KR101525873B1 - Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin - Google Patents

Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin Download PDF

Info

Publication number
KR101525873B1
KR101525873B1 KR1020150037726A KR20150037726A KR101525873B1 KR 101525873 B1 KR101525873 B1 KR 101525873B1 KR 1020150037726 A KR1020150037726 A KR 1020150037726A KR 20150037726 A KR20150037726 A KR 20150037726A KR 101525873 B1 KR101525873 B1 KR 101525873B1
Authority
KR
South Korea
Prior art keywords
ginseng
cosmetic composition
extract
mixed
roasted roasted
Prior art date
Application number
KR1020150037726A
Other languages
Korean (ko)
Inventor
박설웅
최미혜
김동욱
이대우
김윤정
김다애
최성규
Original Assignee
(주)에스디생명공학
주식회사 더마랩
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)에스디생명공학, 주식회사 더마랩 filed Critical (주)에스디생명공학
Priority to KR1020150037726A priority Critical patent/KR101525873B1/en
Application granted granted Critical
Publication of KR101525873B1 publication Critical patent/KR101525873B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9789Magnoliopsida [dicotyledons]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/02Preparations for care of the skin for chemically bleaching or whitening the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/85Products or compounds obtained by fermentation, e.g. yoghurt, beer, wine

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Dermatology (AREA)
  • Engineering & Computer Science (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Cosmetics (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The present invention relates to a manufacturing method of a mixed fermentation extract containing wild ginseng roots, Hedysarum ussuriensis, Salvia miltiorrhiza Bunge, Sophora flavescens, Adenophora triphylla var. japonica Hara, Codonopsis pilosula, and Scrophularia burgeriana. The mixed fermentation extract has excellent effects of expressing collagen and TIMP-1, expressing tropoelastin, and inhibiting an expression of MMP-1, whereby a cosmetic composition containing the mixed fermentation extract as an active ingredient can be effectively used as anti-aging cosmetics.

Description

산삼 배양근, 단너삼, 고삼 및 사삼을 포함하는 2단 발효추출물 제조방법 및 이를 이용한 피부 개선용 화장료 조성물{Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin}[0001] The present invention relates to a method for producing a two-stage fermented extract comprising a ginseng root, a ginseng root, a ginseng root, a ginseng root and a ginseng root, and a cosmetic composition containing the ginseng root, for improving skin}

본 발명은 안전성이 우수하면서 항노화 효과가 있는 혼합발효추출물의 제조에 관한 것으로, 구체적으로는 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 전통주 발효기법에 따라 발효시킨 후, 다시 삼나무 통에서 저온 숙성 과정을 거쳐 제조하는 혼합발효추출물의 제조방법 및 이를 유효성분으로 포함하여 우수한 항노화 활성을 가지는 항노화 화장료 조성물에 관한 것이다.The present invention relates to the production of a mixed fermented extract having an excellent anti-aging effect with excellent safety. Specifically, the fermented extract is fermented according to the traditional fermentation technique, and then the fermented soybean ginseng root, Dansei, Dansam, The present invention relates to a method for producing a mixed fermented extract prepared through a low temperature aging process in a barrel and an anti-aging cosmetic composition having an excellent anti-aging activity as an effective ingredient.

생체 내에서 발생하는 hydroxyl radical(·OH), superoxide anion(·O2 -), hydrogen peroxide(H2O2) 등과 같은 활성산소종(Reactive Oxygen Species;ROS)에 의한 산화적 대사 부산물은 노화의 중요한 원인이 된다는 것이 알려져 있다(Comporti 1993). 이들 ROS는 세포막 지방질을 과산화시키고 세포막투과성의 변화를 초래하여 DNA 손상을 유발시켜 노화를 일으킨다(Meneghini et al., 1993). 사람 피부의 노화는 나이가 많아짐에 따라 섬유아세포 수가 감소하게 되면서 나타나게 된다. 또한 자외선, 기후, 흡연 등에 의해 여러 가지 신호체계가 활성화됨으로써 염증반응이 일어나고 피부 구성성분이 손상되면서 피부노화가 진행된다(Parrado et al., 1999). 자외선에 의해 손상 받은 피부는 콜라겐의 양이 감소되어 있는데, 이는 자외선에 의해 피부 내에서 MMPs(matrix metalloproteinase)의 발현이 증가하기 때문이며, 이러한 MMPs는 피부 광노화 발생에 중요한 역할을 한다(Fisher et al., 1999). MMPs는 피부의 세포들(keratinocytes, fibroblasts)로부터 분비되어 세포 외 기질(extracellular matrix, ECM)과 기저막(basement membrane, BM)을 구성하는 대부분의 단백질 성분을 분해함으로써 피부 탄력을 유지하는 결합조직을 파괴하여 주름과 탄력저하 및 피부 처짐의 원인이 되는 것으로 알려져 있다(Wang et al., 1999). 최근에 노화에 따른 MMPs의 증가와 관련된 세포 신호 전달 경로는 주로 MAP 키나제 경로(stress-activated mitogen-activated protein(MAP) kinase pathway)가 관여 한다고 보고되어 있으며(Hearing VJ. 1999), MAP 키나제 경로(MAP kinase pathway)에서 가장 많은 영향을 받는 AP-1(activator protein-1) 인자는 세포의 성장과 분화에 관련되는 많은 유전자의 발현을 조절하고 몇몇 MMPs의 발현을 강력하게 조절한다(Fisher et al., 1996). MMPs는 활성 중심부에 아연을 가지는 금속단백분해효소로 생체 내에서 잠재성 전효소(zymogen) 형태로 분비되고, 효소활성을 가지기 위해서 구조적 변형이 일어나 아미노 말단 부위가 절단, 활성화 되며 α2-macroglobulin이나 TIMPs(tissue inhibitors of metalloproteinase) 같은 저해제에 의해 활성이 조절된다(Fisher et al., 1999). 최근 연구에서 주름형성에 있어서 콜라겐 이외에 탄력섬유인 엘라스틴(elastin)과 엘라스틴 분해에 관여하는 효소인 엘라스타제(elastase)에 대해서도 많은 연구가 진행되고 있는 것으로 보고되고 있다(Antonicelli et al., 2007; Isenburg et al., 2004; Seite et al., 2006). 특히, 만성적인 UV 조사에 의해 사람의 피부 표피의 각질형성세포(keratinocytes)에서도 엘라스틴의 전구체인 tropoelastin mRNA 발현이 증가한다는 보고가 있었으며(Seo et al., 2001), 선택적인 엘라스타제 활성의 억제를 통한 주름형성에서 엘라스타제의 역할이 보고되기도 하였다(Tsuji et al., 2001).Oxidative metabolic byproducts such as hydroxyl radical (· OH), superoxide anion (· O 2 - ) and hydrogen peroxide (H 2 O 2 ) generated by in vivo reactive oxygen species (ROS) It is known to be an important cause (Comporti 1993). These ROS peroxidize cell membrane lipids and cause changes in cell membrane permeability, leading to DNA damage and aging (Meneghini et al., 1993). Aging of human skin occurs with decreasing number of fibroblasts as age gets older. In addition, activation of various signaling systems by ultraviolet rays, climate, smoking, etc., leads to inflammation and damage to skin components, leading to skin aging (Parrado et al., 1999). The skin damaged by ultraviolet rays has a reduced amount of collagen because of the increased expression of matrix metalloproteinase (MMPs) in the skin by ultraviolet rays, and these MMPs play an important role in the development of skin photoaging (Fisher et al. , 1999). MMPs are secreted from the cells of the skin (keratinocytes, fibroblasts) to break down the connective tissue that maintains skin elasticity by decomposing most of the protein components constituting the extracellular matrix (ECM) and the basement membrane (BM) (Wang et al., 1999), which causes wrinkles, decreased elasticity, and skin sagging. Recently, it has been reported that the cell signaling pathway associated with aging-related increases in MMPs is mainly involved in the MAP kinase pathway (Hearing VJ 1999), MAP kinase pathway The AP-1 (activator protein-1) factor, which is most affected by the MAP kinase pathway, regulates the expression of many genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs (Fisher et al. , 1996). MMPs are metalloproteinases with zinc at the active center and are secreted in vivo in the form of zymogen. In order to have enzymatic activity, structural modification occurs and aminoterminal part is cleaved and activated and α2-macroglobulin or TIMPs and tissue inhibitors of metalloproteinase (Fisher et al., 1999). In recent research, it has been reported that elastin, an elastic fiber in addition to collagen in wrinkle formation, and elastase, an enzyme involved in elastin degradation, are undergoing research (Antonicelli et al., 2007; Isenburg et al., 2004; Seite et al., 2006). In particular, it has been reported that the expression of tropoelastin mRNA, an elastin precursor, is also increased in keratinocytes of human skin epidermis by chronic UV irradiation (Seo et al., 2001), suppression of selective elastase activity (Tsuji et al., 2001). It has also been reported that elastase plays a role in the formation of wrinkles.

멜라닌은 피부와 머리카락의 색상을 결정하는 주요한 인자이며 자외선으로부터 피부세포를 보호하기 위한 역할을 하며, 태양 광선으로부터 들어오는 자외선을 차단하는 색소이다. 이러한 멜라닌의 생성은 기저층의 멜라닌세포(melanocyte)내 멜라닌소체(melanosome)라는 소기관에서 합성된다(Hearing, 1999). 합성된 멜라닌색소는 멜라닌세포의 수지상돌기(dendrite)를 통하여 인접세포인 각질세포(keratinocyte)로 전달되며, 전달된 멜라닌색소는 각질세포를 통하여 피부 내 여러 부위에 분포하게 된다(Lowell, 1991). 그러나 멜라닌이 비정상적으로 소량 생산되면 백반증과 같은 피부병변이 유발되고, 반대로 일광, 호르몬 변화, 염증 또는 약제 등 여러 가지 환경적 요인에 의해 멜라닌이 과도하게 합성되거나 색소가 침착되면 기미, 주근깨를 형성한다 (Lim et al., 2010; Park et al., 1998). 이와 같은 병변으로부터 나아가 피부암의 원인이 되기도 한다. 그러므로 이러한 색소 침착 현상을 방지하고 미백효과를 얻기 위해서는 멜라닌 생성 과정의 일 부분을 저해하여 멜라닌의 생성을 감소시켜야 한다. 이 멜라닌 생성에 있어서 가장 중요한 역할을 하는 효소가 바로 티로시나제(tyrosinase)이며, 멜라노좀(melanosome) 내의 티로신(tyrosine)을 산화시켜 DOPA(3,4-dihydroxyphenylalanine)를 만드는 티로신 수산화효소(tyrosine hydroxylase)로 DOPA를 산화시켜 도파크롬(dopachrome)을 만드는 DOPA 옥시다제(oxidase)로 작용하여 최종적으로 멜라닌 폴리머(melanin polymer)를 합성하게 된다. 따라서 피부 미백제의 개발에 있어서 티로시나제(tyrosinase)활성 억제 실험은 유용한 일차 평가법으로 인정되고 있다(Pavel and Muskiet 1980; Prota 1990).Melanin is a major factor in determining the color of skin and hair. It acts to protect skin cells from ultraviolet rays and blocks ultraviolet rays from sunlight. This production of melanin is synthesized in the organelles called melanosomes in the basal layer of melanocytes (Hearing, 1999). The synthesized melanin pigment is transferred to the adjacent keratinocyte through the dendrite of the melanin cell, and the melanin pigment is distributed in various parts of the skin through the keratinocyte (Lowell, 1991). However, abnormal production of melanin causes skin lesions such as vitiligo. On the contrary, when melanin is over-synthesized or pigmented by various environmental factors such as sunshine, hormonal changes, inflammation or medicines, it forms spots and freckles (Lim et al., 2010; Park et al., 1998). These lesions lead to skin cancer. Therefore, in order to prevent such a pigmentation phenomenon and obtain a whitening effect, it is necessary to inhibit a part of the melanin production process to reduce the production of melanin. The most important enzyme involved in melanogenesis is tyrosinase, a tyrosine hydroxylase that oxidizes tyrosine in the melanosome to form 3,4-dihydroxyphenylalanine (DOPA). DOPA is oxidized to form DOPA oxidase, which produces dopachrome. Finally, melanin polymer is synthesized. Thus, inhibition of tyrosinase activity in the development of skin whitening agents has been recognized as a useful first-line assay (Pavel and Muskiet 1980; Prota 1990).

피부노화와 같은 미용과 건강에 관한 관심이 생활수준 향상으로 급증하는 가운데 기능성 화장품을 개발하려는 연구가 활발해지고 있다. 식품의약품안전청의 기능성화장품 고시 품목으로서 주름개선 소재로 대표적으로 사용되는 레티놀(비타민 A), AHA(a-hydroxy acid), 아데노신 등은 콜라겐의 합성을 증가시키고 표피 각화 과정을 정상화시켜 피부재생에 기여하는 물질로 많이 사용되고 있지만 빛과 열에 불안정하고 피부에 자극이 있는 것으로 알려져 있다. 그리고 미백 기능성화장품의 경우 닥나무추출물, 알부틴(arbutin), 에칠아스코빌에텔, 유용성 감초추출물, 아스코빌글루코사이드와 마그네슘아스코빌포스페이트가 있다.Research on the development of functional cosmetics has been actively carried out with interest in beauty and health such as aging of the skin soaring as the level of living improves. Retinol (a vitamin A), a-hydroxy acid (AHA), and adenosine which are typical examples of wrinkle improving materials for the functional cosmetics notices of the KFDA increase the synthesis of collagen and normalize the epidermal keratinization process and contribute to skin regeneration It is widely used as a substance, but it is known to be irritating to light and heat, and irritating to the skin. In the case of whitening functional cosmetics, there are mulberry extract, arbutin, ethyl ascorbic ether, soluble licorice extract, ascorbyl glucoside and magnesium ascorbyl phosphate.

이에 본 발명자들은 상기한 문제점을 해결하고자 천연소재로부터 항노화 효능을 평가 확인하고 이에 따라 피부 안전성이 확보된 새로운 천연 항노화 화장료 조성물을 개발하고자 하였으며, 이에 본 발명을 완성하였다.Accordingly, the inventors of the present invention intend to develop a new natural anti-aging cosmetic composition having an anti-aging effect evaluated from natural materials in order to solve the above-mentioned problems and to secure skin safety.

(0001) 대한민국 공개특허 10-2011-0063269 (2011.06.10)(0001) Korean Patent Publication No. 10-2011-0063269 (June 10, 2011) (0002) 대한민국 공개특허 10-2014-0055049 (2014.05.09)(0002) Korean Patent Laid-Open No. 10-2014-0055049 (April 201, 2014) (0003) 대한민국 공개특허 10-2013-0059640 (2013.06.07)(0003) Korean Patent Publication No. 10-2013-0059640 (June 3, 2013)

본 발명은 항노화 활성이 우수한 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼의 혼합발효추출물 제조방법을 제공하는 것을 목적으로 한다.It is an object of the present invention to provide a method for producing a mixed fermented extract of ginseng cultured ginseng having excellent anti-aging activity, Danseong, Dansam, Gosam, Samam, Mansam and Hyosung.

또한 본 발명은 상기 제조방법에 의해 제조되어 항노화 활성이 우수한 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼의 혼합발효추출물을 함유하는 화장료 조성물을 제공하는 것을 다른 목적으로 한다.It is another object of the present invention to provide a cosmetic composition comprising a mixed ginseng root prepared by the above-described method and having excellent anti-aging activity, and a mixed fermentation extract of Dansei, Dansam, Gosam, Samam, Mansam and Hyosung.

상기 목적을 달성하기 위하여 본 발명에 따르면, (A)누룩, 곡물 및 정제수를 혼합하는 단계; (B)건조된 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 혼합하여 삼베포에 싸서 상기 혼합물에 묻는 단계; (C)35~60℃에서 2~3일간 발효시키는 단계; (D)상기 발효물을 추출하는 단계; 및 (E)상기 추출물을 삼나무 통에 담아 7~10일간 2~8℃에서 숙성하는 단계를 포함하는 혼합발효추출물의 제조방법이 제공된다.To achieve the above object, according to the present invention, there is provided a method for producing a fermented milk, comprising: (A) mixing yeast, grain and purified water; (B) mixing the dried wild ginseng cultivating roots, Dansei ginseng, Danshang, Gosam, Ginseng, Ginseng and Hyangsam in a bag wrapped with the mixture to the mixture; (C) fermenting at 35 to 60 DEG C for 2 to 3 days; (D) extracting the fermentation product; And (E) adding the extract to a cedar vat for aging at 2-8 ° C for 7-10 days.

상기 (A)단계에서 누룩, 곡물 및 정제수의 혼합물은 누룩 1~6중량%, 곡물 30~50중량% 및 정제수 45~65중량%로 이루어지는 것이다. 상기 곡물로는 쌀, 보리 및 밀로 이루어지는 군으로부터 선택되는 적어도 하나의 것이 사용될 수 있으며, 바람직하게는 쌀이 사용된다.In the step (A), the mixture of the koji, the grain and the purified water comprises 1 to 6% by weight of the koji, 30 to 50% by weight of the grain and 45 to 65% by weight of the purified water. As the grain, at least one selected from the group consisting of rice, barley, and wheat may be used, and rice is preferably used.

상기 (B)단계에서, 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼은 건조 중량으로 1 : 1 : 1 : 1 : 1~1.5 : 1~1.5 : 1~1.5의 비율로 혼합되는 것이며, 더욱 바람직하게는 1 : 1 : 1 : 1 : 1 : 1 : 1로 혼합되는 것이다.In step (B), the dried ginseng root, Dansei, Danshang, Gosam, Samam, Mansam and Hyungsam are mixed in a dry weight ratio of 1: 1: 1: 1: 1 to 1.5: 1 to 1.5: 1: 1: 1: 1: 1: 1.

상기 (D)단계에서, 추출은 물, 탄소수 1 내지 4의 무수 또는 함수알코올, 에틸아세테이트, 아세톤, 글리세린, 에틸렌글리콜, 프로필렌글리콜 및 부틸렌글리콜로 이루어지는 군으로부터 선택된 1종 이상의 용매로 추출한 것이다.In the step (D), the extraction is carried out with at least one solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol.

상기 다른 목적을 달성하기 위하여 본 발명에 따르면, 상기 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼의 혼합발효추출물이 화장료 조성물 전체 중량에 대하여 0.001 ~ 10 중량% 포함되는 화장료 조성물이 제공된다.According to another aspect of the present invention, there is provided a cosmetic composition comprising a mixed fermented extract of the wild ginseng root, Danseom, Dansam, Gosam, Samam, Mansam and Hyosung, in an amount of 0.001-10 wt% based on the total weight of the cosmetic composition .

상기 화장료 조성물은 피부주름개선, 피부미백용으로 사용될 수 있다. The cosmetic composition can be used for improving skin wrinkles and skin whitening.

상기 화장료 조성물은 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 또는 아이섀도의 제형으로 이루어질 수 있다.The cosmetic composition may be at least one selected from the group consisting of a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutrition cream, a moisturizing cream, a hand cream, A cleansing cream, a body lotion, a body cleanser, an emulsion, a press powder, a loose powder or an eye shadow.

본 발명에 따른 혼합발효추출물은 DPPH free radical, Superoxide radical, Alkyl radical 및 Hydroxyl radical의 소거능과 콜라겐 생성효과, TIMP-1의 발현, 트로포엘라스틴의 발현 및 MMP-1의 발현 억제 효과가 우수하여 이를 유효성분으로 함유하는 화장료 조성물은 항노화 화장료로 유용하게 사용될 수 있다.The mixed fermented extract according to the present invention is excellent in the scavenging ability and collagen production effect of DPPH free radical, superoxide radical, Alkyl radical and hydroxyl radical, the expression of TIMP-1, the expression of tropoelastin and the suppression of MMP-1 expression, The cosmetic composition containing the component can be usefully used as an anti-aging cosmetic composition.

도 1은 본 발명의 실시예 및 비교예에 따른 추출물들의 Collagen mRNA 유전자 발현에 대한 활성을 나타내는 그래프이다.
도 2는 본 발명의 실시예 및 비교예에 따른 추출물들의 TIMP-1 mRNA 유전자 발현에 대한 활성을 나타내는 그래프이다.
도 3은 본 발명의 실시예 및 비교예에 따른 추출물들의 Tropoelastin mRNA 유전자 발현에 대한 활성을 나타내는 그래프이다.
도 4는 본 발명의 실시예 및 비교예에 따른 추출물들의 MMP-1 mRNA 유전자 발현 억제 효과를 나타내는 그래프이다.
도 5는 본 발명의 실시예 및 비교예에 따른 추출물들의 MITF mRNA 유전자 발현 억제 효과를 나타내는 그래프이다.
도 6은 본 발명의 실시예 및 비교예에 따른 추출물들의 Tyrosinase mRNA 유전자 발현 억제 효과를 나타내는 그래프이다.
FIG. 1 is a graph showing the activities of extracts according to Examples and Comparative Examples of the present invention on Collagen mRNA gene expression.
FIG. 2 is a graph showing the activity of TIMP-1 mRNA gene expressions of extracts according to Examples and Comparative Examples of the present invention.
FIG. 3 is a graph showing the activity of Tropoelastin mRNA gene expression of extracts according to Examples and Comparative Examples of the present invention.
FIG. 4 is a graph showing the effect of inhibiting the MMP-1 mRNA gene expression of the extracts according to Examples and Comparative Examples of the present invention.
FIG. 5 is a graph showing the inhibitory effect of MITF mRNA gene expression on the extracts according to Examples and Comparative Examples of the present invention.
FIG. 6 is a graph showing inhibitory effects of Tyrosinase mRNA gene expression on the extracts according to Examples and Comparative Examples of the present invention.

이하, 본 발명을 더욱 상세히 설명한다.Hereinafter, the present invention will be described in more detail.

본 발명은 항노화 활성을 가지는 생약재인 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 1차적으로 전통주 발효기법에 따라 발효시키고, 다시 2차적으로 삼나무 통에서 저온 숙성시켜 항노화 활성이 우수한 혼합발효추출물을 제조하는 기술에 관한 것이다.The present invention relates to a method of fermenting wild ginseng root, anti-aging active herbaceous ginseng root, Dan-son ginseng, Dansam ginseng, Ginseng ginseng, Manchus ginseng and Hyosung primary fungus according to the traditional fermentation technique and secondary- And to a technique for producing an excellent mixed fermentation extract.

본 발명 혼합발효추출물의 원료인 산삼 배양근은 천연 야생산삼으로부터 조직을 분리하여 세포괴(callus)와 부정근을 단계별로 유도하고, 이들 뿌리 중에서 건실한 것을 선별한 후, 생물반응기를 이용하여 45~60일 가량 배양하여 생산되는 것이다. 이렇게 생산된 산삼 배양근은 야생 산삼과 매우 유사한 성분을 함유하고, 대체로 인삼보다 사포닌 함량이 높고, 인삼에서는 볼 수 없는 다양한 약리 성분을 함유하고 있다(Son et al., 1999).The cultured wild ginseng cultured root of the present invention was obtained by isolating tissues from wild wild ginseng and inducing callus and adventitious roots in stages. After selecting robust roots from these roots, they were cultured in a bioreactor for about 45 to 60 days It is produced by cultivation. The cultured ginseng cultivars contain very similar components to wild ginseng and contain various pharmacological components which are higher in saponin content than ginseng and not found in ginseng (Son et al., 1999).

현삼(Scrophularia burgeriana)은 약재용으로 가꾸기도 하는 여러해살이 풀이다. 네모진 줄기는 곧게 1.5m 안팎의 높이로 자라며 윗부분에서 약간의 가지를 친다. 잎은 계란 꼴로서 마디마다 2장이 마주 자리한다. 잎 끝은 뾰족하고 밑동은 둥글며 잎자루를 가지고 있다. 잎 가장자리에는 날카로운 톱니가 규칙적으로 배열된다. 줄기 끝과 끝에 가까운 부분의 잎 겨드랑이로부터 기다란 꽃대가 자라나 많은 꽃이 피어나는데 꽃차례는 홀쭉한 원뿌리꼴로 생겼다. 꽃은 단지와 같은 외모를 가지고 있으며, 입술과 같은 모양으로 끝이 갈라지고 아래의 입술은 뒤로 말린다. 꽃의 길이는 6~7mm 정도이며 빛깔은 황록색이다. 식물체 전체에 헤스페리딘(Hesperidin)과 디오스민(Diosmin)등의 배당체를 함유한다. 그리고 자음, 해열, 해독, 소종 등의 효능이 있으며, 고열이 있어 가슴이 답답하고 목이 마르는 증세, 고혈압, 편도선염, 임파선염, 혈전증, 결핵성임파선염, 인후염, 기관지염, 토혈, 식은땀을 흘리는 증세 등의 치료에 쓴다. Scrophularia burgeriana is a perennial plant for medicinal purposes. The square stem grows up to about 1.5m in height and strikes a little branch at the top. Leaves are egg-shaped, two per side facing each other. Leaf end is pointed, base is round and has petiole. Sharp teeth are regularly arranged on the edges of the leaves. A long peduncle grows from the leaf axil near the tip and end of the stem, and many flowers bloom. The flower has the appearance just like a lips, the end is split in shape like a lips, and the lower lips are dried back. The length of the flower is about 6 ~ 7mm and the color is yellow-green. The whole plant contains glycosides such as hesperidin (Hesperidin) and diosmin (Diosmin). And it has efficacy such as consonant, fever, detoxification, and exclusion, and symptoms of high fever, chest tightness, thirsty, hypertension, tonsillitis, lymphadenitis, thrombosis, tuberculous lymphadenitis, sore throat, bronchitis, For the treatment of.

단삼(Salvia miltiorrhiza Bunge)은 뿌리줄기(근경)는 짧고 거칠며 끝부분에 보통 줄기 자국이 남아 있다. 뿌리는 긴 원통형으로 여러 개로 갈라져 있으며 바깥 면은 적갈색 또는 어두운 적갈색이고 거칠고 세로 주름이 있다. 오래된 것은 자갈색을 띠며 보통 비늘 모양의 것이 떨어져 나온다. 특이한 향기가 있고, 약성은 쓰고 떫으며 약간 차다. 약리작용은 관상동맥 확장, 콜레스테롤 강하, 혈압 강하, 간기능 활성화, 진정 항염, 항암, 항균작용이 보고되었다.Salvia miltiorrhiza Bunge has short and rough roots (stem) and usually has stem marks at the end. The roots are long cylindrical and are divided into several parts. The outer surface is reddish brown or dark reddish brown, rough and has vertical wrinkles. The old ones are dark brown, usually scaly ones. There is a peculiar smell, weakness is weary and slightly cold. Pharmacological actions have been reported for coronary artery enlargement, cholesterol depression, hypotension, liver function activation, sedative anti-inflammatory, anti-cancer and anti-bacterial effects.

고삼(Sophora flavescens)은 도둑놈의 지팡이·너삼·뱀의 정자나무라고도 한다. 양지 바른 풀밭에서 자란다. 높이 80~100cm로 녹색이지만 어릴 때는 검은빛을 띤다. 줄기는 곧고 잎은 어긋나며 홀수깃꼴 겹잎이다. 작은 잎은 15~40개이고 긴 타원형 또는 긴 달걀 모양이며 길이 2~4cm, 너비 7~15mm이다. 잎자루가 길며 가장자리는 밋밋하다. 한방에서는 뿌리를 말린 것을 고삼이라 하는데, 맛이 쓰고 인삼의 효능이 있어 소화불량렘키延酉간염렸껜玭치질 등에 처방한다. 민간에서는 줄기나 잎을 달여서 살충제로 쓰기도 한다. 같은 속의 식물로 산두근(山豆根)이 있는데 생김새가 매우 비슷하다. 한국, 일본, 중국, 시베리아 등지에 분포한다. Gosam ( Sophora flavescens ) is also known as the sperm of the thistle's rod, nephew, and snake. It grows in a sunny grass. It is 80-100cm high and green, but it is black when it is young. The stem is straight, leaves are alternate, odd numbered compound leaf. Small leaves are 15 ~ 40, long oval or long ovate, 2 ~ 4cm long, 7 ~ 15mm wide. The petiole is long and the edge is flat. In one room, dried roots are called roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted roasted grilled roasted roast In the private sector, it is also used as an insecticide by dying stem or leaf. They are the same plants and have mountain peaks. They look very similar. It is distributed in Korea, Japan, China and Siberia.

사삼(Adenophora triphylla var. japonica Hara)은 생김새는 방추형이나 긴 원추형이며 구부러졌고 간혹 가지뿌리가 있다. 위쪽에 윤상의 가로주름이 있는 뿌리줄기가 있다. 뿌리는 가볍고 꺾어지기 쉬우며 꺾은 면은 유백색을 띠고 빈틈이 많다. 이 약은 특이한 방향이 있고 씹으면 점액성이 있으며, 맛은 조금 달고 성질은 조금 차다. 약리작용으로 거담작용, 항균작용, 용혈작용, 강심작용 등이 보고되었다. 그리고 사삼은 진액을 보충하여 폐를 윤택하게 하고 열을 식히며 담을 없애 인후건조, 마른기침, 가래, 해수, 천식 등에 쓰인다. 위음 부족으로 입안이 마르고 인후가 건조하며 대변이 굳는 변비 증상 등에 사용한다.The ginseng ( Adenophora triphylla var. Japonica Hara) is fusiform, long conical, bent and occasionally with root. There is a rhizome with horizontal wrinkles on top. The roots are light and easy to bend, and the folded side is milky white with many gaps. This medicine has an unusual direction, chewy, mucilaginous, taste a little sweet and a little temperate. The pharmacological effects of gadam work, antimicrobial action, hemolytic action, and cardiac action have been reported. And the ginseng replenishes the essence, soaking the lungs, cooling the heat, getting rid of the wall, drying, drying cough, sputum, seawater and asthma. It is used for symptom of constipation which dry mouth is dry and throat is dry due to shortage of forgery.

만삼(Codonopsis pilosula)은 깊은 산속에서 자란다. 자르면 즙이 나온다. 뿌리는 도라지 모양이며 길이 약 30cm이다. 잎은 어긋나지만 짧은 가지에서는 마주나고, 달걀 모양 또는 달걀 모양 타원형이며 양면에 잔털이 나고 뒷면은 흰색이다. 잎 길이 1~5cm, 너비 1~3.5cm이고 잎자루는 길이 2~3cm로 털이 난다. 뿌리를 당삼(黨蔘) 또는 삼이라고 하며 거담제로 사용하거나 식용한다. Licorice ( Codonopsis pilosula ) grows in deep mountains. The juice comes out when I cut it. The roots are bellflower shaped and about 30 cm long. Leaves are alternate but opposite in short branches, egg-shaped or egg-shaped elliptical, with fine hairs on both sides and white on the back. Leaf length is 1 ~ 5cm, width is 1 ~ 3.5cm and petiole is 2 ~ 3cm long and hairy. Roots are called gangnam (ginseng) or gang, and they are used as expectorants or edible.

단너삼(Hedysarum ussuriensis)은 산지의 바위틈에서 자란다. 높이 40~70cm이며 전체에 흰색의 부드러운 잔털이 있다. 줄기는 총생(叢生)하며, 잎은 6~11쌍의 작은 잎으로 이루어진 홀수 1회 깃꼴 겹잎이다. 작은 잎은 길이 약 1~2 cm로 달걀 모양의 타원형이며 잎 가장자리는 밋밋하다. 한국, 일본, 만주, 중국 북동부, 시베리아 동부 등지에 분포한다. 일반적으로 약초로서 재배하며 한방에서는 가을에 채취하여 노두(蘆頭)와 잔뿌리를 제거하고 햇빛에 말린 것을 한약재의 황기라 하며, 강장, 이뇨(利尿), 소종(消腫)등의 효능이 있다.Danynac ( Hedysarum ussuriensis ) grows in the rocks of the mountain. It is 40 ~ 70cm high and has soft white hairs all over. The stem is a cumulus, and the leaf is an odd numbered iguite leaf of 6-11 pairs of small leaves. The small leaf is about 1 ~ 2 cm long and is egg-shaped elliptical, and leaf edge is flat. It is distributed in Korea, Japan, Manchuria, Northeastern China, and Eastern Siberia. Generally, it is cultivated as a herb. In the oriental medicine, it is collected in the autumn to remove the head and the root, and dried in the sun. It is called Huangji of Chinese medicine, and it has the effects such as tongue, diuretic, and exenteration.

본 발명에서 사용되는 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼은 오프라인 또는 인터넷 마켓에서도 구입할 수 있다. 본 발명에서 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼은 정제수로 깨끗이 세척하여 사용하며, 추출 방법에 따라 건조시켜 세절하거나 가루로 만들어 사용하는 것이 바람직하다. The ginseng cultivated root used in the present invention can be purchased either offline or on the internet market, such as Danseok, Dansam, Gosam, Samam, Mansam and Hyosam. In the present invention, it is preferable that the dried ginseng cultivar, Dansei, Dansam, Gamsam, Samam, Mansam and Hyungsam are cleanly washed with purified water and dried by using an extraction method.

본 발명의 일 구체예에 따르면, 다음과 같은 방법으로 혼합발효추출물을 제조한다.According to one embodiment of the present invention, a mixed fermentation extract is prepared as follows.

먼저, 생약재를 1차 발효시키기 위해, 누룩, 곡물 및 정제수의 혼합물을 제조한다. 누룩, 곡물 및 정제수의 혼합물은 누룩 1~6중량%, 곡물 30~50중량% 및 정제수 45~65중량%로 이루어진다. 상기 곡물로는 쌀, 보리 및 밀로 이루어지는 군으로부터 선택되는 적어도 하나의 것이 사용될 수 있으며, 바람직하게는 쌀이 사용된다.First, in order to primary ferment the herbal medicines, a mixture of yeast, grain and purified water is prepared. The mixture of the koji, the grain and the purified water is composed of 1 to 6% by weight of koji, 30 to 50% by weight of grains and 45 to 65% by weight of purified water. As the grain, at least one selected from the group consisting of rice, barley, and wheat may be used, and rice is preferably used.

세척, 건조 후 세절된 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 삼베포에 싸서 상기 혼합물에 묻어서 발효시킨다. 상기 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼은 건조 중량으로 1:1:1:1:1~1.5:1~1.5:1~1.5의 비율로 혼합되는 것이며, 1:1:1:1:1:1:1로 혼합되는 경우에 가장 우수한 항노화활성을 나타내었다.After washing and drying, the dried ginseng cultivating roots, Dansei, Danshang, Gosam, Samam, Ginseng and Seed ginseng are wrapped in hemp wrap and put into the mixture and fermented. 1: 1 to 1.5: 1 to 1.5: 1 to 1.5 in terms of dry weight, and the ratio of 1: 1: 1: 1: : 1: 1: 1: 1 showed the best anti-aging activity.

상기 생약재 혼합물을 삼베포에 싸서, 상기 누룩 혼합물에 묻어 35~60℃에서 2~3일간 발효시킨다.The mixture of the herbal medicines is wrapped in a bag of bran, and is buried in the yeast mixture to be fermented at 35 to 60 DEG C for 2 to 3 days.

이어 상기 삼베포를 꺼내어 발효된 상기 생약재 혼합물을 용매로 추출하여 추출물을 제조한다. 이때, 물, 탄소수 1 내지 4의 무수 또는 함수알코올, 에틸아세테이트, 아세톤, 글리세린, 에틸렌글리콜, 프로필렌글리콜 및 부틸렌글리콜로 이루어지는 군으로부터 선택되는 적어도 하나의 용매를 사용하여 추출한 것이다. 통상의 추출방법에 따라 추출할 수 있으며, 본 발명의 일 구체예에 따르면, 1~80배 부피량의 물, 30%(V/V) 에탄올을 부가하여 90~95℃에서 2~3시간 중탕시켜 추출할 수 있다.Then, the embryo is taken out and the fermented herbal medicine mixture is extracted with a solvent to prepare an extract. At least one solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol is used. According to one embodiment of the present invention, a 1 to 80 volume volume of water and 30% (V / V) ethanol is added and the mixture is stirred at 90 to 95 ° C for 2 to 3 hours. .

상기 추출물을 그대로 사용하지 않고, 본 발명에서는 2차로 상기 추출물을 삼나무 통에 넣어 저온 숙성시킨다. 삼나무(Cryptomeria japonica)는 일본 원산의 상록교목으로 제주도 지방과 남부지방에 널리 분포되어 있는 수종이다. 현재 삼나무는 내장재, 가구재, 도로용 깔개 등으로 이용되고 있으며 추출성분에 의한 생리활성 연구 등 목재의 부가가치를 높이기 위한 연구도 활발히 진행되고 있다(Kofujita et al., 2001; Matsushita et al., 2006). 삼나무에는 다양한 종류의 테르페노이드(terpenoids)가 함유되어 있으며, 특히 탄소 15개로 이루어진 세스키테르펜(sesquiterpene) 류가 주요성분으로 함유되어 있다. 이들 성분은 그 자체로서 피부사상균에 대한 항진균 활성을 가지는 것으로 알려져 있다. The extract is not used as it is, but in the present invention, the extract is secondarily put into a cedar vat and matured at low temperature. Cryptomeria japonica (Cryptomeria japonica) is an evergreen tree of Japanese origin and widely distributed in Jeju Island and southern region. Cedarwood is currently being used as an interior material, furniture material, road rug, etc. Research is also actively carried out to increase the added value of wood, including physiological activity by extractive ingredients (Kofujita et al., 2001; Matsushita et al., 2006) . Cedar contains a wide variety of terpenoids, especially sesquiterpene, which is composed of 15 carbons. These components themselves are known to have antifungal activity against dermatophytes.

본 발명에서는 상기 생약재 혼합발효추출물의 항노화 활성을 증진시키기 위하여, 삼나무로 이루어진 통에 상기 생약재 혼합발효추출물을 담아 저온에서 숙성시켰다.In order to enhance the anti-aging activity of the herbal medicine mixed fermentation extract, the herbal medicine mixed fermented extract was placed in a container made of cedar and aged at a low temperature.

산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 누룩 발효시킨 추출물을 삼나무 통에 담아 7~10일간 2~8℃의 저온에서 숙성시켰다. 이를 여과 또는 여과 후 감압 농축하여 본 발명의 생약재 혼합발효추출물을 제조할 수 있다.Extracts obtained by fermenting Nanseong cultivated ginseng root, Dansei, Dansam, Gosam, Samam, Mansam and Hyungsam were placed in a cedar barrel and aged at a low temperature of 2 ~ 8 ℃ for 7 ~ 10 days. The mixture can be filtered or filtered, and then concentrated under reduced pressure to prepare a mixed fermented extract of herbal medicines according to the present invention.

삼나무 통에서 2차의 숙성과정을 거침으로써 항노화 활성성분의 추출이 증진되어, 본 발명의 발효추출물은 숙성시키기 않은 발효추출물이나, 일반 도기 항아리에 넣어 숙성시킨 추출물에 비하여 항산화, 콜라겐 생성활성, TIMP-1의 발현, 트로포엘라스틴의 발현 및 MMP-1의 발현 억제 효과가 우수함을 확인하였다. The fermented extract of the present invention has antioxidant activity, collagen production activity, antioxidant activity, antioxidant activity, antioxidant activity, antioxidant activity and antioxidant activity, TIMP-1 expression, tropoelastin expression, and MMP-1 expression.

상기 제조방법에 의하여 제조된 본 발명 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼 혼합발효추출물은 화장료 조성물의 총 중량에 대하여 분말형태 또는 액상형태로 0.001~10 중량%의 양으로 화장료에 첨가될 수 있으며, 바람직하게는 0.01∼5 중량%의 양으로 화장료에 첨가될 수 있다.The fermented extract of the wild ginseng cultivating roots of the present invention produced by the above-described method of the present invention can be used in cosmetics in an amount of 0.001 to 10% by weight in powder or liquid form relative to the total weight of the cosmetic composition And may be added to the cosmetic in an amount of preferably 0.01 to 5% by weight.

본 발명의 화장료 조성물은 그 제형에 있어서 특별히 한정되는 바가 없으며, 예를 들면, 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 또는 아이섀도의 제형으로 이루어질 수 있다.The cosmetic composition of the present invention is not particularly limited in its formulation and examples thereof include a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, , A hand cream, an essence, a pack, a soap, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, an emulsion, a press powder, a loose powder or an eye shadow.

또한, 각 제형의 화장료 조성물에 있어서, 상기의 혼합발효추출물 외에 다른 성분들을 기타 화장료의 제형 또는 사용목적 등에 따라 임의로 선정하여 배합할 수 있다. 예를 들어, 착색제(색소), 착향제(향료), 현탁화제, 유화제, 용해보조제, 안정제, 등장제, pH조절제, 점도조절제, 용제 등을 포함할 수 있다.In addition, in the cosmetic composition of each formulation, components other than the above-mentioned mixed fermentation extract may be arbitrarily selected and formulated according to the formulation or purpose of use of other cosmetics. For example, it may include a coloring agent (coloring matter), a flavoring agent (fragrance), a suspending agent, an emulsifying agent, a solubilizing agent, a stabilizer, an isotonic agent, a pH adjusting agent, a viscosity adjusting agent,

본 발명의 화장료 조성물은 혼합발효추출물 이외에 주름개선에 대한 피부노화 방지 효과를 나타내는 다른 유효 성분을 1가지 이상 포함할 수 있다.
The cosmetic composition of the present invention may contain, in addition to the mixed fermentation extract, one or more other active ingredients exhibiting anti-aging effects against wrinkle improvement.

이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐, 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. It should be noted, however, that the following examples are illustrative of the present invention, and the scope of the present invention is not limited to these examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

[실시예][Example]

실시예 1 : 산삼 배양근 발효추출물 제조Example 1: Preparation of fermented extract of wild ginseng cultured muscle

도기 항아리에 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 산삼 배양근 200g을 혼합하여 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 삼나무 통에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of the ground ginseng cultured muscle was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

실시예 2 : 단너삼 발효추출물Example 2: Fermented soybean extract 제조Produce

도기 항아리에 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 단너삼 200g을 혼합하여 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 삼나무 통에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of pulverized monascus gum was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

실시예 3 : 단삼 발효추출물Example 3: Fermented extract of Dansam 제조Produce

도기 항아리에 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 단삼 200g을 혼합하여 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 삼나무 통에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed ginseng was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

실시예 4 : 고삼 발효추출물Example 4: Fermented extract 제조Produce

도기 항아리에 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 고삼 200g을 혼합하여 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 삼나무 통에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed red ginseng were mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

실시예 5 : 사삼 발효추출물Example 5: Fermented extract of Samams 제조Produce

도기 항아리에 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 사삼 200g을 혼합하여 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 삼나무 통에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed ginseng was mixed and wrapped in a burlap cloth and buried in the koji mixture, followed by fermentation at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

실시예 6 : 만삼 발효추출물Example 6: Extract of fermented manchans 제조Produce

도기 항아리에 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 만삼 200g을 혼합하여 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 삼나무 통에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed manzan were mixed, wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

실시예 7 : 현삼 발효추출물Example 7: Fermented extract of ginseng 제조Produce

도기 항아리에 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 현삼 200g을 혼합하여 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 삼나무 통에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70 g of koji, 700 g of rice, and 1050 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 200 g of crushed ginseng was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

실시예 8 내지 12 : 혼합발효추출물Examples 8 to 12: Mixed fermentation extract 제조Produce

하기 표 1과 같이 중량비율을 달리하여 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼, 현삼을 혼합하여 실시예 7의 방법과 동일한 방법으로 추출물을 제조하였다. 원료만 달리하여 동일하게 실시하였다.
The extracts were prepared in the same manner as in Example 7 by mixing the ginseng root with different weight ratios as shown in Table 1 below, and mixing the ginseng root, Danseom, Dansam, Gosam, Samam, The same operation was performed with different raw materials.

비교예 1 : 삼나무통 숙성과정을 거치지 않은 혼합발효추출물의 제조Comparative Example 1: Preparation of mixed fermented extract without aging process of cedar

도기 항아리에 누룩 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 동일 중량비로 혼합하여 총 200g을 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.
70g of koji leek, 700g of rice, and 1050g of purified water were mixed in a pottery pot to prepare a mixture. After drying, the pulverized ginseng cultured root, Dansei, Dansam, Gam, Samam, Mansam and Hyungsam were mixed at the same weight ratio, and a total of 200 g of the dried ginseng cultivar was wrapped in a ruby wrapper, buried in the koji mixture and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

비교예 2 : 항아리 숙성과정을 거친 혼합발효추출물의 제조Comparative Example 2: Preparation of mixed fermented extracts through a jar fermentation process

도기 항아리에 누룩 누룩 70g, 쌀 700g을 넣고 정제수 1050g을 혼합하여 혼합물을 제조하였다. 건조 후 분쇄된 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 동일 중량비로 혼합하여 총 200g을 삼베보자기에 싸서 상기 누룩 혼합물에 묻고 35℃에서 3일간 발효시켰다. 삼베보자기를 꺼내어 혼합용매로서 정제수 700g, 에탄올 300g을 사용하여 95℃에서 2시간 동안 중탕 추출하였다. 이 후 상기 추출물을 도기 항아리에서 7일간 2~8℃에서 저온 숙성시켰다. 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 추출물을 제조하였다.70g of koji leek, 700g of rice, and 1050g of purified water were mixed in a pottery pot to prepare a mixture. After drying, the pulverized ginseng cultured root, Dansei, Dansam, Gam, Samam, Mansam and Hyungsam were mixed at the same weight ratio, and a total of 200 g of the dried ginseng cultivar was wrapped in a ruby wrapper, buried in the koji mixture and fermented at 35 ° C for 3 days. The samba crepe was taken out and was extracted with hot water at 95 ° C for 2 hours using 700 g of purified water and 300 g of ethanol as a mixed solvent. The extract was then matured at 2-8 [deg.] C for 7 days in a pottery jar. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

성분ingredient 실시예 8Example 8 실시예 9Example 9 실시예 10Example 10 실시예 11Example 11 실시예 12Example 12 산삼 배양근Wild ginseng cultivator 1One 1One 1One 1One 1One 단너삼Dan Sam-sam 1One 1One 1One 1One 1One 단삼Sansam 1One 1One 1One 1One 1One 고삼GoSam 1One 1One 1One 1One 1One 사삼Sasayam -- 1One 1.51.5 1.51.5 -- 만삼Mansam -- 1One 1.51.5 -- 1.51.5 현삼figwort -- 1One -- 1.51.5 1.51.5

혼합발효추출물을 가지고 항노화 효과를 확인 하고자 추출물은 농축 후 동결 건조하였고, Radical 소거능 측정 및 세포 내 효능평가 샘플을 준비하였다. 그리고 DPPH free radical, Superoxide Radical, Alkyl Radical 및 Hydroxyl Radical 소거능과 in vitro에서 콜라게나제(Collagenase), Timp-1, 트로포엘라스틴(Tropoelastin)의 유전자 발현과 MMP-1의 유전자 발현 억제 효과를 확인 하였다.
The extracts were concentrated and lyophilized to confirm the anti - aging effect of the mixed fermented extract. Radical scavenging ability and intracellular efficacy evaluation samples were prepared. In addition, the inhibitory effects of DPPH free radical, Superoxide Radical, Alkyl Radical and Hydroxyl Radical scavenging ability and collagenase, Timp-1 and Tropoelastin gene expression and MMP-1 gene expression in vitro were confirmed.

시험예 1 : DPPH free radical 소거능 측정Test Example 1: Measurement of scavenging activity of DPPH free radical

DPPH free radical 소거능은 Nanjo et al.(1996)의 방법에 따라 측정하였다. 시료 30㎕에 60μM DPPH(1,1-diphenyl-2-picrylhydrazyl) 용액 30㎕를 혼합 후, 반응액을 100㎕ quartz capillary tube에 옮겨 2분 후 electron spin resonance(ESR) spectrometer(JES-FA, JEOL Ltd., Tokyo, Japan)로 측정하였다. 실험조건은 다음과 같다. DPPH free radical scavenging activity was measured by the method of Nanjo et al. (1996). 30 μl of 60 μM DPPH (1,1-diphenyl-2-picrylhydrazyl) solution was added to 30 μl of the sample, and the reaction solution was transferred to a 100 μl quartz capillary tube. Electron spin resonance (ESR) spectrometer (JES- Ltd., Tokyo, Japan). The experimental conditions are as follows.

magnetic field, 336.5±5 mT; power, 5 mW; modulation frequency, 9.41 GHz; amplitude, 1×1,000; sweep time, 30 s; temperature, 298 K. magnetic field, 336.5 ± 5 mT; power, 5 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30 s; temperature, 298 K.

DPPH radical 소거능은 H 와 H0 의 상대적인 radical signal peak 높이의 차에 의하여 계산하였다. 그 결과를 각각 표 2에 나타내었다.
The DPPH radical scavenging activity was calculated by the difference in the relative radical signal peak heights of H and H 0 . The results are shown in Table 2, respectively.

DPPH free radical scavenging activity(%)=(1-H/HDPPH free radical scavenging activity (%) = (1-H / H 00 )×100) × 100

시험예 2 : Superoxide radical 소거능 측정Test Example 2: Superoxide radical scavenging ability measurement

Superoxide radical은 Guo et al.(1999)에 따라 시료 10㎕에 0.3mM riboflavin 10㎕, 1.6mM EDTA 10㎕, 800mM DMPO 10㎕를 첨가 후 365nm의 UV lamp에서 1분 동안 조사하였다. 반응물을 quartz capillary tube에 옮긴 후, ESR spectrometer를 이용하여 분석하였으며 실험조건은 다음과 같다.Superoxide radicals were irradiated with 10 μl of 0.3 mM riboflavin, 10 μl of 1.6 mM EDTA and 10 μl of 800 mM DMPO in 10 μl of a sample according to Guo et al. (1999), and then irradiated with UV lamp at 365 nm for 1 minute. The reaction was transferred to a quartz capillary tube and analyzed using an ESR spectrometer. The experimental conditions were as follows.

magnetic field, 336.5±5 mT; power, 10 mW; modulation frequency, 9.41 GHz; amplitude, 1×1,000; sweep time, 30 s; temperature 298 K. magnetic field, 336.5 ± 5 mT; power, 10 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30 s; temperature 298 K.

Superoxide radical 소거능은 H과 H0 의 상대적인 peak를 이용하는 수식에 의해 계산되었다. 그 결과를 각각 표 2에 나타내었다.
Superoxide radical scavenging activity was calculated by the equation using the relative peaks of H and H 0 . The results are shown in Table 2, respectively.

Superoxide radical scavenging activity(%)=(1-H/HSuperoxide radical scavenging activity (%) = (1-H / H 00 )×100) × 100

시험예 3 : Alkyl radical 소거능 측정Test Example 3: Measurement of Alkyl radical scavenging ability

10㎕의 시료에 각각 10㎕의 PBS(Phosphate buffered saline), 40mM AAPH (2,2-azobis-(2-amidinopropane)-dihydrochloride), 40mM POBN α-(4-pyridyl-1- oxide)-N-tert-butylnitrone을 첨가한다. 그리고 37℃에서 30분간 반응시킨 후 quartz capillary tube에 옮겨 ESR spectrometer를 이용하여 측정하였다. 실험조건은 다음과 같다.10 μl of each sample was supplemented with 10 μl of PBS (Phosphate buffered saline), 40 mM AAPH (2,2-azobis- (2-amidinopropane) -dihydrochloride), 40 mM POBN α- (4-pyridyl- Add tert-butylnitrone. After incubation at 37 ° C for 30 min, the cells were transferred to a quartz capillary tube and measured using an ESR spectrometer. The experimental conditions are as follows.

magnetic field, 336.5±5 mT; power, 10 mW; modulation frequency, 9.41 GHz; amplitude, 1×1,000; sweep time, 1 min; temperature 298 K. magnetic field, 336.5 ± 5 mT; power, 10 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 1 min; temperature 298 K.

Alkyl radical 소거능은 아래의 식으로 계산 하였다. 그 결과를 각각 표 2에 나타내었다.
Alkyl radical scavenging activity was calculated by the following equation. The results are shown in Table 2, respectively.

Alkyl radical scavenging activity(%)=(1-H/HAlkyl radical scavenging activity (%) = (1-H / H 00 )×100) × 100

시험예 4 : Hydroxyl radical 소거능 측정Test Example 4: Measurement of scavenging ability of hydroxyl radical

Hydroxyl radical 소거능은 Rosen et al. (1984)의 방법으로 분석하였다. 시료 20㎕에 0.3M DMPO 20㎕, 10mM FeSO4 20㎕, 10mM H2O2 20㎕을 혼합한 다음 quartz capillary tube에 옮긴 후 2.5분 후에 ESR spectrometer로 측정하였다. 실험조건은 다음과 같다.Hydroxyl radical scavenging activity was measured by Rosen et al. (1984). 20 μl of 0.3 M DMPO, 20 μl of 10 mM FeSO 4 and 20 μl of 10 mM H 2 O 2 were added to a 20 μl sample, and then transferred to a quartz capillary tube. After 2.5 minutes, the sample was measured by ESR spectrometer. The experimental conditions are as follows.

magnetic field, 336.5±5 mT; power, 1 mW; modulation frequency, 9.41 GHz; amplitude, 1×200; sweep time, 4 min; temperature 298 K. magnetic field, 336.5 ± 5 mT; power, 1 mW; modulation frequency, 9.41 GHz; amplitude, 1 × 200; sweep time, 4 min; temperature 298 K.

Hydroxy radical 소거능 은 H 과 H0 의 상대적인 높이에 의해 측정하는 다음 수식에 의해 계산되었다. 그 결과를 각각 표 2에 나타내었다.
Hydroxy radical scavenging activity was calculated by the following equation, measured by the relative heights of H and H 0 . The results are shown in Table 2, respectively.

Hydroxyl radical scavenging activity(%)=(1-H/HHydroxyl radical scavenging activity (%) = (1-H / H 00 )×100) × 100

구분division Radical scavenging activity (%) at concentration 2.5㎎/㎖.Radical scavenging activity (%) at concentration 2.5 mg / ml. DPPHDPPH HydroxylHydroxyl AlkylAlkyl SuperoxideSuperoxide 실시예 1Example 1 56.82 ± 0.9156.82 ± 0.91 59.65 ± 1.2259.65 ± 1.22 47.18 ± 0.8647.18 ± 0.86 50.01 ± 0.9850.01 + - 0.98 실시예 2Example 2 49.27 ± 1.2649.27 ± 1.26 52.17 ± 1.0352.17 ± 1.03 41.22 ± 1.0341.22 ± 1.03 46.18 ± 0.9646.18 ± 0.96 실시예 3Example 3 52.63 ± 1.0152.63 + - 1.01 56.96 ± 0.8356.96 ± 0.83 52.99 ± 0.5452.99 + - 0.54 49.09 ± 1.1149.09 ± 1.11 실시예 4Example 4 47.42 ± 1.1847.42 ± 1.18 50.25 ± 0.7950.25 + - 0.79 42.89 ± 0.8242.89 + - 0.82 45.81 ± 1.0945.81 ± 1.09 실시예 5Example 5 52.14 ± 0.7052.14 + - 0.70 59.71 ± 0.5159.71 ± 0.51 46.47 ± 1.1646.47 ± 1.16 5.045 ± 0.515.045 ± 0.51 실시예 6Example 6 48.65 ± 0.4648.65 + - 0.46 55.23 ± 1.0355.23 + - 1.03 42.83 ± 0.3342.83 + - 0.33 45.99 ± 0.9645.99 ± 0.96 실시예 7Example 7 46.49 ± 1.1046.49 ± 1.10 50.96 ± 0.4350.96 + - 0.43 40.09 ± 0.5440.09 + - 0.54 43.32 ± 0.9143.32 ± 0.91 실시예 8Example 8 56.65 ± 0.4656.65 + - 0.46 60.23 ± 1.0360.23 + - 1.03 49.83 ± 0.3349.83 + - 0.33 51.99 ± 0.9651.99 ± 0.96 실시예 9Example 9 70.68 ± 0.3470.68 + - 0.34 77.97 ± 0.5177.97 + - 0.51 65.58 ± 0.7465.58 + - 0.74 68.12 ± 1.0768.12 ± 1.07 실시예 10Example 10 67.68 ± 0.6167.68 + - 0.61 71.97 ± 1.2171.97 ± 1.21 61.58 ± 0.9761.58 ± 0.97 63.12 ± 0.6763.12 + - 0.67 실시예 11Example 11 64.25 ± 1.0064.25 ± 1.00 68.38 ± 1.1168.38 ± 1.11 55.28 ± 0.9155.28 + - 0.91 59.25 ± 0.5159.25 + - 0.51 실시예 12Example 12 61.68 ± 0.6161.68 + - 0.61 65.97 ± 1.2165.97 ± 1.21 52.58 ± 0.7452.58 + - 0.74 58.12 ± 0.6758.12 + - 0.67 비교예 1Comparative Example 1 53.47 ± 1.0853.47 ± 1.08 58.52 ± 0.9158.52 + - 0.91 48.15 ± 1.1848.15 ± 1.18 50.08 ± 1.2750.08 + - 1.27 비교예 2Comparative Example 2 57.85 ± 1.0857.85 ± 1.08 61.10 ± 0.8561.10 ± 0.85 50.21 ± 1.1650.21 + - 1.16 52.98 ± 1.0352.98 + - 1.03

상기 표 2에서 확인되는 바와 같이 라디칼 소거능 효과에 있어서, 누룩발효 후 삼나무통에서 2차 숙성시킨 본 발명 실시예 9의 혼합발효추출물이 다른 발효추출물, 즉 생약재 각각의 발효추출물이나, 생약재를 혼합 발효 후 숙성시키지 않은 발효추출물이나, 생약재 혼합 발효 후 도기 항아리에서 숙성시킨 발효추출물 보다 우수한 결과를 확인할 수 있었다. 이를 통해 삼나무 통에서의 저온 숙성과정을 통하여 각 생약재로부터의 활성성분 추출이 증진되어 항노화 활성이 현저히 상승하였음을 알 수 있다.
As shown in the above Table 2, in the radical scavenging effect, the mixed fermentation extract of Example 9 of the present invention in which the fermentation of koji was second-aged in the cedar barrel after the fermentation of koji showed the fermentation extract of each fermented extract, The fermented extracts which were not aged after the fermentation and the fermented extracts which were aged in the pottery jar after the mixed fermentation of the herbal medicines were found to be superior. The results showed that the active ingredient extraction from each herbal medicine was enhanced through the low - temperature aging process in the cedar barrel, and the anti - aging activity was remarkably increased.

시험예 5 : 세포독성 시험Test Example 5: Cytotoxicity test

세포 배양Cell culture

추출물들의 항노화에 작용하는 유전자 발현을 확인하기 위하여 콜라게나제(Collagenase)와 TIMP-1는 HaCaT(Human keratinocyte cell line)에서, MMP-1와 트로포엘라스틴(Tropoelastin)은 CCD-986Sk(Human fibroblast cell line)에서, 미백에 작용하는 유전자 발현을 확인하기 위하여 티로시나제(Tyrosinase)와 MITF는 B16F10 melanoma cells을 사용하였다. HaCaT, CCD-986Sk 및 B16F10 melanoma 세포는 10%(v/v) FBS(fetal bovine serum, Gibco, USA), 100U/mL의 streptomycin, 100U/mL의 penicillin 항생제(Gibco, USA)가 포함된 DMEM(Dulbeco? modified eagle? medium, Gibco, USA)배지를 사용하여 5% CO2 및 37℃ 조건의 인큐베이터에서 배양하였다.
Collagenase and TIMP-1 were detected in HaCaT (human keratinocyte cell line), MMP-1 and tropoelastin were detected in CCD-986Sk (Human fibroblast cell line), tyrosinase and MITF were used for B16F10 melanoma cells in order to confirm gene expression in whitening. HaCaT, CCD-986Sk and B16F10 melanoma cells were cultured in DMEM containing 10% v / v FBS (fetal bovine serum, Gibco, USA), streptomycin at 100 U / mL, penicillin antibiotics at 100 U / Dulbecco? Modified eagle? Medium, Gibco, USA) in an incubator at 5% CO 2 and 37 ° C.

세포 생존율 측정 실험(MTT assay)Cell viability assay (MTT assay)

MTT assay법은 MTT[3-(4,5-dimethythiasol-2-yl)-2,5-diphenyl tetrazolium bromide] 시약이 세포 내로 흡수된 후 미토콘드리아의 숙신산 탈수소효소(succinate dehydrogenase)에 의해 포마잔(formazan)을 형성하는데 이 물질의 세포 내 축적은 미토콘드리아의 활성, 넓게는 세포의 활성을 의미하는 것으로써 세포의 생존율을 측정하는 대표적인 방법이다.MTT assays were performed by succinate dehydrogenase of mitochondria after MTT [3- (4,5-dimethythiasol-2-yl) -2,5-diphenyl tetrazolium bromide] ). The accumulation of this substance in the cell represents the activity of mitochondria, broadly, the activity of the cell, which is a typical method for measuring the survival rate of cells.

각각의 HaCaT, CCD-986Sk 및 B16F10 melanoma 세포를 1×105cell/well의 밀도로 96 well에 200㎕ 배지와 함께 분주한 뒤 5% CO2, 37℃ incubator에서 24시간 배양한 후 배지를 버리고 PBS로 씻어준 다음, 같은 양의 배지와 PBS에 녹인 시료를 0.1%에서 5.0%까지 다양한 농도에 따라 각 well에 처리하여 24시간 배양하였다. 배양이 끝나기 4시간 전에 PBS에 녹인 5㎎/㎖ MTT를 20㎕씩 각 well에 첨가하고 알루미늄 호일로 차광시킨 후 3간 동안 5% CO2 및 37℃ 조건의 incubator에서 배양하였다. 배양액을 제거하고 DMSO용액 200㎕를 첨가하여 37℃ incubator에서 1시간 반응 시킨 후 ELISA reader를 이용하여 570nm에서 흡광도를 측정하여 비교하였다. 세포 생존율은 하기 식에 의해 산출되었고, 그 결과는 하기 표 3에 나타내었다.
Each HaCaT, CCD-986Sk, and B16F10 melanoma cells were seeded at a density of 1 × 10 5 cells / well in 96-wells with 200 μl of the medium, cultured in a 5% CO 2 incubator at 37 ° C. for 24 hours, After washing with PBS, the same amount of the medium and the sample dissolved in PBS were cultured in each well at various concentrations ranging from 0.1% to 5.0% and cultured for 24 hours. Four hours before the end of incubation, 20 μl of 5 mg / ml MTT dissolved in PBS was added to each well, shaded with aluminum foil, and incubated for 3 h in an incubator at 5% CO 2 and 37 ° C. After removing the culture medium, 200 μl of DMSO solution was added, incubated at 37 ° C for 1 hour, and absorbance was measured at 570 nm using an ELISA reader. The cell survival rate was calculated by the following equation, and the results are shown in Table 3 below.

세포생존율(%)=시료첨가군의 O.D at 570㎚/시료무첨가군의 O.D at 570㎚×100Cell survival rate (%) = O.D at 570 nm in the sample addition group / O.D at 570 nm × 100 in the sample addition group

구분division 세포 생존율(%)Cell survival rate (%) 0.1 %0.1% 0.5 %0.5% 1 %One % 5.0 %5.0% 실시예 8Example 8 100100 100100 100100 101101 실시예 9Example 9 101101 100100 101101 100100 실시예 10Example 10 100100 100100 100100 100100 실시예 11Example 11 100100 100100 101101 100100 실시예 12Example 12 101101 101101 101101 100100 비교예 1Comparative Example 1 100100 100100 100100 100100 비교예 2Comparative Example 2 101101 101101 101101 101101 대조군
Adenosine
Control group
Adenosine
100100 101 101 100 100 100100
대조군
Arbutin
Control group
Arbutin
101101 100100 100100 101101

상기 표 3에서 확인되는 바와 같이 상기 실시예, 비교예 그리고 대조군 Adenosine(아데노신) Arbutin(알부틴) 모두 세포독성을 나타내지 않았다.
As shown in the above Table 3, none of the examples, the comparative examples, and the control group Adenosine (adenosine) Arbutin (arbutin) showed cytotoxicity.

시험예 6 : 세포내 Collagenase, Timp-1 및 Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현 억제 효과.Test Example 6: Gene expression of Collagenase, Timp-1 and Tropoelastin in cells and inhibitory effect on gene expression of MMP-1.

HaCaT와 CCD-986Sk 세포는 세포의 수를 5×105cells/㎖로 조제한 후에 페트리디쉬에 처리하여 24시간 동안 5% CO2 및 37℃의 조건에서 배양하였다. 세포가 페트리디쉬에서 80% 이상 자란 다음, 추출물을 세포 생존율 100% 이상으로 나타난 농도로 첨가하였다.HaCaT and CCD-986Sk cells were cultured in Petri dishes at 5% CO 2 and 37 ° C for 24 hours after the number of cells was adjusted to 5 × 10 5 cells / ml. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

Free radical 소거능이 가장 우수한 것으로 확인된 혼합발효추출물 실시예 8, 9, 10, 11, 12와 비교예 1, 2 추출물을 처리한 후 DMED/10 FBS에서 24시간 동안 5% CO2 및 37℃의 조건에서 배양하였다. 24시간 후 세포에서 RNA 분리, cDNA 합성 및 RT-PCR은 Komoroski 등(Drug Metab. Dispos. 32:512-518, 2004)이 기술한 방법에 따라 수행하였다. RT-PCR에서 측정한 유전자는 COL1A1, TIMP-1 및 Tropoelastin의 발현과 MMP-1의 발현 억제를 확인하였다. 유전자 발현의 차이를 확인하기 위해 house keeping gene으로 GAPDH을 사용하였다.Mixed fermentation extracts, which were found to have the best free radical scavenging ability, were treated with DMED / 10 FBS for 24 hours at 5% CO 2 and 37 ° C for 24 hours after treating the extracts of Examples 8, 9, 10, 11, Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.

각각의 유전자의 프라이머 서열은 표 4에 나타냈다. 추출된 RNA를 주형으로 올리고 dT-어댑터 프라이머(Oligo dT-adaptor primer)와 DEPC water를 이용하여 총량 15㎕로 하고 70℃ 5분 변성후, M-MLV(Moloney murine leukemia virus) RNA의 역전사를 수행하여 42℃ 60분, 94℃ 5분 cDNA를 합성하였다. 합성된 cDNA는 PCR 반응을 통해 증폭하였으며, 총 반응액은 25㎕로 하였다. 각 반응물의 최종 농도는 프라이머 100pmol, 1.0μM, dNTP 혼합액 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5mM, MgCl2(PCR완충액) 및 GoTaq DNA 폴리머라제 1.25units이었다. 변성(Denaturation), 어닐링(annealing) 및 익스텐션(extension)에 대한 PCR 반응 조건은 다음과 같으며, 95℃ 2분, 95℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 5분, 30~40 사이클로 수행하였다. PCR 반응 후 생성물의 10㎕를 2% 아가로즈 겔(agarose gel)에서 전기영동 하였다. Gel Documentation system(코리아랩텍, Cat. No DGS-200D)을 이용하여 발현양을 확인 했다.The primer sequences of the respective genes are shown in Table 4. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to carry out reverse transcription of M-MLV (Moloney murine leukemia virus) CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction, and the total reaction solution was 25 μl. The final concentration of each reagent was 100 pmol of the primer, 1.0 μM, 0.2 mM of the dNTP mixture, 1 × 1.5 or 5 × green or colorless GoTaq Reaction buffer, MgCl 2 (PCR buffer) and 1.25 units of GoTaq DNA polymerase. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

프라이머 이름Name of the primer 염기서열Base sequence GAPDHGAPDH Froward : GGCATTGCTCTCAATGACAAFroward: GGCATTGCTCTCAATGACAA Reverse : TGTGAGGGAGATGCTCAGTGReverse: TGTGAGGGAGATGCTCAGTG COL1A1COL1A1 Forward : AGCCAGCAGATCGAGAACAT Forward: AGCCAGCAGATCGAGAACAT Reverse : TCTTGTCCTTGGGGTTCTTG Reverse: TCTTGTCCTTGGGGTTCTTG TIMP-1TIMP-1 Forward : TGCTGGGTGGTAACTCTTTATTTCAForward: TGCTGGGTGGTAACTCTTTATTTCA Reverse : ATCCTGTTGTTGCTGTGGCTGATAGReverse: ATCCTGTTGTTGCTGTGGCTGATAG TropoelastinTropoelastin Forward : AAAGCAGCAGCAAAGTTCGGForward: AAAGCAGCAGCAAAGTTCGG Reverse : ACCTGGGACAACTGGAATCCReverse: ACCTGGGACAACTGGAATCC MMP-1MMP-1 Forward : AAGGTTAGCTTACTGTCACACGCTT Forward: AAGGTTAGCTTACTGTCACACGCTT Reverse : CGACTCTAGAAACACAAGAGCAAGA Reverse: CGACTCTAGAAACACAAGAGCAAGA

그 결과는 각각 도 1 내지 4에 나타내었다.The results are shown in FIGS. 1 to 4, respectively.

PT-PCR 수행 후 관찰결과, 본 발명 실시예 9의 혼합발효추출물은 다른 혼합발효추출물 보다 collagen 및 TIMP-1의 발현을 증가시켰다. 도 4에서 확인되는 바와 같이 실시예 9의 혼합발효추출물이 다른 혼합발효추출물 보다 MMP-1의 발현 억제 효과가 우수 했다. 대조군인 아데노신(Adenosine)과 비교했을 때 우수한 결과를 확인할 수 있었다. As a result of observation after PT-PCR, the mixed fermented extract of Example 9 of the present invention increased the expression of collagen and TIMP-1 more than other mixed fermented extracts. As shown in FIG. 4, the mixed fermentation extract of Example 9 was superior to other mixed fermentation extracts in inhibiting the expression of MMP-1. Compared with the control group, adenosine (Adenosine), excellent results were obtained.

또한 트로포엘라스틴(Tropoelastin)은 피부 탄력을 나타내는 탄력 섬유 중심의 엘라스틴을 형성하고 있는 인자로 도 3에서 확인되는 바와 같이 본 발명 실시예 9의 혼합발효추출물은 5%에서 대조군 Adenosine 5%보다도 우수한 결과를 나타내었다.
In addition, Tropoelastin is a factor that forms elastic fiber center elastic fiber showing skin elasticity. As shown in FIG. 3, the mixed fermented extract of Example 9 has an excellent result than 5% of control adenosine 5% Respectively.

시험예 7 : 세포 내 Tyrosinase 및 MITF의 유전자 발현 억제 효과 Test Example 7: Inhibitory effect of intracellular Tyrosinase and MITF on gene expression

B16F10 melanoma 세포는 세포의 수를 5×105cells/㎖로 조제한 후에 페트리디쉬에 처리하여 24시간 동안 5% CO2 및 37℃의 조건에서 배양하였다. 세포가 페트리디쉬에서 80% 이상 자란 다음, 추출물을 세포 생존율 100% 이상으로 나타난 농도로 첨가하였다. B16F10 melanoma cells were treated with 5 × 10 5 cells / ㎖ of cells and cultured in Petri dishes at 5% CO 2 and 37 ° C for 24 hours. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

미백에 대한 효과를 알아보고자 혼합발효추출물 실시예 8, 9, 10, 11, 12와 비교예 1, 2 추출물을 처리한 후 DMED/10 FBS에서 24시간 동안 5% CO2 및 37℃의 조건에서 배양하였다. 24시간 후 세포에서 RNA 분리, cDNA 합성 및 RT-PCR은 Komoroski 등(Drug Metab. Dispos. 32:512-518, 2004)이 기술한 방법에 따라 수행하였다. RT-PCR에서 측정한 유전자는 Tyrosinase 및 MITF를 선택하여 발현을 확인하였다. 유전자 발현의 차이를 확인하기 위해 house keeping gene으로 GAPDH을 사용 하였다.To investigate the effect of the mixed fermentation extracts on the whitening, the extracts were treated with DMED / 10 FBS for 24 hours at 5% CO 2 and 37 ° C after treating the extracts of Examples 8, 9, 10, 11 and 12 and Comparative Examples 1 and 2 Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). Tyrosinase and MITF were selected for RT-PCR. GAPDH was used as a house keeping gene to identify differences in gene expression.

각각의 유전자의 프라이머 서열은 표 5에 나타냈다. 추출된 RNA를 주형으로 올리고 dT-어댑터 프라이머(Oligo dT-adaptor primer)와 DEPC water를 이용하여 총량 15㎕로 하고 70℃ 5분 변성후, Moloney murine leukemia virus(M-MLV) RNA의 역전사를 수행하여 42℃ 60분, 94℃ 5분 cDNA를 합성하였다. 합성된 cDNA는 PCR 반응을 통해 증폭하였으며, 총 반응액은 25μL로 하였다. 각 반응물의 최종 농도는 프라이머 100pmol, 1.0μM, dNTP 혼합액 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5 mM, MgCl2(PCR완충액) 및 GoTaq DNA 폴리머라제 1.25units이었다. 변성(Denaturation), 어닐링(annealing) 및 익스텐션(extension)에 대한 PCR 반응 조건은 다음과 같으며, 95℃ 2분, 95℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 5분, 30~40 사이클로 수행하였다. PCR 반응 후 생성물의 10㎕를 2% 아가로즈 겔(agarose gel)에서 전기영동 하였다. Gel Documentation system(코리아랩텍, Cat. No DGS-200D)을 이용하여 발현양을 확인했다.The primer sequences of the respective genes are shown in Table 5. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to perform reverse transcription of Moloney murine leukemia virus (M-MLV) RNA CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction and the total reaction volume was 25 μL. The final concentration of each reagent is a primer 100pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5 mM, MgCl 2 (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

프라이머 이름Name of the primer 염기서열Base sequence GAPDHGAPDH Froward : GGCATTGCTCTCAATGACAAFroward: GGCATTGCTCTCAATGACAA Reverse : TGTGAGGGAGATGCTCAGTGReverse: TGTGAGGGAGATGCTCAGTG MITFMITF Forward : AACCGACAGAAGAAGCTGGAForward: AACCGACAGAAGAAGCTGGA Reverse : ACAAGTTCCTGGCTGCAGTTReverse: ACAAGTTCCTGGCTGCAGTT TyrosinaseTyrosinase Forward : TTATGCGATGGAACACCTGA Forward: TTATGCGATGGAACACCTGA Reverse : ACTGGCAAATCCTTCCAGTGReverse: ACTGGCAAATCCTTCCAGTG

그 결과는 도 5 및 도 6에 나타내었다.The results are shown in Fig. 5 and Fig.

PT-PCR 수행 후 관찰 결과, 본 발명 실시예 9의 혼합발효추출물은 다른 혼합발효추출물 보다 Tyrosinase 및 MITF의 mRNA 유전자 발현 억제 효과가 우수하게 나타났다. 따라서, 본 발명 혼합발효추출물은 다른 발효추출물 보다 미백 효과가 우수한 것을 확인할 수 있었다.
As a result of observation after PT-PCR, the mixed fermented extract of Example 9 of the present invention showed superior inhibitory effect on tyrosinase and MITF mRNA gene expression than other mixed fermented extracts. Therefore, it was confirmed that the mixed fermentation extract of the present invention had better whitening effect than other fermented extracts.

제형 실시예 1 : 스킨로션의 제조Formulation Example 1: Preparation of skin lotion

하기 표 6의 조성에 따라, 하기의 방법으로 혼합발효추출물(실시예 9)을 함유한 스킨로션 1kg을 제조하였다.1 kg of a skin lotion containing a mixed fermented extract (Example 9) was prepared according to the following composition according to the following Table 6.

번호number 원 료Raw material 함량(중량%)Content (% by weight) 1One 혼합발효추출물(실시예 9)Mixed fermented extract (Example 9) 1.01.0 22 글리세린glycerin 3.03.0 33 부틸렌글리콜Butylene glycol 2.02.0 44 프로필렌글리콜Propylene glycol 2.02.0 55 폴리옥시에칠렌 경화피마자유Polyoxyethylene hardened castor oil 1.01.0 66 에탄올ethanol 10.010.0 77 트리에탄올아민Triethanolamine 0.10.1 88 방부제antiseptic 미량a very small amount 99 색소Pigment 미량a very small amount 1010 향료Spices 미량a very small amount 1111 정제수Purified water 잔량Balance

상기 표 6에서 11번 물질에 2, 3, 4, 8번 물질을 순서대로 반응용기에 투입하고 교반하여 용해시킨 후, 5번 물질을 60℃ 정도로 가열하여 용해시켰다. 이 후, 10번 물질을 투입하여 용해한 후 11번 물질에 투입하였다. 마지막으로 1, 6, 7, 9번 물질을 투입하여 충분히 교반시킨 뒤 25℃에서 3일간 숙성시켜 표제의 스킨로션을 제조하였다.
In Table 6, substances No. 2, No. 3, No. 4 and No. 8 were sequentially added to the No. 11 material, and the materials were stirred and melted. Then, the No. 5 material was dissolved by heating to about 60 ° C. Subsequently, the substance 10 was added to the substance 11 after dissolution. Finally, the ingredients 1, 6, 7, and 9 were added, stirred sufficiently, and aged at 25 ° C for 3 days to prepare a skin lotion of the title.

제형 실시예 2 : 영양로션의 제조Formulation Example 2: Preparation of nutrition lotion

하기 표 7의 조성에 따라, 하기의 방법으로 혼합발효추출물(실시예 9)을 함유한 하이드로좀 영양로션 1kg을 제조하였다.According to the composition shown in the following Table 7, 1 kg of hydrosome nutrition lotion containing mixed fermented extract (Example 9) was prepared by the following method.

번호number 원 료Raw material 함량(중량%)Content (% by weight) 1One 혼합발효추출물(실시예 9)Mixed fermented extract (Example 9) 1.01.0 22 밀납Wax 1.01.0 33 폴리솔베이트 60Polysorbate 60 1.51.5 44 솔비탄 세스퀴올레이트Sorbitan sesquioleate 0.50.5 55 유동 파라핀Liquid paraffin 10.010.0 66 소르비탄 스테아레이트Sorbitan stearate 1.01.0 77 친유형 모노스테아린산 글리세린Pro-type glycerin monostearate 0.50.5 88 스테아린산Stearic acid 1.51.5 99 글리세릴스테아레이트/피이지-400 스테아레이트Glyceryl stearate / FG-400 stearate 1.01.0 1010 프로필렌글리콜Propylene glycol 3.03.0 1111 카르복시폴리머Carboxy polymer 0.10.1 1212 트리에탄올아민Triethanolamine 0.20.2 1313 방부제antiseptic 미량a very small amount 1414 색소Pigment 미량a very small amount 1515 향료Spices 미량a very small amount 1616 정제수Purified water 잔량Balance

상기 표 7에서 10, 11, 13, 16번 물질을 혼합 교반하면서, 80~85 ℃ 사이로 가열하여 제조부에 투입한 후 유화기를 작용시키고 2, 3, 4, 5, 6, 7, 8, 9, 12번 물질을 80~85℃사이로 가열 용해한 후 유화시켰다. 유화가 끝나면 교반기를 이용하여 교반하면서 50℃까지 냉각한 뒤 15번 물질을 투입하고 45℃까지 냉각한 뒤 14번 물질을 투입하고 35℃에서 1번 물질을 투입하여 25℃까지 냉각한 뒤 25℃에서 3일간 숙성시켜 표제의 영양로션을 제조하였다.
In Table 7, the materials 10, 11, 13, and 16 were heated to 80 to 85 ° C while mixing and stirring. , The substance No. 12 was dissolved by heating at a temperature of 80 to 85 ° C, followed by emulsification. After the emulsification is completed, the mixture is cooled to 50 ° C with stirring using an agitator, and then the substance 15 is added. After cooling to 45 ° C, the substance 14 is added and the substance 1 is added at 35 ° C. For 3 days to prepare the nutritional lotion of the title.

지금까지 본 발명에 대해서 상세히 설명하였으나, 그 과정에서 언급한 실시예는 예시적인 것일 뿐이며, 한정적인 것이 아님을 분명히 하고, 본 발명은 이하의 특허청구범위에 의해 제공되는 본 발명의 기술적 사상이나 분야를 벗어나지 않는 범위내에서, 균등하게 대처될 수 있는 정도의 구성요소 변경은 본 발명의 범위에 속한다 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, It is within the scope of the present invention that component changes to such an extent that they can be coped evenly within a range that does not deviate from the scope of the present invention.

Claims (7)

(A)누룩, 곡물 및 정제수를 혼합하는 단계;
(B)건조된 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼을 혼합하여 삼베포에 싸서 상기 혼합물에 묻는 단계;
(C)35~60℃에서 2~3일간 발효시키는 단계;
(D)상기 발효물을 추출하는 단계; 및
(E)상기 추출물을 삼나무 통에 담아 7~10일간 2~8℃에서 숙성하는 단계를 포함하는 혼합발효추출물의 제조방법.
(A) mixing yeast, grain and purified water;
(B) mixing the dried wild ginseng cultivating roots, Dansei ginseng, Danshang, Gosam, Ginseng, Ginseng and Hyangsam in a bag wrapped with the mixture to the mixture;
(C) fermenting at 35 to 60 DEG C for 2 to 3 days;
(D) extracting the fermentation product; And
(E) adding the extract to a cedar barrel and aging the fermented extract at 2-8 [deg.] C for 7-10 days.
제1항에 있어서, (A)단계에서 누룩, 곡물 및 정제수의 혼합물은 누룩 1~6중량%, 곡물 30~50중량% 및 정제수 45~65중량%로 이루어지는 것임을 특징으로 하는 혼합발효추출물의 제조방법.The method according to claim 1, wherein in step (A), the mixture of the koji, the grain and the purified water comprises 1 to 6% by weight of the koji, 30 to 50% by weight of the grain and 45 to 65% by weight of the purified water. Way. 제1항에 있어서, (B)단계에서, 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼은 건조 중량으로 1:1:1:1:1~1.5:1~1.5:1~1.5의 비율로 혼합되는 것임을 특징으로 하는 혼합발효추출물의 제조방법.The method according to claim 1, wherein, in step (B), the dried ginseng root, Dansei, Dansam, Gosam, Samam, By weight based on the total weight of the fermented extract. 제1항에 있어서, (D)단계에서, 추출은 물, 탄소수 1 내지 4의 무수 또는 함수알코올, 에틸아세테이트, 아세톤, 글리세린, 에틸렌글리콜, 프로필렌글리콜 및 부틸렌글리콜로 이루어지는 군으로부터 선택되는 적어도 하나의 용매를 사용하여 이루어지는 것임을 특징으로 하는 혼합발효추출물의 제조방법.The method according to claim 1, wherein, in step (D), the extraction is carried out in the presence of water, at least one selected from the group consisting of water, anhydrous or hydroalcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol Of the total weight of the mixed fermentation extract. 제1항 내지 제4항 중 어느 한 항에 의하여 제조되는 산삼 배양근, 단너삼, 단삼, 고삼, 사삼, 만삼 및 현삼 혼합발효추출물이 화장료 조성물 전체 중량에 대하여 0.001~10 중량% 함유되는 화장료 조성물.The cosmetic composition according to any one of claims 1 to 4, wherein the fermented extract of mixed ginseng root, Danseom, Dansam, Gosam, Samam, Mansam and Hyungsam is contained in an amount of 0.001-10 wt% based on the total weight of the cosmetic composition. 제5항에 있어서, 상기 화장료 조성물은 피부주름 및 탄력개선용임을 특징으로 하는 화장료 조성물.The cosmetic composition according to claim 5, wherein the cosmetic composition is used for improving skin wrinkles and elasticity. 제5항에 있어서, 상기 화장료 조성물은 피부미백용임을 특징으로 하는 화장료 조성물.The cosmetic composition according to claim 5, wherein the cosmetic composition is for skin whitening.
KR1020150037726A 2015-03-18 2015-03-18 Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin KR101525873B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150037726A KR101525873B1 (en) 2015-03-18 2015-03-18 Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150037726A KR101525873B1 (en) 2015-03-18 2015-03-18 Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin

Publications (1)

Publication Number Publication Date
KR101525873B1 true KR101525873B1 (en) 2015-06-04

Family

ID=53499603

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150037726A KR101525873B1 (en) 2015-03-18 2015-03-18 Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin

Country Status (1)

Country Link
KR (1) KR101525873B1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105943414A (en) * 2015-03-09 2016-09-21 韩国化妆品制造株式会社 Cosmetic composition comprising oil of cultured root of wild ginseng, method for preparing same and makeup method using same
KR101713486B1 (en) * 2016-05-27 2017-03-07 (주)토니모리 Cosmetic composition containing fermented extracts of Kigelia Africana Fruit, Canavalia Gladiata Pod and Corn Cob
KR101773456B1 (en) * 2017-03-08 2017-08-31 주식회사 더마랩 Method for preparing complex fermented extract of crude drugs and cosmetic composition comprising the same
KR20190101067A (en) * 2018-02-22 2019-08-30 안동과학대학교 산학협력단 A cosmetic composition containing fermented broussonetia kazinoki siebold and setaria italica and the method thereof
KR102219382B1 (en) 2020-12-02 2021-02-22 얼라이드 탑 (홍콩) 인더스트리얼 리미티드 Cosmetic composition containing fermented natural plant extracts complex
KR102505332B1 (en) * 2022-09-19 2023-03-06 아이큐어 주식회사 Cosmetic composition containing extracts of Sophora flavescens, Salvia miltiorrhiza, Scrophularia buergeriana and Acanthopanax Senticosus

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090081810A (en) * 2008-01-25 2009-07-29 코스맥스 주식회사 Cosmetic composition containing herb extracts
KR20120010699A (en) * 2010-07-27 2012-02-06 닥터후 주식회사 Composition for preventing hair loss or promoting hair growth comprising an extract of fermented ginseng
KR20130027822A (en) * 2011-09-08 2013-03-18 경희대학교 산학협력단 A enzyme having activities of transforming saponin in ginseng isolated from culture of aspergillus niger, a method of manufacturing the same, a ginseng extract treated with the same, a method of manufacturing the ginseng extract and composition comprising the ginseng extract for improving skin beauty
KR20130052242A (en) * 2011-11-11 2013-05-22 (주)아모레퍼시픽 Composition comprising salted and fermented ginseng extract

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090081810A (en) * 2008-01-25 2009-07-29 코스맥스 주식회사 Cosmetic composition containing herb extracts
KR20120010699A (en) * 2010-07-27 2012-02-06 닥터후 주식회사 Composition for preventing hair loss or promoting hair growth comprising an extract of fermented ginseng
KR20130027822A (en) * 2011-09-08 2013-03-18 경희대학교 산학협력단 A enzyme having activities of transforming saponin in ginseng isolated from culture of aspergillus niger, a method of manufacturing the same, a ginseng extract treated with the same, a method of manufacturing the ginseng extract and composition comprising the ginseng extract for improving skin beauty
KR20130052242A (en) * 2011-11-11 2013-05-22 (주)아모레퍼시픽 Composition comprising salted and fermented ginseng extract

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105943414A (en) * 2015-03-09 2016-09-21 韩国化妆品制造株式会社 Cosmetic composition comprising oil of cultured root of wild ginseng, method for preparing same and makeup method using same
KR101713486B1 (en) * 2016-05-27 2017-03-07 (주)토니모리 Cosmetic composition containing fermented extracts of Kigelia Africana Fruit, Canavalia Gladiata Pod and Corn Cob
KR101773456B1 (en) * 2017-03-08 2017-08-31 주식회사 더마랩 Method for preparing complex fermented extract of crude drugs and cosmetic composition comprising the same
KR20190101067A (en) * 2018-02-22 2019-08-30 안동과학대학교 산학협력단 A cosmetic composition containing fermented broussonetia kazinoki siebold and setaria italica and the method thereof
KR102021322B1 (en) * 2018-02-22 2019-09-16 안동과학대학교 산학협력단 A cosmetic composition containing fermented broussonetia kazinoki siebold and setaria italica and the method thereof
KR102219382B1 (en) 2020-12-02 2021-02-22 얼라이드 탑 (홍콩) 인더스트리얼 리미티드 Cosmetic composition containing fermented natural plant extracts complex
KR102505332B1 (en) * 2022-09-19 2023-03-06 아이큐어 주식회사 Cosmetic composition containing extracts of Sophora flavescens, Salvia miltiorrhiza, Scrophularia buergeriana and Acanthopanax Senticosus

Similar Documents

Publication Publication Date Title
KR101525873B1 (en) Cosmetic composition containing Manufacturing method and Cultured wild Ginseng Roots, Hedysarum ussuriensis, Sophora flavescens and Adenophora triphylla by two-stage fermentation for improving skin
KR101773456B1 (en) Method for preparing complex fermented extract of crude drugs and cosmetic composition comprising the same
KR20150139688A (en) The Extract Of The Citrus grandis Osbeck Having Skin Whitening Activity And Cosmetic Composition Containing The Same
KR101738075B1 (en) Cosmetic composition containing extracts of Anemarrhena Asphodeloides, Salvia officinalis and Tagetes Erecta
KR101541289B1 (en) Cosmetic composition containing sea horse, Eckloma cava and Gelidium amansii LAMOUROUX Extracts for anti-aging
KR101769755B1 (en) A leuconostoc mesenteroides gfc 160704, cosmetic composition including the leuconostoc mesenteroides gfc 160704 or its culture fluid, and manufacturing method of the cosmetic composition
KR102004322B1 (en) Cosmetic composition containing botanical extract complex
KR102348419B1 (en) Cosmetic composition containing ferment complex extracts of Pyrus Malu, Fragaria Ananassa and Sambucus Nigra
KR101819060B1 (en) Cosmetic Compositions Containing Fermented Extracts of Hwangryunhaedoktang
KR20170137465A (en) Composition for improving skin condition comprising herb extracts mixture
KR20230109193A (en) Whitening cosmetic composition containing mixed extract peony, locust tree, blue lotus, saffron, cornflower using Lactobaciilus brevis
CN113631227B (en) Anti-aging agent, antioxidant, anti-inflammatory agent, whitening agent, and cosmetic
KR101772494B1 (en) COMPOSITION OF SKIN WHITENING CONTAINING EXTRACT OF Sargassum horneri AND METHOD OF MAKING THE SAME
KR20170136919A (en) Composition for improving skin condition comprising herb extracts mixture
KR102462080B1 (en) Cosmetic compositions containing fermented extracts of herb mixture
KR20170137412A (en) Composition for improving skin condition comprising herb extracts mixture
KR102014312B1 (en) Skin-whitening functional composition including polyopes affinis extracts
KR100883773B1 (en) Cosmetic compositions comprising fermenting extracts of citrus junos fruit or poncirus trifoliata fruit with salt
KR102646545B1 (en) Cosmetic composition for skin whitening or skin barrier improvement comprising Hosta longipes extract
KR102168533B1 (en) Cosmetic composition for whitening or improving the facial color containing herb extracts
KR101710005B1 (en) Cosmetic composition comprising cheonjeongpalgindan as active ingredient
KR101713486B1 (en) Cosmetic composition containing fermented extracts of Kigelia Africana Fruit, Canavalia Gladiata Pod and Corn Cob
KR102149223B1 (en) Cosmetic composition for skin whitening containing the fermented complex natural extracts
KR20120118946A (en) Skin whitening complex containing trihydroxyisoflavone and glycyrrhiza uralensis extracts
KR20170137405A (en) Composition for improving skin condition comprising herb extracts mixture

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180424

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20190107

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20200107

Year of fee payment: 6