KR101525873B1 - Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin - Google Patents

Abstract

The present invention relates to a manufacturing method of a mixed fermentation extract containing wild ginseng roots, Hedysarum ussuriensis, Salvia miltiorrhiza Bunge, Sophora flavescens, Adenophora triphylla var. japonica Hara, Codonopsis pilosula, and Scrophularia burgeriana. The mixed fermentation extract has excellent effects of expressing collagen and TIMP-1, expressing tropoelastin, and inhibiting an expression of MMP-1, whereby a cosmetic composition containing the mixed fermentation extract as an active ingredient can be effectively used as anti-aging cosmetics.

Description

[0001] The present invention relates to a method for producing a two-stage fermented extract comprising a ginseng root, a ginseng root, a ginseng root, a ginseng root and a ginseng root, and a cosmetic composition containing the ginseng root, for improving skin}

The present invention relates to the production of a mixed fermented extract having an excellent anti-aging effect with excellent safety. Specifically, the fermented extract is fermented according to the traditional fermentation technique, and then the fermented soybean ginseng root, Dansei, Dansam, The present invention relates to a method for producing a mixed fermented extract prepared through a low temperature aging process in a barrel and an anti-aging cosmetic composition having an excellent anti-aging activity as an effective ingredient.

Oxidative metabolic byproducts such as hydroxyl radical (· OH), superoxide anion (· O ₂ ^- ) and hydrogen peroxide (H ₂ O ₂ ) generated by in vivo reactive oxygen species (ROS) It is known to be an important cause (Comporti 1993). These ROS peroxidize cell membrane lipids and cause changes in cell membrane permeability, leading to DNA damage and aging (Meneghini et al., 1993). Aging of human skin occurs with decreasing number of fibroblasts as age gets older. In addition, activation of various signaling systems by ultraviolet rays, climate, smoking, etc., leads to inflammation and damage to skin components, leading to skin aging (Parrado et al., 1999). The skin damaged by ultraviolet rays has a reduced amount of collagen because of the increased expression of matrix metalloproteinase (MMPs) in the skin by ultraviolet rays, and these MMPs play an important role in the development of skin photoaging (Fisher et al. , 1999). MMPs are secreted from the cells of the skin (keratinocytes, fibroblasts) to break down the connective tissue that maintains skin elasticity by decomposing most of the protein components constituting the extracellular matrix (ECM) and the basement membrane (BM) (Wang et al., 1999), which causes wrinkles, decreased elasticity, and skin sagging. Recently, it has been reported that the cell signaling pathway associated with aging-related increases in MMPs is mainly involved in the MAP kinase pathway (Hearing VJ 1999), MAP kinase pathway The AP-1 (activator protein-1) factor, which is most affected by the MAP kinase pathway, regulates the expression of many genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs (Fisher et al. , 1996). MMPs are metalloproteinases with zinc at the active center and are secreted in vivo in the form of zymogen. In order to have enzymatic activity, structural modification occurs and aminoterminal part is cleaved and activated and α2-macroglobulin or TIMPs and tissue inhibitors of metalloproteinase (Fisher et al., 1999). In recent research, it has been reported that elastin, an elastic fiber in addition to collagen in wrinkle formation, and elastase, an enzyme involved in elastin degradation, are undergoing research (Antonicelli et al., 2007; Isenburg et al., 2004; Seite et al., 2006). In particular, it has been reported that the expression of tropoelastin mRNA, an elastin precursor, is also increased in keratinocytes of human skin epidermis by chronic UV irradiation (Seo et al., 2001), suppression of selective elastase activity (Tsuji et al., 2001). It has also been reported that elastase plays a role in the formation of wrinkles.

Melanin is a major factor in determining the color of skin and hair. It acts to protect skin cells from ultraviolet rays and blocks ultraviolet rays from sunlight. This production of melanin is synthesized in the organelles called melanosomes in the basal layer of melanocytes (Hearing, 1999). The synthesized melanin pigment is transferred to the adjacent keratinocyte through the dendrite of the melanin cell, and the melanin pigment is distributed in various parts of the skin through the keratinocyte (Lowell, 1991). However, abnormal production of melanin causes skin lesions such as vitiligo. On the contrary, when melanin is over-synthesized or pigmented by various environmental factors such as sunshine, hormonal changes, inflammation or medicines, it forms spots and freckles (Lim et al., 2010; Park et al., 1998). These lesions lead to skin cancer. Therefore, in order to prevent such a pigmentation phenomenon and obtain a whitening effect, it is necessary to inhibit a part of the melanin production process to reduce the production of melanin. The most important enzyme involved in melanogenesis is tyrosinase, a tyrosine hydroxylase that oxidizes tyrosine in the melanosome to form 3,4-dihydroxyphenylalanine (DOPA). DOPA is oxidized to form DOPA oxidase, which produces dopachrome. Finally, melanin polymer is synthesized. Thus, inhibition of tyrosinase activity in the development of skin whitening agents has been recognized as a useful first-line assay (Pavel and Muskiet 1980; Prota 1990).

Research on the development of functional cosmetics has been actively carried out with interest in beauty and health such as aging of the skin soaring as the level of living improves. Retinol (a vitamin A), a-hydroxy acid (AHA), and adenosine which are typical examples of wrinkle improving materials for the functional cosmetics notices of the KFDA increase the synthesis of collagen and normalize the epidermal keratinization process and contribute to skin regeneration It is widely used as a substance, but it is known to be irritating to light and heat, and irritating to the skin. In the case of whitening functional cosmetics, there are mulberry extract, arbutin, ethyl ascorbic ether, soluble licorice extract, ascorbyl glucoside and magnesium ascorbyl phosphate.

Accordingly, the inventors of the present invention intend to develop a new natural anti-aging cosmetic composition having an anti-aging effect evaluated from natural materials in order to solve the above-mentioned problems and to secure skin safety.

(0001) Korean Patent Publication No. 10-2011-0063269 (June 10, 2011) (0002) Korean Patent Laid-Open No. 10-2014-0055049 (April 201, 2014) (0003) Korean Patent Publication No. 10-2013-0059640 (June 3, 2013)

It is an object of the present invention to provide a method for producing a mixed fermented extract of ginseng cultured ginseng having excellent anti-aging activity, Danseong, Dansam, Gosam, Samam, Mansam and Hyosung.

It is another object of the present invention to provide a cosmetic composition comprising a mixed ginseng root prepared by the above-described method and having excellent anti-aging activity, and a mixed fermentation extract of Dansei, Dansam, Gosam, Samam, Mansam and Hyosung.

To achieve the above object, according to the present invention, there is provided a method for producing a fermented milk, comprising: (A) mixing yeast, grain and purified water; (B) mixing the dried wild ginseng cultivating roots, Dansei ginseng, Danshang, Gosam, Ginseng, Ginseng and Hyangsam in a bag wrapped with the mixture to the mixture; (C) fermenting at 35 to 60 DEG C for 2 to 3 days; (D) extracting the fermentation product; And (E) adding the extract to a cedar vat for aging at 2-8 ° C for 7-10 days.

In the step (A), the mixture of the koji, the grain and the purified water comprises 1 to 6% by weight of the koji, 30 to 50% by weight of the grain and 45 to 65% by weight of the purified water. As the grain, at least one selected from the group consisting of rice, barley, and wheat may be used, and rice is preferably used.

In step (B), the dried ginseng root, Dansei, Danshang, Gosam, Samam, Mansam and Hyungsam are mixed in a dry weight ratio of 1: 1: 1: 1: 1 to 1.5: 1 to 1.5: 1: 1: 1: 1: 1: 1.

In the step (D), the extraction is carried out with at least one solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol.

According to another aspect of the present invention, there is provided a cosmetic composition comprising a mixed fermented extract of the wild ginseng root, Danseom, Dansam, Gosam, Samam, Mansam and Hyosung, in an amount of 0.001-10 wt% based on the total weight of the cosmetic composition .

The cosmetic composition can be used for improving skin wrinkles and skin whitening.

The cosmetic composition may be at least one selected from the group consisting of a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutrition cream, a moisturizing cream, a hand cream, A cleansing cream, a body lotion, a body cleanser, an emulsion, a press powder, a loose powder or an eye shadow.

The mixed fermented extract according to the present invention is excellent in the scavenging ability and collagen production effect of DPPH free radical, superoxide radical, Alkyl radical and hydroxyl radical, the expression of TIMP-1, the expression of tropoelastin and the suppression of MMP-1 expression, The cosmetic composition containing the component can be usefully used as an anti-aging cosmetic composition.

FIG. 1 is a graph showing the activities of extracts according to Examples and Comparative Examples of the present invention on Collagen mRNA gene expression.
FIG. 2 is a graph showing the activity of TIMP-1 mRNA gene expressions of extracts according to Examples and Comparative Examples of the present invention.
FIG. 3 is a graph showing the activity of Tropoelastin mRNA gene expression of extracts according to Examples and Comparative Examples of the present invention.
FIG. 4 is a graph showing the effect of inhibiting the MMP-1 mRNA gene expression of the extracts according to Examples and Comparative Examples of the present invention.
FIG. 5 is a graph showing the inhibitory effect of MITF mRNA gene expression on the extracts according to Examples and Comparative Examples of the present invention.
FIG. 6 is a graph showing inhibitory effects of Tyrosinase mRNA gene expression on the extracts according to Examples and Comparative Examples of the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a method of fermenting wild ginseng root, anti-aging active herbaceous ginseng root, Dan-son ginseng, Dansam ginseng, Ginseng ginseng, Manchus ginseng and Hyosung primary fungus according to the traditional fermentation technique and secondary- And to a technique for producing an excellent mixed fermentation extract.

The cultured wild ginseng cultured root of the present invention was obtained by isolating tissues from wild wild ginseng and inducing callus and adventitious roots in stages. After selecting robust roots from these roots, they were cultured in a bioreactor for about 45 to 60 days It is produced by cultivation. The cultured ginseng cultivars contain very similar components to wild ginseng and contain various pharmacological components which are higher in saponin content than ginseng and not found in ginseng (Son et al., 1999).

Scrophularia burgeriana is a perennial plant for medicinal purposes. The square stem grows up to about 1.5m in height and strikes a little branch at the top. Leaves are egg-shaped, two per side facing each other. Leaf end is pointed, base is round and has petiole. Sharp teeth are regularly arranged on the edges of the leaves. A long peduncle grows from the leaf axil near the tip and end of the stem, and many flowers bloom. The flower has the appearance just like a lips, the end is split in shape like a lips, and the lower lips are dried back. The length of the flower is about 6 ~ 7mm and the color is yellow-green. The whole plant contains glycosides such as hesperidin (Hesperidin) and diosmin (Diosmin). And it has efficacy such as consonant, fever, detoxification, and exclusion, and symptoms of high fever, chest tightness, thirsty, hypertension, tonsillitis, lymphadenitis, thrombosis, tuberculous lymphadenitis, sore throat, bronchitis, For the treatment of.

Salvia miltiorrhiza Bunge has short and rough roots (stem) and usually has stem marks at the end. The roots are long cylindrical and are divided into several parts. The outer surface is reddish brown or dark reddish brown, rough and has vertical wrinkles. The old ones are dark brown, usually scaly ones. There is a peculiar smell, weakness is weary and slightly cold. Pharmacological actions have been reported for coronary artery enlargement, cholesterol depression, hypotension, liver function activation, sedative anti-inflammatory, anti-cancer and anti-bacterial effects.

Gosam ( Sophora flavescens ) is also known as the sperm of the thistle's rod, nephew, and snake. It grows in a sunny grass. It is 80-100cm high and green, but it is black when it is young. The stem is straight, leaves are alternate, odd numbered compound leaf. Small leaves are 15 ~ 40, long oval or long ovate, 2 ~ 4cm long, 7 ~ 15mm wide. The petiole is long and the edge is flat. In one room, dried roots are called roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted grilled roasted roast In the private sector, it is also used as an insecticide by dying stem or leaf. They are the same plants and have mountain peaks. They look very similar. It is distributed in Korea, Japan, China and Siberia.

The ginseng ( Adenophora triphylla var. Japonica Hara) is fusiform, long conical, bent and occasionally with root. There is a rhizome with horizontal wrinkles on top. The roots are light and easy to bend, and the folded side is milky white with many gaps. This medicine has an unusual direction, chewy, mucilaginous, taste a little sweet and a little temperate. The pharmacological effects of gadam work, antimicrobial action, hemolytic action, and cardiac action have been reported. And the ginseng replenishes the essence, soaking the lungs, cooling the heat, getting rid of the wall, drying, drying cough, sputum, seawater and asthma. It is used for symptom of constipation which dry mouth is dry and throat is dry due to shortage of forgery.

Licorice ( Codonopsis pilosula ) grows in deep mountains. The juice comes out when I cut it. The roots are bellflower shaped and about 30 cm long. Leaves are alternate but opposite in short branches, egg-shaped or egg-shaped elliptical, with fine hairs on both sides and white on the back. Leaf length is 1 ~ 5cm, width is 1 ~ 3.5cm and petiole is 2 ~ 3cm long and hairy. Roots are called gangnam (ginseng) or gang, and they are used as expectorants or edible.

Danynac ( Hedysarum ussuriensis ) grows in the rocks of the mountain. It is 40 ~ 70cm high and has soft white hairs all over. The stem is a cumulus, and the leaf is an odd numbered iguite leaf of 6-11 pairs of small leaves. The small leaf is about 1 ~ 2 cm long and is egg-shaped elliptical, and leaf edge is flat. It is distributed in Korea, Japan, Manchuria, Northeastern China, and Eastern Siberia. Generally, it is cultivated as a herb. In the oriental medicine, it is collected in the autumn to remove the head and the root, and dried in the sun. It is called Huangji of Chinese medicine, and it has the effects such as tongue, diuretic, and exenteration.

The ginseng cultivated root used in the present invention can be purchased either offline or on the internet market, such as Danseok, Dansam, Gosam, Samam, Mansam and Hyosam. In the present invention, it is preferable that the dried ginseng cultivar, Dansei, Dansam, Gamsam, Samam, Mansam and Hyungsam are cleanly washed with purified water and dried by using an extraction method.

According to one embodiment of the present invention, a mixed fermentation extract is prepared as follows.

First, in order to primary ferment the herbal medicines, a mixture of yeast, grain and purified water is prepared. The mixture of the koji, the grain and the purified water is composed of 1 to 6% by weight of koji, 30 to 50% by weight of grains and 45 to 65% by weight of purified water. As the grain, at least one selected from the group consisting of rice, barley, and wheat may be used, and rice is preferably used.

After washing and drying, the dried ginseng cultivating roots, Dansei, Danshang, Gosam, Samam, Ginseng and Seed ginseng are wrapped in hemp wrap and put into the mixture and fermented. 1: 1 to 1.5: 1 to 1.5: 1 to 1.5 in terms of dry weight, and the ratio of 1: 1: 1: 1: : 1: 1: 1: 1 showed the best anti-aging activity.

The mixture of the herbal medicines is wrapped in a bag of bran, and is buried in the yeast mixture to be fermented at 35 to 60 DEG C for 2 to 3 days.

Then, the embryo is taken out and the fermented herbal medicine mixture is extracted with a solvent to prepare an extract. At least one solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol is used. According to one embodiment of the present invention, a 1 to 80 volume volume of water and 30% (V / V) ethanol is added and the mixture is stirred at 90 to 95 ° C for 2 to 3 hours. .

The extract is not used as it is, but in the present invention, the extract is secondarily put into a cedar vat and matured at low temperature. Cryptomeria japonica (Cryptomeria japonica) is an evergreen tree of Japanese origin and widely distributed in Jeju Island and southern region. Cedarwood is currently being used as an interior material, furniture material, road rug, etc. Research is also actively carried out to increase the added value of wood, including physiological activity by extractive ingredients (Kofujita et al., 2001; Matsushita et al., 2006) . Cedar contains a wide variety of terpenoids, especially sesquiterpene, which is composed of 15 carbons. These components themselves are known to have antifungal activity against dermatophytes.

In order to enhance the anti-aging activity of the herbal medicine mixed fermentation extract, the herbal medicine mixed fermented extract was placed in a container made of cedar and aged at a low temperature.

Extracts obtained by fermenting Nanseong cultivated ginseng root, Dansei, Dansam, Gosam, Samam, Mansam and Hyungsam were placed in a cedar barrel and aged at a low temperature of 2 ~ 8 ℃ for 7 ~ 10 days. The mixture can be filtered or filtered, and then concentrated under reduced pressure to prepare a mixed fermented extract of herbal medicines according to the present invention.

The fermented extract of the present invention has antioxidant activity, collagen production activity, antioxidant activity, antioxidant activity, antioxidant activity, antioxidant activity and antioxidant activity, TIMP-1 expression, tropoelastin expression, and MMP-1 expression.

The fermented extract of the wild ginseng cultivating roots of the present invention produced by the above-described method of the present invention can be used in cosmetics in an amount of 0.001 to 10% by weight in powder or liquid form relative to the total weight of the cosmetic composition And may be added to the cosmetic in an amount of preferably 0.01 to 5% by weight.

The cosmetic composition of the present invention is not particularly limited in its formulation and examples thereof include a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, , A hand cream, an essence, a pack, a soap, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, an emulsion, a press powder, a loose powder or an eye shadow.

In addition, in the cosmetic composition of each formulation, components other than the above-mentioned mixed fermentation extract may be arbitrarily selected and formulated according to the formulation or purpose of use of other cosmetics. For example, it may include a coloring agent (coloring matter), a flavoring agent (fragrance), a suspending agent, an emulsifying agent, a solubilizing agent, a stabilizer, an isotonic agent, a pH adjusting agent, a viscosity adjusting agent,

The cosmetic composition of the present invention may contain, in addition to the mixed fermentation extract, one or more other active ingredients exhibiting anti-aging effects against wrinkle improvement.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. It should be noted, however, that the following examples are illustrative of the present invention, and the scope of the present invention is not limited to these examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

[Example]

Example 1: Preparation of fermented extract of wild ginseng cultured muscle

70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of the ground ginseng cultured muscle was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example 2: Fermented soybean extract Produce

70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of pulverized monascus gum was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example 3: Fermented extract of Dansam Produce

70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed ginseng was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example 4: Fermented extract Produce

70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed red ginseng were mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example 5: Fermented extract of Samams Produce

70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed ginseng was mixed and wrapped in a burlap cloth and buried in the koji mixture, followed by fermentation at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example 6: Extract of fermented manchans Produce

70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed manzan were mixed, wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example 7: Fermented extract of ginseng Produce

70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed ginseng was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Examples 8 to 12: Mixed fermentation extract Produce

The extracts were prepared in the same manner as in Example 7 by mixing the ginseng root with different weight ratios as shown in Table 1 below, and mixing the ginseng root, Danseom, Dansam, Gosam, Samam, The same operation was performed with different raw materials.

Comparative Example 1: Preparation of mixed fermented extract without aging process of cedar

70g of koji leek, 700g of rice, and 1050g of purified water were mixed in a pottery pot to prepare a mixture. After drying, the pulverized ginseng cultured root, Dansei, Dansam, Gam, Samam, Mansam and Hyungsam were mixed at the same weight ratio, and a total of 200 g of the dried ginseng cultivar was wrapped in a ruby wrapper, buried in the koji mixture and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Comparative Example 2: Preparation of mixed fermented extracts through a jar fermentation process

70g of koji leek, 700g of rice, and 1050g of purified water were mixed in a pottery pot to prepare a mixture. After drying, the pulverized ginseng cultured root, Dansei, Dansam, Gam, Samam, Mansam and Hyungsam were mixed at the same weight ratio, and a total of 200 g of the dried ginseng cultivar was wrapped in a ruby wrapper, buried in the koji mixture and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. The extract was then matured at 2-8 [deg.] C for 7 days in a pottery jar. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

ingredient Example 8 Example 9 Example 10 Example 11 Example 12 Wild ginseng cultivator One One One One One Dan Sam-sam One One One One One Sansam One One One One One GoSam One One One One One Sasayam - One 1.5 1.5 - Mansam - One 1.5 - 1.5 figwort - One - 1.5 1.5

The extracts were concentrated and lyophilized to confirm the anti - aging effect of the mixed fermented extract. Radical scavenging ability and intracellular efficacy evaluation samples were prepared. In addition, the inhibitory effects of DPPH free radical, Superoxide Radical, Alkyl Radical and Hydroxyl Radical scavenging ability and collagenase, Timp-1 and Tropoelastin gene expression and MMP-1 gene expression in vitro were confirmed.

Test Example 1: Measurement of scavenging activity of DPPH free radical

DPPH free radical scavenging activity was measured by the method of Nanjo et al. (1996). 30 μl of 60 μM DPPH (1,1-diphenyl-2-picrylhydrazyl) solution was added to 30 μl of the sample, and the reaction solution was transferred to a 100 μl quartz capillary tube. Electron spin resonance (ESR) spectrometer (JES- Ltd., Tokyo, Japan). The experimental conditions are as follows.

magnetic field, 336.5 ± 5 mT; power, 5 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30 s; temperature, 298 K.

The DPPH radical scavenging activity was calculated by the difference in the relative radical signal peak heights of H and H ₀ . The results are shown in Table 2, respectively.

DPPH free radical scavenging activity (%) = (1-H / H ₀ ) × 100

Test Example 2: Superoxide radical scavenging ability measurement

Superoxide radicals were irradiated with 10 μl of 0.3 mM riboflavin, 10 μl of 1.6 mM EDTA and 10 μl of 800 mM DMPO in 10 μl of a sample according to Guo et al. (1999), and then irradiated with UV lamp at 365 nm for 1 minute. The reaction was transferred to a quartz capillary tube and analyzed using an ESR spectrometer. The experimental conditions were as follows.

magnetic field, 336.5 ± 5 mT; power, 10 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30 s; temperature 298 K.

Superoxide radical scavenging activity was calculated by the equation using the relative peaks of H and H ₀ . The results are shown in Table 2, respectively.

Superoxide radical scavenging activity (%) = (1-H / H ₀ ) × 100

Test Example 3: Measurement of Alkyl radical scavenging ability

10 μl of each sample was supplemented with 10 μl of PBS (Phosphate buffered saline), 40 mM AAPH (2,2-azobis- (2-amidinopropane) -dihydrochloride), 40 mM POBN α- (4-pyridyl- Add tert-butylnitrone. After incubation at 37 ° C for 30 min, the cells were transferred to a quartz capillary tube and measured using an ESR spectrometer. The experimental conditions are as follows.

magnetic field, 336.5 ± 5 mT; power, 10 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 1 min; temperature 298 K.

Alkyl radical scavenging activity was calculated by the following equation. The results are shown in Table 2, respectively.

Alkyl radical scavenging activity (%) = (1-H / H ₀ ) × 100

Test Example 4: Measurement of scavenging ability of hydroxyl radical

Hydroxyl radical scavenging activity was measured by Rosen et al. (1984). 20 μl of 0.3 M DMPO, 20 μl of 10 mM FeSO _{4 and} 20 μl of 10 mM H ₂ O ₂ were added to a 20 μl sample, and then transferred to a quartz capillary tube. After 2.5 minutes, the sample was measured by ESR spectrometer. The experimental conditions are as follows.

magnetic field, 336.5 ± 5 mT; power, 1 mW; modulation frequency, 9.41 GHz; amplitude, 1 × 200; sweep time, 4 min; temperature 298 K.

Hydroxy radical scavenging activity was calculated by the following equation, measured by the relative heights of H and H ₀ . The results are shown in Table 2, respectively.

Hydroxyl radical scavenging activity (%) = (1-H / H ₀ ) × 100

division Radical scavenging activity (%) at concentration 2.5 mg / ml. DPPH Hydroxyl Alkyl Superoxide Example 1 56.82 ± 0.91 59.65 ± 1.22 47.18 ± 0.86 50.01 + - 0.98 Example 2 49.27 ± 1.26 52.17 ± 1.03 41.22 ± 1.03 46.18 ± 0.96 Example 3 52.63 + - 1.01 56.96 ± 0.83 52.99 + - 0.54 49.09 ± 1.11 Example 4 47.42 ± 1.18 50.25 + - 0.79 42.89 + - 0.82 45.81 ± 1.09 Example 5 52.14 + - 0.70 59.71 ± 0.51 46.47 ± 1.16 5.045 ± 0.51 Example 6 48.65 + - 0.46 55.23 + - 1.03 42.83 + - 0.33 45.99 ± 0.96 Example 7 46.49 ± 1.10 50.96 + - 0.43 40.09 + - 0.54 43.32 ± 0.91 Example 8 56.65 + - 0.46 60.23 + - 1.03 49.83 + - 0.33 51.99 ± 0.96 Example 9 70.68 + - 0.34 77.97 + - 0.51 65.58 + - 0.74 68.12 ± 1.07 Example 10 67.68 + - 0.61 71.97 ± 1.21 61.58 ± 0.97 63.12 + - 0.67 Example 11 64.25 ± 1.00 68.38 ± 1.11 55.28 + - 0.91 59.25 + - 0.51 Example 12 61.68 + - 0.61 65.97 ± 1.21 52.58 + - 0.74 58.12 + - 0.67 Comparative Example 1 53.47 ± 1.08 58.52 + - 0.91 48.15 ± 1.18 50.08 + - 1.27 Comparative Example 2 57.85 ± 1.08 61.10 ± 0.85 50.21 + - 1.16 52.98 + - 1.03

As shown in the above Table 2, in the radical scavenging effect, the mixed fermentation extract of Example 9 of the present invention in which the fermentation of koji was second-aged in the cedar barrel after the fermentation of koji showed the fermentation extract of each fermented extract, The fermented extracts which were not aged after the fermentation and the fermented extracts which were aged in the pottery jar after the mixed fermentation of the herbal medicines were found to be superior. The results showed that the active ingredient extraction from each herbal medicine was enhanced through the low - temperature aging process in the cedar barrel, and the anti - aging activity was remarkably increased.

Test Example 5: Cytotoxicity test

Cell culture

Collagenase and TIMP-1 were detected in HaCaT (human keratinocyte cell line), MMP-1 and tropoelastin were detected in CCD-986Sk (Human fibroblast cell line), tyrosinase and MITF were used for B16F10 melanoma cells in order to confirm gene expression in whitening. HaCaT, CCD-986Sk and B16F10 melanoma cells were cultured in DMEM containing 10% v / v FBS (fetal bovine serum, Gibco, USA), streptomycin at 100 U / mL, penicillin antibiotics at 100 U / Dulbecco? Modified eagle? Medium, Gibco, USA) in an incubator at 5% CO ₂ and 37 ° C.

Cell viability assay (MTT assay)

MTT assays were performed by succinate dehydrogenase of mitochondria after MTT [3- (4,5-dimethythiasol-2-yl) -2,5-diphenyl tetrazolium bromide] ). The accumulation of this substance in the cell represents the activity of mitochondria, broadly, the activity of the cell, which is a typical method for measuring the survival rate of cells.

Each HaCaT, CCD-986Sk, and B16F10 melanoma cells were seeded at a density of 1 × 10 ⁵ cells / well in 96-wells with 200 μl of the medium, cultured in a 5% CO ₂ incubator at 37 ° C. for 24 hours, After washing with PBS, the same amount of the medium and the sample dissolved in PBS were cultured in each well at various concentrations ranging from 0.1% to 5.0% and cultured for 24 hours. Four hours before the end of incubation, 20 μl of 5 mg / ml MTT dissolved in PBS was added to each well, shaded with aluminum foil, and incubated for 3 h in an incubator at 5% CO ₂ and 37 ° C. After removing the culture medium, 200 μl of DMSO solution was added, incubated at 37 ° C for 1 hour, and absorbance was measured at 570 nm using an ELISA reader. The cell survival rate was calculated by the following equation, and the results are shown in Table 3 below.

Cell survival rate (%) = O.D at 570 nm in the sample addition group / O.D at 570 nm × 100 in the sample addition group

division Cell survival rate (%) 0.1% 0.5% One % 5.0% Example 8 100 100 100 101 Example 9 101 100 101 100 Example 10 100 100 100 100 Example 11 100 100 101 100 Example 12 101 101 101 100 Comparative Example 1 100 100 100 100 Comparative Example 2 101 101 101 101 Control group
Adenosine 100 101 100 100 Control group
Arbutin 101 100 100 101

As shown in the above Table 3, none of the examples, the comparative examples, and the control group Adenosine (adenosine) Arbutin (arbutin) showed cytotoxicity.

Test Example 6: Gene expression of Collagenase, Timp-1 and Tropoelastin in cells and inhibitory effect on gene expression of MMP-1.

HaCaT and CCD-986Sk cells were cultured in Petri dishes at 5% CO ₂ and 37 ° C for 24 hours after the number of cells was adjusted to 5 × 10 ⁵ cells / ml. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

Mixed fermentation extracts, which were found to have the best free radical scavenging ability, were treated with DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C for 24 hours after treating the extracts of Examples 8, 9, 10, 11, Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.

The primer sequences of the respective genes are shown in Table 4. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to carry out reverse transcription of M-MLV (Moloney murine leukemia virus) CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction, and the total reaction solution was 25 μl. The final concentration of each reagent was 100 pmol of the primer, 1.0 μM, 0.2 mM of the dNTP mixture, 1 × 1.5 or 5 × green or colorless GoTaq Reaction buffer, MgCl ₂ (PCR buffer) and 1.25 units of GoTaq DNA polymerase. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Name of the primer Base sequence GAPDH Froward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG COL1A1 Forward: AGCCAGCAGATCGAGAACAT Reverse: TCTTGTCCTTGGGGTTCTTG TIMP-1 Forward: TGCTGGGTGGTAACTCTTTATTTCA Reverse: ATCCTGTTGTTGCTGTGGCTGATAG Tropoelastin Forward: AAAGCAGCAGCAAAGTTCGG Reverse: ACCTGGGACAACTGGAATCC MMP-1 Forward: AAGGTTAGCTTACTGTCACACGCTT Reverse: CGACTCTAGAAACACAAGAGCAAGA

The results are shown in FIGS. 1 to 4, respectively.

As a result of observation after PT-PCR, the mixed fermented extract of Example 9 of the present invention increased the expression of collagen and TIMP-1 more than other mixed fermented extracts. As shown in FIG. 4, the mixed fermentation extract of Example 9 was superior to other mixed fermentation extracts in inhibiting the expression of MMP-1. Compared with the control group, adenosine (Adenosine), excellent results were obtained.

In addition, Tropoelastin is a factor that forms elastic fiber center elastic fiber showing skin elasticity. As shown in FIG. 3, the mixed fermented extract of Example 9 has an excellent result than 5% of control adenosine 5% Respectively.

Test Example 7: Inhibitory effect of intracellular Tyrosinase and MITF on gene expression

B16F10 melanoma cells were treated with 5 × 10 ⁵ cells / ㎖ of cells and cultured in Petri dishes at 5% CO ₂ and 37 ° C for 24 hours. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

To investigate the effect of the mixed fermentation extracts on the whitening, the extracts were treated with DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C after treating the extracts of Examples 8, 9, 10, 11 and 12 and Comparative Examples 1 and 2 Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). Tyrosinase and MITF were selected for RT-PCR. GAPDH was used as a house keeping gene to identify differences in gene expression.

The primer sequences of the respective genes are shown in Table 5. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to perform reverse transcription of Moloney murine leukemia virus (M-MLV) RNA CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction and the total reaction volume was 25 μL. The final concentration of each reagent is a primer 100pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5 mM, MgCl 2 (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Name of the primer Base sequence GAPDH Froward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG MITF Forward: AACCGACAGAAGAAGCTGGA Reverse: ACAAGTTCCTGGCTGCAGTT Tyrosinase Forward: TTATGCGATGGAACACCTGA Reverse: ACTGGCAAATCCTTCCAGTG

The results are shown in Fig. 5 and Fig.

As a result of observation after PT-PCR, the mixed fermented extract of Example 9 of the present invention showed superior inhibitory effect on tyrosinase and MITF mRNA gene expression than other mixed fermented extracts. Therefore, it was confirmed that the mixed fermentation extract of the present invention had better whitening effect than other fermented extracts.

Formulation Example 1: Preparation of skin lotion

1 kg of a skin lotion containing a mixed fermented extract (Example 9) was prepared according to the following composition according to the following Table 6.

number Raw material Content (% by weight) One Mixed fermented extract (Example 9) 1.0 2 glycerin 3.0 3 Butylene glycol 2.0 4 Propylene glycol 2.0 5 Polyoxyethylene hardened castor oil 1.0 6 ethanol 10.0 7 Triethanolamine 0.1 8 antiseptic a very small amount 9 Pigment a very small amount 10 Spices a very small amount 11 Purified water Balance

In Table 6, substances No. 2, No. 3, No. 4 and No. 8 were sequentially added to the No. 11 material, and the materials were stirred and melted. Then, the No. 5 material was dissolved by heating to about 60 ° C. Subsequently, the substance 10 was added to the substance 11 after dissolution. Finally, the ingredients 1, 6, 7, and 9 were added, stirred sufficiently, and aged at 25 ° C for 3 days to prepare a skin lotion of the title.

Formulation Example 2: Preparation of nutrition lotion

According to the composition shown in the following Table 7, 1 kg of hydrosome nutrition lotion containing mixed fermented extract (Example 9) was prepared by the following method.

number Raw material Content (% by weight) One Mixed fermented extract (Example 9) 1.0 2 Wax 1.0 3 Polysorbate 60 1.5 4 Sorbitan sesquioleate 0.5 5 Liquid paraffin 10.0 6 Sorbitan stearate 1.0 7 Pro-type glycerin monostearate 0.5 8 Stearic acid 1.5 9 Glyceryl stearate / FG-400 stearate 1.0 10 Propylene glycol 3.0 11 Carboxy polymer 0.1 12 Triethanolamine 0.2 13 antiseptic a very small amount 14 Pigment a very small amount 15 Spices a very small amount 16 Purified water Balance

In Table 7, the materials 10, 11, 13, and 16 were heated to 80 to 85 ° C while mixing and stirring. , The substance No. 12 was dissolved by heating at a temperature of 80 to 85 ° C, followed by emulsification. After the emulsification is completed, the mixture is cooled to 50 ° C with stirring using an agitator, and then the substance 15 is added. After cooling to 45 ° C, the substance 14 is added and the substance 1 is added at 35 ° C. For 3 days to prepare the nutritional lotion of the title.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, It is within the scope of the present invention that component changes to such an extent that they can be coped evenly within a range that does not deviate from the scope of the present invention.

Claims (7)

(A) mixing yeast, grain and purified water;
(B) mixing the dried wild ginseng cultivating roots, Dansei ginseng, Danshang, Gosam, Ginseng, Ginseng and Hyangsam in a bag wrapped with the mixture to the mixture;
(C) fermenting at 35 to 60 DEG C for 2 to 3 days;
(D) extracting the fermentation product; And
(E) adding the extract to a cedar barrel and aging the fermented extract at 2-8 [deg.] C for 7-10 days. The method according to claim 1, wherein in step (A), the mixture of the koji, the grain and the purified water comprises 1 to 6% by weight of the koji, 30 to 50% by weight of the grain and 45 to 65% by weight of the purified water. Way. The method according to claim 1, wherein, in step (B), the dried ginseng root, Dansei, Dansam, Gosam, Samam, By weight based on the total weight of the fermented extract. The method according to claim 1, wherein, in step (D), the extraction is carried out in the presence of water, at least one selected from the group consisting of water, anhydrous or hydroalcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol Of the total weight of the mixed fermentation extract. The cosmetic composition according to any one of claims 1 to 4, wherein the fermented extract of mixed ginseng root, Danseom, Dansam, Gosam, Samam, Mansam and Hyungsam is contained in an amount of 0.001-10 wt% based on the total weight of the cosmetic composition. The cosmetic composition according to claim 5, wherein the cosmetic composition is used for improving skin wrinkles and elasticity. The cosmetic composition according to claim 5, wherein the cosmetic composition is for skin whitening.

Images