBS AI-1 proteins include GBS 80 or GBS 104.
  • the GBS AI-2 proteins may be selected from the group consisting of GBS 67, GBS 59, GBS 150, SAG1405, SAG1406, 01520, 01521, 01522, 01523, 01523, 01524 and 01525.
  • the GBS AI-2 proteins are selected from the group consisting of GBS 67, GBS 59, GBS 150, SAG1405, and SAG1406.
  • the GBS AI-2 proteins may be selected from the group consisting of 01520, 01521, 01522, 01523, 01523, 01524 and 01525.
  • the GBS AI-2 protein includes GBS 59 or GBS 67.
  • the invention includes an immunogenic composition comprising one or more of any combination of GAS AI-1, GAS AI-2, GAS AI-3, or GAS AI-4 proteins.
  • GAS AI proteins may be a sortase.
  • the GAS AI-1 proteins may be selected from the group consisting of M6_Spy0156, M6_Spy0157, M6_Spy0158, M6_Spy0159, M6_Spy0160, M6_Spy0161, CDC SS 410_fimbrial, ISS3650_fimbrial, and DSM2071_fimbrial.
  • the GAS AI-1 proteins are selected from the group consisting of M6_Spy0157, M6_Spy0159, M6_Spy0160, CDC SS 410_fimbrial, ISS3650_fimbrial, and DSM2071_fimbrial.
  • the GAS AI-2 proteins may be selected from the group consisting of Spy0124, GAS15, Spy0127, GAS16, GAS17, GAS18, Spy0131, Spy0133, and GAS20.
  • the GAS AI-2 proteins are selected from the group consisting of GAS 15, GAS 16, and GAS 18.
  • the GAS AI-3 proteins may be selected from the group consisting of SpyM3 — 0097, SpyM3 — 0098, SpyM3 — 0099, SpyM3 — 0100, SpyM3 — 0101, SpyM3 — 0102, SpyM3 — 0103, SpyM3 — 0104, SPs0099, SPs0100, SPs0101, SPs0102, SPs0103, SPs0104, SPs0105, SPs0106, orf77, orf78, orf79, orf80, orf81, orf82, orf83, orf84, spyM18 — 0125, spyM18 — 0126, spyM18 — 0127, spyM18 — 0128, spyM18 — 0129, spyM18 — 0130, spyM18 — 0131, spyM18 — 0132, SpyoM01000156, SpyoM01000155, SpyoM01000154, SpyoM
  • the GAS AI-3 proteins are selected from the group consisting of SpyM3 — 0097, SpyM3 — 0098, SpyM3 — 0099, SpyM3 — 0100, SpyM3 — 0101, SpyM3 — 0102, SpyM3 — 0103, and SpyM3 — 0104.
  • the GAS AI-3 proteins are selected from the group consisting of SPs0099, SPs0100, SPs0101, SPs0102, SPs0103, SPs0104, SPs0105, and SPs0106.
  • the GAS AI-3 proteins are selected from the group consisting of orf77, orf78, orf79, orf80, orf81, orf82, orf83, and orf84.
  • the GAS AI-3 proteins are selected from the group consisting of spyM18 — 0125, spyM18 — 0126, spyM18 — 0127, spyM18 — 0128, spyM18 — 0129, spyM18 — 0130, spyM18 — 0131, and spyM18 — 0132.
  • GAS AI-3 proteins are selected from the group consisting of SpyoM01000156, SpyoM01000155, SpyoM01000154, SpyoM01000153, SpyoM01000152, SpyoM01000151, SpyoM01000150, and SpyoM01000149.
  • the GAS AI-4 proteins may be selected from the group consisting of 19224133, 19224134, 19224135, 19224136, 19224137, 19224138, 19224139, 19224140, 19224141, 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, and ISS4538_fimbrial.
  • the GAS-AI-4 proteins are selected from the group consisting of 19224134, 19224135, 19224137, 19224139, 19224141, 20010296_fimbrial, 20020069_fimbrial, CDC SS 635_fimbrial, ISS4883_fimbrial, and ISS4538_fimbrial.
  • the invention includes an immunogenic composition comprising one or more of any combination of S. pneumonaie from TIGR4 , S. pneumonaie strain 670 , S. pneumonaie from 19A Hungary 6 , S. pneumonaie from 6B Finland 12 , S. pneumonaie from 6B Spain 2 , S. pneumonaie from 9V Spain 3 , S. pneumonaie from 14 CSR 10 , S. pneumonaie from 19F Taiwan 14 , S. pneumonaie from 23F Taiwan 15, or S. pneumonaie from 23F Poland 16 AI proteins.
  • One or more of the AI proteins may be a surface protein. Such surface proteins may contain an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) and may bind fibrinogen, fibronectin, or collagen.
  • One or more of the AI proteins may be a sortase.
  • the S. pneumonaie from TIGR4 AI proteins may be selected from the group consisting of SP0462, SP0463, SP0464, SP0465, SP0466, SP0467, SP0468.
  • the S. pneumonaie from TIGR4 AI proteins include SP0462, SP0463, or SP0464.
  • the S. pneumonaie strain 670 AI proteins may be selected from the group consisting of Orf1 — 670, Orf3 — 670, Orf4 — 670, Orf5 — 670, Orf6 — 670, Orf7 — 670, and Orf8 — 670.
  • the S. pneumonaie strain 670 AI proteins include Orf3 — 670, Orf4 — 670, or Orf5 — 670.
  • the S. pneumonaie from 19A Hungary 6 AI proteins may be selected from the group consisting of ORF2 — 1 gAH, ORF3 — 1 gAH, ORF4 — 19AH, ORF5 — 19AH, ORF6 — 1 gAH, ORF7 — 19AH, or ORF8 — 19AH.
  • the S. pneumonaie from 6B Finland 12 AI proteins may be selected from the group consisting of ORF2 — 6BF, ORF3 — 6BF, ORF4 — 6BF, ORF5 — 6BF, ORF6 — 6BF, ORF7 — 6BF, or ORF8 — 6BF.
  • the S. pneumonaie from 6B Spain 2 AI proteins may be selected from the group consisting of ORF2 — 6BSP, ORF3 — 6BSP, ORF4 — 6BSP, ORF5 — 6BSP, ORF6 — 6BSP, ORF7 — 6BSP, or ORF8 — 6BSP.
  • the S. pneumonaie from 9V Spain 3 AI proteins may be selected from the group consisting of ORF2 — 9VSP, ORF3 — 9VSP, ORF4 — 9VSP, ORF5 — 9VSP, ORF6 — 9VSP, ORF7 — 9VSP, or ORF8 — 9VSP.
  • the S. pneumonaie from 14 CSR 10 AI proteins may be selected from the group consisting of ORF2 — 14CSR, ORF3 — 14CSR, ORF4 — 14CSR, ORF5 — 14CSR, ORF6 — 14CSR, ORF7 — 14CSR, or ORF8 — 14CSR.
  • the S. pneumonaie from 19F Taiwan 14 AI proteins may be selected from the group consisting of ORF2 — 1 gFTW, ORF3 — 19FTW, ORF4 — 19FTW, ORF5 — 19FTW, ORF6 — 19FTW, ORF7 — 19FTW, or ORF8 — 19FTW.
  • the S. pneumonaie from 23F Taiwan 15 AI proteins may be selected from the group consisting of ORF2 — 23FTW, ORF3 — 23FTW, ORF4 — 23FTW, ORF5 — 23FTW, ORF6 — 23FTW, ORF7 — 23FTW, or ORF8 — 23FTW.
  • the S. pneumonaie from 23F Poland 16 AI proteins may be selected from the group consisting of ORF2 — 23FP, ORF3 — 23FP, ORF4 — 23FP, ORF5 — 23FP, ORF6 — 23FP, ORF7 — 23FP or ORF8 — 23FP.
  • the Gram positive bacteria AI proteins included in the immunogenic compositions of the invention can provide protection across more than one serotype or strain isolate.
  • the immunogenic composition may comprise a first AI protein, wherein the amino acid sequence of said AI protein is at least 90% (i.e., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%) homologous to the amino acid sequence of a second AI protein, and wherein said first AI protein and said second AI protein are derived from the genomes of different serotypes of a Gram positive bacteria.
  • the first AI protein may also be homologous to the amino acid sequence of a third AI protein, such that the first AI protein, the second AI protein and the third AI protein are derived from the genomes of different serotypes of a Gram positive bacteria.
  • the first AI protein may also be homologous to the amino acid sequence of a fourth AI protein, such that the first AI protein, the second AI protein and the third AI protein are derived from the genomes of different serotypes of a Gram positive bacteria.
  • the GBS AI proteins included in the immunogenic compositions of the invention can provide protection across more than one GBS serotype or strain isolate.
  • the immunogenic composition may comprise a first GBS AI protein, wherein the amino acid sequence of said AI protein is at least 90% (i.e., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%) homologous to the amino acid sequence of a second GBS AI protein, and wherein said first AI protein and said second AI protein are derived from the genomes of different GBS serotypes.
  • the first GBS AI protein may also be homologous to the amino acid sequence of a third GBS AI protein, such that the first AI protein, the second AI protein and the third AI protein are derived from the genomes of different GBS serotypes.
  • the first AI protein may also be homologous to the amino acid sequence of a fourth GBS AI protein, such that the first AI protein, the second AI protein and the third AI protein are derived from the genomes of different GBS serotypes.
  • the first AI protein may be selected from an AI-1 protein or an AI-2 protein.
  • the first AI protein may be a GBS AI-1 surface protein such as GBS 80.
  • GBS 80 The amino acid sequence of GBS 80 from GBS serotype V, strain isolate 2603 is greater than 90% homologous to the GBS 80 amino acid sequence from GBS serotype III, strain isolates NEM316 and COH1 and the GBS 80 amino acid sequence from GBS serotype 1a, strain isolate A909.
  • the first AI protein may be GBS 104.
  • the amino acid sequence of GBS 104 from GBS serotype V, strain isolate 2603 is greater than 90% homologous to the GBS 104 amino acid sequence from GBS serotype III, strain isolates NEM316 and COH1, the GBS 104 amino acid sequence from GBS serotype 1a, strain isolate A909, and the GBS 104 amino acid sequence serotype II, strain isolate 18RS21.
  • Table 12 provides the amino acid sequence identity of GBS 80 and GBS 104 across GBS serotypes Ia, Ib, II, III, V, and VIII.
  • the GBS strains in which genes encoding GBS 80 and GBS 104 were identified share, on average, 99.88 and 99.96 amino acid sequence identity, respectively. This high degree of amino acid identity indicates that an immunogenic composition comprising a first protein of GBS 80 or GBS 104 may provide protection across more than one GBS serotype or strain isolate.
  • GBS 80 GBS 104 Serotype Strains cGH % AA identity cGH % AA identity Ia 090 + 99.79 + 100.00 A909 + 100.00 + 100.00 515 ⁇ ⁇ DK1 ⁇ ⁇ DK8 ⁇ ⁇ Davis ⁇ ⁇ Ib 7357b + 100.00 + H36B ⁇ ⁇ II 18RS21 ⁇ + 100.00 DK21 ⁇ ⁇ III NEM316 + 100.00 + 100.00 COH31 + 100.00 + D136 + 100.00 + M732 + 100.00 + 99.88 COH1 + 99.79 + 99.88 M781 + 99.79 + 99.88 No type CJB110 + 99.37 + 100.00 1169NT ⁇ ⁇ V CJB111 + 100.00 + 100.00 2603 + 100.00 + 100.00 VIII JM130013 + 99.79 + 100.00 SMU014 + 100.00 + total 14/22 99.88 +/ ⁇ 0.19 15/22 99
  • the first AI protein may be an AI-2 protein such as GBS 67.
  • the amino acid sequence of GBS 67 from GBS serotype V, strain isolate 2603 is greater than 90% homologous to the GBS 67 amino acid sequence from GBS serotype III, strain isolate NEM316, the GBS 67 amino acid sequence from GBS serotype 1b, strain isolate H36B, and the GBS 67 amino acid sequence from GBS serotype II, strain isolate 17RS21.
  • the first AI protein may be an AI-2 protein such as spb1.
  • the amino acid sequence of spb1 from GBS serotype III, strain isolate COH1 is greater than 90% homologous to the spb1 amino acid sequence from GBS serotype Ia, strain isolate A909.
  • the first AI protein may be an AI-2 protein such as GBS 59.
  • the amino acid sequence of GBS 59 from GBS serotype II, strain isolate 18RS21 is 100% homologous to the GBS 59 amino acid sequence from GBS serotype V, strain isolate 2603.
  • the amino acid sequence of GBS 59 from GBS serotype V, strain isolate CJB111 is 98% homologous to the GBS 59 amino acid sequence from GBS serotype III, strain isolate NEM316.
  • compositions of the invention may also be designed to include Gram positive AI proteins from divergent serotypes or strain isolates, i.e., to include a first AI protein which is present in one collection of serotypes or strain isolates of a Gram positive bacteria and a second AI protein which is present in those serotypes or strain isolates not represented by the first AI protein.
  • the invention may include an immunogenic composition comprising a first and second Gram positive bacteria AI protein, wherein a polynucleotide sequence encoding for the full length sequence of the first AI protein is not present in a similar Gram positive bacterial genome comprising a polynucleotide sequence encoding for the second AI protein.
  • compositions of the invention may also be designed to include AI proteins from divergent GBS serotypes or strain isolates, i.e., to include a first AI protein which is present in one collection of GBS serotypes or strain isolates and a second AI protein which is present in those serotypes or strain isolates not represented by the first AI protein.
  • the invention may include an immunogenic composition comprising a first and second GBS AI protein, wherein a polynucleotide sequence encoding for the full length sequence of the first GBS AI protein is not present in a genome comprising a polynucleotide sequence encoding for the second GBS AI protein.
  • the first AI protein could be GBS 80 (such as the GBS 80 sequence from GBS serotype V, strain isolate 2603).
  • the sequence for GBS 80 in GBS sertoype II, strain isolate 18RS21 is disrupted.
  • the second AI protein could be GBS 104 or GBS 67 (sequences selected from the GBS serotype II, strain isolate 18RS21).
  • the invention may include an immunogenic composition comprising a first and second GBS AI protein, wherein the first GBS AI protein has detectable surface exposure on a first GBS strain or serotype but not a second GBS strain or serotype and the second GBS AI protein has detectable surface exposure on a second GBS strain or serotype but not a first GBS strain or serotype.
  • the first AI protein could be GBS 80 and the second AI protein could be GBS 67.
  • Table 15 there are some GBS serotypes and strains that have surface exposed GBS 80 but that do not have surface exposed GBS 67 and vice versa.
  • An immunogenic composition comprising a GBS 80 and a GBS 67 protein may provide protection across a wider group of GBS strains and serotypes.
  • TABLE 15 Antigen surface exposure of GBS 80, GBS 322, GBS 104, and GBS 67 GBS strains
  • Type GBS 80 GBS 322 GBS 104 GBS 67 DK1* Ia 0 nd 237 478 DK8* 0 213 151 475 Davis* 0 86 271 430 515* 0 227 262 409 090 0 0 0 0 A909 0 0 0 0 2986 0 0 157 397 5551 0 36 384 485 2177 Ib 477 323 328 66 H36B* 0 105 518 444 7357b- 91 102 309 316 2129 57 71 132 0 5518 31 nd 60 28 COH1 III 305 130 305 0 D136C 16 460 226 406 COH31
  • the invention may include an immunogenic composition comprising a first and second Gram positive bacteria AI protein, wherein the polynucleotide sequence encoding the sequence of the first AI protein is less than 90% (i.e., less than 90, 88, 86, 84, 82, 80, 78, 76, 74, 72, 70, 65, 60, 55, 50, 45, 40, 35 or 30 percent) homologous than the corresponding sequence in the genome of the second AI protein.
  • the invention may include an immunogenic composition comprising a first and second GBS AI protein, wherein the polynucleotide sequence encoding the sequence of the first GBS AI protein is less than 90% (i.e., less than 90, 88, 86, 84, 82, 80, 78, 76, 74, 72, 70, 65, 60, 55, 50, 45, 40, 35 or 30 percent) homologous than the corresponding sequence in the genome of the second GBS AI protein.
  • the first GBS AI protein could be GBS 67 (such as the GBS 67 sequence from GBS serotype 1b, strain isolate H36B). As shown in FIGS.
  • the GBS 67 sequence for this strain is less than 90% homologous (87%) to the corresponding GBS 67 sequence in GBS serotype V, strain isolate 2603.
  • the second GBS AI protein could then be the GBS 80 sequence from GBS serotype V, strain isolate 2603.
  • An example immunogenic composition of the invention may comprise adhesin island proteins GBS 80, GBS 104, GBS 67, and GBS 59, and non-AI protein GBS 322.
  • FACS analysis of different GBS strains demonstrates that at least one of these five proteins is always found to be expressed on the surface of GBS bacteria.
  • FIG. 227 provides the FACS data obtained for surface exposure of GBS 80, GBS 104, GBS 67, GBS 322, and GBS 59 on each of 37 GBS strains.
  • FIG. 228 provides the FACS data obtained for surface exposure of GBS 80, GBS 104, GBS 67, GBS 322, and GBS 59 on each of 41 GBS strains obtained from the CDC.
  • each GBS strain had surface expression of at least one of GBS 80, GBS 104, GBS 67, GBS 322, and GBS 59.
  • the surface exposure of at least one of these proteins on each bacterial strain indicates that an immunogenic composition comprising these proteins will provide wide protection across GBS strains and serotypes.
  • the surface exposed GBS 80, GBS 104, GBS 67, GBS 322, and GBS 59 proteins are also present at high levels as determined by FACS.
  • Table 49 summarizes the FACS results for the initial 70 GBS strains examined for GBS 80, GBS 104, GBS 67, GBS 322, and GBS 59 surface expression.
  • a protein was designated as having high levels of surface expression of a protein if a five-fold shift in fluorescence was observed when using antibodies for the protein relative to preimmune control serum.
  • Table 50 details which of the surface proteins is highly expressed on the different GBS serotype. TABLE 50 High Levels of Surface Protein Expression on GBS Serotypes 5-fold shift in fluorescence by FACS GBS 80 GBS 104 GBS 67 GBS 59 GBS 322 Ia + Ib + III 4/36 2/36 22/36 20/36 18/36 II + V 11/25 9/25 21/25 21/25 13/25 Others 2/9 3/9 6/9 5/9 2/9
  • the immunogenic composition of the invention may include GBS 80, GBS 104, GBS 67, and GBS 322. Assuming that protein antigens that are highly accessible to antibodies confer 100% protection with suitable adjuvants, an immunogenic composition containing GBS 80, GBS 104, GBS 67, GBS 59 and GBS 322 will provide protection for 89% of GBS strains and serotypes, the same percentage as an immunogenic composition containing GBS 80, GBS 104, GBS 67, and GBS 322 proteins. See FIG. 229 . However, it may be preferable to include GBS 59 in the composition to increase its immunogenic strength.
  • GBS 59 is highly expressed on the surface two-thirds of GBS bacteria examined by FACS analysis, unlike GBS 80, GBS 104, and GBS 322, which are highly expressed in less than half of GBS bacteria examined.
  • GBS 59 opsonophagocytic activity is also comparable to that of a mix of GBS 322, GBS 104, GBS 67, and GBS 80 proteins. See FIG. 230 .
  • the GAS AI proteins included in the immunogenic compositions of the invention can provide protection across more than one GAS serotype or strain isolate.
  • the immunogenic composition may comprise a first GAS AI protein, wherein the amino acid sequence of said AI protein is at least 90% (i.e., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%) homologous to the amino acid sequence of a second GAS AI protein, and wherein said first AI protein and said second AI protein are derived from the genomes of different GAS serotypes.
  • the first GAS AI protein may also be homologous to the amino acid sequence of a third GAS AI protein, such that the first AI protein, the second AI protein and the third AI protein are derived from the genomes of different GAS serotypes.
  • the first AI protein may also be homologous to the amino acid sequence of a fourth GAS AI protein, such that the first AI protein, the second AI protein and the third AI protein are derived from the genomes of different GAS serotypes.
  • compositions of the invention may also be designed to include GAS AI proteins from divergent serotypes or strain isolates, i.e., to include a first AI protein which is present in one collection of serotypes or strain isolates of a GAS bacteria and a second AI protein which is present in those serotypes or strain isolates not represented by the first AI protein.
  • the first AI protein could be a prtF2 protein (such as the 19224141 protein from GAS serotype M12, strain isolate A735).
  • the sequence for a prtF2 protein is not present in GAS AI types 1 or 2.
  • the second AI protein could be collagen binding protein M6_Spy0159 (from M6 isolate (MGAS10394), which comprises an AI-1) or GAS15 (from M1 isolate (SF370), which comprises an AI-2).
  • the invention may include an immunogenic composition comprising a first and second GAS AI protein, wherein the first GAS AI protein has detectable surface exposure on a first GAS strain or serotype but not a second GAS strain or serotype and the second GAS AI protein has detectable surface exposure on a second GAS strain or serotype but not a first GAS strain or serotype.
  • the invention may include an immunogenic composition comprising a first and second GAS AI protein, wherein the polynucleotide sequence encoding the sequence of the first GAS AI protein is less than 90% (i.e., less than 90, 88, 86, 84, 82, 80, 78, 76, 74, 72, 70, 65, 60, 55, 50, 45, 40, 35 or 30 percent) homologous than the corresponding sequence in the genome of the second GAS AI protein.
  • the first and second GAS AI proteins are subunits of the pilus.
  • the first and second GAS AI proteins are selected from the major pilus forming proteins (i.e., M6_Spy0160 from M6 strain 10394, SPy0128 from M1 strain SF370, SpyM3 — 0100 from M3 strain 315, SPs0102 from M3 strain SSI, orf80 from M5 isolate Manfredo, spyM18 — 0128 from M18 strain 8232, SpyoM01000153 from M49 strain 591, 19224137 from M12 strain A735, fimbrial structural subunit from M77 strain ISS4959, fimbrial structural subunit from M44 strain ISS3776, fimbrial structural subunit from M50 strain ISS3776 ISS 4538, fimbrial structural subunit from M12 strain CDC SS635, fimbrial structural subunit from M23 strain DSM2071, fimbrial structural subunit from M6 strain CDC SS410).
  • M6_Spy0160 from M6 strain 10394
  • Table 45 provides the percent identity between the amino acidic sequences of each of the main pilus forming subunits from GAS AI-1, AI-2, AI-3, and AI-4 representative strains (i.e., M6_Spy0160 from M6 strain 10394, SPy0128 from M1 strain SF370, SpyM3 — 0100 from M3 strain 315, SPs0102 from M3 strain SSI, orf80 from M5 isolate Manfredo, spyM18 — 0128 from M18 strain 8232, SpyoM01000153 from M49 strain 591, 19224137 from M12 strain A735, Fimbrial structural subunit from M77 strain ISS4959, fimbrial structural subunit from M44 strain ISS3776, fimbrial structural subunit from M50 strain ISS3776 ISS 4538, fimbrial structural subunit from M12 strain CDC SS635, fimbrial structural subunit from M23 strain DSM2071, fimbrial structural subunit from M6 strain CDC SS410
  • the first main pilus subunit may be selected from bacteria of GAS serotype M6 strain 10394 and the second main pilus subunit may be selected from bacteria of GAS serotype M1 strain 370.
  • the main pilus subunits encoded by these strains of bacteria share only 23% nucleotide identity.
  • An immunogenic composition comprising pilus main subunits from each of these strains of bacteria is expected to provide protection across a wider group of GAS strains and serotypes.
  • main pilus subunits that can be used in combination to provide increased protection across a wider range of GAS strains and serotypes include proteins encoded by GAS serotype M5 Manfredo isolate and serotype M6 strain 10394, which share 23% sequence identity, GAS serotype M18 strain 8232 and serotype M1 strain 370, which share 38% sequence identity, GAS serotype M3 strain 315 and serotype M12 strain A735, which share 61% sequence identity, and GAS serotype M3 strain 315 and serotype M6 strain 10394 which share 25% sequence identity.
  • FIGS. 198-201 provide further tables comparing the percent identity of adhesin island-encoded surface exposed proteins for different GAS serotypes relative to other GAS serotypes harbouring an adhesin island of the same or a different subtype (GAS AI-1, GAS AI-2, GAS AI-3, and GAS AI-4). See also further discussion below.
  • Applicants have discovered that surface exposure of GBS 104 is dependent on the concurrent expression of GBS 80.
  • reverse transcriptase PCR analysis of AI-1 shows that all of the AI genes are co-transcribed as an operon.
  • Applicants constructed a series of mutant GBS containing in frame deletions of various AI-1 genes. (A schematic of the GBS mutants is presented in FIG. 7 ). FACS analysis of the various mutants comparing mean shift values using anti-GBS 80 versus anti-GBS 104 antibodies is presented in FIG. 8 . Removal of the GBS 80 operon prevented surface exposure of GBS 104; removal of the GBS 104 operon did not affect surface exposure of GBS 80.
  • GBS 80 is involved in the transport or localization of GBS 104 to the surface of the bacteria.
  • the two proteins may be oligomerized or otherwise associated. It is possible that this association involves a conformational change in GBS 104 that facilitates its transition to the surface of the GBS bacteria.
  • FIG. 68 shows that polyclonal anti-GBS 104 antibodies (see lane marked ⁇ -104 POLIC.) cross-hybridize with smaller structures than do polyclonal anti-GBS 80 antibodies (see lane marked ⁇ -GBS 80 POLIC.).
  • sortases within the adhesin island also appear to play a role in localization and presentation of the surface proteins.
  • FACS analysis of various sortase deletion mutants showed that removal of sortase SAG0648 prevented GBS 104 from reaching the surface and slightly reduced the surface exposure of GBS 80.
  • sortase SAG0647 and sortase SAG0648 were both knocked out, neither GBS 80 nor GBS 104 were surface exposed. Expression of either sortase alone was sufficient for GBS 80 to arrive at the bacterial surface. Expression of SAG0648, however, was required for GBS 104 surface localization.
  • compositions of the invention may include two or more AI proteins, wherein the AI proteins are physically or chemically associated.
  • the two AI proteins may form an oligomer.
  • the associated proteins are two AI surface proteins, such as GBS 80 and GBS 104.
  • the associated proteins may be AI surface proteins from different adhesin islands, including host cell adhesin island proteins if the AI surface proteins are expressed in a recombinant system.
  • the associated proteins may be GBS 80 and GBS 67.
  • Adhesin Island or “AI” refers to a series of open reading frames within a bacterial genome that encode for a collection of surface proteins and sortases.
  • An Adhesin Island may encode for amino acid sequences comprising at least one surface protein.
  • the Adhesin Island may encode at least one surface protein.
  • an Adhesin Island may encode for at least two surface proteins and at least one sortase.
  • an Adhesin Island encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • One or more AI surface proteins may participate in the formation of a pilus structure on the surface of the Gram positive bacteria.
  • Gram positive adhesin islands of the invention preferably include a divergently transcribed transcriptional regulator.
  • the transcriptional regulator may regulate the expression of the AI operon.
  • the invention includes a composition comprising one or more Gram positive bacteria AI surface proteins.
  • AI surface proteins may be associated in an oligomeric or hyperoligomeric structure.
  • Preferred Gram positive adhesin island proteins for use in the invention may be derived from Staphylococcus (such as S. aureus ), Streptococcus (such as S. agalactiae (GBS), S. pyogenes (GAS), S. pneumonaie, S. mutans ), Enterococcus (such as E. faecalis and E. faecium ), Clostridium (such as C. difficile ), Listeria (such as L. monocytogenes ) and Corynebacterium (such as C. diphtheria ).
  • Staphylococcus such as S. aureus
  • Streptococcus such as S. agalactiae (GBS), S. pyogenes (GAS), S. pneumonaie, S. mutans
  • Enterococcus such as E. faecalis and E. faecium
  • Clostridium such as C
  • Gram positive AI surface protein sequences typically include an LPXTG motif or other sortase substrate motif.
  • Gram positive AI surface proteins of the invention may affect the ability of the Gram positive bacteria to adhere to and invade epithelial cells. AI surface proteins may also affect the ability of Gram positive bacteria to translocate through an epithelial cell layer. Preferably, one or more AI surface proteins are capable of binding to or otherwise associating with an epithelial cell surface. Gram positive AI surface proteins may also be able to bind to or associate with fibrinogen, fibronectin, or collagen.
  • Gram positive AI sortase proteins are predicted to be involved in the secretion and anchoring of the LPXTG containing surface proteins.
  • a Gram positive bacteria AI may encode for at least one surface exposed protein.
  • the Adhesin Island may encode at least one surface protein.
  • a Gram positive bacteria AI may encode for at least two surface exposed proteins and at least one sortase.
  • a Gram positive AI encodes for at least three surface exposed proteins and at least two sortases.
  • Gram positive AI surface proteins may be covalently attached to the bacterial cell wall by membrane-associated transpeptidases, such as an AI sortase.
  • the sortase may function to cleave the surface protein, preferably between the threonine and glycine residues of an LPXTG motif.
  • the sortase may then assist in the formation of an amide link between the threonine carboxyl group and a cell wall precursor such as lipid II.
  • the precursor can then be incorporated into the peptidoglycan via the transglycoslylation and transpeptidation reactions of bacterial wall synthesis. See Comfort et al., Infection & Immunity (2004) 72(5): 2710-2722.
  • Gram positive bacteria AI surface proteins of the invention will contain an N-terminal leader or secretion signal to facilitate translocation of the surface protein across the bacterial membrane.
  • Gram positive bacteria AI surface proteins of the invention may affect the ability of the Gram positive bacteria to adhere to and invade target host cells, such as epithelial cells.
  • Gram positive bacteria AI surface proteins may also affect the ability of the gram positive bacteria to translocate through an epithelial cell layer.
  • one or more of the Gram positive AI surface proteins are capable of binding to or other associating with an epithelial cell surface.
  • one or more Gram positive AI surface proteins may bind to fibrinogen, fibronectin, or collagen protein.
  • the invention includes a composition comprising oligomeric, pilus-like structures comprising a Gram positive bacteria AI surface protein.
  • the oligomeric, pilus-like structure may comprise numerous units of the AI surface protein.
  • the oligomeric, pilus-like structures comprise two or more AI surface proteins.
  • the oligomeric, pilus-like structure comprises a hyper-oligomeric pilus-like structure comprising at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 150, 200 or more) oligomeric subunits, wherein each subunit comprises an AI surface protein or a fragment thereof.
  • the oligomeric subunits may be covalently associated via a conserved lysine within a pilin motif.
  • the oligomeric subunits may be covalently associated via an LPXTG motif, preferably, via the threonine amino acid residue.
  • Gram positive bacteria AI surface proteins or fragments thereof to be incorporated into the oligomeric, pilus-like structures of the invention will preferably include one or both of a pilin motif comprising a conserved lysine residue and an E box motif comprising a conserved glutamic acid residue.
  • the oligomeric, pilus like structures may be used alone or in the combinations of the invention.
  • the invention comprises a Gram positive bacteria Adhesin Island in oligomeric form, preferably in a hyperoligomeric form.
  • the oligomeric, pilus-like structures of the invention may be combined with one or more additional Gram positive AI proteins (from the same or a different Gram positive species or genus).
  • the oligomeric, pilus-like structures comprise one or more Gram positive bacteria AI surface proteins in combination with a second Gram positive bacteria protein.
  • the second Gram positive bacteria protein may be a known antigen, and need not normally be associated with an AI protein.
  • the oligomeric, pilus-like structures may be isolated or purified from bacterial cultures overexpressing a Gram positive bacteria AI surface protein.
  • the invention therefore includes a method for manufacturing an oligomeric Adhesin Island surface antigen comprising culturing a Gram positive bacteria adapted for increased AI protein expression and isolation of the expressed oligomeric Adhesin Island protein from the Gram positive bacteria.
  • the AI protein may be collected from secretions into the supernatant or it may be purified from the bacterial surface.
  • the method may further comprise purification of the expressed Adhesin Island protein.
  • the Adhesin Island protein is in a hyperoligomeric form.
  • Gram positive bacteria are preferably adapted to increase AI protein expression by at least two (e.g., 2, 3, 4, 5, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150 or 200) times wild type expression levels.
  • Gram positive bacteria may be adapted to increase AI protein expression by means known in the art, including methods of increasing gene dosage and methods of gene upregulation. Such means include, for example, transformation of the Gram positive bacteria with a plasmid encoding the AI protein.
  • the plasmid may include a strong promoter or it may include multiple copies of the sequence encoding the AI protein.
  • the sequence encoding the AI protein within the Gram positive bacterial genome may be deleted.
  • the promoter regulating the Gram positive Adhesin Island may be modified to increase expression.
  • the invention further includes Gram positive bacteria which have been adapted to produce increased levels of AI surface protein.
  • the invention includes Gram positive bacteria which have been adapted to produce oligomeric or hyperoligomeric AI surface protein.
  • the Gram positive bacteria of the invention are inactivated or attenuated to permit in vivo delivery of the whole bacteria, with the AI surface protein exposed on its surface.
  • the invention further includes Gram positive bacteria which have been adapted to have increased levels of expressed AI protein incorporated in pili on their surface.
  • the Gram positive bacteria may be adapted to have increased exposure of oligomeric or hyperoligomeric AI proteins on its surface by increasing expression levels of a signal peptidase polypeptide.
  • Increased levels of a local signal peptidase expression in Gram positive bacteria (such us LepA in GAS) are expected to result in increased exposure of pili proteins on the surface of Gram positive bacteria.
  • Increased expression of a leader peptidase in Gram positive may be achieved by any means known in the art, such as increasing gene dosage and methods of gene upregulation.
  • the Gram positive bacteria adapted to have increased levels of leader peptidase may additionally be adapted to express increased levels of at least one pili protein.
  • the AI proteins of the invention may be expressed on the surface of a non-pathogenic Gram positive bacteria, such as Streptococus gordonii (See, e.g., Byrd et al., “Biological consequences of antigen and cytokine co-expression by recombinant Streptococcus gordonii vaccine vectors”, Vaccine (2002) 20:2197-2205) or Lactococcus lactis (See, e.g., Mannam et al., “Mucosal VaccineMade from Live, Recombinant Lactococcus lactis Protects Mice against Pharangeal Infection with Streptococcus pyogenes ” Infection and Immunity (2004) 72(6):3444-3450). It has already been demonstrated, above, that L. lactis expresses GBS and GAS AI polypeptides in oligomeric form and on its surface.
  • the oligomeric, pilus-like structures may be produced recombinantly.
  • the Gram positive bacteria AI surface protein will preferably be expressed in coordination with the expression of one or more of the AI sortases of the invention.
  • AI sortases will facilitate oligomeric or hyperoligomeric formation of the AI surface protein subunits.
  • Gram positive AI Sortases of the invention will typically have a signal peptide sequence within the first 70 amino acid residues. They may also include a transmembrane sequence within 50 amino acid residues of the C terminus. The sortases may also include at least one basic amino acid residue within the last 8 amino acids. Preferably, the sortases have one or more active site residues, such as a catalytic cysteine and histidine.
  • Adhesin island surface proteins from two or more Gram positive bacterial genus or species may be combined to provide an immunogenic composition for prophylactic or therapeutic treatment of disease or infection of two more Gram positive bacterial genus or species.
  • the adhesin island surface proteins may be associated together in an oligomeric or hyperoligomeric structure.
  • the invention comprises an adhesin island surface proteins from two or more Streptococcus species.
  • the invention includes a composition comprising a GBS AI surface protein and a GAS adhesin island surface protein.
  • the invention includes a composition comprising a GAS adhesin island surface protein and a S. pneumoniae adhesin island surface protein.
  • the invention comprises an adhesin island surface protein from two or more Gram positive bacterial genus.
  • the invention includes a composition comprising a Streptococcus adhesin island protein and a Corynebacterium adhesin island protein.
  • adhesion islands are thought to encode surface proteins which are important in the bacteria's virulence, and Applicants have obtained the first electron micrographs revealing the presence of these adhesin island proteins in hyperoligomeric pilus structures on the surface of Group A Streptococcus.
  • Group A Streptococcus is a human specific pathogen which causes a wide variety of diseases ranging from pharyngitis and impetigo through life threatening invasive disease and necrotizing fasciitis.
  • post-streptococcal autoimmune responses are still a major cause of cardiac pathology in children.
  • Group A Streptococcal infection of its human host can generally occur in three phases.
  • the first phase involves attachment and/or invasion of the bacteria into host tissue and multiplication of the bacteria within the extracellular spaces. Generally this attachment phase begins in the throat or the skin. The deeper the tissue level infected, the more severe the damage that can be caused.
  • the bacteria secrete a soluble toxin that diffuses into the surrounding tissue or even systemically through the vasculature. This toxin binds to susceptible host cell receptors and triggers innappropropriate immune responses by these host cells, resulting in pathology. Because the toxin can diffuse throughout the host, the necrosis directly caused by the GAS toxins may be physically located in sites distant from the bacterial infection.
  • the final phase of GAS infection can occur long after the original bacteria have been cleared from the host system. At this stage, the host's previous immune response to the GAS bacteria due to cross reactivity between epitopes of a GAS surface protein, M, and host tissues, such as the heart.
  • a general review of GAS infection can be found in Principles of Bacterial Pathogeneis, Groisman ed., Chapter 15 (2001).
  • an effective vaccine against GAS will preferably facilitate host elimination of the bacteria during the initial attachment and invasion stage.
  • Isolates of Group A Streptococcus are historically classified according to the M surface protein described above.
  • the M protein is surface exposed trypsin-sensitive protein generally comprising two polypeptide chains complexed in an alpha helical formation.
  • the carboxyl terminus is anchored in the cytoplasmic membrane and is highly conserved among all group A streptococci.
  • the amino terminus which extends through the cell wall to the cell surface, is responsible for the antigenic variability observed among the 80 or more serotypes of M proteins.
  • T-antigen A second layer of classification is based on a variable, trypsin-resistant surface antigen, commonly referred to as the T-antigen.
  • T-antigen a variable, trypsin-resistant surface antigen
  • Decades of epidemiology based on M and T serological typing have been central to studies on the biological diversity and disease causing potential of Group A Streptococci. While the M-protein component and its inherent variability have been extensively characterized, even after five decades of study, there is still very little known about the structure and variability of T-antigens.
  • Antisera to define T types are commercially available from several sources, including Sevapharma (http://www.sevapharma.cz/en).
  • T-antigen T-type 6
  • M6 strain of GAS M6 strain of GAS
  • FCT Fibronectin-binding, Collagen-binding T-antigen
  • the antiserum recognized, in addition to a band corresponding to the predicted molecular mass of the tee6 gene product, very high molecular weight ladders ranging in mobility from about 100 kDa to beyond the resolution of the 3-8% gradient gels used. See FIG. 163A , last lane labeled “M6 Tee6.”
  • the FCT region in M6_ISS3650 contains two other genes (prtF1 and cpa) predicted to code for surface exposed proteins; these proteins are characterized as containing the cell wall attachment motif LPXTG.
  • Western blot analysis using antiserum specific for PrtF1 detected a single molecular species with electrophoretic mobility corresponding to the predicted molecular mass of the protein and one smaller band of unknown origin.
  • Western blot analysis using antisera specific for Cpa recognized a high molecular weight covalently linked ladder ( FIG. 163A , second lane).
  • Immunogold labelling of Cpa with specific antiserum followed by transmission electron microscopy detected an abundance of Cpa at the cell surface and only occasional structures extending from the cell surface ( FIG. 163J ).
  • FCT region Four classes of FCT region can be discerned by the types and order of the genes contained within the region.
  • the FCT region of strains of types M3, M5, M18 and M49 have a similar organization whereas those of M6, M1 and M12 differ. See FIG. 164 .
  • these four FCT regions correlate to four GAS Adhesin Island types (AI-1, AI-2, AI-3 and AI-4).
  • M1 strain SF370 there are three predicted surface proteins (Cpa (also referred to as M1 — 126 and GAS 15), M1 — 128 (a fimbrial protein also referred to as Spy0128 and GAS 16), and M1 — 130 (also referred to as Spy0130 and GAS 18)) (GAS AI-2).
  • Antisera specific for each surface protein reacted with a ladder of high molecular weight material ( FIG. 163B ).
  • Immunogold staining of M1 strain SF370 with antiserum specific for M1 — 128 revealed pili structures similar to those seen when M6 strain ISS3650 was immunogold stained with antiserum specific for tee6 (See FIG. 1163K ).
  • Antisera specific for surface proteins Cpa and M1 — 130 revealed abundant surface staining and occasional structures extending from the surface of M1 strain SF370 bacteria ( FIG. 163S ).
  • the M1 — 128 protein appears to be necessary for polymerization of Cpa and M1 — 130 proteins. If the M1 — 128 gene in M1_SF370 was deleted, Western blot analysis using antibodies that hybridize to Cpa and M1 — 130 no longer detected high molecular weight ladders comprising the Cpa and M1 — 130 proteins ( FIG. 163 E ). See also FIGS. 177 A-C which provide the results of Western blot analysis of the M1 — 128 ( ⁇ 128) deleted bacteria using anti-M1 — 130 antiserum ( FIG. 177 A ), anti-M1 — 128 antiserum ( FIG. 177 B ), and anti-M1 — 126 antiserum ( FIG. 177 C ).
  • High molecular weight ladders indicative of pilus formation on the surface of M1 strain SF370, could not be detected by any of the three antisera in ⁇ 128 bacteria. If the ⁇ 128 bacteria were transformed with a plasmid containing the gene for M1 — 128, Western blot analysis using antisera specific for Cpa and M1 — 130 again detected high molecular weight ladders ( FIG. 163 H ).
  • FIGS. 177 A-C provide Western blot analysis results of the M1 — 130 deleted ( ⁇ 130) strain SF370 bacteria using anti-M1 — 130 ( FIG. 177 A ), anti-M1 — 128 ( FIG. 177 B ), and anti-M1 — 126 antiserum ( FIG. 177 C ).
  • composition of the pili in GAS resembles that previously described for both C. diphtheria (7, 8) and S. agalactiae (described above) (9) in that each pilus is formed by a backbone component which abundantly stains the pili in EM and is essential for the incorporation of the other components.
  • FIGS. 177 A-C provide Western blot analysis of the SrtC1 deleted ( ⁇ srtC1) strain SF370 bacteria using anti-M1 — 130 ( FIG. 177 A ), anti-M1 — 128 ( FIG. 177 B ), and anti-M1 — 126 antiserum ( FIG. 177 C ). None of the three antisera immunoreacted with high molecular weight structures (pili) in the ⁇ SrtC1 bacteria.
  • FIG. 179 G-I show a shift in fluorescence when antibodies immunoreactive to M1 — 126 ( FIG. 179 G ), M1 — 128 ( FIG. 179 H ), and M1 — 130 ( FIG. 179 I ) are used to detect cell surface protein expression on ⁇ SrtC1 bacteria.
  • SrtC1 deletion prevents pilus formation, but not surface anchoring of proteins involved in pilus formation on the surface of bacteria.
  • Another sortase is possibly involved in anchoring of the proteins to the bacteria surface.
  • Pilus polymerization in C. diphtheriae is also dependent on particular sortase enzyme whose gene resides at the same genetic locus as the pilus components (7, 8).
  • LepA signal peptidase Spy0127
  • LepA deletion mutants ( ⁇ LepA) of strain SF370 fail to assemble pili on the cell surface. Not only are the ⁇ LepA mutants unable to assemble pili, they are also deficient at cell surface M1 expression. See FIG. 180 , which provides a FACS analysis of the wildtype (A) and ⁇ LepA mutant (B) SF370 bacteria using M1 antisera. No shift in fluorescence is observed for the ⁇ LepA mutant bacteria in the presence of M1 immune serum. It is possible that these deletion mutants of LepA will be useful for detecting non-M, non-pili, surface exposed antigens on the surface of GAS, or any Gram positive bacteria. These antigens may also be useful in immunogenic compositions.
  • M5 strain ISS4882 contains genes for four predicted surface exposed proteins (GAS AI-3). Antisera against three of the four products of the FCT region (GAS AI-3) of M5_ISS4883 (Cpa, M5_orf80, M5_orf82) stained high molecular weight ladders in Western blot analysis ( FIG. 163 C ). Long pili were visible when antisera against M5_orf80 was used in immunogold staining followed by electron microscopy ( FIG. 163L ).
  • the M12 strain 20010296 contains genes for five predicted surface exposed proteins.
  • GAS AI-4 Antisera against three of the five products of the FCT region (GAS AI-4) of M12 — 20010296 (Cpa, EftLSL.A, Orf2) stained high molecular weight ladders in Westen blot analysis ( FIG. 163 D ). Long pili were visible when antisera against EftLSL.A were used ( FIG. 163M ).
  • the major pilus forming proteins identified in the four strains studied by applicants share between 23% and 65% amino acid identity in any pairwise comparison, indicating that each pilus may represent a different Lancefield T-antigen.
  • Each pilus is part of a trypsin resistant structure on the GAS bacteria surface, as is the case for the Lancefield T antigens. See FIG. 165 , which provides a FACS analysis of bacteria harboring each of the FCT types that had or had not been treated with trypsin (6).
  • the pili structures identified on the surface of the GAS bacteria were confirmed to be Lancefield T antigens when commercially available T-serotyping sera detected the pili on the surface of bacteria.
  • Western blot analysis was initially performed to determine if polyvalent serum pools (designated T, U, W, X, and Y) could detect recombinant proteins for each of the major pilis components (T6, M1 — 128, M5_orf80 and EftLSL.A) identified in the strains of bacteria discussed above.
  • Pool U which contains the T6 serum, recognized the T6 protein specifically (a surface exposed pilus protein from GAS AI-1) ( FIG. 166 B ).
  • Pool T specifically recognized M1 — 128 (a surface exposed pilus protein from GAS AI-2) ( FIG. 166 A ).
  • Pool W recognized both M5_orf80 and EftLSL.A ( FIG. 166 C ).
  • T6 antigen corresponding to a surface exposed pilus protein from GAS AI-1
  • M1 — 28 antigen T1
  • FIG. 166 D EftLSL.A as antigen T12 (corresponding to a surface exposed pilus protein from GAS AI-4)
  • FIG. 166 G M5_orf80 as a common antigen recognized by the related sera T5, T27 and T44 (corresponding to a surface exposed pilus protein from GAS AI-3).
  • Applicants have identified at least four different Group A Streptococcus Adhesin Islands. While these GAS AI sequences can be identified in numerous M types, Applicants have surprisingly discovered a correlation between the four main pilus subunits from the four different GAS AI types and specific T classifications. While other trypsin-resistant surface exposed proteins are likely also implicated in the T classification designations, the discovery of the role of the GAS adhesin islands (and the associated hyper-oligomeric pilus like structures) in T classification and GAS serotype variance has important implications for prevention and treatment of GAS infections. Applicants have identified protein components within each of the GAS adhesin islands which are associated with the pilus formation. These proteins are believed to be involved in the bacteria's initial adherence mechanisms.
  • GAS pili may be involved in formation of biofilms.
  • the GBS pili structures appear to be implicated in the formation of biofilms (populations of bacteria growing on a surface, often enclosed in an exopolysaccharide matrix).
  • Biofilms are generally associated with bacterial resistance, as antibiotic treatments and host immune response are frequently unable to erradicate all of the bacteria components of the biofilm.
  • Direction of a host immune response against surface proteins exposed during the first steps of bacterial attachment i.e., before complete biofilm formation) is preferable.
  • the invention therefore provides for improved immunogenic compositions against GAS infection which may target GAS bacteria during their initial attachment efforts to the host epithelial cells and may provide protection against a wide range of GAS serotypes.
  • the immunogenic compositions of the invention include GAS AI surface proteins which may be formulated in an oligomeric, or hyperoligomeric (pilus) form.
  • the invention also includes combinations of GAS AI surface proteins. Combinations of GAS AI surface proteins may be selected from the same adhesin island or they may be selected from different GAS adhesin islands.
  • the invention comprises compositions comprising a first GAS AI protein and a second GAS AI protein wherein the first and second GAS AI proteins are derived from different GAS adhesin islands.
  • the invention includes a composition comprising at least two GAS AI proteins wherein the GAS AI proteins are encoded by the adhesin islands selected from the group consisting of GAS AI-1 and AI-2; GAS AI-1 and GAS AI-3; GAS AI-1 and GAS AI-4; GAS AI-2 and GAS AI-3; GAS AI-2 and GAS AI-4; and GAS AI-3 and GAS AI-4.
  • the two GAS AI proteins are derived from different T-types.
  • FIG. 162 A schematic arrangement of GAS Adhesin Island sequences is set forth in FIG. 162 .
  • the AI region is flanked by the highly conserved open reading frames M1 — 123 and M1-136. Between three and five genes in each locus code for surface proteins containing LPXTG motifs. These surface proteins also all belong to the family of genes coding for ECM binding adhesins.
  • Adhesin island sequences can be identified in numerous M types of Group A Streptococcus . Examples of AI sequences within M1, M6, M3, M5, M12, M18, and M49 serotypes are discussed below.
  • GAS Adhesin Islands generally include a series of open reading frames within a GAS genome that encode for a collection of surface proteins and sortases.
  • a GAS Adhesin Island may encode for amino acid sequences comprising at least one surface protein.
  • a GAS Adhesin Island may encode for at least two surface proteins and at least one sortase.
  • a GAS Adhesin Island encodes for at least three surface proteins and at least two sortases.
  • One or more of the surface proteins may include an LPXTG motif (such as LPXTG (SEQ ID NO: 122)) or other sortase substrate motif.
  • One or more GAS AI surface proteins may participate in the formation of a pilus structure on the surface of the Gram positive bacteria.
  • GAS Adhesin Islands of the invention preferably include a divergently transcribed transcriptional regulator.
  • the transcriptional regulator may regulate the expression of the GAS AI operon. Examples of transcriptional regulators found in GAS AI sequences include RofA and Nra.
  • the GAS AI surface proteins may bind or otherwise adhere to fibrinogen, fibronectin, or collagen.
  • One or more of the GAS AI surface proteins may comprise a fimbrial structural subunit.
  • One or more of the GAS AI surface proteins may include an LPXTG motif or other sortase substrate motif.
  • the LPXTG motif may be followed by a hydrophobic region and a charged C terminus, which are thought to retard the protein in the cell membrane to facilitate recognition by the membrane-localized sortase. See Barnett, et al., J. Bacteriology (2004) 186 (17): 5865-5875.
  • GAS AI sequences may be generally categorized as Type 1, Type 2, Type 3, or Type 4, depending on the number and type of sortase sequences within the island and the percentage identity of other proteins (with the exception of RofA and cpa) within the island.
  • FIG. 167 provides a chart indicating the number and type of sortase sequences identified within the adhesin islands of various strains and serotypes of GAS.
  • GAS Adhesin Island within M6 serotype is outlined in Table 4 below.
  • This GAS adhesin island 1 (“GAS AI-1”) comprises surface proteins, a srtB sortase and a rofA divergently transcribed transcriptional regulator.
  • GAS AI-1 surface proteins include Spy0157 (a fibronectin binding protein), Spy0159 (a collagen adhesion protein) and Spy0160 (a fimbrial structural subunit).
  • each of these GAS AI-1 surface proteins includes an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122) or LPXSG (SEQ ID NO: 134) (conservative replacement of threonine with serine).
  • GAS AI-1 includes a srtB type sortase.
  • GAS srtB sortases may preferably anchor surface proteins with an LPSTG motif (SEQ ID NO: 166), particularly where the motif is followed by a serine.
  • M6 isolate M6 isolate
  • Sortase substrate AI-1 sequence sequence or sortase identifier type functional description M6_Spy0156 Transcriptional regulator (rofA)
  • M6_Spy0157 LPXTG Fibronectin-binding protein
  • M6_Spy0158 Reverse transcriptase
  • M6_Spy0159 LPXSG Collagen adhesion protein
  • M6_Spy0160 LPXTG Fimbrial structural subunit
  • M6_Spy0160 appears to be present on the surface of GAS as part of oligomeric (pilus) structures.
  • FIGS. 127-132 present electron micrographs of GAS serotype M6 strain 3650 immunogold stained for M6 Spy0160 using anti-M6 Spy0160 antiserum. Oligomeric or hyperoligmeric structures labelled with gold particles can be seen extending from the surface of the GAS in each of these figures, indicating the presence of multiple M6_Spy0160 polypeptides in the oligomeric or hyperoligomeric structures.
  • 176 A-F present electron micrographs of GAS M6 strain 2724 immunogold stained for M6_Spy0160 using anti-M6_Spy0160 antiserum (FIGS. 176 A-E) or immunogold stained for M6_Spy0159 using anti-M6_Spy0159 antiserum ( FIG. 176 F ). Oligomeric or hyperoligomeric structures labelled with gold particles can again be seen extending from the surface of the M6 strain 2724 GAS bacteria immunogold stained for M6_Spy0160. M6_Spy0159 is also detected on the surface of the M6 strain 2724 GAS.
  • FIG. 73 provides the results of FACS analysis for surface expression of spyM6 — 0159 on each of GAS serotypes M6 2724, M6 3650, and M6 2894. A shift in fluorescence is observed for each GAS serotype when anti-spyM6 — 0159 antiserum is present, demonstrating cell surface expression.
  • FIG. 74 provides the results of FACS analysis for surface expression of spyM6 — 0160 on each of GAS serotypes M6 2724, M6 3650, and M6 2894.
  • anti-spyM6 — 0160 antiserum In the presence of of anti-spyM6 — 0160 antiserum, a shift in fluorescence is observed for each GAS serotype, which demonstrates its cell surface expression.
  • Table 19, below quantitatively summarizes the FACS fluorescence values obtained for each GAS serotype in the presence of pre-immune antiserum, anti-spyM6 — 0160 antiserum, and the change in fluorescence value between the pre-immune and anti-spyM6 — 0160 antiserum.
  • FIG. 98 shows that while pre-immune sera (P ⁇ -0159) does not detect expression of M6_Spy0159 in GAS serotype M6, anti-M6_Spy0159 immune sera (I ⁇ -0159) is able to detect M6_Spy0159 protein in both total GAS M6 extracts (M6 tot) and GAS M6 fractions enriched for cell surface proteins (M6 surf prot).
  • M6_Spy0159 proteins detected in the total GAS M6 extracts or the GAS M6 extracts enriched for surface proteins are also present as high molecular weight structures, indicating that M6_Spy0159 may be in an oligomeric (pilus) form.
  • FIG. 112 shows that while preimmune sera (Preimmune Anti 106) does not detect expression of M6_Spy0160 in GAS serotype M6 strain 2724, anti-M6_Spy0160 immune sera (Anti 160) does in both total GAS M6 strain 2724 extracts (M6 2724 tot) and GAS M6 strain 2724 fractions enriched for surface proteins.
  • the M6_Spy0160 proteins detected in the total GAS M6 strain 2724 extracts or the GAS M6 strain 2724 extracts enriched for surface proteins are also present as high molecular weight structures, indicating that M6_Spy0160 may be in an oligomeric (pilus) form.
  • FIGS. 110 and 111 both further verify the presence of M6_Spy0159 and M6_Spy0160 in higher molecular weight structures on the surface of GAS.
  • FIG. 110 provides a Western blot performed to detect M6_Spy0159 and M6_Spy0160 in GAS M6 strain 2724 extracts enriched for surface proteins. Antiserum raised against either M6_Spy0159 (Anti-159) or M6_Spy0160 (Anti-160) cross-hybridizes with high molecular weight structures (pili) in these extracts.
  • FIG. 111 provides a similar Western blot that verifies the presence of M6_Spy0159 and M6_Spy0160 in high molecular weight structures in GAS M6 strain 3650 extracts enriched for surface proteins.
  • SpyM6 — 0157 (a fibronectin-binding protein) may also be expressed on the surface of GAS serotype M6 bacteria.
  • FIG. 174 shows the results of FACS analysis for surface expression of spyM6 — 0157 on M6 strain 3650. A slight shift in fluorescence is observed, which demonstrates that some spyM6 — 0157 may be expressed on the GAS cell surface.
  • GAS Adhesin Island 2 (“GAS AI-2”)
  • GAS Adhesin Island within M1 serotype is outlined in Table 5 below.
  • This GAS adhesin island 2 (“GAS AI-2”) comprises surface proteins, a SrtB sortase, a SrtC1 sortase and a RofA divergently transcribed transcriptional regulator.
  • GAS AI-2 surface proteins include GAS 15 (Cpa), Spy0128 (thought to be a fimbrial protein) and Spy0130 (a hypothetical protein).
  • each of these GAS AI-2 surface proteins includes an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122), VVXTG (SEQ ID NO: 135), or EVXTG (SEQ ID NO: 136).
  • GAS AI-2 includes a srtB type sortase and a srtC1 sortase.
  • GAS SrtB sortases may preferably anchor surface proteins with an LPSTG (SEQ ID NO: 166) motif, particularly where the motif is followed by a serine.
  • GAS SrtC1 sortase may preferentially anchor surface proteins with a V(P/V)PTG (SEQ ID NO: 167) motif.
  • GAS SrtC1 may be differentially regulated by RofA.
  • GAS AI-2 may also include a LepA putative signal peptidase I protein.
  • GAS AI-2 sequence from M1 isolate (SF370) Sortase substrate AI-2 sequence sequence or identifier sortase type functional description SPy0124 rofA regulatory protein GAS15(not VVXTG cpa annotated in SF370) SPy0127 LepA putative signal peptidase I SPy0128 (GAS16) EVXTG hypothetical protein (fimbrial) SPy0129 (GAS17) srtC1 sortase SPy0130 (GAS18) LPXTG hypothetical protein SPy0131 conserved hypothetical protein SPy0133 conserved hypothetical protein SPy0135 (GAS20) srtB sortase (putative fimbrial- associated protein)
  • FIGS. 113-115 present electron micrographs of GAS serotype M1 strain SF370 immunogold stained for GAS 15 using anti-GAS 15 antiserum.
  • FIGS. 116-121 provide electron micrographs of GAS serotype M1 strain SF370 immunogold stained for GAS 16 using anti-GAS 16 antiserum.
  • FIGS. 122-125 present electron micrograph of GAS serotype M1 strain SF370 immunogold stained for GAS 18 using anti-GAS 18 antiserum. Oligomers of these proteins can be seen on the surface of SF370 bacteria in the immuno-gold stained micrographs.
  • FIG. 126 reveals a hyperoligomer on the surface of a GAS serotype M1 strain SF370 bacterium immunogold stained for GAS 18. This long hyperoliogmeric structure comprising GAS 18 stretches far out into the supernatant from the surface of the bacteria.
  • FIG. 75 provides the results of FACS analysis for surface expression of GAS 15 on each of GAS serotypes M1 2719, M1 2580, M1 3280, M1 SF370, M1 2913, and M1 3348. A shift in fluorescence is observed for each GAS serotype when anti-GAS 15 antiserum is present, demonstrating cell surface expression.
  • Table 20 quantitatively summarizes the FACS fluorescence values obtained for each GAS serotype in the presence of pre-immune antiserum, anti-GAS 15 antiserum, and the difference in fluorescence value between the pre-immune and anti-GAS 15 antiserum.
  • TABLE 20 Summary of FACS values for surface expression of GAS 15 Pre- Anti-GAS Pre- Anti-GAS Pre- Anti-GAS immune 15 Change immune 15 Change immune 15 Change 2719 2580 3280 159.46 712.71 553 123.9 682.84 559 217.02 639.69 423 SF370 2913 3348 201.93 722.68 521 121.41 600.45 479 152.09 446.41 294
  • FIGS. 76 and 79 provide the results of FACS analysis for surface expression of GAS 16 on each of GAS serotypes M1 2719, M1 2580, M1 3280, M1 SF370, M1 2913, and M1 3348.
  • the FACS data in FIG. 76 was obtained using antisera was raised against full length GAS 16. In the presence of this anti-GAS 16 antiserum, a shift in fluorescence is observed for each GAS serotype, demonstrating its cell surface expression.
  • SEQ ID NO: 179 GCTACAACAGTTCACGGGGAGACTGTTGTAAACGGAGCCAAACTAACAGT TACAAAAAACCTTGATTTAGTTAATAGCAATGCATTAATTCCAAATACAG ATTTTACATTTAAAATCGAACCTGATACTACTGTCAACGAAGACGGAAAT AAGTTTAAAGGTGTAGCTTTGAACACACCGATGACTAAAGTCACTTACAC CAATTCAGATAAAGGTGGATCAAATACGAAAACTGCAGAATTTGATTTTT CAGAAGTTACTTTTGAAAAACCAGGTGTTTATTATTACAAAGTAACTGAG GAGAAGATAGATAAAGTTCCTGGTGTTTCTTATGATACAACATCTTACAC TGTTCAAGTTCATGTCTTGTGGAATGAAGAGCAACAAAAACCAGTAGCTACTTGTGGAATGAAGCAACAAAAACCAGTAGCTACTTGTGGAATGAAGCAACAAAAACCAGTAGCTACTTGTGGAATGAAGCAACAAAAACCAGTAGCTACTTGTGGAATGAAGAG
  • FIGS. 77 and 78 provide the results of FACS analysis for surface expression of GAS 18 on each of GAS serotypes M12719, M12580, M1 3280, M1 SF370, M12913, and M13348.
  • the antiserum used to obtain the FACS data in each of FIGS. 77 and 78 was different, although each was raised against full length GAS 18.
  • a shift in fluorescence is observed for each GAS serotype, demonstrating its cell surface expression.
  • FIG. 89 shows that while pre-immune sera does not detect GAS M1 expression of GAS 15, anti-GAS 15 immune sera is able to detect GAS 15 protein in both total GAS M1 extracts and GAS M1 proteins enriched for cell surface proteins.
  • the GAS 15 proteins detected in the M1 extracts enriched for surface proteins are also present as high molecular weight structures, indicating that GAS 15 may be in an oligomeric (pilus) form.
  • FIG. 90 also shows the results of Western blot analysis of M1 serotype GAS using anti-GAS 15 antisera.
  • FIG. 91 provides an additional Western blot identical to that of FIG. 90 , but that was probed with pre-immune sera. As expected, no proteins were detected on this membrane.
  • FIG. 92 provides a Western blot that was probed for GAS 16 protein. While pre-immune sera does not detect GAS M1 expression of GAS 16, anti-GAS 16 immune sera is able to detect GAS 16 protein in GAS M1 extracts enriched for cell surface proteins. The GAS 16 proteins detected in the M1 extracts enriched for surface proteins are present as high molecular weight structures, indicating that GAS 16 may be in an oligomeric (pilus) form.
  • FIG. 93 also shows the results of Western blot analysis of M1 serotype GAS using anti-GAS 16 antisera.
  • FIG. 94 provides an additional Western blot identical to that of FIG. 93 , but that was probed with pre-immune sera. As expected, no proteins were detected on this membrane.
  • FIG. 95 provides a Western blot that was probed for GAS 18 protein. While pre-immune sera does not detect GAS M1 expression of GAS 18, anti-GAS 18 immune sera is able to detect GAS 18 protein in GAS M1 extracts enriched for cell surface proteins. The GAS 18 proteins detected in the M1 extracts enriched for surface proteins are present as high molecular weight structures, indicating that GAS 18 may be in an oligomeric (pilus) form.
  • FIG. 96 also shows the results of Western blot analysis of M1 serotype GAS using anti-GAS 18 antisera.
  • FIG. 97 provides an additional Western blot identical to that of FIG. 96 , but that was probed with pre-immune sera. As expected, no proteins were detected on this membrane.
  • FIGS. 102-106 provide additional Western blots to verify the presence of GAS 15, GAS 16, and GAS 18 in high molecular weight structures in GAS.
  • Each Western blot was performed using proteins from a different GAS M1 strain, 2580, 2913, 3280, 3348, and 2719.
  • Each Western blot was probed with antisera raised against each of GAS 15, GAS 16, and GAS 18. As can be seen in FIGS.
  • FIG. 107 provides a similar Western blot performed to detect GAS 15, GAS 16, and GAS 18 proteins in a GAS serotype M1 strain SF370 protein fraction enriched for surface proteins. This Western blot also shows detection of GAS 15 (Anti-15), GAS 16 (Anti-16), and GAS 18 (Anti-18) as high molecular weight structures.
  • GAS Adhesin Island sequences within M3, M5, and M18 serotypes are outlined in Tables 6-8 and 10 below.
  • This GAS adhesin island 3 (“GAS AI-3”) comprises surface proteins, a SrtC2 sortase, and a Negative transcriptional regulator (Nra) divergently transcribed transcriptional regulator.
  • GAS AI-3 surface proteins within include a collagen binding protein, a fimbrial protein, a F2 like fibronectin-binding protein.
  • GAS AI-3 surface proteins may also include a hypothetical surface protein.
  • each of these GAS AI-3 surface proteins include an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122), VPXTG (SEQ ID NO: 137), QVXTG (SEQ ID NO: 138) or LPXAG (SEQ ID NO: 139).
  • GAS AI-3 includes a SrtC2 type sortase.
  • GAS SrtC2 type sortases may preferably anchor surface proteins with a QVPTG (SEQ ID NO: 140) motif, particularly when the motif is followed by a hydrophobic region and a charged C terminus tail.
  • GAS SrtC2 may be differentially regulated by Nra.
  • GAS AI-3 may also include a LepA putative signal peptidase I protein.
  • GAS AI-3 may also include a putative multiple sugar metabolism regulator.
  • GAS AI-3 sequences from M3 isolate (MGAS315) Sortase substrate AI-3 sequence sequence or identifier sortase type Functional description SpyM3_0097 Negative transcriptional regulator (Nra) SpyM3_0098 VPXTG putative collagen binding protein (Cpb) SpyM3_0099 LepA putative signal peptidase I SpyM3_0100 QVXTG conserved hypothetical protein (fimbrial) SpyM3_0101 SrtC2 sortase SpyM3_0102 LPXAG hypothetical protein SpyM3_0103 putative multiple sugar metabolism regulator SpyM3_0104 LPXTG protein F2 like fibronectin-binding protein
  • FIG. 51A A schematic of AI-3 serotypes M3, M5, M 18, and M49 is shown in FIG. 51A .
  • Each contains an open reading frame encoding a SrtC2-type sortase of nearly identical amino acid sequence. See FIG. 52B for an amino acid sequence alignment for each of the SrtC2 amino acid sequences.
  • FIG. 60 indicates the amino acid sequence of the pilin motif and E-box of each of GAS AI-3 serotype M3 MGAS315 (SpyM3 — 0104/21909640), GAS AI-3 serotype M3 SSI (Sps0106/28895018), GAS AI-3 serotype M18 (SpyM18 — 0132/19745307), and GASAI-3 serotype M5 (orf84).
  • FIG. 80 provides the results of FACS analysis for surface expression of SpyM3 — 0098 on each of GAS serotypes M3 2721 and M3 3135. A shift in fluorescence is observed for each GAS serotype when anti-SpyM3 — 0098 antiserum is present, demonstrating cell surface expression.
  • FIG. 81 provides the results of FACS analysis for surface expression of SpyM3 — 0100 on each of GAS serotypes M3 2721 and M3 3135.
  • a shift in fluorescence is observed for each GAS serotype when anti-SpyM3 — 0100 antiserum is present, demonstrating cell surface expression.
  • Table 26, below quantitatively summarizes the FACS fluorescence values obtained for each GAS serotype in the presence of pre-immune antiserum, anti-SpyM3 — 0100 antiserum, and the difference in fluorescence value between the pre-immune and anti-SpyM3 — 0100 antiserum.
  • TABLE 26 Summary of FACS values for surface expression of SpyM3_0100 2721 3135 Pre- Anti- Pre- Anti- immune spyM3_0100 Change immune spyM3_0100 Change 110.31 181.91 72 97.87 250.01 152
  • FIG. 82 provides the results of FACS analysis for surface expression of SpyM3 — 0102 on each of GAS serotypes M3 2721 and M3 3135. A shift in fluorescence is observed for each GAS serotype when anti-SpyM3 — 0102 antiserum is present, demonstrating cell surface expression.
  • Table 27, below quantitatively summarizes the FACS fluorescence values obtained for each GAS serotype in the presence of pre-immune antiserum, anti-SpyM3 — 0102 antiserum, and the difference in fluorescence value between the pre-immune and anti-SpyM3 — 0102 antiserum.
  • FIG. 82 also provides the results of FACS analysis for surface expression of a pilin antigen that has homology to SpyM3 — 0102 identified in a different GAS serotype, M6.
  • FACS analysis conducted with the SpyM3 — 0102 antisera was able to detect surface expression of the homologous SpyM3 — 0102 antigen on each of GAS serotypes M6 2724, M6 3650, and M6 2894.
  • SpyM3 — 0102 is also homologous to pilin antigen 19224139 of GAS serotype M12. Antisera raised against SpyM3 — 0102 is able to detect high molecular weight structures in GAS serotype M12 strain 2728 protein fractions enriched for surface proteins, which would contain the 19224139 antigen. See FIG. 109 at the lane labelled M112 2728 surf prot.
  • FIG. 83 provides the results of FACS analysis for surface expression of SpyM3 — 0104 on each of GAS serotypes M3 2721 and M3 3135. A shift in fluorescence is observed for each GAS serotype when anti-SpyM3 — 0104 antiserum is present, demonstrating cell surface expression.
  • Table 29, below quantitatively summarizes the FACS fluorescence values obtained for each GAS serotype in the presence of pre-immune antiserum, anti-SpyM3 — 0104 antiserum, and the difference in fluorescence value between the pre-immune and anti-SpyM3 — 0104 antiserum.
  • FIG. 83 also provides the results of FACS analysis for surface expression of a pilin antigen that has homology to SpyM3 — 0104 identified in a different GAS serotype, M12.
  • FACS analysis conducted with the SpyM3 — 0104 antisera was able to detect surface expression of the homologous SpyM3 — 0104 antigen on GAS serotype M12 2728.
  • Table 30, below quantitatively summarizes the FACS fluorescence values obtained for this GAS serotype in the presence of pre-immune antiserum, anti-SpyM3 — 0104 antiserum, and the difference in fluorescence value between the pre-immune and anti-SpyM3 — 0104 antiserum.
  • FIG. 84 provides the results of FACS analysis for surface expression of SPs — 0106 on each of GAS serotypes M3 2721 and M3 3135. A shift in fluorescence is observed for each GAS serotype when anti-SPs — 0106 antiserum is present, demonstrating cell surface expression.
  • Table 31, below quantitatively summarizes the FACS fluorescence values obtained for each GAS serotype in the presence of pre-immune antiserum, anti-SPs — 0106 antiserum, and the difference in fluorescence value between the pre-immune and anti-SPs — 0106 antiserum.
  • FIG. 84 also provides the results of FACS analysis for surface expression of a pilin antigen that has homology to SPs — 0106 identified in a different GAS serotype, M12.
  • FACS analysis conducted with the SPs — 0106 antisera was able to detect surface expression of the homologous SPs — 0106 antigen on GAS serotype M12 2728.
  • Table 32 below, quantitatively summarizes the FACS fluorescence values obtained for each GAS serotype in the presence of pre-immune antiserum, anti-SPs — 0106 antiserum, and the difference in fluorescence value between the pre-immune and anti-SPs — 0106 antiserum.
  • TABLE 32 Summary of FACS values for surface expression of SPs_0106 in an M12 serotype 2728 Pre-immune Anti-SPs_0106 Change 304.01 254.64 ⁇ 49
  • GAS Adhesin Island 4 (“GAS AI-4”)
  • GAS Adhesin Island sequences within M12 serotype are outlined in Table 11 below.
  • This GAS adhesin island 4 (“GAS AI-4”) comprises surface proteins, a SrtC2 sortase, and a RofA regulatory protein.
  • GAS AI-4 surface proteins within may include a fimbrial protein, an F or F2 like fibronectin-binding protein, and a capsular polysaccharide adhesion protein (Cpa). GAS AI-4 surface proteins may also include a hypothetical surface protein in an open reading frame (orf). Preferably, each of the GAS AI-4 surface proteins include an LPXTG sortase substrate motif, such as LPXTG (SEQ ID NO: 122), VPXTG (SEQ ID NO: 137), QVXTG (SEQ ID NO: 138) or LPXAG (SEQ ID NO: 139).
  • LPXTG sortase substrate motif such as LPXTG (SEQ ID NO: 122), VPXTG (SEQ ID NO: 137), QVXTG (SEQ ID NO: 138) or LPXAG (SEQ ID NO: 139).
  • GAS AI-4 includes a SrtC2 type sortase.
  • GAS SrtC2 type sortases may preferably anchor surface proteins with a QVPTG (SEQ ID NO: 140) motif, particularly when the motif is followed by a hydrophobic region and a charged C terminus tail.
  • GAS AI-4 may also include a LepA putative signal peptidase I protein and a MsmRL protein. TABLE 11 GAS AI-4 sequences from M12 isolate (A735) Sortase substrate AI-4 sequence sequence or sortase identifier type Functional description 19224133 RofA regulatory protein 19224134 LPXTG protein F SrtB SrtB (stop codon*) 19224135 VPXTG Cpa 19224136 LepA 19224137 QVXTG EftLSL.A (fimbrial) 19224138 SrtC2 EftLSL.B 19224139 LPXAG Orf2 19224140 MsmRL 19224141 LPXTG protein F2
  • FIG. 51A A schematic of AI- 4 serotype M12 is shown in FIG. 51A .
  • One of the open reading frames encodes a SrtC2-type sortase having an amino acid sequence nearly identical to the amino acid sequence of the SrtC2-type sortase of the AI-3 serotypes described above. See FIG. 52B for an amino acid sequence alignment for each of the SrtC2 amino acid sequences.
  • FIG. 52 is an amino acid alignment of the capsular polysaccharide adhesion protein (cpa) of AI-4 serotype M112 (19224135), GAS AI-3 serotype M5 (ORF78), S. pyogenes strain MGAS315 serotype M3 (21909634), S. pyogenes SSI-1 serotype M3 (28810257), S.
  • cpa capsular polysaccharide adhesion protein
  • FIG. 53 shows that the F-like fibronectin-binding protein encoded by the AI-4 serotype M12 open frame (19224134) shares homology with a F-like fibronectin-binding protein found in S. pyogenes strain MGAS10394 serotype M6 (50913503).
  • FIG. 54 is an amino acid sequence alignment that illustrates that the F2-like fibronectin-binding protein of AI-4 serotype M12 (19224141) shares homology with the F2-like fibronectin-binding protein of S. pyogenes strain MGAS8232 serotype M3 (19745307), GAS AI-3 serotype M5 (ORF84), S. pyogenes strain SSI serotype M3 (28810263), and S. pyogenes strain MGAS315 serotype M3 (21909640).
  • FIG. 55 is an amino acid sequence alignment that illustrates that the fimbrial protein of AI-4 serotype M12 (19224137) shares homology with the fimbrial protein of GAS AI-3 serotype M5 (ORF80), and the hypothetical protein of S. pyogenes strain MGAS315 serotype M3 (21909636), S. pyogenes strain SSI serotype M3 (28810259), S. pyogenes strain MGAS8732 serotype M3 (19745303), and S. pyogenes strain M1 GAS serotype M1 (13621428).
  • FIG. 56 is an amino acid sequence alignment that illustrates that the hypothetical protein of GAS AI-4 serotype M12 (19224139) shares homology with the hypothetical protein of S. pyogenes strain MGAS315 serotype M3 (21909638), S. pyogenes strain SSI-1 serotype M3 (28810261), GAS AI-3 serotype M5 (ORF82), and S. pyogenes strain MGAS8232 serotype M3 (19745305).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
US11/192,046 2004-07-29 2005-07-29 Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae Abandoned US20060165716A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US11/192,046 US20060165716A1 (en) 2004-07-29 2005-07-29 Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
US12/906,510 US8778358B2 (en) 2004-07-29 2010-10-18 Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae

Applications Claiming Priority (11)

Application Number Priority Date Filing Date Title
US59280504P 2004-07-29 2004-07-29
US60983304P 2004-09-13 2004-09-13
US61683304P 2004-10-08 2004-10-08
US63341804P 2004-12-07 2004-12-07
US64006904P 2004-12-30 2004-12-30
US66032105P 2005-03-11 2005-03-11
US67375405P 2005-04-22 2005-04-22
US69300105P 2005-06-21 2005-06-21
US69545305P 2005-07-01 2005-07-01
US69764305P 2005-07-11 2005-07-11
US11/192,046 US20060165716A1 (en) 2004-07-29 2005-07-29 Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/906,510 Continuation US8778358B2 (en) 2004-07-29 2010-10-18 Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae

Publications (1)

Publication Number Publication Date
US20060165716A1 true US20060165716A1 (en) 2006-07-27

Family

ID=36692677

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/192,046 Abandoned US20060165716A1 (en) 2004-07-29 2005-07-29 Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
US11/658,842 Abandoned US20090317420A1 (en) 2004-07-29 2005-07-29 Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
US12/906,510 Expired - Fee Related US8778358B2 (en) 2004-07-29 2010-10-18 Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/658,842 Abandoned US20090317420A1 (en) 2004-07-29 2005-07-29 Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
US12/906,510 Expired - Fee Related US8778358B2 (en) 2004-07-29 2010-10-18 Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae

Country Status (5)

Country Link
US (3) US20060165716A1 (https=)
EP (2) EP2612679A1 (https=)
JP (2) JP2008508320A (https=)
CA (1) CA2575548A1 (https=)
WO (1) WO2006078318A2 (https=)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060210581A1 (en) * 2000-10-27 2006-09-21 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A & B
US20060252691A1 (en) * 1997-12-19 2006-11-09 Naomi Balaban Methods and compositions for the treatment and prevention of staphylococcus and other bacterial infections
US20070065464A1 (en) * 2003-07-31 2007-03-22 Chiron Corporation Immunogenic compositions for streptococcus pyogenes
US20080031877A1 (en) * 2006-02-17 2008-02-07 Antonello Covacci Purification of bacterial antigens
US20080152701A1 (en) * 1997-12-19 2008-06-26 Naomi Balaban Methods and Compositions for the Treatment and Prevention of Staphylococcus Infections
US20080219976A1 (en) * 1997-12-19 2008-09-11 Naomi Balaban Methods and compositions for treatment and prevention of staphylococcal infections
US20080220010A1 (en) * 2003-09-15 2008-09-11 Novartis Vaccines And Diagnostics Srl Immunogenic Compositions for Streptococcus Agalactiae
US20090117113A1 (en) * 2004-10-08 2009-05-07 Chiron Corporation Immunogenic And Therapeutic Compositions For Streptococcus Pyogenes
US20090148058A1 (en) * 2007-12-10 2009-06-11 Qualcomm Incorporated Reference selection for video interpolation or extrapolation
US20090162392A1 (en) * 2007-12-21 2009-06-25 Novartis Ag Mutant forms of streptolysin o
US20090317420A1 (en) * 2004-07-29 2009-12-24 Chiron Corporation Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
US20100150943A1 (en) * 2006-07-26 2010-06-17 Novartis Ag Immunogenic compositions for gram positive bacteria
US20100303864A1 (en) * 2002-08-26 2010-12-02 Herve Tettelin Conserved and specific streptococcal genomes
US20110038879A1 (en) * 2006-10-30 2011-02-17 Novartis Ag Immunogenic and therapeutic compositions for streptococcus pyogenes
US20110206692A1 (en) * 2006-06-09 2011-08-25 Novartis Ag Conformers of bacterial adhesins
WO2011104632A1 (en) * 2010-02-26 2011-09-01 Novartis Ag Immunogenic proteins and compositions
US20120076814A1 (en) * 2009-06-01 2012-03-29 Novartis Ag Combinations of pneumococcal rrgb clades
US8287885B2 (en) 2007-09-12 2012-10-16 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
US20140086950A1 (en) * 2012-09-24 2014-03-27 Montana State University Recombinant lactococcus lactis expressing escherichia coli colonization factor antigen i (cfa/i) fimbriae and their methods of use
US9777076B2 (en) 2012-07-16 2017-10-03 Pfizer Inc. Saccharides and uses thereof
US10391161B2 (en) * 2016-12-19 2019-08-27 I-Shou University FSBM recombinant protein
EP3872096A4 (en) * 2018-10-25 2022-11-30 Ajinomoto Co., Inc. PROCESS FOR THE SECRETORY PRODUCTION OF A PROTEIN
US12077795B2 (en) 2016-10-18 2024-09-03 The Research Foundation For The State University Of New York Method for biocatalytic protein-oligonucleotide conjugation

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2822302A1 (en) 2006-02-13 2007-08-23 Alethia Biotherapeutics Inc. Methods of impairing osteoclast differentiation
US8168181B2 (en) 2006-02-13 2012-05-01 Alethia Biotherapeutics, Inc. Methods of impairing osteoclast differentiation using antibodies that bind siglec-15
CN103897045A (zh) 2009-01-12 2014-07-02 诺华股份有限公司 抗革兰氏阳性细菌疫苗中的Cna_B结构域
ITMI20090946A1 (it) 2009-05-28 2010-11-29 Novartis Ag Espressione di proteine ricombinanti
US20120237536A1 (en) * 2009-09-10 2012-09-20 Novartis Combination vaccines against respiratory tract diseases
WO2011040133A1 (ja) * 2009-10-02 2011-04-07 学校法人 東京女子医科大学 ヒト血清アミロイドa3抗体およびその利用
GB201114923D0 (en) * 2011-08-30 2011-10-12 Novartis Ag Immunogenic proteins and compositions
DE102011121069A1 (de) * 2011-12-13 2013-06-13 Martin-Luther-Universität Halle-Wittenberg Vakzinierung mittels rekombinanter Hefe durch Erzeugung einer protektiven humoralen Immunantwort gegen definierte Antigene
HK1210192A1 (en) 2012-07-19 2016-04-15 Alethia Biotherapeutics Inc. Anti-siglec-15 antibodies
MX2017001638A (es) * 2014-08-05 2017-04-27 Glaxosmithkline Biologicals Sa Molecula portadora para antigenos.

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070036828A1 (en) * 2002-09-13 2007-02-15 Chiron Corporation Group b streptococcus vaccine

Family Cites Families (172)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SU548947A1 (ru) 1975-09-05 1980-02-05 Всесоюзный Ордена Ленина Институт Экспериментальной Ветеринарии Васхнил Вакцина дл специфической профилактики и трерапии трихофитии лошадей
NO153458C (no) 1978-06-07 1986-03-26 Inst Experimentalnoi Veterinar Fremgangsm¨te for fremstilling av vaksine for profylakse o g behandling av ringorm hos pelsdyr og kaniner for¨rsaket av trichophyton mentagrophytes.
US5360897A (en) 1981-08-31 1994-11-01 The University Of Rochester Immunogenic conjugates of streptococcus pneumonial capsular polymer and toxin or in toxiad
US4454121A (en) * 1982-07-27 1984-06-12 The University Of Tennessee Research Corporation Synthetic peptides corresponding to antigenic determinants of the M protein of Streptococcus pyogenes
SE8205892D0 (sv) 1982-10-18 1982-10-18 Bror Morein Immunogent membranproteinkomplex, sett for framstellning och anvendning derav som immunstimulerande medel och sasom vaccin
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
FR2550094B1 (fr) * 1983-08-01 1986-03-21 Anvar Compositions de vaccins conditionnees pour la vaccination de sujets immunitairement non naifs contre un agent pathogene determine et contenant un haptene comportant lui-meme un site antigenique caracteristique dudit agent pathogene ou un oligomere de cet haptene
US5324513A (en) 1984-03-07 1994-06-28 Institut Pasteur Composition useful for the fabrication of vaccines
US5171568A (en) 1984-04-06 1992-12-15 Chiron Corporation Recombinant herpes simplex gb-gd vaccine
US6090406A (en) 1984-04-12 2000-07-18 The Liposome Company, Inc. Potentiation of immune responses with liposomal adjuvants
US5916588A (en) 1984-04-12 1999-06-29 The Liposome Company, Inc. Peptide-containing liposomes, immunogenic liposomes and methods of preparation and use
US5098704A (en) 1984-06-18 1992-03-24 Chiron Corporation Hepatitis surface antigen particle vaccine
US4722840A (en) 1984-09-12 1988-02-02 Chiron Corporation Hybrid particle immunogens
ES2061500T5 (es) 1986-06-17 2003-05-16 Chiron Corp Diagnosis y vacunas de la hepatitis delta, su preparacion y uso.
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
JPH02500880A (ja) 1987-11-18 1990-03-29 カイロン コーポレイション Nanbvの診断用薬およびワクチン
US5098827A (en) * 1988-02-26 1992-03-24 The University Of Florida Novel bacterial markers for pathogenic group B streptococci
AU631377B2 (en) 1988-08-25 1992-11-26 Liposome Company, Inc., The Affinity associated vaccine
US5354846A (en) * 1988-11-18 1994-10-11 Michael Kehoe Streptolysin O antigen derivatives, its production and uses
GB8827038D0 (en) 1988-11-18 1988-12-21 Kehoe M Streptolysin o antigens & uses
DE3841091A1 (de) 1988-12-07 1990-06-13 Behringwerke Ag Synthetische antigene, verfahren zu ihrer herstellung und ihre verwendung
WO1990006951A1 (en) 1988-12-16 1990-06-28 De Staat Der Nederlanden Vertegenwoordigd Door De Minister Van Welzijn, Volksgezondheid En Cultuur Pneumolysin mutants and pneumococcal vaccines made therefrom
GB2233977B (en) 1989-01-04 1993-03-31 Michael Kehoe Cytolytic streptolysin o mutants and uses
CA2006700A1 (en) 1989-01-17 1990-07-17 Antonello Pessi Synthetic peptides and their use as universal carriers for the preparation of immunogenic conjugates suitable for the development of synthetic vaccines
KR0185373B1 (ko) 1989-03-17 1999-05-01 로버트 피. 블랙버언 Hcv 폴리단백질에서 유래되는 hcv 아미노산 서열 부분을 포함하는 폴리펩티드 및 그 사용
CA2011896C (en) 1989-04-21 2001-05-08 Mark Werner Ringworm vaccine
ATE211772T1 (de) 1989-05-18 2002-01-15 Chiron Corp Nanbv-diagnostika: polynukleotide, geeignet für reihenuntersuchungen auf hepatitis c-virus
CA2017507C (en) 1989-05-25 1996-11-12 Gary Van Nest Adjuvant formulation comprising a submicron oil droplet emulsion
KR920703114A (ko) 1989-07-14 1992-12-17 원본미기재 접합체 백신을 위한 시토킨 및 호르몬 운반체
IT1237764B (it) 1989-11-10 1993-06-17 Eniricerche Spa Peptidi sintetici utili come carriers universali per la preparazione di coniugati immunogenici e loro impiego per lo sviluppo di vaccini sintetici.
US5821088A (en) * 1990-05-11 1998-10-13 Siga Pharmaceuticals, Inc. Use of gram-positive bacteria to express recombinant proteins
US6737521B1 (en) * 1990-05-11 2004-05-18 The Rockefeller University Delivery and expression of a hybrid surface protein on the surface of gram positive bacteria
GB2276169A (en) 1990-07-05 1994-09-21 Celltech Ltd Antibodies specific for carcinoembryonic antigen
ATE128628T1 (de) 1990-08-13 1995-10-15 American Cyanamid Co Faser-hemagglutinin von bordetella pertussis als träger für konjugierten impfstoff.
US5153312A (en) 1990-09-28 1992-10-06 American Cyanamid Company Oligosaccharide conjugate vaccines
US5277904A (en) 1990-10-26 1994-01-11 Pier Allan C Broad spectrum dermatophyte vaccine
US5284652A (en) 1990-10-26 1994-02-08 Pier Allan C Dermatophyte vaccine
US5378620A (en) 1991-08-30 1995-01-03 Beckman Instruments, Inc. Streptolysin O derivatives
US5391712A (en) 1991-08-30 1995-02-21 Beckman Instruments, Inc. Non-hemolytic streptolysin O variants
DE69333110T2 (de) 1992-03-02 2004-05-06 Chiron S.P.A. Mit dem cytotoxin von helicobacter pylori assoziiertes, immunodominantes antigen verwendbar in impfstoffen und zur diagnose
IT1262896B (it) 1992-03-06 1996-07-22 Composti coniugati formati da proteine heat shock (hsp) e oligo-poli- saccaridi, loro uso per la produzione di vaccini.
CA2138997C (en) 1992-06-25 2003-06-03 Jean-Paul Prieels Vaccine composition containing adjuvants
IL102687A (en) 1992-07-30 1997-06-10 Yeda Res & Dev Conjugates of poorly immunogenic antigens and synthetic pepide carriers and vaccines comprising them
DE4240056A1 (de) * 1992-11-28 1994-06-01 Boehringer Mannheim Gmbh Streptolysin O Peptidantigene und Verfahren zur Bestimmung von Streptolysin-Antikörper
PT613947E (pt) 1993-02-01 2004-07-30 Beckman Coulter Inc Factor mitogenico seu gene e metodo para a sua microdeteccao
US5776468A (en) 1993-03-23 1998-07-07 Smithkline Beecham Biologicals (S.A.) Vaccine compositions containing 3-0 deacylated monophosphoryl lipid A
WO1995000650A1 (en) * 1993-06-23 1995-01-05 Beckman Instruments, Inc. Recombinant dnase b derived from streptococcus pyogenes
US5585098A (en) * 1993-11-23 1996-12-17 Ovimmune, Inc. Oral administration of chicken yolk immunoglobulins to lower somatic cell count in the milk of lactating ruminants
GB9326174D0 (en) 1993-12-22 1994-02-23 Biocine Sclavo Mucosal adjuvant
GB9326253D0 (en) 1993-12-23 1994-02-23 Smithkline Beecham Biolog Vaccines
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
AU697227B2 (en) * 1994-10-07 1998-10-01 Rockefeller University, The Enzyme for cleavage of the anchor region of surface proteins from gram positive bacteria
AUPM873294A0 (en) 1994-10-12 1994-11-03 Csl Limited Saponin preparations and use thereof in iscoms
AUPM885194A0 (en) * 1994-10-14 1994-11-10 Council Of The Queensland Institute Of Medical Research, The Synthetic peptides and vaccines comprising same
IL117483A (en) 1995-03-17 2008-03-20 Bernard Brodeur MENINGITIDIS NEISSERIA shell protein is resistant to proteinase K.
UA56132C2 (uk) 1995-04-25 2003-05-15 Смітклайн Бічем Байолоджікалс С.А. Композиція вакцини (варіанти), спосіб стабілізації qs21 відносно гідролізу (варіанти), спосіб приготування композиції вакцини
US6284884B1 (en) * 1995-06-07 2001-09-04 North American Vaccine, Inc. Antigenic group B streptococcus type II and type III polysaccharide fragments having a 2,5-anhydro-D-mannose terminal structure and conjugate vaccine thereof
US6936259B2 (en) * 1995-06-08 2005-08-30 University Of Saskatchewan CAMP factor of Streptococcus uberis
GB9513261D0 (en) 1995-06-29 1995-09-06 Smithkline Beecham Biolog Vaccines
US5846547A (en) * 1996-01-22 1998-12-08 Regents Of The University Of Minnesota Streptococcal C5a peptidase vaccine
US6346392B1 (en) 1996-11-27 2002-02-12 Smithkline Beecham Corporation Polynucleotides encoding a novel glutamine transport ATP-binding protein
IES76925B2 (en) 1996-07-03 1997-11-19 Provost Subunit Vaccine for Streptococcus Equi
EP0821070A1 (en) 1996-07-22 1998-01-28 Carelli, Claude Marcel Henri Pit-1 gene polymorphism and trait selection in animals
DE19630390A1 (de) 1996-07-26 1998-01-29 Chiron Behring Gmbh & Co Proteine, insbesondere Membranproteine von Helicobacter pylori, ihre Herstellung und Verwendung
WO1998009990A1 (en) 1996-09-04 1998-03-12 Takara Shuzo Co., Ltd. Fungal antigens and process for producing the same
JP4469026B2 (ja) 1996-10-31 2010-05-26 ヒューマン ジノーム サイエンシーズ,インコーポレイテッド Streptococcus pneumoniaeの抗原およびワクチン
JP2001510989A (ja) 1996-11-01 2001-08-07 スミスクライン・ビーチャム・コーポレイション 新規コーディング配列
US7033765B1 (en) * 1997-02-20 2006-04-25 Toronto Research Chemicals, Inc. Site-specific drug delivery
DK1005368T3 (da) 1997-03-10 2010-01-04 Ottawa Hospital Res Inst Anvendelse af nukleinsyrer, der indeholder ikke-metyleret CpG dinukleotid i kombination med alun som hjælpestoffer
US6426074B1 (en) * 1997-03-19 2002-07-30 The Brigham And Women's Hospital Inc. Group B Streptococcus vaccine
US6818222B1 (en) 1997-03-21 2004-11-16 Chiron Corporation Detoxified mutants of bacterial ADP-ribosylating toxins as parenteral adjuvants
US6299881B1 (en) 1997-03-24 2001-10-09 Henry M. Jackson Foundation For The Advancement Of Military Medicine Uronium salts for activating hydroxyls, carboxyls, and polysaccharides, and conjugate vaccines, immunogens, and other useful immunological reagents produced using uronium salts
CA2289116A1 (en) * 1997-05-06 1998-11-12 Human Genome Sciences, Inc. Enterococcus faecalis polynucleotides and polypeptides
US6635623B1 (en) * 1997-06-13 2003-10-21 Baylor College Of Medicine Lipoproteins as nucleic acid vectors
GB9712347D0 (en) 1997-06-14 1997-08-13 Smithkline Beecham Biolog Vaccine
GB9713156D0 (en) 1997-06-20 1997-08-27 Microbiological Res Authority Vaccines
US5948413A (en) 1997-07-17 1999-09-07 Board Of Trustees Operating Michigan State University Method and vaccine for treatment of pythiosis insidiosi in humans and lower animals
AU1145699A (en) 1997-09-05 1999-03-22 Smithkline Beecham Biologicals (Sa) Oil in water emulsions containing saponins
ATE349527T1 (de) 1997-09-12 2007-01-15 Univ Tennessee Res Foundation Gruppe a streptokokken-impfstoff
AU9507698A (en) 1997-09-26 1999-04-23 Med Immune, Inc. (lmb) gene of (streptococcus agalactiae)
US6406883B1 (en) 1997-09-26 2002-06-18 Luetticken Rudolf Lmb gene of Streptococcus agalactiae
US6756361B1 (en) 1997-10-14 2004-06-29 Nabi Enterococcus antigens and vaccines
BR9813071A (pt) * 1997-10-17 2000-08-15 Nestle Sa Espécie de bactéria láctica
CA2671261A1 (en) 1997-11-06 1999-05-20 Novartis Vaccines And Diagnostics S.R.L. Neisserial antigens
WO1999026969A1 (en) 1997-11-21 1999-06-03 University Of Otago Zoocin a immunity factor
JP2002536958A (ja) 1997-11-21 2002-11-05 ジェンセット Chlamydiapneumoniaeゲノム配列およびポリペプチド、それらのフラグメント、ならびに特に感染症の診断、予防および治療のためのそれらの使用
EP2218731A1 (en) 1997-11-28 2010-08-18 Merck Serono Biodevelopment Chlamydia trachomatis genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection
GB9725084D0 (en) 1997-11-28 1998-01-28 Medeva Europ Ltd Vaccine compositions
CA2312900A1 (en) 1997-12-02 1999-06-10 Powderject Vaccines, Inc. Transdermal delivery of particulate vaccine compositions
WO1999035270A1 (en) * 1997-12-31 1999-07-15 Stressgen Biotechnologies Corporation Streptococcal heat shock proteins of the hsp60 family
EP1047784B2 (en) 1998-01-14 2015-03-18 Novartis Vaccines and Diagnostics S.r.l. Neissera meningitidis antigens
US7041814B1 (en) * 1998-02-18 2006-05-09 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to Enterobacter cloacae for diagnostics and therapeutics
CA2321106C (en) 1998-02-20 2013-07-23 Biochem Pharma Inc. Group b streptococcus antigens
GB9807721D0 (en) 1998-04-08 1998-06-10 Chiron Spa Antigen
WO1999052549A1 (en) 1998-04-09 1999-10-21 Smithkline Beecham Biologicals S.A. Adjuvant compositions
GB9808327D0 (en) * 1998-04-20 1998-06-17 Chiron Spa Antidiotypic compounds
EP2261338A3 (en) 1998-05-01 2012-01-04 Novartis Vaccines and Diagnostics, Inc. Neisseria meningitidis antigens and compositions
US6562798B1 (en) 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US6660520B2 (en) * 1998-06-05 2003-12-09 Smithkline Beecham Corporation Nrde
WO2000006736A2 (en) 1998-07-27 2000-02-10 Microbial Technics Limited Nucleic acids and proteins from group b streptococcus
US7098182B2 (en) * 1998-07-27 2006-08-29 Microbial Technics Limited Nucleic acids and proteins from group B streptococcus
US6936252B2 (en) * 1998-07-27 2005-08-30 Microbial Technics Limited Streptococcus pneumoniae proteins and nucleic acid molecules
GB9817052D0 (en) 1998-08-05 1998-09-30 Smithkline Beecham Biolog Vaccine
BR9914374A (pt) 1998-10-09 2002-09-17 Chiron Corp Sequências genÈmicas de neisseria e métodos para seu uso
KR100629028B1 (ko) 1998-10-16 2006-09-26 글락소스미스클라인 바이오로지칼즈 에스.에이. 애쥬번트 시스템 및 백신
CA2350775A1 (en) 1998-11-12 2000-05-18 The Regents Of The University Of California Chlamydia pneumoniae genome sequence
GB9828000D0 (en) 1998-12-18 1999-02-10 Chiron Spa Antigens
US7128918B1 (en) * 1998-12-23 2006-10-31 Id Biomedical Corporation Streptococcus antigens
ATE459373T1 (de) 1999-03-19 2010-03-15 Glaxosmithkline Biolog Sa Impfstoff gegen kapsulare polysaccharide von streptococcus pneumoniae
JP2002541808A (ja) 1999-04-09 2002-12-10 テクラブ, インコーポレイテッド ポリサッカリド結合体ワクチンのための組換えトキシンaタンパク質キャリア
US7101692B2 (en) * 1999-04-15 2006-09-05 The Regents Of The University Of California Identification of sortase gene
AU4989100A (en) 1999-05-04 2000-11-17 Susan A. Capizzi Method and apparatus for categorizing and retrieving network pages and sites
US6833356B1 (en) * 1999-08-25 2004-12-21 Medimmune, Inc. Pneumococcal protein homologs and fragments for vaccines
HUP0202885A3 (en) 1999-09-24 2004-07-28 Smithkline Beecham Biolog Vaccines
TR200200777T2 (tr) 1999-09-24 2002-09-23 Smithkline Beecham Biologicals S.A. Polioksietilen alkil eteri veya esteriyle en az bir iyonik olmayan yüzey aktif maddeli adjuvant.
CA2384713A1 (en) 1999-09-29 2001-04-05 Human Genome Sciences, Inc. Colon and colon cancer associated polynucleotides and polypeptides
PT2289545T (pt) 2000-01-17 2016-09-06 Glaxosmithkline Biologicals Sa Vacina de omv suplementada contra meningococos
US20010044416A1 (en) 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
US6777547B1 (en) * 2000-01-31 2004-08-17 Andreas Podbielski Collagen-binding proteins from streptococcus pyogenes
US6400152B1 (en) * 2000-01-31 2002-06-04 General Electric Company Spiral trajectory calculations for MRI
CA2404260A1 (en) * 2000-03-21 2001-09-27 Elitra Pharmaceuticals, Inc. Identification of essential genes in prokaryotes
GB0007432D0 (en) 2000-03-27 2000-05-17 Microbiological Res Authority Proteins for use as carriers in conjugate vaccines
AUPQ801700A0 (en) * 2000-06-07 2000-06-29 Peplin Research Pty Ltd Enzyme and viral activation
JP2004502415A (ja) 2000-07-03 2004-01-29 カイロン エセ.ピー.アー. Chlamydiapneumoniaeに対する免疫化
JP4718099B2 (ja) * 2000-07-06 2011-07-06 アイディー バイオメディカル コーポレイション ストレプトコッカス・パイオジェンス抗原
WO2002012294A2 (en) * 2000-08-08 2002-02-14 St. Jude Children's Research Hospital Group b streptococcus polypeptides nucleic acids and therapeutic compositions and vaccines thereof
AU2001294750C1 (en) 2000-09-26 2008-09-18 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes
AU2001294953A1 (en) * 2000-09-29 2002-04-08 Regents Of The University Of Minnesota Triterpenes having fungicidal activity against yeast
US7160547B2 (en) * 2000-10-10 2007-01-09 University Of Tennessee Research Corporation Streptococcal streptolysin S vaccines
WO2002057315A2 (en) * 2000-10-10 2002-07-25 University Of Tennessee Research Corporation Streptococcal streptolysin s vaccines
JP2002135314A (ja) 2000-10-26 2002-05-10 Sharp Corp 通信制御方法および通信機器
CA2881568C (en) * 2000-10-27 2019-09-24 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups a & b
GB0103424D0 (en) 2001-02-12 2001-03-28 Chiron Spa Gonococcus proteins
DK1372708T3 (da) 2001-02-13 2008-10-20 Us Gov Sec Army Vaccine til transkutan immunisering mod rejsediarre
JP2004529906A (ja) 2001-03-19 2004-09-30 イオマイ コーポレイシヨン 経皮的免疫賦活
GB0107658D0 (en) 2001-03-27 2001-05-16 Chiron Spa Streptococcus pneumoniae
US20070128229A1 (en) * 2002-04-12 2007-06-07 Wyeth Surface proteins of Streptococcus pyogenes
BR0208874A (pt) * 2001-04-13 2004-06-22 Wyeth Corp Proteìnas superficiais de streptococcus pyogenes
FR2824074A1 (fr) * 2001-04-26 2002-10-31 Pasteur Institut Sequence du genome streptococcus agalactiae, application au developpement de vaccins, d'outils de diagnostic, et a l'identification de cibles therapeutiques
WO2002094851A2 (en) * 2001-05-18 2002-11-28 The Government Of The United States Of America, Asrepresented By The Secretary, Department Of Healthand Human Services, Centers For Disease Control And Prevention, Technology Transfer Office Peptide vaccines against group a streptococci
GB0118249D0 (en) * 2001-07-26 2001-09-19 Chiron Spa Histidine vaccines
US20060073530A1 (en) * 2001-08-15 2006-04-06 Olaf Schneewind Methods and compositions involving sortase B
DE60234375D1 (de) 2001-09-14 2009-12-24 Cytos Biotechnology Ag VERPACKUNG VON IMMUNSTIMULIERENDEM CpG IN VIRUSÄHNLICHEN PARTIKELN: HERSTELLUNGSVERFAHREN UND VERWENDUNG
CA2492823A1 (en) 2001-09-14 2003-03-27 Cytos Biotechnology Ag In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles
GB0123580D0 (en) 2001-10-01 2001-11-21 Glaxosmithkline Biolog Sa Vaccine
WO2003035836A2 (en) 2001-10-24 2003-05-01 Hybridon Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5' ends
US20040029129A1 (en) * 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
ES2381967T3 (es) 2002-02-11 2012-06-04 Id Biomedical Corporation Antígeno de streptococcus del grupo B
GB2385274B (en) * 2002-02-13 2004-04-14 Ming-Jeng Shue Vaginal suppository delivery device
US20050181388A1 (en) * 2002-04-02 2005-08-18 Affinium Pharmaceuticals, Inc. Novel purified polypeptides from bacteria
WO2003087353A2 (en) * 2002-04-08 2003-10-23 Affinium Pharmaceuticals, Inc. Purified polypeptides involved in membrane biogenesis
GB0210128D0 (en) * 2002-05-02 2002-06-12 Chiron Spa Nucleic acids and proteins from streptococcus groups A & B
US20070053924A1 (en) * 2002-08-26 2007-03-08 Herve Tettelin Conserved and specific streptococcal genomes
TW566366U (en) * 2002-09-27 2003-12-11 Wus Tech Co Ltd Labor-saving portable battery equipment for power-driven walking assisted scooter
JP5116971B2 (ja) * 2002-10-15 2013-01-09 インターセル アーゲー B群連鎖球菌の接着因子をコードする核酸、b群連鎖球菌の接着因子、およびその使用
EP2287315A1 (en) 2003-03-04 2011-02-23 Intercell AG Streptococcus pyogenes antigens
ES2529736T3 (es) 2003-04-10 2015-02-25 Novartis Vaccines And Diagnostics, Inc. Composición inmunogénica que comprende una proteína espicular del coronavirus del SARS
EP2289907A3 (en) * 2003-05-07 2011-08-31 Intercell AG Streptococcus agalactiae antigens I + II
MXPA05013260A (es) 2003-06-26 2006-03-09 Chiron Corp Composiciones inmunogenicas para chlamydia trachomatis.
ES2505695T3 (es) * 2003-07-31 2014-10-10 Novartis Vaccines And Diagnostics, Inc. Composiciones inmunógenas para Streptococcus pyogenes
AU2003904237A0 (en) * 2003-08-08 2003-08-21 Garvan Institute Of Medical Research Novel translocation assay
US8945589B2 (en) * 2003-09-15 2015-02-03 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus agalactiae
US7424370B2 (en) * 2004-02-06 2008-09-09 Council Of Scientific And Industrial Research Computational method for identifying adhesin and adhesin-like proteins of therapeutic potential
US20060041961A1 (en) * 2004-03-25 2006-02-23 Abad Mark S Genes and uses for pant improvement
WO2005108419A1 (en) 2004-05-07 2005-11-17 Lea-Ann Kirkham Mutant cholesterol-binding cytolysin proteins
JP2008508320A (ja) * 2004-07-29 2008-03-21 カイロン コーポレイション Streptococcusagalactiaeのようなグラム陽性細菌に対する免疫原性組成物
AU2005335216A1 (en) 2004-10-05 2007-02-15 Wyeth Probe arrays for detecting multiple strains of different species
EP1770171A1 (en) 2005-09-29 2007-04-04 Universität Zu Köln DNA microarray for rapid identification of Candida albicans in blood cultures.
EP2292644A3 (en) 2006-07-07 2011-05-25 Intercell AG Small Streptococcus pyogenes antigens and their use
AT514720B1 (de) 2013-08-30 2016-03-15 Blum Gmbh Julius Stellvorrichtung

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070036828A1 (en) * 2002-09-13 2007-02-15 Chiron Corporation Group b streptococcus vaccine

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080152701A1 (en) * 1997-12-19 2008-06-26 Naomi Balaban Methods and Compositions for the Treatment and Prevention of Staphylococcus Infections
US8067015B2 (en) 1997-12-19 2011-11-29 Naomi Balaban Methods and compositions for the treatment and prevention of Staphylococcus and other bacterial infections
US7534857B2 (en) 1997-12-19 2009-05-19 Centegen, Inc. Methods and compositions for the treatment and prevention of staphylococcal infections
US20060252691A1 (en) * 1997-12-19 2006-11-09 Naomi Balaban Methods and compositions for the treatment and prevention of staphylococcus and other bacterial infections
US20080219976A1 (en) * 1997-12-19 2008-09-11 Naomi Balaban Methods and compositions for treatment and prevention of staphylococcal infections
US20070009569A1 (en) * 1997-12-19 2007-01-11 Naomi Balaban Methods and compositions for the treatment and prevention of staphylococcus and other bacterial infections
US7939087B2 (en) 2000-10-27 2011-05-10 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from Streptococcus groups A & B
US7955604B2 (en) * 2000-10-27 2011-06-07 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A and B
US8137673B2 (en) * 2000-10-27 2012-03-20 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from Streptococcus groups A & B
US20060258849A1 (en) * 2000-10-27 2006-11-16 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A & B
US20060210579A1 (en) * 2000-10-27 2006-09-21 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A & B
US10428121B2 (en) 2000-10-27 2019-10-01 Novartis Ag Nucleic acids and proteins from streptococcus groups A and B
US8025890B2 (en) 2000-10-27 2011-09-27 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A and B
US20060210582A1 (en) * 2000-10-27 2006-09-21 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A & B
US9840538B2 (en) 2000-10-27 2017-12-12 Novartis Ag Nucleic acids and proteins from Streptococcus groups A and B
US9738693B2 (en) 2000-10-27 2017-08-22 Novartis Ag Nucleic acids and proteins from streptococcus groups A and B
US8431139B2 (en) 2000-10-27 2013-04-30 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from Streptococcus groups A and B
US20060210581A1 (en) * 2000-10-27 2006-09-21 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A & B
US20100105865A1 (en) * 2000-10-27 2010-04-29 John Telford Nucleic acids and proteins from streptococcus groups a & b
US20100303864A1 (en) * 2002-08-26 2010-12-02 Herve Tettelin Conserved and specific streptococcal genomes
US7709009B2 (en) 2003-07-31 2010-05-04 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for streptococcus pyogenes
US20070065464A1 (en) * 2003-07-31 2007-03-22 Chiron Corporation Immunogenic compositions for streptococcus pyogenes
US8128936B2 (en) 2003-07-31 2012-03-06 Novartis Vaccines And Diagnostics, S.R.L. Immunogenic compositions for Streptococcus pyogenes
US9056912B2 (en) 2003-07-31 2015-06-16 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus pyogenes
US8529913B2 (en) 2003-07-31 2013-09-10 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus pyogenes
US8945589B2 (en) 2003-09-15 2015-02-03 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus agalactiae
US20080220010A1 (en) * 2003-09-15 2008-09-11 Novartis Vaccines And Diagnostics Srl Immunogenic Compositions for Streptococcus Agalactiae
US8778358B2 (en) 2004-07-29 2014-07-15 Novartis Vaccines And Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae
US20090317420A1 (en) * 2004-07-29 2009-12-24 Chiron Corporation Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
US20090117113A1 (en) * 2004-10-08 2009-05-07 Chiron Corporation Immunogenic And Therapeutic Compositions For Streptococcus Pyogenes
US7838010B2 (en) 2004-10-08 2010-11-23 Novartis Vaccines And Diagnostics S.R.L. Immunogenic and therapeutic compositions for Streptococcus pyogenes
US20100074923A1 (en) * 2006-02-17 2010-03-25 Antonello Covacci Purification of bacterial antigens
US20080031877A1 (en) * 2006-02-17 2008-02-07 Antonello Covacci Purification of bacterial antigens
US20110206692A1 (en) * 2006-06-09 2011-08-25 Novartis Ag Conformers of bacterial adhesins
US20100150943A1 (en) * 2006-07-26 2010-06-17 Novartis Ag Immunogenic compositions for gram positive bacteria
US20110038879A1 (en) * 2006-10-30 2011-02-17 Novartis Ag Immunogenic and therapeutic compositions for streptococcus pyogenes
US8858957B2 (en) 2007-09-12 2014-10-14 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
US8399651B2 (en) 2007-09-12 2013-03-19 Novartis Ag Nucleic acids encoding GAS57 mutant antigens
US9102741B2 (en) 2007-09-12 2015-08-11 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
US8287885B2 (en) 2007-09-12 2012-10-16 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
WO2009054858A1 (en) * 2007-10-25 2009-04-30 Centegen, Inc. Methods and compositions for the treatment and prevention of staphylococcus aureus infections
US8953685B2 (en) 2007-12-10 2015-02-10 Qualcomm Incorporated Resource-adaptive video interpolation or extrapolation with motion level analysis
US9426414B2 (en) 2007-12-10 2016-08-23 Qualcomm Incorporated Reference selection for video interpolation or extrapolation
US20090147853A1 (en) * 2007-12-10 2009-06-11 Qualcomm Incorporated Resource-adaptive video interpolation or extrapolation
US8660175B2 (en) 2007-12-10 2014-02-25 Qualcomm Incorporated Selective display of interpolated or extrapolated video units
US20090148058A1 (en) * 2007-12-10 2009-06-11 Qualcomm Incorporated Reference selection for video interpolation or extrapolation
US20090147854A1 (en) * 2007-12-10 2009-06-11 Qualcomm Incorporated Selective display of interpolated or extrapolaed video units
US8409589B2 (en) 2007-12-21 2013-04-02 Novartis Ag Mutant forms of streptolysin O
US20090162392A1 (en) * 2007-12-21 2009-06-25 Novartis Ag Mutant forms of streptolysin o
US7731978B2 (en) 2007-12-21 2010-06-08 Novartis Ag Mutant forms of streptolysin O
US8039005B2 (en) 2007-12-21 2011-10-18 Novartis Ag Mutant forms of streptolysin O
US20120076814A1 (en) * 2009-06-01 2012-03-29 Novartis Ag Combinations of pneumococcal rrgb clades
AU2011219524B2 (en) * 2010-02-26 2015-05-21 Novartis Ag Immunogenic proteins and compositions
WO2011104632A1 (en) * 2010-02-26 2011-09-01 Novartis Ag Immunogenic proteins and compositions
CN102770444A (zh) * 2010-02-26 2012-11-07 诺华有限公司 免疫原性蛋白和组合物
US9777076B2 (en) 2012-07-16 2017-10-03 Pfizer Inc. Saccharides and uses thereof
US9452205B2 (en) * 2012-09-24 2016-09-27 Montana State University Recombinant Lactococcus lactis expressing Escherichia coli colonization factor antigen I (CFA/I) fimbriae and their methods of use
US20140086950A1 (en) * 2012-09-24 2014-03-27 Montana State University Recombinant lactococcus lactis expressing escherichia coli colonization factor antigen i (cfa/i) fimbriae and their methods of use
US9931390B2 (en) 2012-09-24 2018-04-03 Montana State University Recombinant Lactococcus lactis expressing Escherichia coli colonization factor antigen I (CFA/I) fimbriae and their methods of use
US12077795B2 (en) 2016-10-18 2024-09-03 The Research Foundation For The State University Of New York Method for biocatalytic protein-oligonucleotide conjugation
US10391161B2 (en) * 2016-12-19 2019-08-27 I-Shou University FSBM recombinant protein
EP3872096A4 (en) * 2018-10-25 2022-11-30 Ajinomoto Co., Inc. PROCESS FOR THE SECRETORY PRODUCTION OF A PROTEIN
AU2019364829B2 (en) * 2018-10-25 2025-11-20 Ajinomoto Co., Inc. Method for secretory production of protein

Also Published As

Publication number Publication date
CA2575548A1 (en) 2006-07-27
EP2612679A1 (en) 2013-07-10
JP2008508320A (ja) 2008-03-21
WO2006078318A3 (en) 2008-10-30
EP1784211A2 (en) 2007-05-16
US20090317420A1 (en) 2009-12-24
US8778358B2 (en) 2014-07-15
WO2006078318A2 (en) 2006-07-27
US20110110982A1 (en) 2011-05-12
EP1784211A4 (en) 2010-06-30
JP2011206061A (ja) 2011-10-20

Similar Documents

Publication Publication Date Title
US8778358B2 (en) Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae
US20100150943A1 (en) Immunogenic compositions for gram positive bacteria
JP2008508320A5 (https=)
EP2167531B1 (en) Streptococcus pneumoniae pilus antigens
US20100074923A1 (en) Purification of bacterial antigens
EP2537857B1 (en) Mutant forms of streptolysin O
US9102740B2 (en) Cna-B domain antigens in vaccines against gram positive bacteria
US20110038879A1 (en) Immunogenic and therapeutic compositions for streptococcus pyogenes
US8945589B2 (en) Immunogenic compositions for Streptococcus agalactiae
RU2727476C2 (ru) Антигены и антигенные композиции
US8147849B2 (en) Protective antigens for group B Streptococcus hypervirulent strains
AU2013203028A1 (en) Cna_B domain antigens in vaccines against gram positive bacteria

Legal Events

Date Code Title Description
AS Assignment

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TELFORD, JOHN L.;GRANDI, GUIDO;MORA, MARIROSA;AND OTHERS;REEL/FRAME:017376/0716;SIGNING DATES FROM 20051020 TO 20051215

AS Assignment

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: RE-RECORD TO CORRECT SEVERAL ASSIGNORS NAMES ON A DOCUMENT PREVIOUSLY RECORDED AT REEL 017376, FRAME 0716. (ASSIGNMENT OF ASSIGNOR'S INTEREST);ASSIGNORS:TELFORD, JOHN L.;GRANDI, GUIDO;MORA, MARIROSA;AND OTHERS;REEL/FRAME:017817/0542;SIGNING DATES FROM 20051020 TO 20051215

AS Assignment

Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC., CALIFORNI

Free format text: MERGER;ASSIGNOR:CHIRON CORPORATION;REEL/FRAME:022664/0792

Effective date: 20060419

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE