KR101713486B1 - Cosmetic composition containing fermented extracts of Kigelia Africana Fruit, Canavalia Gladiata Pod and Corn Cob - Google Patents

Abstract

The present invention relates to production of a mixed fermentation extract of Kigelia pinnata DC. fruits, Canavalia gladiata pod, ad corn cob. The mixed fermentation extract according to the present invention is excellent, thereby a cosmetic composition containing the same, as an active ingredient can be usefully used as an anti-aging cosmetic.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a cosmetic composition containing fermented extracts of corn cobs, soybean nuts, soybean curd pods and corn cobs. [0002] Cosmetic composition containing fermented extracts of Kigelia Africana Fruit, Canavalia Gladiata Pod and Corn Cob,

The present invention relates to a technology for producing a mixed fermented extract having an excellent anti-aging effect with excellent safety and using it as a cosmetic. Specifically, the present invention relates to a technique for fermenting sausage nuts, soybean bean pods and corn by conventional fermentation techniques, The present invention relates to a cosmetic composition containing a mixed fermentation extract prepared through a low temperature aging process in a cedar barrel, and a process for producing the mixed fermentation extract.

Oxidative metabolic byproducts such as hydroxyl radical (OH), superoxide anion (O ₂ ^- ), hydrogen peroxide (H ₂ O ₂ ) and other reactive oxygen species (ROS) (Comporti 1993). These ROS peroxidize cell membrane lipids and cause changes in cell membrane permeability, leading to DNA damage and aging (Meneghini et al., 1993). Aging of human skin occurs with decreasing number of fibroblasts as age gets older. In addition, activation of various signaling systems by ultraviolet rays, climate, smoking, etc. leads to an inflammatory reaction, which causes skin aging (Parrado et al., 1999). The skin damaged by ultraviolet rays has a reduced amount of collagen because of the increased expression of matrix metalloproteinase (MMPs) in the skin by ultraviolet rays, and these MMPs play an important role in the development of skin photoaging (Fisher et al. , 1999). MMPs are secreted from the cells of the skin (keratinocytes, fibroblasts) to break down the connective tissue that maintains skin elasticity by decomposing most of the protein components constituting the extracellular matrix (ECM) and the basement membrane (BM) (Wang et al., 1999), which causes wrinkles, decreased elasticity, and skin sagging. Recently, it has been reported that the cell signaling pathway associated with aging-related increases in MMPs is mainly involved in the MAP kinase pathway (Hearing VJ 1999), MAP kinase pathway The AP-1 (activator protein-1) factor, which is most affected by the MAP kinase pathway, regulates the expression of many genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs (Fisher et al. , 1996). MMPs are metalloproteinases with zinc at the active center, which are secreted in vivo in the form of zymogens. In order to have enzymatic activity, they undergo structural modification, cleavage and activation of the amino terminal region, and α2-macroglobulin Activity is regulated by inhibitors such as tissue inhibitors of metalloproteinase (TIMPs) (Fisher et al., 1999). In recent research, it has been reported that elastin, an elastic fiber in addition to collagen in wrinkle formation, and elastase, an enzyme involved in elastin degradation, are undergoing research (Antonicelli et al., 2007; Isenburg et al., 2004; Seite et al., 2006). In particular, it has been reported that the expression of tropoelastin mRNA, an elastin precursor, is also increased in keratinocytes of human skin epidermis by chronic UV irradiation (Seo et al., 2001), suppression of selective elastase activity (Tsuji et al., 2001). It has also been reported that elastase plays a role in the formation of wrinkles.

Melanin is a major factor in determining the color of skin and hair. It acts to protect skin cells from ultraviolet rays and blocks ultraviolet rays from sunlight. This production of melanin is synthesized in the organelles called melanosomes in the basal layer of melanocytes (Hearing, 1999). The synthesized melanin pigment is transferred to the adjacent keratinocyte through the dendrite of the melanin cell, and the melanin pigment is distributed in various parts of the skin through the keratinocyte (Lowell, 1991). However, abnormal production of melanin causes skin lesions such as vitiligo. On the contrary, when melanin is over-synthesized or pigmented by various environmental factors such as sunshine, hormonal changes, inflammation or medicines, it forms spots and freckles (Lim et al., 2010; Park et al., 1998). These lesions lead to skin cancer. Therefore, in order to prevent such a pigmentation phenomenon and obtain a whitening effect, it is necessary to inhibit a part of the melanin production process to reduce the production of melanin. The most important enzyme involved in melanogenesis is tyrosinase, a tyrosine hydroxylase that oxidizes tyrosine in the melanosome to form 3,4-dihydroxyphenylalanine (DOPA). DOPA is oxidized to form DOPA oxidase, which produces dopachrome. Finally, melanin polymer is synthesized. Thus, inhibition of tyrosinase activity in the development of skin whitening agents has been recognized as a useful first-line assay (Pavel and Muskiet 1980; Prota 1990).

Research on the development of functional cosmetics has been actively carried out with interest in beauty and health such as aging of the skin soaring as the level of living improves. Retinol (a vitamin A), a-hydroxy acid (AHA), and adenosine which are typical examples of wrinkle improving materials for the functional cosmetics notices of the KFDA increase the synthesis of collagen and normalize the epidermal keratinization process and contribute to skin regeneration It is widely used as a substance, but it is known to be irritating to light and heat, and irritating to the skin. As a whitening functional cosmetic, mulberry extract, arbutin, ethyl ascorbyl ether, useful licorice extract, ascorbyl glucoside and magnesium ascorbyl phosphate are known.

The present inventors measured the anti-aging efficacy by preparing extracts of natural materials by various methods. Among them, when extracting sausage, soybean bean pods and corn from a specific method, their synergistic action resulted in excellent anti-aging activity And completed the present invention.

(0001) Korean Patent Publication No. 10-2011-0063269 (June 10, 2011) (0002) Korean Patent Laid-Open No. 10-2014-0055049 (April 201, 2014)

It is an object of the present invention to provide a cosmetic composition containing sausage nuts having excellent anti-aging activity, soybean bean pods and mixed fermentation extracts of corn.

It is another object of the present invention to provide a method for producing a fermented extract of sausage, fruit of soybean curd and corn.

To achieve the above object, according to the present invention, there is provided a cosmetic composition in which sausage nuts, soybean bean pods and corn mixed fermentation extracts produced by fermentation of yeast with cedar barrel aging are contained in an amount of 0.001 to 10 wt% based on the total weight of the cosmetic composition / RTI >

The cosmetic composition may be used for antioxidation, wrinkling of the skin, for improving elasticity, or for skin whitening.

The cosmetic composition may be at least one selected from the group consisting of a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutrition cream, a moisturizing cream, a hand cream, A cleansing cream, a body lotion, a body cleanser, an emulsion, a press powder, a loose powder or an eye shadow.

According to another aspect of the present invention, there is provided a method of producing a fermented milk, comprising: (A) mixing yeast, grain and purified water; (B) mixing the dried sausage nuts, soybean bean pods and maize seeds and wrapping them in a bag and placing them in the mixture; (C) fermenting at 35 to 60 DEG C for 2 to 3 days; (D) extracting the fermentation product; And (E) adding the extract to a cedar vat for aging at 2-8 ° C for 7-10 days.

In the step (A), the mixture of the koji, the grain and the purified water comprises 1 to 6% by weight of the koji, 30 to 50% by weight of the grain and 45 to 65% by weight of the purified water. As the grain, at least one selected from the group consisting of rice, barley, and wheat may be used, and rice is preferably used.

In step (B), it is most preferable that the sausage nuts, soybean bean pods and corn are mixed at a ratio of 1: 1: 1 by dry weight.

In the step (D), the extraction is carried out with at least one solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol.

The mixed fermented extract according to the present invention is excellent in the scavenging ability and collagen production effect of DPPH free radical, superoxide radical, Alkyl radical and hydroxyl radical, the expression of TIMP-1, the expression of tropoelastin and the suppression of MMP-1 expression, The cosmetic composition containing the component can be usefully used as an anti-aging cosmetic composition.

1 is a graph showing collagen expression effect of a mixed fermentation extract according to an embodiment of the present invention.
FIG. 2 is a graph showing the effect of TIMP-1 on the mixed fermented extract according to the present invention.
FIG. 3 is a graph showing the effect of the mixed fermentation extract according to the present invention on the expression of Tropoelastin.
4 is a graph showing the inhibitory effect of MMP-1 on the mixed fermentation extract according to the present invention.
FIG. 5 shows the effect of inhibiting the MITF expression of the mixed fermentation extract according to the example of the present invention.
6 shows the inhibitory effect of Tyrosinase on the mixed fermented extract according to the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a technique for producing a mixed fermented extract having excellent anti-aging activity by first fermenting sausage nuts, soybean bean pods and corn in accordance with a conventional fermentation technique and then secondary fermentation in a cedar barrel at low temperatures.

The sausage tree ( Kigelia < RTI ID = 0.0 > pinnata DC. ) Is a tropical evergreen arboreal herbaceous plant cultivated mainly in tropical Africa. Common Height 6 to 17 meters The fruit that looks like a sausage of about 30 ~ 60cm in length, 8 ~ 12cm in diameter and 7 ~ 9kg in weight hangs on a long stem and is called sausage tree. Sometimes it is opened as a bunch like banana, but the fruit contains many seeds and it is also used for food. The flower is hanging on the end of a long vase of 50cm ~ 2m in diameter and has a dark purple color with a size of about 10cm. In Africa, this fruit is used to treat rheumatism, syphilis, and snake bites.

Canavalia gladiata ) are native to tropical Asia and cultivated for food. Leaves have long petiole and three small leaves. The small leaf is egg-shaped, long oval, pointed end, about 10cm long, and the edge is wavy. The flower is light reddish purple or white, and long flower stalks grow on the axil of the leaves in the summer, and run on the gun. The end of the pod is curved or hooked, 20 ~ 30cm long, 5cm wide and about 10 beans. The beans are about 3cm long, with long seats on one side and red or white. The red species uses pods and the white species uses soybeans. Hemorrhoids, sinusitis, otitis media, gastritis, colitis, etc. It is called soybeans because the fruit is shaped like a candle. In the present invention, soybean pods of soybean curd are used.

Maize ( Zea mays Linne ) is a perennial herbaceous plant belonging to the family Paddyweed. The corn was imported from Mexico and originated from China. The name is also derived from stomachs and is called corn in Chinese pronunciation. The stem is sturdy and upright, with a height of 1 to 4 meters. There is an arboreal grace between the node and the node, and a parasitic root at each node of the donor. Blade is long, large, flat, sword-like or lanceolate, apex gradually pointed, corrugated wrinkles on edge, and strong intramedullary vein. Pharmacological actions include anticancer, diuretic, blood sugar, and hemostatic. The corn cob used in the present invention is the remaining part of the corn that has been removed from the corn.

The sausage nuts, soybean bean pods and corn used in the present invention can be purchased offline or on the internet market. In the present invention, the sausage nuts, the soybean bean pods and the corn are thoroughly washed with purified water, and they are preferably dried and pulverized or powdered according to the extraction method.

According to one embodiment of the present invention, a mixed fermentation extract is prepared as follows.

First, a mixture of yeast, grain and purified water is prepared to primary ferment sausage, soybean pods and corn. The mixture of the koji, the grain and the purified water is composed of 1 to 6% by weight of koji, 30 to 50% by weight of grains and 45 to 65% by weight of purified water. As the grain, at least one selected from the group consisting of rice, barley, and wheat may be used, and rice is preferably used.

After washing and drying, the crushed sausage nuts, soybean pods and corn are wrapped in a bag and put on the mixture for fermentation. At this time, the sausage nuts, soybean bean pods and corn were the best antioxidant activity when they were mixed at a ratio of 1: 1: 1 by dry weight. In the present invention, the mixed fermentation extract may be prepared by preparing fermented extracts of sausage nuts, soybean bean pods and corn, respectively, followed by mixing.

The mixture of the herbal medicines is wrapped in a bag of bran, and is buried in the yeast mixture to be fermented at 35 to 60 DEG C for 2 to 3 days. Then, the embryo is taken out and the fermented herbal medicine mixture is extracted with a solvent to prepare an extract. At this time, extraction is carried out using at least one solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol. According to one embodiment of the present invention, a mixed solvent of 1 to 80 times volume of water and 30% (W / W) ethanol is added, It can be extracted by boiling in water for 3 hours.

The extract is not used as it is, but in the present invention, the extract is secondarily put into a cedar vat and matured at low temperature. Cryptomeria japonica (Cryptomeria japonica) is an evergreen tree of Japanese origin and widely distributed in Jeju Island and southern region. Cedarwood is currently being used as an interior material, furniture material, road rug, etc. Research is also actively carried out to increase the added value of wood, including physiological activity by extractive ingredients (Kofujita et al., 2001; Matsushita et al., 2006) . Cedar contains a wide variety of terpenoids, especially sesquiterpene, which is composed of 15 carbons. These components themselves are known to have antifungal activity against dermatophytes.

In order to enhance the anti-aging activity of the herbal medicine mixed fermentation extract, the herbal medicine mixed fermented extract was placed in a container made of cedar and aged at a low temperature.

Sourdough, soybean bean pods and corn were fermented in a cedar barrel and aged at low temperature of 2-8 ℃ for 7 ~ 10 days. The mixture can be filtered or filtered and then concentrated under reduced pressure to prepare the mixed fermented extract of the present invention.

The fermented extract of the present invention has antioxidant activity, collagen production activity, antioxidant activity, antioxidant activity, antioxidant activity, antioxidant activity and antioxidant activity, TIMP-1 expression, tropoelastin expression, and MMP-1 expression.

The sausage noodles, soybean bean pods and corn mixed fermentation extract according to the present invention can be added to the cosmetic composition in an amount of 0.001 to 10% by weight in powder form or liquid form based on the total weight of the cosmetic composition , Preferably 0.01 to 5% by weight, based on the weight of the cosmetic composition.

The cosmetic composition of the present invention is not particularly limited in its formulation and examples thereof include a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, , A hand cream, an essence, a pack, a soap, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, an emulsion, a press powder, a loose powder or an eye shadow.

In addition, in the cosmetic composition of each formulation, components other than the above-mentioned mixed fermentation extract may be arbitrarily selected and formulated according to the formulation or purpose of use of other cosmetics. For example, it may include a coloring agent (coloring matter), a flavoring agent (fragrance), a suspending agent, an emulsifying agent, a solubilizing agent, a stabilizer, an isotonic agent, a pH adjusting agent, a viscosity adjusting agent,

The cosmetic composition of the present invention may contain, in addition to the mixed fermentation extract, one or more other active ingredients exhibiting anti-aging effects against wrinkle improvement.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

[Example]

Example  One: Sausage tree  Production of fruit fermented extract

50 g of leaven, 500 g of rice, and 1100 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 220 g of pulverized sausage nuts were mixed, wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The hemp cloth was taken out, and 700 g of purified water and 300 g of ethanol were used as a mixed solvent, and the mixture was extracted with hot water at 90 캜 for 2 hours. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example  2: Soybean fermented soybean extract Produce

50 g of leaven, 500 g of rice, and 1100 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 220 g of pulverized soybean bean pods were mixed, wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The hemp cloth was taken out, and 700 g of purified water and 300 g of ethanol were used as a mixed solvent, and the mixture was extracted with hot water at 90 캜 for 2 hours. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example  3: Fermented extract of corn Produce

50 g of leaven, 500 g of rice, and 1100 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, 220 g of pulverized corn was mixed and wrapped in a burlap cloth, buried in the koji mixture, and fermented at 35 ° C for 3 days. The hemp cloth was taken out, and 700 g of purified water and 300 g of ethanol were used as a mixed solvent, and the mixture was extracted with hot water at 90 캜 for 2 hours. Thereafter, the extract was aged at a temperature of 2-8 ° C for 7 days in a cedar bottle. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Example  4 to 8: mixed fermentation extract Produce

The extracts were prepared in the same manner as in Example 3, except that sausage nuts, soybean bean pods, and corn were mixed in a weight ratio of 220 g as shown in Table 1 below. The same operation was performed with different raw materials.

Comparative Example  One: In a cedar barrel  Preparation of mixed fermented extract without aging process

50 g of leaven, 500 g of rice, and 1100 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, the pulverized sausage nuts, soybean bean pods and corn were mixed at the same weight ratio, and a total of 220 g of the sausage nuts were wrapped in a burlap bag, buried in the bunch mixture, and fermented at 35 ° C for 3 days. The hemp cloth was taken out, and 700 g of purified water and 300 g of ethanol were used as a mixed solvent, and the mixture was extracted with hot water at 90 캜 for 2 hours. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

Comparative Example  2: Preparation of Mixed Fermented Extract after Fermentation in a Pot

50 g of leaven, 500 g of rice, and 1100 g of purified water were mixed in a pottery pot to prepare a mixture. After drying, the pulverized sausage nuts, soybean bean pods and corn were mixed at the same weight ratio, and a total of 220 g of the sausage nuts were wrapped in a burlap bag, buried in the bunch mixture, and fermented at 35 ° C for 3 days. The hemp cloth was taken out, and 700 g of purified water and 300 g of ethanol were used as a mixed solvent, and the mixture was extracted with hot water at 90 캜 for 2 hours. The extract was then matured at 2-8 [deg.] C for 7 days in a pottery jar. 300 mesh filter paper, and filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to prepare an extract.

ingredient Example 4 Example 5 Example 6 Example 7 Example 8 Sausage nuts One 2 One One 3 Soybean pods One One 2 One One cob One One One 2 One

The extracts were concentrated and lyophilized to confirm the anti - aging effect of the mixed fermented extract. Radical scavenging ability and intracellular efficacy evaluation samples were prepared. DPPH free radical, Superoxide Radical, Alkyl Radical and Hydroxyl Radical scavenging ability were confirmed.

Test Example  One: DPPH  free radical Scatters  Measure

DPPH free radical scavenging activity was measured by the method of Nanjo et al. (1996). 30 μl of 60 μM DPPH (1,1-diphenyl-2-picrylhydrazyl) solution was added to 30 μl of the sample, and the reaction solution was transferred to a 100 μl quartz capillary tube. Electron spin resonance (ESR) spectrometer (JES- Ltd., Tokyo, Japan). The experimental conditions are as follows.

magnetic field, 336.5 ± 5 mT; power, 5mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30s; temperature, 298K.

The DPPH radical scavenging activity was calculated by the difference in the relative radical signal peak heights of H and H ₀ . The results are shown in Table 2 below.

Test Example  2: Superoxide  radical Scatters  Measure

Superoxide radicals were irradiated with 10 μl of 0.3 mM riboflavin, 10 μl of 1.6 mM EDTA and 10 μl of 800 mM DMPO in 10 μl of a sample according to Guo et al. (1999), and then irradiated with UV lamp at 365 nm for 1 minute. The reaction was transferred to a quartz capillary tube and analyzed using an ESR spectrometer. The experimental conditions were as follows.

magnetic field, 336.5 ± 5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30s; temperature 298K.

Superoxide radical scavenging activity was calculated by the equation using the relative peaks of H and H ₀ . The results are shown in Table 2 below.

Test Example  3: Alkyl radical Scatters  Measure

10 μl of each sample was supplemented with 10 μl of PBS (Phosphate buffered saline), 40 mM AAPH (2,2-azobis- (2-amidinopropane) -dihydrochloride), 40 mM POBN α- (4-pyridyl- Add tert-butylnitrone. The reaction was carried out at 37 for 30 min and then transferred to a quartz capillary tube and measured using an ESR spectrometer. The experimental conditions are as follows.

magnetic field, 336.5 ± 5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1000; sweep time, 1 min; temperature 298 K.

Alkyl radical scavenging activity was calculated by the following formula. The results are shown in Table 2 below.

Test Example  4: Hydroxyl radical Scatters  Measure

Hydroxyl radical scavenging activity was analyzed by the method of Rosen et al. (1984). 20 μl of 0.3 M DMPO, 20 μl of 10 mM FeSO _{4 and} 20 μl of 10 mM H ₂ O ₂ were added to a 20 μl sample, and then transferred to a quartz capillary tube. After 2.5 minutes, the sample was measured by ESR spectrometer. The experimental conditions are as follows.

magnetic field, 336.5 ± 5 mT; power, 1 mW; modulation frequency, 9.41 GHz; amplitude, 1 × 200; sweep time, 4 min; temperature 298 K.

Hydroxy radical scavenging activity was calculated by the following equation, measured by the relative heights of H and H ₀ . The results are shown in Table 2 below.

division Radical scavenging activity (%) at concentration 2.5 mg / ml. DPPH Hydroxyl Alkyl Superoxide Example 1 54.32 ± 0.91 57.15 ± 1.22 44.98 + - 0.86 48.55 + - 0.98 Example 2 46.77 ± 1.26 49.67 ± 1.03 38.72 ± 1.03 43.68 ± 0.96 Example 3 50.13 + 1.01 54.46 ± 0.83 50.49 + - 0.54 46.59 ± 1.11 Example 4 58.95 ± 1.08 63.10 ± 0.85 52.24 + 1.16 53.28 ± 1.03 Example 5 54.64 ± 0.70 57.21 + - 0.51 50.97 + - 1.16 51.95 ± 0.51 Example 6 53.47 ± 1.08 58.52 + - 0.91 49.15 ± 1.18 50.08 + - 1.27 Example 7 56.65 + - 0.46 60.23 + - 1.03 49.83 + - 0.33 51.99 ± 0.96 Example 8 54.92 + 1.18 57.75 ± 0.79 50.39 + - 0.82 51.31 ± 1.09 Comparative Example 1 52.77 ± 1.08 56.52 + - 0.91 48.05 ± 1.18 49.08 ± 1.27 Comparative Example 2 52.65 + - 0.46 55.23 + - 1.03 49.01 + - 0.33 49.89 ± 0.96

As shown in Table 2, in the radical scavenging effect, the mixed fermentation extract of the example of the present invention, in which the fermented extracts of the examples of the present invention, which were second-aged in the cedar barrel after fermentation of koji, fermented extracts of different fermentation extracts, The fermented extracts which were not fermented and the fermented extracts which were aged in pottery jars after mixed fermentation of herbal medicines were found to be superior. Through this process, it was found that the antioxidant activity was significantly increased by the active ingredient extraction from the herbal medicines through the low temperature aging process in the cedar barrel .

Test Example  5: Cytotoxicity test

Cell culture

Collagenase and TIMP-1 were detected in HaCaT (human keratinocyte cell line), MMP-1 and tropoelastin were detected in CCD-986Sk (Human fibroblast cell line), tyrosinase and MITF were used for B16F10 melanoma cells in order to confirm gene expression in whitening. HaCaT, CCD-986Sk and B16F10 melanoma cells were cultured in DMEM containing 10% v / v FBS (fetal bovine serum, Gibco, USA), streptomycin at 100 U / mL, penicillin antibiotics at 100 U / Dulbeco's modified eagle's medium, Gibco, USA). The cells were cultured in an incubator at 5% CO ₂ and 37 ° C.

Cell viability measurement experiment MTT  assay)

MTT assays were performed by succinate dehydrogenase of mitochondria after MTT [3- (4,5-dimethythiasol-2-yl) -2,5-diphenyl tetrazolium bromide] ). The accumulation of this substance in the cell represents the activity of mitochondria, broadly, the activity of the cell, which is a typical method for measuring the survival rate of cells.

Each HaCaT, CCD-986Sk, and B16F10 melanoma cells were seeded at a density of 1 × 10 ⁵ cells / well in 96-wells with 200 μl of the medium, cultured in a 5% CO ₂ incubator at 37 ° C. for 24 hours, After washing with PBS, the same amount of the medium and the sample dissolved in PBS were cultured in each well at various concentrations ranging from 0.1% to 5.0% and cultured for 24 hours. Four hours before the end of the culture, 20 5 of 5 mg / ml MTT dissolved in PBS was added to each well, shaded with aluminum foil, and cultured in an incubator with 5% CO ₂ and 37 for 3 hours. After removing the culture medium, 200 μl of DMSO solution was added, incubated at 37 ° C for 1 hour, and absorbance was measured at 570 nm using an ELISA reader. The cell survival rate was calculated by the following equation, and the results are shown in Table 3 below.

division Cell survival rate (%) 0.1% 0.5% One % 5.0% Example 4 101 100 101 101 Example 5 100 100 100 100 Example 6 100 100 100 100 Example 7 101 100 101 100 Example 8 100 101 100 100 Comparative Example 1 100 100 100 100 Comparative Example 2 101 101 101 101 Control group
(Adenosine) 100 101 100 100 Control group
(Arbutin) 101 100 100 101

As shown in the above Table 3, none of the examples, the comparative examples, and the control group Adenosine (adenosine) Arbutin (arbutin) showed cytotoxicity.

Test Example  6: Intracellular Collagenase , Timp -1 and Tropoelastin  Gene expression and inhibition of gene expression of MMP-1.

HaCaT and CCD-986Sk cells were cultured at 5% CO ₂ and 37 ° C for 24 hours after treatment with 5 × 10 ⁵ cells / ml. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

Mixed fermentation extracts that were found to have the best free radical scavenging activity were treated with DMED / 10 FBS for 24 h at 5% CO ₂ and 37 ° C for 24 h after treatment with extracts of Examples 4, 5, 6, 7 and 8 and Comparative Examples 1 and 2 Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.

The primer sequences of the respective genes are shown in Table 4. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to carry out reverse transcription of M-MLV (Moloney murine leukemia virus) CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction, and the total reaction solution was 25 μl. The final concentration of each reagent is a primer 100 pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq 1x1.5mM Reaction buffer, MgCl ₂ (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Name of the primer Base sequence GAPDH Froward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG COL1A1 Forward: AGCCAGCAGATCGAGAACAT Reverse: TCTTGTCCTTGGGGTTCTTG TIMP-1 Forward: TGCTGGGTGGTAACTCTTTATTTCA Reverse: ATCCTGTTGTTGCTGTGGCTGATAG Tropoelastin Forward: AAAGCAGCAGCAAAGTTCGG Reverse: ACCTGGGACAACTGGAATCC MMP-1 Forward: AAGGTTAGCTTACTGTCACACGCTT Reverse: CGACTCTAGAAACACAAGAGCAAGA

The results are shown in FIGS. 1 to 4, respectively.

As a result of observation after PT-PCR, the mixed fermented extract of the present invention increased the expression of collagen and TIMP-1 more than other mixed fermented extracts. As shown in FIG. 4, the mixed fermented extract of the Example was superior to the other mixed fermented extracts in inhibiting the expression of MMP-1. In particular, the mixed fermented extract of Example 4 showed the most excellent effect, and superior results were obtained when compared with the control adenosine (Adenosine).

In addition, Tropoelastin is a factor that forms elastin in the center of elastic fibers showing skin elasticity. As shown in FIG. 3, the mixed fermented extract of Example 4 has excellent results than 5% of control adenosine 5% Respectively.

Test Example  7: Intracellular Tyrosinase  And MITF  Gene Expression Inhibitory Effect

B16F10 melanoma cells were treated with 5 × 10 ⁵ cells / ㎖ of cells and cultured in Petri dishes at 5% CO ₂ and 37 ° C for 24 hours. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

To investigate the effect of the mixed fermentation extract on the whitening, the extracts were treated with DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C after treating the extracts of Examples 4, 5, 6, 7 and 8 and Comparative Examples 1 and 2 Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). Tyrosinase and MITF were selected for RT-PCR. GAPDH was used as a house keeping gene to identify differences in gene expression.

The primer sequences of the respective genes are shown in Table 5. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to perform reverse transcription of Moloney murine leukemia virus (M-MLV) RNA CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction and the total reaction volume was 25 μL. The final concentration of each reagent is a primer 100pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5 mM, MgCl 2 (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Name of the primer Base sequence GAPDH Froward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG MITF Forward: AACCGACAGAAGAAGCTGGA Reverse: ACAAGTTCCTGGCTGCAGTT Tyrosinase Forward: TTATGCGATGGAACACCTGA Reverse: ACTGGCAAATCCTTCCAGTG

The results are shown in Fig. 5 and Fig.

As a result of observation after PT-PCR, the mixed fermented extract of the examples of the present invention showed excellent inhibitory effect on tyrosinase and MITF mRNA gene expression. Therefore, it was confirmed that the mixed fermentation extract of the present invention had better whitening effect than other fermented extracts.

Formulation Example  1: Manufacture of skin lotion

According to the composition shown in Table 6 below, 1 kg of skin lotion containing mixed fermented extract (Example 4) was prepared by the following method.

number Raw material Content (% by weight) One Mixed fermented extract (Example 4) 1.0 2 glycerin 3.0 3 Butylene glycol 2.0 4 Propylene glycol 2.0 5 Polyoxyethylene hardened castor oil 1.0 6 ethanol 10.0 7 Triethanolamine 0.1 8 antiseptic a very small amount 9 Pigment a very small amount 10 Spices a very small amount 11 Purified water Balance

In Table 6, materials No. 2, No. 3, No. 4 and No. 8 were sequentially added to the No. 11 material, and the materials were stirred and melted. Subsequently, No. 5 material was heated to dissolve to about 60 ° C. Subsequently, the substance 10 was added to the substance 11 after dissolution. Finally, ingredients 1, 6, 7, and 9 were added, agitated thoroughly, and aged for 25 to 3 days to prepare a skin lotion.

Formulation Example  2: Nutritious lotion  Produce

According to the composition shown in Table 7 below, 1 kg of hydrosomal nutrition lotion containing mixed fermented extract (Example 4) was prepared by the following method.

number Raw material Content (% by weight) One Mixed fermented extract (Example 4) 1.0 2 Wax 1.0 3 Polysorbate 60 1.5 4 Sorbitan sesquioleate 0.5 5 Liquid paraffin 10.0 6 Sorbitan stearate 1.0 7 Pro-type glycerin monostearate 0.5 8 Stearic acid 1.5 9 Glyceryl stearate / FG-400 stearate 1.0 10 Propylene glycol 3.0 11 Carboxy polymer 0.1 12 Triethanolamine 0.2 13 antiseptic a very small amount 14 Pigment a very small amount 15 Spices a very small amount 16 Purified water Balance

In Table 7, the materials 10, 11, 13, and 16 were heated to 80 to 85 ° C while mixing and stirring. , The substance No. 12 was dissolved by heating at a temperature of 80 to 85 ° C, followed by emulsification. After the emulsification is completed, the mixture is cooled to 50 with stirring using an agitator, then the substance 15 is added, cooled to 45, the substance 14 is added, the substance is added at 35 to 1, cooled to 25 and aged at 25 for 3 days The nutritional lotion of the title was prepared.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, It is within the scope of the present invention that component changes to such an extent that they can be coped evenly within a range that does not deviate from the scope of the present invention.

Claims (8)

(A) preparing a mixture of koji, grains and purified water comprising 1 to 6% by weight of koji, 30 to 50% by weight of grains and 45 to 65% by weight of purified water; (B) mixing the dried sausage nuts, soybean bean pods and corn in a weight ratio of 1: 1: 1 and wrapping them in a bag wrapped in a mixture; (C) fermenting at 35 to 60 DEG C for 2 to 3 days; (D) extracting the fermentation product; And (E) adding the extract to a cedar barrel for aging at 2-8 [deg.] C for 7-10 days. The sausage nuts, soybean pods and corn mixed fermented extracts are added to the cosmetic composition in an amount of 0.001-10 By weight of the composition. The cosmetic composition according to claim 1, wherein the cosmetic composition is for antioxidation. The cosmetic composition according to claim 1, wherein the cosmetic composition is used for improving skin wrinkles and elasticity. The cosmetic composition according to claim 1, wherein the cosmetic composition is for skin whitening. delete delete delete delete

Images