KR101541289B1 - Cosmetic composition containing sea horse, Eckloma cava and Gelidium amansii LAMOUROUX Extracts for anti-aging - Google Patents

Abstract

The present invention relates to an anti-aging cosmetic composition comprising extracts of sea horse, Eckloma cava, and Gelidium amansii. According to the present invention, regarding a mixed extract having excellent effects in inhibiting expression of collagen and TIMP-1, expression of tropoelastin, and expression of MMP-1, a cosmetic composition comprising the extracts as an active ingredient can be effectively used as an anti-aging cosmetic material.

Description

(Cosmetic composition containing sea horse, Eckloma cava and Gelidium amansii LAMOUROUX Extracts for anti-aging)

The invention hippocampus (Hippocampus coronatus ), mite ( Eckloma cava and Gelidium amansii The present invention relates to a cosmetic composition containing an extract of LAMOUROUX, and more particularly to an anti-aging cosmetic composition containing a mixed extract of hippopotamus, guttae, and / or mugwort, and exhibiting excellent anti-aging activity.

Recently, oxidative metabolic byproducts (ROS) by reactive oxygen species (ROS) such as hydroxyl radical (OH), superoxide anion (O ₂ ^- ) and hydrogen peroxide (H ₂ O ₂ ) This is an important cause (Comporti 1993). These ROS peroxidize cell membrane lipids and cause changes in cell membrane permeability, leading to DNA damage and aging (Meneghini et al., 1993). And aging of human skin occurs with decreasing number of fibroblasts as age gets older. The activation of various signaling systems by ultraviolet rays, climate, smoking, etc., leads to inflammation and damage to skin components, leading to skin aging (Parrado et al., 1999). The skin damaged by ultraviolet rays has a reduced amount of collagen because of the increased expression of matrix metalloproteinase (MMPs) in the skin by ultraviolet rays, and these MMPs play an important role in the development of skin photoaging (Fisher et al. , 1999). MMPs are secreted from the cells of the skin (keratinocytes, fibroblasts) to break down the connective tissue that maintains skin elasticity by decomposing most of the protein components constituting the extracellular matrix (ECM) and the basement membrane (BM) (Wang et al., 1999), which causes wrinkles, decreased elasticity, and skin sagging. Recently, it has been reported that the cell signaling pathway associated with aging-related increases in MMPs is mainly involved in the MAP kinase pathway (Hearing VJ 1999), MAP kinase pathway The AP-1 (activator protein-1) factor, which is most affected by the MAP kinase pathway, regulates the expression of many genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs (Fisher et al. , 1996). MMPs are metalloproteinases with zinc at the active center and secreted in the form of zymogen in vivo. In order to have enzymatic activity, structural modification occurs and amino terminal region is cleaved and activated, and α2-acroglobulin Activity is regulated by inhibitors such as tissue inhibitors of metalloproteinase (TIMPs) (Fisher et al., 1999). In recent research, it has been reported that elastin, an elastic fiber in addition to collagen in wrinkle formation, and elastase, an enzyme involved in elastin degradation, are undergoing research (Antonicelli et al., 2007; Isenburg et al., 2004; Seite et al., 2006). In particular, it has been reported that the expression of tropoelastin mRNA, an elastin precursor, is also increased in keratinocytes of human skin epidermis by chronic UV irradiation (Seo et al., 2001), suppression of selective elastase activity (Tsuji et al., 2001). It has also been reported that elastase plays a role in the formation of wrinkles.

Melanin is a major factor in determining the color of skin and hair. It acts to protect skin cells from ultraviolet rays and blocks ultraviolet rays from sunlight. This production of melanin is synthesized in the organelles called melanosomes in the basal layer of melanocytes (Hearing, 1999). The synthesized melanin pigment is transferred to the adjacent keratinocyte through the dendrite of the melanin cell, and the melanin pigment is distributed in various parts of the skin through the keratinocyte (Lowell, 1991). However, abnormal production of melanin causes skin lesions such as vitiligo. On the contrary, when melanin is over-synthesized or pigmented by various environmental factors such as sunshine, hormonal changes, inflammation or medicines, it forms spots and freckles (Lim et al., 2010; Park et al., 1998). These lesions lead to skin cancer. Therefore, in order to prevent such a pigmentation phenomenon and obtain a whitening effect, it is necessary to inhibit a part of the melanin production process to reduce the production of melanin. The most important enzyme involved in melanogenesis is tyrosinase, a tyrosine hydroxylase that oxidizes tyrosine in melanosomes to form 3,4-dihydroxyphenylalanine (DOPA). DOPA (DOPA) oxidase which oxidizes and oxidizes to form a dopachrome. Finally, melanin polymer is synthesized. Thus, inhibition of tyrosinase activity in the development of skin whitening agents has been recognized as a useful first-line assay (Pavel and Muskiet 1980; Prota 1990).

Inflammation is a vital reaction caused by wound, infection, or autoimmune mechanism. When inflammation occurs, immune cells penetrate into inflammation site. These cells produce and release various kinds of chemical substances and cytokines, (Park et al., 2010). Macrophages are known to be involved in various host responses such as acquired immunity as well as innate immunity, and they are known to be involved in homeostasis. Nitric oxide (NO) and cytokine are produced during inflammatory reaction and play an important role in biological defense in the early stage of infection. In the field of inflammation, these substances are also called inflammation mediators because they cause inflammation in the biological defense process by these substances. Lipolysaccaharide (LPS), which is known as endotoxin, is present in the extracellular membrane of Gram-negative bacteria. Tumor Necrosis Factor-α (TNF-α), Interleukin-6 (IL-6), Interleukin -1β (IL-1β), which are known to increase pro-inflammatory cytokines. In addition, the formation of these inflammatory mediators leads to the process of converting arachidonic acid into prostaglandin and NO formation due to the activity of phospholipase A2. Excess inflammatory factors such as NO and prostaglandin E2 (PGE2) are formed by inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX-2) in the body inflammation process. Although normal NO formation plays an important role in killing bacteria or eliminating tumors, NO produced by iNOS in the inflammatory state not only promotes inflammatory responses such as vascular permeability and swelling but also stimulates inflammation mediator biosynthesis, (Yoon et al., 2007).

Research on the development of functional cosmetics has been actively carried out with interest in beauty and health such as aging of the skin as the level of living improves rapidly. As a functional cosmetics notification item of the Korea Food & Drug Administration, in case of whitening functional cosmetics, extracts of mulberry, arbutin, , Ethyl ascorbyl ether, useful licorice extract, ascorbyl glucoside and magnesium ascorbyl phosphate. Retinol (a vitamin A), a-hydroxy acid (AHA), and adenosine, which are typical examples of wrinkle improving materials, are used as materials contributing to skin regeneration by increasing the synthesis of collagen and normalizing the epidermal keratinization process. It is known to be unstable to heat and irritating to the skin.

Accordingly, the inventors of the present invention intend to develop a new natural anti-aging cosmetic composition having an anti-aging effect evaluated from natural materials in order to solve the above-mentioned problems and to secure skin safety.

Korean Patent Publication No. 2012-0058720 (2012.06.08) Korean Patent Publication No. 2009-0043656 (2009.05.07)

The object of the present invention is to provide a cosmetic composition containing hippocampus, horsetail, and mugwort extract and having excellent anti-aging effect.

According to the present invention, there is provided an anti-aging cosmetic composition comprising, as an active ingredient, a mixed extract comprising horsetail extract, at least one extract selected from the group consisting of menthol and mugwort.

The hippopotamus, hippocampus and mugwort extract are extracted with at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethanol, propylene glycol and butylene glycol .

Preferably, the mixed extract has a weight ratio of 1: 1: 1 of hippocampus, horsetail, and mugwort.

The mixed extract is preferably contained in an amount of 0.001 to 10% by weight based on the total weight of the cosmetic composition.

The cosmetic composition may be at least one selected from the group consisting of a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutritive cream, a moisturizing cream, a hand cream, Lotions, cleansing creams, body lotions, body cleansers, emulsions, press powders, loose powders or eye shadows.

 According to the present invention, the cosmetic composition containing horseradish, horsetail, and mugwort mixed extract has excellent scavenging ability, wrinkle improvement, whitening and anti-inflammatory activity of DPPH free radical, superoxide radical, Alkyl radical and hydroxyl radical, Can be usefully used.

FIG. 1 is a graph showing the effect of hippocampal, hippocampus and mugwort extracts on Collagen mRNA gene expression according to an embodiment of the present invention.
FIG. 2 is a graph showing the effect of hippocampus, hippopotamus, and mugwort extract on TIMP-1 mRNA gene expression according to an embodiment of the present invention.
FIG. 3 is a graph showing the effect of hippocampal, horsetail, and mugwort extract on the expression of Tropoelastin mRNA gene according to an embodiment of the present invention.
FIG. 4 is a graph showing the inhibitory effect of hippocampal, horsetail, and mugwort extracts on MMP-1 mRNA gene expression according to an embodiment of the present invention.
FIG. 5 is a graph showing the effect of suppressing the MITF mRNA gene expression of hippocampus, horsetail, and mugwort extract according to an embodiment of the present invention.
FIG. 6 is a graph showing the inhibitory effect of tyrosinase mRNA gene expression of hippocampus, horsetail, and mugwort extract according to an embodiment of the present invention.
FIG. 7 is a graph showing the inhibitory effect of TNF-α mRNA gene expression on hippocampus, hippocampus and mugwort extract according to an embodiment of the present invention.
FIG. 8 is a graph showing the inhibitory effect of hippocampal, hippocampal and mugwort extracts on IL-1? MRNA gene expression according to an embodiment of the present invention.
FIG. 9 is a graph showing the inhibitory effect of the hippocampus, hippocampus and mugwort extract of the present invention on iNOS mRNA gene expression.

Hereinafter, the present invention will be described in more detail.

The present invention relates to an anti-aging cosmetic composition containing horseradish, horsetail, and mugwort mixed extract as an active ingredient.

The sea horse, which is a raw material of the extract contained in the cosmetic composition according to the present invention, has a body length of 15 to 30 cm and the body light is brown. There are 54 species in the world. The body is covered with a corrugated sheet, and the head is similar to a horse head. The mouth is shaped like a tube and sucks in small animals. The tail is long and flexible, allowing you to wrap other objects. Young hippocampus often tails together to build a small herd. It has a large ball and can stay at a constant depth of water and swim slowly using dorsal and pectoral fins. The pectoral fin is attached to both sides of the head and looks like a pair of ears. Males have granulocysts and eggs are hatched by females. It is distributed in the Korean coastal waters and all over Japan. It is also used as a fire extinguishing agent in oriental medicine.

Eckloma cava grows deep in the lunch band. The length is 1 ~ 2m. The stem is cylindrical and the base is roots. It is thick when it is thick, and it is hollow when it is young, but it is hollow when it is full. At the end of the stem, there is a flat leaf with a side leaf. This leaf is 1m long and is brown but becomes black when dried. It is thick and swollen (leather-like texture), with small leaf-like leaves on both sides. Young plants appear in spring. In the first year, stem length is 5 ~ 10cm, diameter is about 5mm, and rosette leaf is 20 ~ 30cm and butterfly is about 4cm. In the autumn of the second year, the spores made on the roots of leaves are released, and the leaves fall off. It is distributed in Korea (South coast, Jeju Island) and Japan.

Gelidium amansii LAMOUROUX) is a gametophyte (gametophyte) is separate and sexually produced spore (spore). The spores germinate and become the apical distribution itself (quasi-sporophyte), and it repeats the generation alternation that germinates and becomes the gameto again and again. It is a perennial and lives throughout the year, but after the breeding season of summer, the upper part of the body melts away and only the lower part remains, and the bud again grows in the next spring. It is distributed in the East Sea, South Sea and Yellow Sea outbreaks, but the southern coast of the East Sea is the most produced with the highest quality. It is attached to a rock at a depth of 20-30m deep in the vicinity of the low tide (low tide line: low tide). It lives in a place where the sea water is well communicated, facing the outer sea and sandy bottom. .

The hippocampus, hippocampus, and hippocampus used in the present invention can be purchased offline or on the internet market.

In the production of hippocampus, hippopotamus and mugwort extract of the present invention, hippocampus, hippopotamus, and mugwort are preferably washed with purified water, and dried and pulverized or powdered according to an extraction method. In the present invention, the extraction solvent may be water, anhydrous or hydroalcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethanol, propylene glycol, butylene glycol and mixed solvents thereof (for example, Mixing or mixing with two or more solvents) is most preferable for extracting the active ingredient.

The hippopotamus, hippocampus and mugwort extract of the present invention can be produced by a known extraction method known to a person skilled in the art.

According to one embodiment of the present invention, the hippopotamus, mackerel and mugwort extract are prepared by finely pulverizing the dried product, and adding 1 to 80 times the volume of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin , At least one extraction solvent selected from the group consisting of ethanol, propylene glycol, butylene glycol butylen glycol and propylene glycol was added and the mixture was stirred at 95 ° C for 2 hours to extract an active ingredient. The extraction solvent was concentrated with a vacuum concentrator .

The horseradish, horsetail, and mugwort mixed extracts of the present invention are prepared by mixing and then extracting each of the extracts, mixing the raw materials, and extracting them. The extract of the present invention may be a concentrate obtained by concentrating an extract obtained by extracting with an extraction solvent, a lyophilized concentrate or a powder obtained by spray drying and concentrating the concentrate.

In the present invention, the mixed extracts exhibited the best anti-aging activity in the case of the mixed extracts obtained by mixing hippopotamus, matsutake and mugwort, at a ratio of 1: 1: 1.

In the cosmetic composition of the present invention, the mixed extract of hippopotamus, hippopotamus and mugwort can be added to the cosmetic in an amount of 0.001 to 10% by weight in powder or liquid form relative to the total weight of the cosmetic composition, To the cosmetic in an amount of 0.01 to 5% by weight in powder form or liquid form.

The extracts of DPPH free radical scavenging activity (Test Example 1), Superoxide radical scavenging activity (Test Example 2) and Alkyl radical scavenging activity (Test Example 3 ) And the scavenging ability of hydroxyl radical (Test Example 4), and showed skin wrinkle improving effect (Test Example 6), skin whitening effect (Test Example 7) and anti-inflammatory effect (Test Example 8).

The cosmetic composition of the present invention is not particularly limited in its formulation and examples thereof include a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, A body lotion, a body cleanser, an emulsion, a press powder, a loose powder, or an eye shadow.

In addition, in the cosmetic composition of each formulation, components other than the hippopotamus, hippocampus and mugwort extract can be arbitrarily selected and formulated according to the formulation or purpose of use of other cosmetics. For example, it may include a coloring agent (coloring matter), a flavoring agent (fragrance), a suspending agent, an emulsifying agent, a solubilizing agent, a stabilizer, an isotonic agent, a pH adjusting agent, a viscosity adjusting agent,

The cosmetic composition of the present invention may contain one or more active ingredients other than hippopotamus, matsutake mushroom and mugwort extract, which exhibit anti-aging effect against wrinkle improvement.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

[Example]

Example  1: Preparation of sea horse extract

After drying, the crushed hippocampus ( Hippocampus abdominalis ), 700 g of purified water and 300 g of ethanol were used as a mixed solvent, and they were extracted with hot water at 95 ° C for 2 hours. Thereafter, the mixture was filtered through a 300-mesh filter paper, and the filtrate was subjected to filtration twice using Edbentech No. 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example  2: Moth extract  Produce

700 g of purified water and 300 g of ethanol were used as a mixed solvent in 100.0 g of the crushed gum after drying, and they were extracted with hot water at 95 캜 for 2 hours. Thereafter, the mixture was filtered through a 300-mesh filter paper, and the filtrate was subjected to filtration twice using Edbentech No. 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example  3: Preparation of Extract of Mugwort

After drying, 700.0 g of purified water and 300 g of ethanol were used as a mixed solvent in 100.0 g of the ground bean curd refuse, and they were extracted with hot water at 95 캜 for 2 hours. Thereafter, the mixture was filtered through a 300-mesh filter paper, and the filtrate was subjected to filtration twice using Edbentech No. 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example  4 to 7: Preparation of mixed extract

The components were mixed at the weight ratios shown in Table 1 below and the extracts were prepared in the same manner as in Example 3.

ingredient Example 4 Example 5 Example 6 Example 7 hippocampus One One - One Moth One - One One Mugwort - One One One

The extracts were concentrated and lyophilized in order to examine anti - aging, whitening and anti - inflammatory effects with hippopotamus, mung bean, and mugwort extract. Radical scavenging ability and intracellular efficacy evaluation samples were prepared. In addition, we confirmed the inhibitory effect of collagenase, Timp-1, and Tropoelastin gene expression and MMP-1 gene expression in vitro in DPPH free radical, Superoxide Radical, Alkyl Radical and Hydroxyl Radical scavenging ability. In order to confirm the whitening effect, the inhibitory effect of tyrosinase and MITF gene expression was confirmed in vitro , and the inhibitory effect of TNF-α, IL-1α and iNOS gene expression was confirmed in order to further confirm the anti-inflammatory effect.

Test Example  One : DPPH  free radical Scatters  Measure

DPPH free radical scavenging activity was measured by the method of Nanjo et al. (1996). 30 μl of 60 μM DPPH (1,1-diphenyl-2-picrylhydrazyl) solution was added to 30 μl of sample, and the reaction solution was transferred to a 100 μl quartz capillary tube. Electron spin resonance (ESR) spectrometer (JES-FA ., Tokyo, Japan). The experimental conditions were as follows: magnetic field, 336.5 ± 5 mT; power, 5 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30s; temperature, 298K. The DPPH radical scavenging activity was calculated by the difference in the relative radical signal peak heights of H and H ₀ . The results are shown in Table 2, respectively.

Test Example  2 : Superoxide  radical Scatters  Measure

Superoxide radicals were prepared by adding 10 μl of 0.3 mM riboflavin, 10 μl of 1.6 mM EDTA and 10 μl of 800 mM DMPO to 10 μl of the sample according to Guo et al. (1999), and then irradiated with UV lamp at 365 nm for 1 minute. The reaction was transferred to a quartz capillary tube and analyzed using an ESR spectrometer. The experimental conditions were as follows: magnetic field, 336.5 ± 5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30s; temperature 298K. Superoxide radical scavenging activity was calculated by the equation using the relative peaks of H and H ₀ . The results are shown in Table 2, respectively.

Test Example  3: Alkyl radical Scatters  Measure

10 μl of each sample was supplemented with 10 μl of PBS (Phosphate buffered saline), 40 mM AAPH (2,2-azobis- (2-amidinopropane) -dihydrochloride), 40 mM POBN α- (4-pyridyl- Add tert-butylnitrone. After incubation at 37 ° C for 30 min, the cells were transferred to a quartz capillary tube and measured using an ESR spectrometer. The experimental conditions were as follows: magnetic field, 336.5 ± 5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1000; sweep time, 1 min; temperature 298K. Alkyl radical scavenging activity was calculated by the following equation. The results are shown in Table 2, respectively.

Test Example  4: Hydroxyl radical Scatters  Measure

Hydroxyl radical scavenging activity was measured by Rosen et al. (1984). 20 μl of 0.3 M DMPO, 20 μl of 10 mM FeSO _{4 and} 20 μl of 10 mM H ₂ O ₂ were added to a 20 μl sample, and then transferred to a quartz capillary tube. After 2.5 minutes, the sample was measured by ESR spectrometer. The experimental conditions were as follows: magnetic field, 336.5 ± 5 mT; power, 1mW; modulation frequency, 9.41 GHz; amplitude, 1 × 200; sweep time, 4 min; temperature 298K. Hydroxy radical scavenging activity was calculated by the following equation, measured by the relative heights of H and H ₀ : The results are shown in Table 2, respectively.

division Radical scavenging activity (%) at concentration 2.5 mg / ml. DPPH Hydroxyl Alkyl Superoxide Example 1 57.14 ± 1.20 63.73 + - 0.81 52.45 + - 0.98 47.47 ± 0.68 Example 2 55.66 ± 1.04 61.82 ± 1.03 50.32 + - 1.28 45.25 ± 1.28 Example 3 52.79 + - 0.98 57.65 ± 0.35 43.47 ± 0.92 39.98 1.51 Example 4 62.68 ± 1.34 67.97 + 0.21 56.12 ± 1.17 48.52 + -0.94 Example 5 64.52 + - 0.68 69.41 + - 0.35 61.65 ± 1.22 58.41 + - 1.16 Example 6 60.24 + - 1.18 64.19 + - 0.88 57.49 + - 0.67 53.79 + - 0.74 Example 7 70.68 + - 0.34 77.97 + 1.21 68.12 ± 0.77 65.56 + - 0.94

Test Example  5: Cytotoxicity test

Cell culture

Collagenase and TIMP-1 were detected in HaCaT (Human keratinocyte cell line), and MMP-1 and Tropoelastin were detected in CCD- In 986Sk (human fibroblast cell line), tyrosinase and MITF were used for B16F10 melanoma cells to confirm gene expression in whitening. In addition, HaCaT Cell was used to investigate the anti-inflammatory effects of TNF-α, IL-1α and iNOS. HaCaT, CCD-986Sk and B16F10 melanoma cells were cultured in DMEM containing 10% v / v FBS (fetal bovine serum, Gibco, USA), streptomycin at 100 U / mL, penicillin antibiotics at 100 U / Dulbeco's modified eagle's medium, Gibco, USA). The cells were cultured in an incubator at 5% CO ₂ and 37 ° C.

Cell viability measurement experiment MTT  assay)

MTT assays were performed by using MTT [3- (4,5-dimethythiasol-2-yl) -2,5-diphenyl tetrazolium bromide] reagent in the cells and then by succinate dehydrogenase of mitochondria formazan). The intracellular accumulation of this substance indicates the activity of mitochondria, and broadly, the activity of the cell, which is a typical method for measuring cell viability.

Each HaCaT, CCD-986Sk, and B16F10 melanoma cells were seeded at a density of 1 × 10 ⁵ cells / well in 96-wells with 200 μl of the medium, cultured in a 5% CO ₂ incubator at 37 ° C. for 24 hours, After washing with PBS, the same amount of the medium and the sample dissolved in PBS were cultured in each well at various concentrations ranging from 0.1% to 5.0% for 24 hours. Four hours before the end of incubation, 20 μl of 5 mg / ml MTT dissolved in PBS was added to each well, shaded with aluminum foil, and cultured in an incubator with 5% CO ₂ and 37 ° C for 3 hours. After removing the culture medium, 200 μl of DMSO solution was added, incubated at 37 ° C for 1 hour, and absorbance was measured at 570 nm using an ELISA reader. The cell survival rate was calculated by the following equation, and the results are shown in Table 3 below.

division Cell survival rate (%) 0.1% 0.5% One % 5.0% Example 1 101 101 100 101 Example 2 100 101 100 100 Example 3 101 100 101 100 Example 4 101 100 100 100 Example 5 101 101 101 100 Example 6 100 100 101 101 Example 7 100 100 100 100 Control group
Adenosine 100 100 101 101 Control group
Arbutin 101 101 100 100

As shown in Table 3 above, Examples 1 to 11 and control adenosine and arbutin did not show cytotoxicity.

Test Example  6: Intracellular Collagenase , Timp -1 and Tropoelastin  Inhibitory effect of gene expression and gene expression of MMP-1

HaCaT and CCD-986Sk cells were cultured in Petri dishes at 5% CO ₂ and 37 ° C for 24 hours after the number of cells was adjusted to 5 × 10 ⁵ cells / ml. Cells were grown in Petri dishes at least 80%, and then the extract was added at a concentration that was above 100% cell viability.

The extracts of Examples 1 to 7 were treated and then cultured in DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C. After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.

The primer sequences of the respective genes are shown in Table 4. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to carry out reverse transcription of M-MLV (Moloney murine leukemia virus) CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction, and the total reaction solution was 25 μl. The final concentration of each reagent is a primer 100 pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq 1x1.5mM Reaction buffer, MgCl ₂ (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Name of the primer Base sequence GAPDH Froward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG COL1A1 Forward: AGCCAGCAGATCGAGAACAT Reverse: TCTTGTCCTTGGGGTTCTTG TIMP-1 Forward: TGCTGGGTGGTAACTCTTTATTTCA Reverse: ATCCTGTTGTTGCTGTGGCTGATAG Tropoelastin Forward: AAAGCAGCAGCAAAGTTCGG Reverse: ACCTGGGACAACTGGAATCC MMP-1 Forward: AAGGTTAGCTTACTGTCACACGCTT Reverse: CGACTCTAGAAACACAAGAGCAAGA

The results are shown in FIGS. 1 to 4, respectively.

The results of PT-PCR showed that the extracts of Examples 4, 5, and 7, which are mixed extracts of hippopotamus extract and matsutake and / or mugwort, exhibited excellent activity. In particular, the mixed extract of Example 7 contained collagen and TIMP-1 Expression was increased, and the expression of MMP-1 tended to decrease in a concentration-dependent manner. Compared with the control group, adenosine (Adenosine), excellent results were obtained. In addition, Tropoelastin is a factor that forms elastic fiber centered elastin that shows skin elasticity. As a result, 5% of extract and 5% of control adenosine are superior.

Test Example  7: Intracellular Tyrosinase  And MITF  Gene Expression Inhibitory Effect

B16F10 melanoma cells were treated with 5 × 10 ⁵ cells / ㎖ of cells and cultured in Petri dishes at 5% CO ₂ and 37 ° C for 24 hours. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

The extracts of Examples 1 to 7 were treated and then cultured in DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C. After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). Tyrosinase and MITF were selected for RT-PCR. GAPDH was used as a house keeping gene to identify differences in gene expression.

The primer sequences of the respective genes are shown in Table 5. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to perform reverse transcription of Moloney murine leukemia virus (M-MLV) RNA CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction and the total reaction volume was 25 μL. The final concentration of each reagent is a primer 100pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5 mM, MgCl 2 (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Name of the primer Base sequence GAPDH Froward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG MITF Forward: AACCGACAGAAGAAGCTGGA Reverse: ACAAGTTCCTGGCTGCAGTT Tyrosinase Forward: TTATGCGATGGAACACCTGA Reverse: ACTGGCAAATCCTTCCAGTG

The results are shown in Fig. 5 and Fig.

As a result of observation after PT-PCR, the mixed extract of Examples 4, 5 and 7 showed excellent whitening activity. In particular, the mixed extract of Example 7, which is a mixed extract of hippocampus, And MITF mRNA gene expression was inhibited.

Test Example  8: Intracellular TNF -α, IL-1? and iNOS  Gene Expression Inhibitory Effect

HaCaT cells were plated at 5 × 10 ⁵ cells / ml in a 6-well plate, cultured for 24 h, treated with 0.5 μg / ml of LPS and cultured for 4 h. To extract total RNA, 1 ml of RNA iso (TAKARA, Japan) was added to each well, and the cells were lysed on ice for 5 min. Then, 200 μl of chloroform was added and centrifuged at 14,000 rpm for 15 min. The supernatant was transferred to a new tube, the same amount of isopropanol was added, and the RNA was isolated by centrifugation at 14,000 rpm for 10 min. It was centrifuged at 9900% ethanol at 7,500 rpm, washed once more, dried in air and dissolved in diethylpyrocarbonate (DEPC) water. RNA was quantitated using Nanodrop 2000 (Thermo, USA) and 2 μg of total RNA was heated with DEPC at 70 for 5 min and then placed in a Reverse Transcription Premix containing oligo (dT) (ELPIS-Biotech, Korea) Lt; / RTI > The reaction was carried out at 42 ° C for 55 min and at 70 ° C for 15 min. The cDNA was synthesized and used for polymerase chain reaction (PCR). To amplify TNF-α, IL-1α and iNOS and β-actin from the obtained cDNA, 2 μl of cDNA diluted 5 times with DEPC was added to 0.5 μl of the primer, 7 μl of DEPC water, SYBR green Master Mix (Invitrogen Life Technology, USA) PCR was performed using the StepOne Plus Real-Time PCR system (Applied Biosystems, USA). The reaction conditions were 50 ℃ for 2 min, 95 ℃ for 10 min and 40 ℃ for 10 min at 95 ℃ and 60 ℃ for 1 min. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D). The primer sequences of the genes to be amplified are shown in Table 6.

Name of the primer Base sequence β-actin Froward: GGCCATCTCTTGCTCGAAGT Reverse: GAGACCTTCAACACCCCAGC TNF-a Forward: AGCCCATGTTGTAGCAAACC Reverse: GGAAGACCCCTCCCAGATAG IL-1? Forward: TGGCTCATTTTCCCTCAAAAGTTG Reverse: AGAAATCGTGAAATCCGAAGTCAAG iNOS Forward: CATGCTACTGGAGGTGGGTG Reverse: CATTGATCTCCGTGACAGCC

The results are shown in Figs. 7, 8 and 9. Fig.

As a result of observation after PT-PCR, the mixed extracts of Examples 4, 5 and 7 showed excellent anti-inflammatory activity, and in particular, the mixed extract of Example 7, which is a mixed extract of hippocampus, And suppression of TNF-α, IL-1α and iNOS mRNA gene expression.

Formulation Example  1: Manufacture of skin lotion

1 kg of a skin lotion containing the mixed extract was prepared according to the composition shown in Table 7 below.

number Raw material Content (% by weight) One The mixed extract (Example 7) 1.0 2 glycerin 3.0 3 Butylene glycol 2.0 4 Propylene glycol 2.0 5 Polyoxyethylene hardened castor oil 1.0 6 ethanol 10.0 7 Triethanolamine 0.1 8 antiseptic a very small amount 9 Pigment a very small amount 10 Spices a very small amount 11 Purified water Balance

In Table 7, substances No. 2, No. 3, No. 4 and No. 8 were sequentially added to the No. 11 material, and the materials were stirred and melted. Subsequently, the No. 5 material was dissolved by heating to about 60 ° C. Subsequently, the substance 10 was added to the substance 11 after dissolution. Finally, the ingredients 1, 6, 7, and 9 were added, stirred sufficiently, and aged at 25 ° C for 3 days to prepare a skin lotion of the title.

Formulation Example  2 : Nutritious lotion  Produce

According to the composition shown in the following Table 8, 1 kg of hydrosomy nutrition lotion containing mixed extract was prepared by the following method.

number Raw material Content (% by weight) One The mixed extract (Example 7) 1.0 2 Wax 1.0 3 Polysorbate 60 1.5 4 Sorbitan sesquioleate 0.5 5 Liquid paraffin 10.0 6 Sorbitan stearate 1.0 7 Pro-type glycerin monostearate 0.5 8 Stearic acid 1.5 9 Glyceryl stearate / FG-400 stearate 1.0 10 Propylene glycol 3.0 11 Carboxy polymer 0.1 12 Triethanolamine 0.2 13 antiseptic a very small amount 14 Pigment a very small amount 15 Spices a very small amount 16 Purified water Balance

In Table 8, materials 10, 11, 13, and 16 were heated to 80 to 85 ° C while mixing and stirring, and then charged into the manufacturing section. Then, an emulsifier was allowed to react and the mixture was stirred at 2, 3, 4, 5, 6, 7, , The substance No. 12 was dissolved by heating at a temperature of 80 to 85 ° C, followed by emulsification. After the emulsification is completed, the mixture is cooled to 50 ° C with stirring using an agitator, and then the substance 15 is added. After cooling to 45 ° C, the substance 14 is added and the substance 1 is added at 35 ° C. For 3 days to prepare the nutritional lotion of the title.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, It is within the scope of the present invention that component changes to such an extent that they can be coped evenly within a range that does not deviate from the scope of the present invention.

Claims (7)

The present invention relates to a cosmetic composition containing a mixed extract prepared by mixing hippopotamus, hippopotamus, and mugwort, at a dry weight ratio of 1: 1: 1, in an amount of 0.001 to 10% by weight based on the total weight of the cosmetic composition. The method according to claim 1, wherein the mixed extract is at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethanol, propylene glycol and butylene glycol Wherein the cosmetic composition is prepared by extraction. delete delete The cosmetic composition according to claim 1, wherein the cosmetic composition is used for improving skin wrinkles and elasticity. The cosmetic composition according to claim 1, wherein the cosmetic composition is for skin whitening. The cosmetic composition according to claim 1, wherein the cosmetic composition has anti-inflammatory activity.

Images