KR101738075B1

KR101738075B1 - Cosmetic composition containing extracts of Anemarrhena Asphodeloides, Salvia officinalis and Tagetes Erecta

Info

Publication number: KR101738075B1
Application number: KR1020160145113A
Authority: KR
Inventors: 박상훈; 최지연; 이동현; 백태선; 이대우
Original assignee: 주식회사 아이디플라코스메틱; 주식회사 더마랩
Priority date: 2016-11-02
Filing date: 2016-11-02
Publication date: 2017-05-19

Abstract

The present invention relates to a cosmetic composition containing natural components and, more specifically, to a cosmetic composition containing mixed extracts of Anemarrhena asphodeloides, Salvia officinalis and Tagetes erecta, wherein the mixed extracts are enzyme-treated with -glucosidase. According to the present invention, the cosmetic composition using natural materials is safe and has excellent antioxidant, elasticity improving, wrinkle improving and skin whitening effects, thereby being used as a natural cosmetic material.

Description

[0002] Cosmetic composition containing extracts of Anemarrhena Asphodeloides, Salvia officinalis and Tagetes Erecta,

본 발명은 안전성이 우수하면서 탄력 증진, 주름개선 및 피부 보습 효과가 우수한 혼합추출물을 제조하고, 이를 화장료로 사용하는 기술에 관한 것으로, 구체적으로는 지모, 세이지 및 천수국 혼합추출물을 유효성분으로 함유하여 탄력, 주름개선 및 미백효과가 우수한 화장료 조성물에 관한 것이다.TECHNICAL FIELD The present invention relates to a technique for producing a mixed extract having excellent safety, excellent in elasticity enhancement, wrinkle improvement and skin moisturizing effect, and using it as a cosmetic, and more specifically, Elasticity, wrinkle improvement and whitening effect.

화장품은 일반적으로 신체를 청결히 하고, 자신을 아름답고 매력적으로 가꾸며, 자외선이나 건조 등으로부터 피부나 모발을 보호해서 노화를 방지하는 것을 목적으로 한다. 1차 적인 청결과 건조함으로 인한 피부 고민을 해결 하기 위한 보습 제품의 화장품 영역 이외에 화장품의 영역은 좀 더 넓어져 탄력 저하, 미백, 주름 등의 피부 고민을 미리 예방하거나 케어하여 자신의 아름다움을 가꾸는 적극적인 수단으로 이용되고 있다.Cosmetics are generally intended to clean the body, to make themselves beautiful and attractive, and to protect the skin and hair from ultraviolet rays or drying to prevent aging. In addition to the area of cosmetics for moisturizing products to solve problems of skin caused by primary cleanness and dryness, the area of cosmetics is broadened to prevent aggression, whitening, wrinkles and other skin troubles in advance, It is used as a means.

비교적 젊은 나이에서 발견되는 피부의 탄력저하 현상은 피부의 늘어짐 현상을 동반하지 않기 때문에 육안으로는 식별할 수가 없고 단지 손으로 만져 보아야 그 저하된 탄력성을 느낄 수 있지만, 50대 중반 이후의 나이를 먹은 사람의 피부탄력저하 현상은 거의 예외 없이 피부 늘어짐 현상을 동반하는 것이 보통으로 탄력 저하 피부는 단순한 탄력저하피부(unsupple skin)와 피부 늘어짐을 동반하고 있는 노인성 탄력저하피부(flabby skin)로 구분할 수 있다.The skin elasticity of the skin, which is found at a relatively young age, can not be distinguished from the naked eye because it does not accompany the skin sagging phenomenon. Human skin elasticity is almost exclusively accompanied by skin sagging. Normal skin is less elastic. Skin is divided into simple skin with unsupplied skin and flabby skin with skin sagging .

이러한 피부 탄력 저하는 1차적으로 젊은 층에서 생기는 탄력 저하의 경우 피부세포층이 충분한 영양소를 공급 받지 못하는 데에서 비롯된다. 사실상 이러한 피부유형은 대체로 30대 이전의 젊은 나이의 여성들에게서 흔히 발견되는데, 피부세포의 영양학적 결손 현상이 의외로 잘못된 다이어트에 의한 것일 경우가 많다. 또 다른 원인으로 진피의 대부분을 구성하며 실질적으로 피부를 지지하고 있는 ECM 구조 변화에서 찾을 수 있는데, 나이가 들어감에 따라 햇빛의 광분해 현상으로 인해 콜라겐이나 엘라스틴 조직이 타격을 받아 끊어지거나 변형이 되어 급격하게 ECM 조직이 붕괴 되면서 노화에 따른 탄력 저하 현상이 발생하게 되며 더불어 피하지방층과 근육층의 약화로 인해 피부 탄력 저하가 초래 되는데 피하지방층이 자연히 얇아지게 되어 그 만큼 빈 공간이 생기게 되고 따라서 피부층이 내려앉게 되며 탄력성이 저하 하게 되며 근육이 빈약해 짐으로 지방층의 함몰 현상과 동일한 결과를 초래하게 되는데, 이러한 문제는 얼굴에서만 발생하는 고민이 아니라 전신에서 발생하는 피부 고민이다.This reduction in skin elasticity is primarily due to the inability of the skin layer to provide sufficient nutrients in the case of a loss of elasticity in the younger layer. In fact, these skin types are commonly found in younger women, generally before the age of 30, and nutritional deficiencies in skin cells are often due to a misdiagnosed diet. Another cause is the ECM structure, which constitutes the majority of the dermis and actually supports the skin. As the age increases, photolysis of the sunlight causes the collagen or elastin tissue to be hurt, The ECM tissue is collapsed and the elasticity is reduced due to aging. In addition, the weakening of the subcutaneous fat layer and muscle layer results in a decrease in skin elasticity. The subcutaneous fat layer naturally becomes thinner, And the elasticity is lowered and the muscles are weaker, resulting in the same result as the depression of the fat layer. This problem is not a problem occurring only on the face but a skin anxiety caused by the whole body.

상기 탄력 저하의 피부 고민을 개선하기 위해 물리적인 마사지 요법, 랩핑 요법 혹은 수술 등으로 피부 고민을 해결하고 있으며 화장품 분야에서는 탄력이 저하된 피부의 특징을 고려하여 탄력 강화, 보습 강화, 각질층 박리를 통한 세포 분화 촉진, 진피층 강화를 위한 엘라스틴과 콜라겐 강화 또는 엘라스틴의 분해요소를 억제하고 변형을 막아주는 작용을 하는 효능의 제품들이 출시되고 있다. 하지만, 고객이 원하는 탄력 개선의 필요는 마사지와 같이 즉각적인 물리적인 효과를 주는 제품을 원하고 있으며 즉각적으로 탄력이 개선된 연상 효능을 주는 제품에 대한 만족도가 높은 추세로, 이러한 탄력적인 사용감을 구현하기 위해 다량의 폴리머를 이용하여 제품을 출시하고 있다. 따라서 기존 피부탄력개선용 제품에 대한 만족도가 낮고, 이에 대하여 즉각적 탄력감 제공과 함께 피부탄력과 증진효과가 뛰어난 화장료 개발이 시급하게 중요한 문제가 되었다. 따라서 기존 피부탄력개선용 제품에 대한 즉각적인 인지 효능에 대한 만족도가 낮아 바른 즉시 피부 탄력 증진의 인지 효능을 보이는 화장료 개발이 시급하고 중요한 문제가 되었다.In order to improve the elasticity of the skin, it is solving the problem of the skin by physical massage therapy, lapping therapy or surgery. In the field of cosmetics, considering the characteristics of the skin with reduced elasticity, strengthening of elasticity, moisturizing, Products that promote cell differentiation, enhance elastin and collagen to strengthen the dermis, or inhibit elastin degradation and prevent deformation are being released. However, the customer needs to improve the elasticity of the massage, such as immediate physical effects that want a product that is immediately resilient to improve the effect of products that give a high satisfaction with the tendency to implement such a sense of elasticity We are launching products using a large amount of polymer. Therefore, the satisfaction of the existing skin elasticity improving product is low, and immediate development of elasticity and skin elasticity and enhancement of cosmetic properties are urgently required. Therefore, the satisfaction of immediate cognitive efficacy of existing skin elasticity improving products is low, and development of cosmetics showing cognitive efficacy of skin elasticity enhancement immediately became an urgent and important problem.

이에, 본 발명자들은 상기와 같은 문제점을 해결하기 위해 피부탄력개선, 미백, 항산화 활성 등을 나타내는 천연물 소재를 탐색하여 왔으며, 지모, 세이지, 천수국의 복합추출물이 피부탄력개선 및 피부 미백에 효과적임을 확인하여 본 발명을 완성하였다.In order to solve the above problems, the present inventors have searched for a natural material exhibiting skin elasticity improvement, whitening, antioxidative activity and the like, and found that the combined extracts of Zymo, Sage, and Chrysanthemum are effective for skin elasticity improvement and skin whitening Thereby completing the present invention.

(0001) 대한민국 공개특허 10-2011-0063269 (2011.06.10)(0001) Korean Patent Publication No. 10-2011-0063269 (June 10, 2011) (0002) 대한민국 공개특허 10-2014-0055049 (2014.05.09)(0002) Korean Patent Laid-Open No. 10-2014-0055049 (April 201, 2014) (0003) 대한민국 공개특허 10-2010-0059279 (2010.06.04)(0003) Korean Patent Publication No. 10-2010-0059279 (June 4, 2010)

본 발명은 망기페린(Mangiferin), 이소퀘르시트린(Isoquercitrin), 퀘르세틴 (Quercetin)이 다량 함유된 지모, 세이지 및 천수국의 혼합추출물을 함유하여 피부개선활성이 우수하며, 피부에 자극이 적고, 인체에 안전하며 장기간 사용하여도 부작용이 없는 화장료 조성물을 제공하는 것을 목적으로 한다.The present invention relates to a cosmetic composition which contains a mixed extract of mangiferin, isoquercitrin and quercetin in a large amount, a mixed extract of sage and licorice, has excellent skin improving activity, is less irritating to the skin, It is intended to provide a cosmetic composition which is safe and has no side effects even when used for a long period of time.

또한, 본 발명은 상기 지모, 세이지 및 천수국 혼합추출물의 제조방법을 제공하는 것을 다른 목적으로 한다.It is another object of the present invention to provide a method for producing the mixed extract of Zygo, Sage and Hanwoo.

상기 목적을 달성하기 위하여, 본 발명에 따르면, β-글루코시다아제 효소처리 지모, 세이지 및 천수국 혼합추출물을 함유하는 화장료 조성물이 제공된다.To achieve the above object, according to the present invention, there is provided a cosmetic composition comprising a? -Glucosidase enzyme-treated liposome, a sage, and a mixed extract of licorice root.

상기 효소처리 지모, 세이지 및 천수국 추출물은, 물, 탄소수 1 내지 4의 무수 또는 함수알코올, 에틸아세테이트, 아세톤, 글리세린, 프로필렌글리콜 및 부틸렌글리콜로 이루어지는 군으로부터 선택되는 적어도 하나의 추출용매로 추출 후, β-글루코시다아제 효소처리하여 제조되는 것이다. 바람직하게는 상기 혼합추출물의 제조에 있어서, 추출용매는 에탄올이며, 더욱 바람직하게는 70% 에탄올이다.The enzyme-treated liposomes, sage and licorice extract are extracted with at least one extraction solvent selected from the group consisting of water, anhydrous or hydroalcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, propylene glycol and butylene glycol , and? -glucosidase enzyme treatment. Preferably, in the preparation of the mixed extract, the extraction solvent is ethanol, more preferably 70% ethanol.

그리고 상기 지모, 세이지 및 천수국 혼합추출물의 제조에 있어서, 상기 지모, 세이지 및 천수국은 그 중량 기준으로 각각 1~3:1~3:1~3의 비로 혼합하여 추출되는 것이며, 더욱 바람직하게는 3:1:2로 혼합되어 추출되는 것이다.In addition, in the production of the mixed extracts of Zygo, sage and licorice, the Zygo, sage and licorice are mixed and extracted at a ratio of 1: 3: 1 to 3: 1 to 3, : 1: 2.

상기 β-글루코시다아제 효소처리 지모, 세이지 및 천수국 혼합추출물은 화장료 전체 중량에 대하여 0.001 ~ 30중량% 포함되는 것이 바람직하다.The β-glucosidase enzyme-treated liposomes, sage and licorice mixed extract are preferably contained in an amount of 0.001 to 30% by weight based on the total weight of the cosmetic.

활성성분으로서의 상기 β-글루코시다아제 효소처리 지모, 세이지 및 천수국 혼합추출물은 리포좀화되어 포함될 수 있다.The β-glucosidase enzyme-treated liposomes, sage and lichen mixed extracts as an active ingredient may be liposomized.

상기 화장료 조성물은 항산화, 탄력 증진, 주름개선 및 피부 미백용으로 사용될 수 있다.The cosmetic composition can be used for antioxidation, elasticity enhancement, wrinkle improvement and skin whitening.

본 발명 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 계면활성제 함유 클렌징, 토닉, 스케일링 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 구체적으로는, 유연 화장수, 영양 화장수, 영양 유액, 영양 크림, 마사지 크림, 에센스, 아이크림, 클렌징크림, 클렌징 폼, 클렌징 워터 또는 팩의 제형으로 제조될 수 있다.The cosmetic composition of the present invention may be formulated into a solution, a suspension, an emulsion, a paste, a gel, a cream, a cleansing containing a surfactant, a tonic, a scaling, and the like, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutrient solution, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water or a pack.

상기 다른 목적을 달성하기 위하여 본 발명에 따르면, 지모, 세이지 및 천수국을 건조중량비로 3:1:2의 비율로 혼합하는 단계; 1~30배 부피량의 물, 탄소수 1 내지 4의 무수 또는 함수알코올, 에틸아세테이트, 아세톤, 글리세린, 프로필렌글리콜 및 부틸렌글리콜로 이루어지는 군으로부터 선택되는 적어도 하나의 추출용매로 추출하는 단계; 상기 용매추출물에 β-글루코시다아제 효소를 가하여 효소반응시키는 단계; 및 상기 효소반응 완료 후 여과하는 단계를 포함하는 지모, 세이지 및 천수국 혼합추출물의 제조방법이 제공된다.According to another aspect of the present invention, there is provided a method for preparing a sage, a sage, and a flowering plant, the method comprising: mixing at a ratio of 3: 1: 2 by dry weight; Extracting with at least one extraction solvent selected from the group consisting of 1 to 30 times volume of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, propylene glycol and butylene glycol; Adding the? -Glucosidase enzyme to the solvent extract to cause an enzyme reaction; And a step of filtering after completion of the enzymatic reaction.

본 발명에 따른 효소처리 지모, 세이지 및 천수국 혼합추출물은 천연물을 사용하여 인체에 안전하면서도, 우수한 항산화, 탄력 증진, 주름개선 및 피부 미백 효과를 나타내므로 천연화장료로 유용하게 사용될 수 있다.The enzyme-treated liposomes, sage and licorice mixed extract according to the present invention can be effectively used as natural cosmetics because they are safe for human body and exhibit excellent antioxidation, elasticity enhancement, wrinkle improvement and skin whitening effect by using natural products.

도 1은 본 발명의 일 실시예에 따른 혼합추출물의 콜라겐 발현효과를 나타내고,
도 2는 본 발명의 일 실시예에 따른 혼합추출물의 Timp-1 발현효과를 나타내며,
도 3은 본 발명의 일 실시예에 따른 혼합추출물의 트로포엘라스틴 발현효과를 나타내고,
도 4는 본 발명의 일 실시예에 따른 혼합추출물의 MMP-1 발현 억제효과를 나타낸다.
도 5는 본 발명의 일 실시예에 따른 혼합추출물의 MITF 발현 억제효과를 나타내고,
도 6은 본 발명의 일 실시예에 따른 혼합추출물의 티로시나제 발현 억제효과를 나타낸다.1 shows the collagen expression effect of the mixed extract according to an embodiment of the present invention,
FIG. 2 shows the effect of the mixed extract on the expression of Timp-1 according to an embodiment of the present invention,
Figure 3 shows the effect of tropoelastin expression of the mixed extract according to one embodiment of the present invention,
4 shows the effect of inhibiting MMP-1 expression of the mixed extract according to an embodiment of the present invention.
FIG. 5 shows the effect of inhibiting MITF expression of a mixed extract according to an embodiment of the present invention,
FIG. 6 shows the tyrosinase inhibitory effect of the mixed extract according to an embodiment of the present invention.

지모(Anemarrhena Asphodeloides)는 다년생 초본으로 근경이나 종자로 번식한다. 중국이 원산지이고, 산과 들에서 자란다. 뿌리줄기는 굵고 옆으로 뻗으며 끝에서 잎이 뭉쳐난다. 잎은 줄 모양이고, 길이가 20~70cm이며, 끝이 실처럼 가늘고 밑 부분이 서로 안기어 줄기를 감싸며 가장자리가 밋밋하고 잎맥은 나란히맥이다. 꽃은 6~7월에 연한 자주색으로 피고, 잎 사이에서 나온 꽃줄기에 2~3개씩 모여 수상꽃차례를 이루며 달린다. 꽃줄기는 높이가 60~90cm이고 달걀 모양의 길게 뾰족한 포가 달린다. 화관은 좁은 통 모양이고, 길이가 7~8mm이며, 끝이 6개로 갈라진다. 수술은 3개이며, 안쪽 화피 조각의 중앙에 붙는다. 열매는 삭과이고, 긴 타원 모양이며, 길이가 12mm이고 양끝이 좁으며 3실이다. 각 실에는 검은 색의 종자가 1개씩 들어 있고, 종자에 3개의 날개가 있다. 뿌리줄기에는 약의 성분으로 쓸 수 있는 아스포닌, 살사포케닌 등이 들어 있다. 한방에서는 뿌리줄기를 약재로 쓰는데, 해열제로 사용하고, 만성기관지염, 당뇨병 등에 효과가 있다. 한국, 중국, 몽골 등지에 분포한다. Anemarrhena Asphodeloides ) are perennial herbs that reproduce as rhizomes or seeds. China is a country of origin and grows in mountains and fields. The rootstock is coarse and stretched sideways, and the leaves gather at the ends. Leaves are in the shape of a line, 20 ~ 70cm in length, with a thin thread at the end, a lower part wrapping around the inside of each other, the edge being plain, and the veins being side by side. The flowers bloom in June to July in light purple color, and 2-3 or more are gathered at the stem of the flower which comes out from the leaves, and run with the water inflorescence. Flower stem is 60 ~ 90cm in height and has egg-shaped long pointed cane. The corolla is a narrow tubular shape, 7 ~ 8mm long, and the tip is divided into 6 pieces. There are 3 stamens, attached to the center of the inner scape. Fruit is capsule, long elliptical shape, 12mm in length, narrow at both ends and 3 rooms. Each chamber contains one black seed and three wings on the seed. The rootstock contains asponin and salsapokinin which can be used as a medicine ingredient. Root stalks are used as medicines in herbal medicine. They are used as antipyretics, and are effective for chronic bronchitis and diabetes. It is distributed in Korea, China and Mongolia.

세이지(Salvia officinalis)는 약용 살비야라고도 한다. 세이지는 Common Sage, Garden Sage라고도 하며 흔히 Salvia라는 이름으로도 불린다. 줄기는 사각형으로 밑부분이 거의 목질화되며, 높이 30~90cm이고 전체에서 향기가 난다. 잎은 마주나고 잎자루가 짧으며, 긴 타원형으로 끝이 둔하고 가장자리가 밋밋하다. 잎 뒷면은 줄기와 함께 백색 털이 있어 회록색이고, 표면은 망상의 잔 주름이 있다. 꽃은 5~7월에 피고 자주색인데 가지 끝에 층층으로 달린 총상꽃차례이며, 위는 돌려난다. 꽃에는 꿀이 있어 꿀벌이 모이는 밀원식물이다. 꽃받침통은 종 모양이고 화관은 길이 1.5~2cm로 위아래의 2개의 꽃이 넓은 통부의 선단에 상하 두 입술처럼 갈라지는데, 윗입술은 끝이 파지고 아랫입술은 넓게 3개로 갈라진다. 수술은 2개이고 암술대는 화관의 윗입술보다 길게 나온다. 변종이 많아서 청색과 백색 꽃이 피는 것도 있다. 봄 또는 가을에 파종하고 8월에 잎을 따서 그늘에 말린 것을 샐비아 잎(folia salvia)이라 하며 약 2%의 정유(精油)가 함유되어 있다. 정유의 주성분은 피넨, 세스퀴테르펜, 보르네올 등으로 향기가 있어 소스, 카레, 돼지고기 요리 등의 향미료로 사용한다. 약용으로는 잎을 삶아서 인후염 및 위장염에 사용한다. 방부, 항균, 항염 등 살균 소독작용이 있으며 염증의 소염제로도 이용한다. 또한 중풍이나 심한 운동 뒤의 피로도 씻어준다. 남부 유럽 원산이고 옛날부터 구미 각국에서 가정용 향초(香草)로 널리 재배한다.Sage ( Salvia officinalis ) is also called medicinal salvia . Sage is also called Common Sage, Garden Sage, and is often called Salvia. The stem is rectangular, almost liquefied at the bottom, 30-90cm high, and smells throughout. Leaves are opposite, petiole is short, long oval, dull end, plain edge. The back side of the leaf has white hairs with stem, gray green color, and the surface has a reticular wrinkle on the surface. The flower is bloomed in May-July, purple, with a flower-shaped inflorescence on the end of the branch, and the stomach is turned. Flowers have honey, and honey bees come to the plant. The calyx tube is bell-shaped and the corolla is 1.5 ~ 2cm long. The upper and lower lips are divided into two upper and lower lips on the tip of two flower-shaped upper and lower tubes. The upper lip divides into three parts. The stamen is two and the style is longer than the upper lip of the corolla. There are many varieties and blue and white flowers bloom. It is planted in spring or fall and dried in the shade in August. It is called folia salvia and contains about 2% essential oil. The main ingredient of essential oil is fragrance such as pinene, sesquiterpene and borneol and is used as spice such as sauce, curry, pork dish. For medicinal purposes, the leaf is boiled and used for sore throat and gastroenteritis. Antiseptic, anti-bacterial, anti-inflammatory, such as anti-inflammatory action is also used as anti-inflammatory. It also cleanses the fatigue after a stroke or severe exercise. It is native to southern Europe and has been cultivated extensively as a home-use herb (herb) in Western countries from ancient times.

천수국(Tagetes Erecta)은 1년생 초본으로 종자로 번식하고 멕시코가 원산지인 관상식물이다. 원줄기는 높이 40~80cm 정도이고 가지가 많으며 전체에 털이 없이 평활하다. 어긋나거나 마주나는 경생엽은 1회 우상으로 갈라지고 열편은 피침형으로 가장자리에 잔 톱니가 있다. 8~10월에 1개씩 달리는 두상화는 지름 5~10cm 정도로 황색, 연한황색, 적황색 등으로 품종에 따라 다르다. 수과는 다소 모가 지며 굽고 관모는 가시 같다. 만수국에 비해 잎의 우편에 톱니가 없고 곁맥 끝에 유점이 있으며 설상화관의 윗부분은 입술처럼 퍼지고 가장자리는 물결모양이며 꽃은 황금색이다. 꽃과 뿌리는 '공작초'라 하며 약으로 쓰인다. Tagetes Erecta is a one-year-old herbaceous plant that grows as seeds and is native to Mexico. The main stem is about 40 ~ 80cm in height, has many branches, and is smooth without hair on the whole. The diagonal leaves that are shifted or facing each other are divided into right upper lobes, lobes are lanceolate, and there are small saw teeth on the edge. It is 5 ~ 10cm in diameter with yellow color, light yellow color, reddish yellow color, etc. It varies according to the varieties. Achenes are rather dense, with roots and tubular spines. There is no sawtooth on the posterior leaf of the mandarin soup, there is a point on the edge of the stem, the upper part of the mandarin flower spread like lips, the edge is wavy, and the flower is golden. Flowers and roots are called "hoofs" and are used as medicine.

본 발명에서 사용되는 지모, 세이지 및 천수국은 오프라인 또는 인터넷 마켓에서 구입할 수 있다.The bristles, sages, and bridges used in the present invention can be purchased offline or on the internet market.

본 발명은 지모, 세이지 및 천수국을 혼합하여 추출하고 효소처리하여 혼합추출물로서 제조하는 경우에 항산화, 탄력 증진, 주름개선 및 피부 미백 효과가 상승하여 더욱 우수해 진다는 것을 이용한 것이다.The present invention makes use of the fact that antioxidation, elasticity enhancement, wrinkle improvement and skin whitening effect are enhanced and improved when the extract is mixed with an extract of Zygo, sage and licorice and subjected to enzymatic treatment as a mixed extract.

본 발명에 따르면 β-글루코시다아제 효소처리 지모, 세이지 및 천수국 혼합추출물을 함유하는 화장료 조성물이 제공된다.According to the present invention, there is provided a cosmetic composition containing a? -Glucosidase enzyme-treated liposome, a sage, and a mixed extract of licorice root.

본 발명의 일 구체예에 따르면, 활성성분으로서의 상기 지모, 세이지 및 천수국 혼합추출물은 다음과 같이 제조된다.According to one embodiment of the present invention, the above-mentioned Zymo, Sage and Prunus mume mixed extracts as active ingredients are prepared as follows.

먼저, 지모, 세이지 및 천수국을 일정비로 혼합하여 용매 추출한다. 이때, 추출 용매로는 물, 탄소수 1 내지 4의 무수 또는 함수알코올, 에틸아세테이트, 아세톤, 글리세린, 프로필렌글리콜 및 부틸렌글리콜로 이루어지는 군으로부터 선택되는 적어도 하나의 것이 사용된다. 바람직하게는 70% 에탄올이 사용된다.First, the solvent is extracted by mixing the gypsum, the sage and the water source at a certain ratio. At this time, at least one selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, propylene glycol and butylene glycol is used as an extraction solvent. Preferably 70% ethanol is used.

이때, 상기 지모, 세이지 및 천수국은 각각 1~3:1~3:1~3의 비로 혼합하여 추출되는 것이며, 더욱 바람직하게는 3:1:2로 혼합되어 추출되는 것이다. 특히, 지모, 세이지 및 천수국을 건조 중량비 3:1:2로 혼합 추출하는 경우에 그 수율이나 탄력 증진, 주름개선 및 피부 미백 효과에서 가장 우수한 효과를 나타내었다.At this time, the hair, sage, and shooter are mixed with each other at a ratio of 1: 3: 1 to 3: 1 to 3, more preferably 3: 1: 2. Especially, the best effect was obtained in the yield, elasticity enhancement, wrinkle improvement and skin whitening effect in the case of mixing and extracting with 3: 1: 2 dry weight ratio of gilts, sage and water plants.

상기 추출물의 제조에 있어서, 지모의 뿌리줄기, 세이지의 잎, 천수국의 꽃 부위를 사용하는 것이 바람직하다.In the production of the above extract, it is preferable to use rootstock of Zygo, leaf of sage, flower part of flower garden.

본 발명에서는 상기 용매추출 후 효소처리 공정을 추가하여 유효성분을 더욱 효율적으로 추출한다. 본 발명의 일 구체예에 따르면 효소처리 지모, 세이지 및 천수국 혼합추출물은 다음과 같이 제조된다. 먼저, 지모, 세이지 및 천수국을 세절하고, 그 건조 중량의 1~80배 부피량의 용매, 즉 물, 탄소수 1 내지 4의 무수 또는 함수알코올, 에틸아세테이트, 아세톤, 글리세린, 프로필렌글리콜 및 부틸렌글리콜로 이루어지는 군으로부터 선택되는 적어도 하나의 추출용매를 가하여 90~95℃에서 1~2시간 중탕 추출한다. 이후 상기 용매추출물에 β-글루코시다아제 효소를 넣어 50~55℃에서 100rpm 정도로 교반하면서 4~5시간 동안 반응시킨다. 90℃로 5분 정도 가온하여 효소반응을 정지시킨 후, 여과하고 감압농축기로 농축하여 효소처리 혼합추출물을 제조한다.In the present invention, after the solvent extraction, an enzyme treatment process is added to extract the active ingredient more efficiently. According to one embodiment of the present invention, the enzyme-treated glutinous, sage and lichen mixed extracts are prepared as follows. First, the chewing gum, the sage and the water gill are cut and a solvent of 1 to 80 times their dry weight, that is, water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, propylene glycol and butylene glycol , And the mixture is extracted with hot water at 90 to 95 ° C for 1 to 2 hours. Then, β-glucosidase enzyme is added to the solvent extract, and the mixture is reacted at 50~55 ° C. with stirring at 100 rpm for 4~5 hours. After incubation at 90 ° C for about 5 minutes, the enzyme reaction is stopped, followed by filtration and concentration with a vacuum concentrator to prepare an enzyme-treated mixed extract.

이와 같이 제조된 상기 혼합추출물은 우수한 항산화, 탄력 증진, 주름개선 및 피부 미백 효과를 가지는 것으로 확인되었다.The thus-obtained mixed extract was found to have excellent antioxidation, elasticity enhancement, wrinkle improvement, and skin whitening effect.

이와 같이 제조된 상기 지모, 세이지 및 천수국 혼합추출물은 화장료 전체 중량에 대하여 0.001 ~ 30중량%, 더욱 바람직하게는 0.001~5.0중량%의 비율로 첨가된다.The mixed extract of Zymo, sage and licorice thus prepared is added in a proportion of 0.001 to 30% by weight, more preferably 0.001 to 5.0% by weight, based on the total weight of the cosmetic.

본 발명에 있어서, 활성성분으로서의 상기 지모, 세이지 및 천수국 혼합추출물은 상기 활성성분을 안정화시키고, 피부 흡수율을 높이기 위해 리포좀화되어 포함될 수 있다.In the present invention, the above-mentioned liposomes, sage and licorice mixed extract as an active ingredient may be liposomized to stabilize the active ingredient and increase the skin absorption rate.

본 발명의 일 구체예에 따르면, 상기 지모, 세이지 및 천수국 혼합추출물이 포접된 리포좀은 화장료 조성물의 총 중량에 대해서 0.1~20.0 중량%, 바람직하게는 1.0~10.0 중량% 함유된다. 이때, 상기 리포좀에 포함되는 생약 추출물의 함량은 리포좀의 총 중량에 대해서 1.0~20.0 중량%, 바람직하게 4.0~12.0 중량%이다.According to one embodiment of the present invention, the liposome encapsulated with the mixed extract of Zygo, sage and licorice is contained in an amount of 0.1 to 20.0% by weight, preferably 1.0 to 10.0% by weight based on the total weight of the cosmetic composition. At this time, the content of herbal medicine extract contained in the liposome is 1.0-20.0 wt%, preferably 4.0-12.0 wt% with respect to the total weight of the liposome.

본 발명의 일구체예에 따르면, 상기 리포좀은 다음과 같이 제조된다. (i)폴리올, (ii)계면활성제, (iii)인지질, (iv)지방산 및 (v)물을 포함하는 혼합물에 의해 제조되며, 상기 혼합물은 1가 알코올(예:에탄올)을 포함하지 않는 것을 특징으로 한다.According to one embodiment of the present invention, the liposome is prepared as follows. is prepared by a mixture comprising (i) a polyol, (ii) a surfactant, (iii) a phospholipid, (iv) a fatty acid and (v) water, said mixture not containing a monohydric alcohol .

본 발명의 리포좀에 이용되는 폴리올은 제한되지 않으며, 바람직하게는 프로필렌글리콜, 디프로필렌글리콜, 1,3-부틸렌글리콜, 글리세린, 메틸프로판디올, 이소프렌글리콜, 펜틸렌글리콜, 에티스티톨, 자이리톨, 솔비톨 및 이의 혼합물로 구성된 군으로부터 선택된다. 가장 바람직하게는 프로필렌글리콜이다. 그 사용량은 리포좀 총 중량에 대하여 10.0~80.0중량%, 바람직하게는 30.0~70.0중량%이다.The polyol used in the liposome of the present invention is not limited and preferably propylene glycol, dipropylene glycol, 1,3-butylene glycol, glycerin, methylpropanediol, isoprene glycol, pentylene glycol, ethititol, Sorbitol, and mixtures thereof. Most preferably propylene glycol. The amount thereof is 10.0 to 80.0% by weight, preferably 30.0 to 70.0% by weight based on the total weight of the liposome.

본 발명의 리포좀의 제조에 이용되는 계면활성제로는 당업계에 공지된 어떤 것도 사용할 수 있으며, 예를 들어, 음이온성 계면활성제, 양이온성 계면활성제, 양성 계면활성제 및 비이온성 계면활성제가 사용될 수 있고, 바람직하게는 음이온성 계면활성제 및 비이온성 계면활성제가 사용된다. 음이온성 계면활성제의 구체적인 예는 알킬아실글루타메이트, 알킬포스페이트, 알킬락틸레이트, 디알킬포스페이트 및 트리알킬포스페이트를 포함한다. 비이온성 계면활성제의 구체적인 예는 알콕시레이티드 알킬에테르, 알콕시레이티드 알킬에스테르, 알킬 폴리글리코사이드, 폴리글리세릴에스테르 및 슈가에스테르를 포함한다. 가장 바람직하게는, 비이온성 계면활성제에 속하는 폴리솔베이트류가 이용된다. 계면활성제의 사용량은, 리포좀 총 중량에 대하여 0.1~10.0 중량%이고, 바람직하게는 0.5~5.0 중량%이다.As the surfactant used in the production of the liposome of the present invention, any of those known in the art can be used, and for example, anionic surfactants, cationic surfactants, amphoteric surfactants and nonionic surfactants can be used , Preferably an anionic surfactant and a nonionic surfactant are used. Specific examples of anionic surfactants include alkyl acyl glutamates, alkyl phosphates, alkyl lactylates, dialkyl phosphates and trialkyl phosphates. Specific examples of nonionic surfactants include alkoxylated alkyl ethers, alkoxylated alkyl esters, alkyl polyglycosides, polyglyceryl esters and sugar esters. Most preferably, polysorbates belonging to the nonionic surfactant are used. The amount of the surfactant to be used is 0.1 to 10.0% by weight, preferably 0.5 to 5.0% by weight, based on the total weight of the liposome.

본 발명의 리포좀의 제조에 이용되는 또 다른 성분인 인지질은 양쪽친화성 지질로 이용된 것으로서, 천연 인지질(예: 난황 레시틴 또는 대두 레시틴, 스핑고마이엘린) 및 합성 인지질(예: 디팔미토일포스타티딜콜린 또는 수첨 레시틴)을 포함하며, 바람직하게는 레시틴이다. 보다 바람직하게는, 상기 레시틴은 대두 또는 난황에서 추출한 천연 유래의 불포화 레시틴 또는 포화 레시틴이다. 통상적으로 천연 유래의 레시틴은 포스파티딜 콜린의 양이 23.0~95.0%, 그리고 포스파티딜에탄올아민의 양이 20%이하이다. 본 발명의 리포좀의 제조에 있어서, 레시틴의 사용량은 리포좀 총 중량에 대하여 0.5~20.0 중량%이며, 바람직하게는 2.0~8.0 중량%이다.The phospholipid, which is another component used in the production of the liposome of the present invention, is used as both affinity lipids, and is a natural phospholipid such as egg yolk lecithin or soy lecithin, sphingomyelin and synthetic phospholipids such as dipalmitoylphosphate Tylicolin or hydrogenated lecithin), preferably lecithin. More preferably, the lecithin is a natural derived unsaturated lecithin or saturated lecithin extracted from soybean or egg yolk. Normally, the amount of phosphatidyl choline in the naturally occurring lecithin is 23.0 to 95.0%, and the amount of phosphatidyl ethanolamine is 20% or less. In the production of the liposome of the present invention, the amount of lecithin to be used is 0.5 to 20.0% by weight, preferably 2.0 to 8.0% by weight based on the total weight of the liposome.

본 발명의 리포좀 제조에 이용되는 지방산은 고급 지방산으로서, 바람직하게는 C_12-22 알킬 체인의 포화 또는 불포화지방산으로서, 예컨대, 라우린산, 미리스트산, 팔미트산, 스테아린산, 올레산 및 리놀레산을 포함하며, 가장 바람직하게는 스테아린산을 사용한다. 그 사용량은 리포좀 총 중량에 대하여 0.05~3.0 중량%이고, 바람직하게는 0.1~1.0 중량%이다.The fatty acid used in the production of the liposome of the present invention is a higher fatty acid, preferably a saturated or unsaturated fatty acid of C _12-22 alkyl chain such as lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid and linoleic acid And most preferably stearic acid is used. The amount thereof is 0.05 to 3.0% by weight, preferably 0.1 to 1.0% by weight based on the total weight of the liposome.

본 발명의 리포좀의 제조에 이용되는 물은 탈이온화된 증류수이다.The water used to prepare the liposomes of the present invention is deionized distilled water.

리포좀의 제조는 당 업계에 공지된 다양한 방법을 통해 이루어질 수 있으나, 가장 바람직하게는 상기 성분들을 포함하는 혼합물을 고압 호모게나이저에 적용하여 제조된다. 고압 호모게나이저에 의한 리포좀의 제조는 소망하는 입자 크기에 따라 다양한 조건(압력 및 횟수 등)으로 실시할 수 있으며, 바람직하게는 600~1200 bar 압력하에서 1~5회 고압 호모게나이저를 통하도록 하여 평균 입자 지름은 30~70 nm인 리포좀을 제조한다. 상기 크기를 가지는 리포좀의 경우에 제형 안정성 및 피부 흡수율이 더욱 우수하였다. 이렇게 제조된 리포좀 시스템은 난용성 물질을 녹임과 동시에 불안정한 물질을 안정화시켜 피부침투 효과를 극대화하는 장점을 가지고 있다.The preparation of liposomes can be accomplished through a variety of methods known in the art, but most preferably is made by applying a mixture comprising the ingredients to a high pressure homogenizer. The preparation of the liposome by high pressure homogenizer can be carried out under various conditions (pressure and frequency, etc.) depending on the desired particle size, preferably through the high pressure homogenizer 1-5 times under 600-1200 bar pressure To prepare a liposome having an average particle diameter of 30 to 70 nm. In the case of the liposome having the above-mentioned size, the formulation stability and the skin absorption rate were better. The liposome system thus produced has the advantage of maximizing the penetration effect of the skin by stabilizing the unstable substance while melting the poorly soluble substance.

본 발명의 화장료 조성물은 그 제형에 있어서 특별히 한정되는 바가 없으며, 예를 들면, 외용액제, 크림제, 연고제, 페이스트, 에어로졸제, 겔제, 왁스제 등의 화장료 조성물에 적용가능하다. 또한, 각 제형의 화장료 조성물에 있어서, 상기의 지모, 세이지 및 천수국 혼합추출물 외에 다른 성분들을 기타 화장료의 제형 또는 사용목적 등에 따라 임의로 선정하여 배합할 수 있다. 예를 들어, 화장료 조성물에 통상적으로 사용되는 착색제(색소), 착향제(향료), 현탁화제, 유화제, 용해보조제, 안정제, 등장제, pH조절제, 점도조절제, 용제, 방부제 등을 포함할 수 있다.The cosmetic composition of the present invention is not particularly limited in its formulation and can be applied to cosmetic compositions such as external liquid, cream, ointment, paste, aerosol, gel, wax and the like. In addition, in the cosmetic composition of each formulation, components other than the above-mentioned mixed extract of Zymosan, sage and licorice can be arbitrarily selected and formulated according to the formulation or purpose of use of other cosmetics. For example, it may include colorants (coloring matters), flavoring agents (flavoring agents), suspending agents, emulsifying agents, dissolution aids, stabilizers, isotonic agents, pH adjusting agents, viscosity adjusting agents, solvents, preservatives and the like which are conventionally used in cosmetic compositions .

또한, 본 발명의 화장료 조성물은 지모, 세이지 및 천수국 혼합추출물 외에 피부 탄력 개선 및 노화방지 화장료 조성물이 효과를 나타내는 다른 유효성분을 더욱 포함할 수도 있다.In addition, the cosmetic composition of the present invention may further contain other active ingredients exhibiting the effect of the skin elasticity improvement and anti-aging cosmetic composition, in addition to the gym, sage and licorice extract.

이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

[실시예][Example]

실시예Example 1: 지모, 세이지 및 1: Bristle, sage and 천수국A floating country 혼합추출물 제조 Mixed Extract Manufacture

경동시장에서 구매한, 지모의 뿌리줄기, 세이지 잎, 천수국 꽃 각각 200g, 200g, 200g을 정제수로 세척, 건조시킨 후 사용하였다. 70% 에탄올 2kg을 넣고 냉각콘덴서가 달린 추출기에서 60 ~ 80℃에서 4 시간 끓여서 추출하였다. 이 후 β-글루코시다아제 효소 10g을 넣어 55℃에서 100rpm으로 4시간 동안 반응시켰다. 90℃로 5분간 가온하여 효소반응을 완료한 후 300메쉬 여과지로 여과하고, 에드벤텍 5번 여과지와 와트만 GFC 150mm 여과지로 2번 여과하여 효소처리한 추출물을 얻었다.200g, 200g, and 200g of the rootstock, sage leaf, and water flower of each bud, purchased from Kyungdong market, were washed with purified water and dried. 2 kg of 70% ethanol was added and the mixture was boiled for 4 hours at 60 ~ 80 ℃ in an extractor equipped with a condenser. Then, 10 g of? -Glucosidase enzyme was added and reacted at 55 ° C and 100 rpm for 4 hours. After the enzyme reaction was completed by heating at 90 ° C for 5 minutes, the reaction mixture was filtered through a 300 mesh filter paper, and then filtered twice with Edbentek 5 filter paper and Wattman GFC 150 mm filter paper to obtain an enzyme-treated extract.

종이 여과지로 1차 여과하고, 여액을 1.0㎛ 기공크기의 멤브레인 필터로 2차 여과한 후 0.45㎛ 기공크기의 멤브레인 필터로 마지막 여과하여 추출공정을 수행하였다.The filtrate was subjected to primary filtration with a paper filter paper, followed by secondary filtration with a membrane filter having a pore size of 1.0 mu m, followed by final filtration with a membrane filter having a pore size of 0.45 mu m.

성분분석을 통하여 탄력 증진, 주름개선 및 피부 미백 효과에 관련된 망기페린(Mangiferin), 이소퀘르시트린(Isoquercitrin), 퀘르세틴(Quercetin)의 함량을 측정하였으며, 그 결과를 하기 표 1에 나타내었다.The contents of mangiferin, isoquercitrin, and quercetin related to the improvement of elasticity, improvement of wrinkles and skin whitening effect were measured through ingredient analysis, and the results are shown in Table 1 below.

구 분division 혼합 비율Mixing ratio MangiferinMangiferin IsoquercitrinIsoquercitrin QuercetinQuercetin 실시예 1Example 1 1:1:11: 1: 1 0.005%0.005% 2.3%2.3% 0.49%0.49%

실시예Example 2~12: 혼합비율에 따른 지모, 세이지 및 2 to 12: Mixing ratio of the hair, sage and 천수국A floating country 혼합추출물 제조 Mixed Extract Manufacture

지모, 세이지 및 천수국의 중량비를 하기 표와 같이 조절(총 중량 600g)하여 실시예 1과 동일한 방법으로 추출 및 여과하였다. 성분분석 결과는 하기 표 2와 같다. 각 생약재의 혼합 비율에 따라 활성성분의 함량에 차이를 나타내었으며, 실시예 10의 혼합비에서 특히 높은 함량을 나타내었다.(Total weight: 600 g) were weighed and filtered out in the same manner as in Example 1. The results of the component analysis are shown in Table 2 below. The content of the active ingredient was varied according to the mixing ratio of each herb medicament, and the content was particularly high in the mixing ratio of Example 10.

구 분division 혼합 비율Mixing ratio MangiferinMangiferin IsoquercitrinIsoquercitrin QuercetinQuercetin 실시예 2Example 2 1:2:11: 2: 1 0.010%0.010% 1.00%1.00% 0.17%0.17% 실시예 3Example 3 1:1:21: 1: 2 0.002%0.002% 1.30%1.30% 0.27%0.27% 실시예 4Example 4 2:1:12: 1: 1 0.001%0.001% 1.80%1.80% 1.10%1.10% 실시예 5Example 5 2:2:12: 2: 1 0.003%0.003% 2.40%2.40% 0.90%0.90% 실시예 6Example 6 1:2:21: 2: 2 0.007%0.007% 2.10%2.10% 1.10%1.10% 실시예 7Example 7 3:1:13: 1: 1 0.009%0.009% 1.80%1.80% 1.40%1.40% 실시예 8Example 8 1:3:11: 3: 1 0.011%0.011% 2.00%2.00% 1.70%1.70% 실시예 9Example 9 1:1:31: 1: 3 0.004%0.004% 1.40%1.40% 0.60%0.60% 실시예 10Example 10 3:1:23: 1: 2 0.015%0.015% 2.50%2.50% 1.80%1.80% 실시예 11Example 11 2:3:22: 3: 2 0.008%0.008% 1.90%1.90% 1.30%1.30% 실시예 12Example 12 2:2:32: 2: 3 0.009%0.009% 0.160%0.160% 0.70%0.70%

혼합추출물을 가지고 피부개선효과를 확인하고자 추출물은 농축 후 동결 건조하였고, Radical 소거능 측정 및 세포 내 효능평가 샘플을 준비하였다. 그리고 DPPH free radical, Superoxide Radical, Alkyl Radical 및 Hydroxyl Radical 소거능을 확인하였다.The extracts were concentrated, lyophilized, and examined for radical scavenging activity and intracellular efficacy. DPPH free radical, Superoxide Radical, Alkyl Radical and Hydroxyl Radical scavenging ability were confirmed.

비교예Comparative Example 1: 지모 추출물의 제조 1: Preparation of gum extract

경동시장에서 구매한, 지모 뿌리줄기 600g을 정제수로 세척, 건조시킨 후 상기 실시예 1의 방법과 동일한 방법으로 실시하여, 추출물을 제조하였다.600 g of P. radishes purchased from Kyungdong market were washed with purified water and dried to obtain an extract by the same method as in Example 1.

비교예Comparative Example 2: 세이지 추출물의 제조 2: Preparation of sage extract

경동시장에서 구매한, 세이지 잎 600g을 정제수로 세척, 건조시킨 후 상기 실시예 1의 방법과 동일한 방법으로 실시하여, 추출물을 제조하였다.600 g of sage leaves purchased from Kyungdong market were washed with purified water and dried to obtain an extract by the same method as in Example 1.

비교예Comparative Example 3: 3: 천수국A floating country 추출물의 제조 Preparation of extract

경동시장에서 구매한, 천수국 꽃 600g을 정제수로 세척, 건조시킨 후 상기 실시예 1의 방법과 동일한 방법으로 실시하여, 추출물을 제조하였다.600 g of a flower of a flower of Korea purchased from Kyungdong market was washed with purified water and dried to obtain an extract by the same method as in Example 1.

시험예Test Example 1: One: DPPHDPPH free radical free radical 소거능Scatters 측정 Measure

DPPH free radical 소거능은 Nanjo et al.(1996)의 방법에 따라 측정하였다. 시료 30㎕에 60μM DPPH(1,1-diphenyl-2-picrylhydrazyl) 용액 30㎕를 혼합 후, 반응액을 100㎕ quartz capillary tube에 옮겨 2분 후 electron spin resonance(ESR) spectrometer(JES-FA, JEOL Ltd., Tokyo, Japan)로 측정하였다. 실험조건은 다음과 같다. DPPH free radical scavenging activity was measured by the method of Nanjo et al. (1996). 30 μl of 60 μM DPPH (1,1-diphenyl-2-picrylhydrazyl) solution was added to 30 μl of the sample, and the reaction solution was transferred to a 100 μl quartz capillary tube. Electron spin resonance (ESR) spectrometer (JES- Ltd., Tokyo, Japan). The experimental conditions are as follows.

magnetic field, 336.5±5 mT; power, 5 mW; modulation frequency, 9.41 GHz; amplitude, 1×1,000; sweep time, 30s; temperature, 298 K.magnetic field, 336.5 ± 5 mT; power, 5 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30s; temperature, 298 K.

DPPH radical 소거능은 H 와 H₀ 의 상대적인 radical signal peak 높이의 차에 의하여 계산하였다. 그 결과를 하기 표 3에 나타내었다.The DPPH radical scavenging activity was calculated by the difference in the relative radical signal peak heights of H and H ₀ . The results are shown in Table 3 below.

시험예Test Example 2: 2: SuperoxideSuperoxide radical radical 소거능Scatters 측정 Measure

Superoxide radical은 Guo et al.(1999)에 따라 시료 10㎕에 0.3mM riboflavin 10㎕, 1.6mM EDTA 10㎕, 800mM DMPO 10㎕를 첨가 후 365nm의 UV lamp에서 1분 동안 조사하였다. 반응물을 quartz capillary tube에 옮긴 후, ESR spectrometer를 이용하여 분석하였으며 실험조건은 다음과 같다.Superoxide radicals were irradiated with 10 μl of 0.3 mM riboflavin, 10 μl of 1.6 mM EDTA and 10 μl of 800 mM DMPO in 10 μl of a sample according to Guo et al. (1999), and then irradiated with UV lamp at 365 nm for 1 minute. The reaction was transferred to a quartz capillary tube and analyzed using an ESR spectrometer. The experimental conditions were as follows.

magnetic field, 336.5±5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1×1,000; sweep time, 30s; temperature 298 K. magnetic field, 336.5 ± 5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30s; temperature 298 K.

Superoxide radical 소거능은 H과 H₀의 상대적인 peak를 이용하는 수식에 의해 계산되었다. 그 결과를 하기 표 3에 나타내었다.Superoxide radical scavenging activity was calculated by the equation using the relative peaks of H and H ₀ . The results are shown in Table 3 below.

시험예Test Example 3: Alkyl radical 3: Alkyl radical 소거능Scatters 측정 Measure

10㎕의 시료에 각각 10㎕의 PBS(Phosphate buffered saline), 40mM AAPH (2,2-azobis-(2-amidinopropane)-dihydrochloride), 40mM POBN α-(4-pyridyl-1- oxide)-N-tert-butylnitrone을 첨가한다. 그리고 37℃에서 30분간 반응시킨 후 quartz capillary tube에 옮겨 ESR spectrometer를 이용하여 측정하였다. 실험조건은 다음과 같다.10 μl of each sample was supplemented with 10 μl of PBS (Phosphate buffered saline), 40 mM AAPH (2,2-azobis- (2-amidinopropane) -dihydrochloride), 40 mM POBN α- (4-pyridyl- Add tert-butylnitrone. After incubation at 37 ° C for 30 min, the cells were transferred to a quartz capillary tube and measured by ESR spectrometer. The experimental conditions are as follows.

magnetic field, 336.5±5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1×1000; sweep time, 1 min; temperature 298 K. magnetic field, 336.5 ± 5 mT; power, 10mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1000; sweep time, 1 min; temperature 298 K.

Alkyl radical 소거능은 아래의 식으로 계산하였다. 그 결과를 하기 표 3에 나타내었다.Alkyl radical scavenging activity was calculated by the following formula. The results are shown in Table 3 below.

시험예Test Example 4: Hydroxyl radical 4: Hydroxyl radical 소거능Scatters 측정 Measure

Hydroxyl radical 소거능은 Rosen et al.(1984)의 방법으로 분석하였다. 시료 20㎕에 0.3M DMPO 20㎕, 10mM FeSO₄ 20㎕, 10mM H₂O₂ 20㎕을 혼합한 다음 quartz capillary tube에 옮긴 후, 2.5분 후에 ESR spectrometer로 측정하였다. 실험조건은 다음과 같다.Hydroxyl radical scavenging activity was analyzed by the method of Rosen et al. (1984). 20 μl of 0.3 M DMPO, 20 μl of 10 mM FeSO _{4 and} 20 μl of 10 mM H ₂ O ₂ were added to a quartz capillary tube and measured by ESR spectrometer after 2.5 minutes. The experimental conditions are as follows.

magnetic field, 336.5±5 mT; power, 1mW; modulation frequency, 9.41 GHz; amplitude, 1×200; sweep time, 4 min; temperature 298 K. magnetic field, 336.5 ± 5 mT; power, 1mW; modulation frequency, 9.41 GHz; amplitude, 1 × 200; sweep time, 4 min; temperature 298 K.

Hydroxy radical 소거능은 H와 H₀의 상대적인 높이에 의해 측정하는 다음 수식에 의해 계산되었다. 그 결과를 하기 표 3에 나타내었다.Hydroxy radical scavenging activity was calculated by the following equation, measured by the relative heights of H and H ₀ : The results are shown in Table 3 below.

구분division Radical scavenging activity (%) at concentration 2.5㎎/㎖.Radical scavenging activity (%) at concentration 2.5 mg / ml. DPPHDPPH HydroxylHydroxyl AlkylAlkyl SuperoxideSuperoxide 실시예1Example 1 55.03 ± 1.055.03 ± 1.0 57.46 ± 0.8357.46 ± 0.83 55.39 ± 0.5255.39 + - 0.52 51.42 ± 1.1151.42 + 1.11 실시예5Example 5 57.25 ± 0.8657.25 + - 0.86 65.13 ± 1.0565.13 + - 1.05 53.83 ± 0.7253.83 + - 0.72 56.98 ± 0.9156.98 + - 0.91 실시예8Example 8 58.27 ± 0.9858.27 + - 0.98 61.52 ± 1.0161.52 ± 1.01 54.05 ± 1.1454.05 + 1.14 55.02 ± 1.2455.02 + - 1.24 실시예10Example 10 64.34 ± 0.8064.34 + - 0.80 68.21 ± 0.8168.21 + - 0.81 60.77 ± 1.0660.77 ± 1.06 61.92 ± 0.5261.92 + - 0.52 비교예1Comparative Example 1 54.12 ± 1.0854.12 ± 1.08 58.75 ± 0.8258.75 + - 0.82 50.19 ± 0.8850.19 ± 0.88 51.32 ± 1.0451.32 ± 1.04 비교예2Comparative Example 2 52.07 ± 1.0152.07 ± 1.01 57.52 ± 0.9157.52 ± 0.91 49.05 ± 1.1849.05 ± 1.18 48.08 ± 1.2248.08 ± 1.22 비교예3Comparative Example 3 52.25 ± 0.6852.25 + - 0.68 56.23 ± 1.0256.23 + - 1.02 49.01 ± 0.3249.01 + - 0.32 45.81 ± 0.8845.81 + - 0.88

상기 표 3에서 확인되는 바와 같이 라디칼 소거능 효과에 있어서, 본 발명 효소처리 지모, 세이지 및 천수국 혼합추출물은 생약재 각각의 발효추출물보다 우수한 결과를 확인할 수 있었다. As shown in the above Table 3, in the radical scavenging effect, the enzyme-treated zymosan, sage and licorice mixed extract of the present invention showed superior results to the fermented extracts of the herbal medicines .

그 가운데서도 지모, 세이지 및 천수국을 3:1:2로 혼합하여 추출한 실시예 10의 혼합발효추출물에서 가장 우수한 항산화 활성을 나타내었다. Among them Fermented extract of Example 10, which was prepared by mixing 3: 1: 2 of water, methanol, sage, and water, and showed the best antioxidative activity .

시험예Test Example 6: 세포독성 시험 6: Cytotoxicity test

세포 배양Cell culture

추출물들의 항노화에 작용하는 유전자 발현을 확인하기 위하여 콜라게나제(Collagenase)와 TIMP-1는 HaCaT(Human keratinocyte cell line)에서, MMP-1와 트로포엘라스틴(Tropoelastin)은 CCD-986Sk(Human fibroblast cell line)에서, 미백에 작용하는 유전자 발현을 확인하기 위하여 티로시나제(Tyrosinase)와 MITF는 B16F10 melanoma cells을 사용하였다. HaCaT, CCD-986Sk 및 B16F10 melanoma 세포는 10%(v/v) FBS(fetal bovine serum, Gibco, USA), 100U/mL의 streptomycin, 100U/mL의 penicillin 항생제(Gibco, USA)가 포함된 DMEM(Dulbeco's modified eagle's medium, Gibco, USA)배지를 사용하여 5% CO₂ 및 37℃ 조건의 인큐베이터에서 배양하였다.Collagenase and TIMP-1 were detected in HaCaT (human keratinocyte cell line), MMP-1 and tropoelastin were detected in CCD-986Sk (Human fibroblast cell line), tyrosinase and MITF were used for B16F10 melanoma cells in order to confirm gene expression in whitening. HaCaT, CCD-986Sk and B16F10 melanoma cells were cultured in DMEM containing 10% v / v FBS (fetal bovine serum, Gibco, USA), streptomycin at 100 U / mL, penicillin antibiotics at 100 U / Dulbeco's modified eagle's medium, Gibco, USA). The cells were cultured in an incubator at 5% CO ₂ and 37 ° C.

세포 생존율 측정 실험(Cell viability measurement experiment MTTMTT assay) assay)

MTT assay법은 MTT [3-(4,5-dimethythiasol-2-yl)-2,5-diphenyl tetrazolium bromide] 시약이 세포 내로 흡수된 후 미토콘드리아의 숙신산 탈수소효소(succinate dehydrogenase)에 의해 포마잔(formazan)을 형성하는데, 이 물질의 세포 내 축적은 미토콘드리아의 활성, 넓게는 세포의 활성을 의미하는 것으로써 세포의 생존율을 측정하는 대표적인 방법이다.MTT assays were performed by succinate dehydrogenase of mitochondria after MTT [3- (4,5-dimethythiasol-2-yl) -2,5-diphenyl tetrazolium bromide] The intracellular accumulation of this substance means the activity of mitochondria, and broadly, the activity of cells, and is a typical method for measuring the survival rate of cells.

각각의 HaCaT, CCD-986Sk 및 B16F10 melanoma 세포를 1×10⁵cell/well의 밀도로 96 well에 200㎕ 배지와 함께 분주한 뒤 5% CO₂, 37℃ incubator에서 24시간 배양한 후 배지를 버리고 PBS로 씻어준 다음, 같은 양의 배지와 PBS에 녹인 시료를 0.1%에서 5.0%까지 다양한 농도에 따라 각 well에 처리하여 24시간 배양하였다. 배양이 끝나기 4시간 전에 PBS에 녹인 5㎎/㎖ MTT를 20㎕씩 각 well에 첨가하고 알루미늄 호일로 차광시킨 후 3시간 동안 5% CO₂ 및 37℃ 조건의 incubator에서 배양하였다. 배양액을 제거하고 DMSO용액 200㎕를 첨가하여 37℃ incubator에서 1시간 반응 시킨 후 ELISA reader를 이용하여 570nm에서 흡광도를 측정하여 비교하였다. 세포 생존율은 하기 식에 의해 산출되었고, 그 결과는 하기 표 4에 나타내었다.Each HaCaT, CCD-986Sk, and B16F10 melanoma cells were seeded at a density of 1 × 10 ⁵ cells / well in 96-wells with 200 μl of the medium, cultured in a 5% CO ₂ incubator at 37 ° C. for 24 hours, After washing with PBS, the same amount of the medium and the sample dissolved in PBS were cultured in each well at various concentrations ranging from 0.1% to 5.0% and cultured for 24 hours. Four hours before the end of incubation, 20 μl of 5 mg / ml MTT dissolved in PBS was added to each well, shaded with aluminum foil, and cultured in a 5% CO ₂ and 37 ° C incubator for 3 hours. After removing the culture medium, 200 μl of DMSO solution was added, incubated at 37 ° C for 1 hour, and absorbance was measured at 570 nm using an ELISA reader. Cell viability was calculated by the following equation, and the results are shown in Table 4 below.

구분division 세포 생존율(%)Cell survival rate (%) 0.1 %0.1% 0.5 %0.5% 1 %One % 5.0 %5.0% 실시예 1Example 1 100100 100100 100100 100100 실시예 5Example 5 100100 100100 100100 100100 실시예 8Example 8 100100 100100 101101 100100 실시예 10Example 10 100100 101101 100100 100100 비교예 1Comparative Example 1 101101 100100 100100 100100 비교예 2Comparative Example 2 100100 100100 100100 100100 비교예 3Comparative Example 3 101101 101 101 101 101 101101 대조군
AdenosineControl group
Adenosine 100100 101101 100100 100100 대조군
ArbutinControl group
Arbutin 101101 100100 101101 100100

상기 표 4에서 확인되는 바와 같이 상기 실시예, 비교예 그리고 대조군 Adenosine(아데노신) Arbutin(알부틴) 모두 세포독성을 나타내지 않았다.As shown in the above Table 4, neither of the examples, the comparative examples, and the control group Adenosine (adenosine) Arbutin (arbutin) showed cytotoxicity.

시험예Test Example 7: 7: 세포내Intracellular CollagenaseCollagenase , , TimpTimp -1 및 -1 and Tropoelastin의Tropoelastin 유전자 발현과 MMP-1의 유전자 발현 억제 효과. Gene expression and inhibition of gene expression of MMP-1.

HaCaT와 CCD-986Sk 세포는 세포의 수를 5×10⁵cells/㎖로 조제한 후에 페트리디쉬에 처리하여 24시간 동안 5% CO₂및 37℃의 조건에서 배양하였다. 세포가 페트리디쉬에서 80% 이상 자란 다음, 추출물을 세포 생존율 100% 이상으로 나타난 농도로 첨가하였다.HaCaT and CCD-986Sk cells were cultured at 5% CO ₂ and 37 ° C for 24 hours after treatment with 5 × 10 ⁵ cells / ml. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

상기 실시예 및 비교예의 추출물들을 처리한 후, DMED/10 FBS에서 24시간 동안 5% CO₂ 및 37℃의 조건에서 배양하였다. 24시간 후 세포에서 RNA 분리, cDNA 합성 및 RT-PCR은 Komoroski 등(Drug Metab. Dispos. 32:512-518, 2004)이 기술한 방법에 따라 수행하였다. RT-PCR에서 측정한 유전자는 COL1A1, TIMP-1 및 Tropoelastin의 발현과 MMP-1의 발현 억제를 확인하였다. 유전자 발현의 차이를 확인하기 위해 house keeping gene으로 GAPDH을 사용하였다.The extracts of the above Examples and Comparative Examples were treated and then cultured in DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C. After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.

각각의 유전자의 프라이머 서열은 표 5에 나타냈다. 추출된 RNA를 주형으로 올리고 dT-어댑터 프라이머(Oligo dT-adaptor primer)와 DEPC water를 이용하여 총량 15㎕로 하고 70℃ 5분 변성 후, M-MLV(Moloney murine leukemia virus) RNA의 역전사를 수행하여 42℃ 60분, 94℃ 5분 cDNA를 합성하였다. 합성된 cDNA는 PCR 반응을 통해 증폭하였으며, 총 반응액은 25㎕로 하였다. 각 반응물의 최종 농도는 프라이머 100 pmol, 1.0μM, dNTP 혼합액 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5mM, MgCl₂(PCR완충액) 및 GoTaq DNA 폴리머라제 1.25units이었다. 변성(Denaturation), 어닐링(annealing) 및 익스텐션(extension)에 대한 PCR 반응 조건은 다음과 같으며, 95℃ 2분, 95℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 5분, 30~40 사이클로 수행하였다. PCR 반응 후 생성물의 10㎕를 2% 아가로즈 겔(agarose gel)에서 전기영동 하였다. Gel Documentation system(코리아랩텍, Cat. No DGS-200D)을 이용하여 발현양을 확인했다.The primer sequences of the respective genes are shown in Table 5. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to carry out reverse transcription of M-MLV (Moloney murine leukemia virus) CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction, and the total reaction solution was 25 μl. The final concentration of each reagent is a primer 100 pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq 1x1.5mM Reaction buffer, MgCl ₂ (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

프라이머 이름Name of the primer 염기서열Base sequence GAPDHGAPDH Froward : GGCATTGCTCTCAATGACAAFroward: GGCATTGCTCTCAATGACAA Reverse : TGTGAGGGAGATGCTCAGTGReverse: TGTGAGGGAGATGCTCAGTG COL1A1COL1A1 Forward : AGCCAGCAGATCGAGAACAT Forward: AGCCAGCAGATCGAGAACAT Reverse : TCTTGTCCTTGGGGTTCTTG Reverse: TCTTGTCCTTGGGGTTCTTG TIMP-1TIMP-1 Forward : TGCTGGGTGGTAACTCTTTATTTCAForward: TGCTGGGTGGTAACTCTTTATTTCA Reverse : ATCCTGTTGTTGCTGTGGCTGATAGReverse: ATCCTGTTGTTGCTGTGGCTGATAG TropoelastinTropoelastin Forward : AAAGCAGCAGCAAAGTTCGGForward: AAAGCAGCAGCAAAGTTCGG Reverse : ACCTGGGACAACTGGAATCCReverse: ACCTGGGACAACTGGAATCC MMP-1MMP-1 Forward : AAGGTTAGCTTACTGTCACACGCTT Forward: AAGGTTAGCTTACTGTCACACGCTT Reverse : CGACTCTAGAAACACAAGAGCAAGA Reverse: CGACTCTAGAAACACAAGAGCAAGA

그 결과는 각각 도 1 내지 4에 나타내었다.The results are shown in FIGS. 1 to 4, respectively.

도 1에서 확인되는 바와 같이 본 발명 실시예의 혼합발효추출물은 비교예의 추출물보다 높은 콜라겐발현 효과를 나타내었으며, 특히 실시예 10의 혼합물은 Adenosine 보다 더 높은 발현효과를 나타내었다.As shown in FIG. 1, the mixed fermented extract of the example of the present invention exhibited higher collagen expression than the extract of the comparative example. In particular, the mixture of Example 10 showed a higher expression effect than that of adenosine.

또한, 도 2에서 확인되는 바와 같이 본 발명 실시예의 혼합발효추출물은 비교예의 추출물보다 높은 Timp-1 발현 효과를 나타내었으며, 특히 실시예 10의 혼합물은 Adenosine 보다도 높은 발현효과를 나타내었다.Further, as shown in FIG. 2, the mixed fermented extract of the examples of the present invention had higher Timp-1 In particular, the mixture of Example 10 showed higher expression effect than Adenosine.

트로포엘라스틴(Tropoelastin)은 피부 탄력을 나타내는 탄력 섬유 중심의 엘라스틴을 형성하고 있는 인자로 도 3에서 확인되는 바와 같이 본 발명 실시예 10의 혼합물은 5%에서 대조군 Adenosine 5%보다도 매우 우수한 결과를 나타내었다.Tropoelastin is a factor that forms elastin in the center of the elastic fibers showing skin elasticity. As shown in FIG. 3, the mixture of Example 10 shows excellent results than 5% of control adenosine 5% .

또한, 도 4에서 확인되는 바와 같이 본 발명 실시예의 혼합발효추출물은 MMP-1의 발현 억제 효과가 우수하였으며, 특히 실시예 10의 혼합물에서 가장 우수한 효과를 나타내었다. Also, as shown in FIG. 4, the mixed fermented extract of the example of the present invention showed an excellent effect of inhibiting the expression of MMP-1.

시험예Test Example 8: 세포 내 8: Intracellular TyrosinaseTyrosinase 및 And MITF의MITF 유전자 발현 억제 효과 Gene Expression Inhibitory Effect

B16F10 melanoma 세포는 세포의 수를 5×10⁵cells/㎖로 조제한 후에 페트리디쉬에 처리하여 24시간 동안 5% CO₂및 37℃의 조건에서 배양하였다. 세포가 페트리디쉬에서 80% 이상 자란 다음, 추출물을 세포 생존율 100% 이상으로 나타난 농도로 첨가하였다. B16F10 melanoma cells were treated with 5 × 10 ⁵ cells / ㎖ of cells and cultured in Petri dishes at 5% CO ₂ and 37 ° C for 24 hours. Cells were grown in petri dishes at least 80%, and then the extract was added at a concentration of 100% or more cell viability.

미백에 대한 효과를 알아보고자 본 발명 실시예의 혼합발효추출물과 비교예의 추출물을 처리한 후 DMED/10 FBS에서 24시간 동안 5% CO₂ 및 37℃의 조건에서 배양하였다. 24시간 후 세포에서 RNA 분리, cDNA 합성 및 RT-PCR은 Komoroski 등(Drug Metab. Dispos. 32:512-518, 2004)이 기술한 방법에 따라 수행하였다. RT-PCR에서 측정한 유전자는 Tyrosinase 및 MITF를 선택하여 발현을 확인하였다. 유전자 발현의 차이를 확인하기 위해 house keeping gene으로 GAPDH을 사용하였다. 각각의 유전자의 프라이머 서열은 표 6에 나타냈다. 추출된 RNA를 주형으로 올리고 dT-어댑터 프라이머(Oligo dT-adaptor primer)와 DEPC water를 이용하여 총량 15㎕로 하고 70℃ 5분 변성 후, Moloney murine leukemia virus(M-MLV) RNA의 역전사를 수행하여 42℃ 60분, 94℃ 5분 cDNA를 합성하였다. 합성된 cDNA는 PCR 반응을 통해 증폭하였으며, 총 반응액은 25μL로 하였다. 각 반응물의 최종 농도는 프라이머 100pmol, 1.0μM, dNTP 혼합액 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5 mM, MgCl₂(PCR완충액) 및 GoTaq DNA 폴리머라제 1.25units이었다. 변성(Denaturation), 어닐링(annealing) 및 익스텐션(extension)에 대한 PCR 반응 조건은 다음과 같으며, 95℃ 2분, 95℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 5분, 30~40 사이클로 수행하였다. PCR 반응 후 생성물의 10㎕를 2% 아가로즈 겔(agarose gel)에서 전기영동 하였다. Gel Documentation system(코리아랩텍, Cat. No DGS-200D)을 이용하여 발현양을 확인했다.To examine the effect of whitening, the mixed fermented extract of the present invention and the extract of Comparative Example were treated and cultured in DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C. After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). Tyrosinase and MITF were selected for RT-PCR. GAPDH was used as a house keeping gene to identify differences in gene expression. The primer sequences of the respective genes are shown in Table 6. The extracted RNA was transformed into a template and denatured at 70 ° C for 5 minutes using a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to perform reverse transcription of Moloney murine leukemia virus (M-MLV) RNA CDNA was synthesized at 42 ° C for 60 minutes and at 94 ° C for 5 minutes. The synthesized cDNA was amplified by PCR reaction and the total reaction volume was 25 μL. The final concentration of each reagent is a primer 100pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq Reaction buffer 1x1.5 mM, MgCl 2 (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

프라이머 이름Name of the primer 염기서열Base sequence GAPDHGAPDH Froward : GGCATTGCTCTCAATGACAAFroward: GGCATTGCTCTCAATGACAA Reverse : TGTGAGGGAGATGCTCAGTGReverse: TGTGAGGGAGATGCTCAGTG MITFMITF Forward : AACCGACAGAAGAAGCTGGAForward: AACCGACAGAAGAAGCTGGA Reverse : ACAAGTTCCTGGCTGCAGTTReverse: ACAAGTTCCTGGCTGCAGTT TyrosinaseTyrosinase Forward : TTATGCGATGGAACACCTGA Forward: TTATGCGATGGAACACCTGA Reverse : ACTGGCAAATCCTTCCAGTGReverse: ACTGGCAAATCCTTCCAGTG

그 결과는 도 5 및 도 6에 나타내었다.The results are shown in Fig. 5 and Fig.

PT-PCR 수행 후 관찰 결과, 본 발명 실시예의 혼합발효추출물은 Tyrosinase 및 MITF의 mRNA 유전자 발현 억제 효과가 우수하게 나타났다. 따라서, 본 발명 혼합발효추출물은 미백 효과가 우수한 것을 확인할 수 있었다.As a result of observation after PT-PCR, the mixed fermented extract of the examples of the present invention showed excellent inhibitory effect on tyrosinase and MITF mRNA gene expression. Therefore, it was confirmed that the mixed fermented extract of the present invention had excellent whitening effect.

제형 Formulation 실시예Example 1: 스킨로션의 제조 1: Manufacture of skin lotion

하기 표 7의 조성에 따라, 하기의 방법으로 혼합추출물을 함유한 스킨로션 1kg을 제조하였다.1 kg of a skin lotion containing the mixed extract was prepared according to the composition of Table 7 below.

번호number 원 료Raw material 함량(중량%)Content (% by weight) 1One 지모, 세이지 및 천수국의 혼합추출물
(실시예 10)Mixed extracts of ginseng, sage and lichen
(Example 10) 1.01.0 22 글리세린glycerin 3.03.0 33 부틸렌글리콜Butylene glycol 2.02.0 44 프로필렌글리콜Propylene glycol 2.02.0 55 폴리옥시에칠렌 경화피마자유Polyoxyethylene hardened castor oil 1.01.0 66 에탄올ethanol 10.010.0 77 트리에탄올아민Triethanolamine 0.10.1 88 방부제antiseptic 미량a very small amount 99 색소Pigment 미량a very small amount 1010 향료Spices 미량a very small amount 1111 정제수Purified water 잔량Balance

상기 표 7에서 11번 물질에 2, 3, 4, 8번 물질을 순서대로 반응용기에 투입하고 교반하여 용해시킨 후, 5번 물질을 60℃ 정도로 가열하여 용해시켰다. 이 후, 10번 물질을 투입하여 용해한 후 11번 물질에 투입하였다. 마지막으로 1, 6, 7, 9번 물질을 투입하여 충분히 교반시킨 뒤 25℃에서 3일간 숙성시켜 표제의 스킨로션을 제조하였다.In Table 7, substances No. 2, No. 3, No. 4 and No. 8 were sequentially added to the No. 11 material, and the materials were stirred and melted. Subsequently, the No. 5 material was dissolved by heating to about 60 ° C. Subsequently, the substance 10 was added to the substance 11 after dissolution. Finally, ingredients 1, 6, 7, and 9 were added and agitated for 3 days at 25 ° C to prepare a skin lotion.

제형 Formulation 실시예Example 2: 2: 영양로션의Nutritious lotion 제조 Produce

하기 표 8의 조성에 따라, 하기의 방법으로 혼합추출물을 함유한 하이드로좀 영양로션 1kg을 제조하였다.According to the composition shown in Table 8 below, 1 kg of a hydrozoal nutrition lotion containing a mixed extract was prepared by the following method.

번호number 원 료Raw material 함량(중량%)Content (% by weight) 1One 지모, 세이지 및 천수국의 혼합추출물
(실시예 10)Mixed extracts of ginseng, sage and lichen
(Example 10) 1.01.0 22 밀납Wax 1.01.0 33 폴리솔베이트 60Polysorbate 60 1.51.5 44 솔비탄 세스퀴올레이트Sorbitan sesquioleate 0.50.5 55 유동 파라핀Liquid paraffin 10.010.0 66 소르비탄 스테아레이트Sorbitan stearate 1.01.0 77 친유형 모노스테아린산 글리세린Pro-type glycerin monostearate 0.50.5 88 스테아린산Stearic acid 1.51.5 99 글리세릴스테아레이트/피이지-400 스테아레이트Glyceryl stearate / FG-400 stearate 1.01.0 1010 프로필렌글리콜Propylene glycol 3.03.0 1111 카르복시폴리머Carboxy polymer 0.10.1 1212 트리에탄올아민Triethanolamine 0.20.2 1313 방부제antiseptic 미량a very small amount 1414 색소Pigment 미량a very small amount 1515 향료Spices 미량a very small amount 1616 정제수Purified water 잔량Balance

상기 표 8에서 10, 11, 13, 16번 물질을 혼합 교반하면서, 80~85 ℃ 사이로 가열하여 제조부에 투입한 후 유화기를 작용시키고 2, 3, 4, 5, 6, 7, 8, 9, 12번 물질을 80~85℃ 사이로 가열 용해한 후 유화시켰다. 유화가 끝나면 교반기를 이용하여 교반하면서 50℃ 까지 냉각한 뒤 15번 물질을 투입하고 45℃까지 냉각한 뒤 14번 물질을 투입하고 35℃에서 1번 물질을 투입하여 25℃까지 냉각한 뒤 25℃에서 3일간 숙성시켜 표제의 영양로션을 제조하였다.In Table 8, materials 10, 11, 13, and 16 were heated to 80 to 85 ° C while mixing and stirring, and then charged into the manufacturing section. Then, an emulsifier was allowed to react and the mixture was stirred at 2, 3, 4, 5, 6, 7, , The substance No. 12 was dissolved by heating at a temperature of 80 to 85 ° C, followed by emulsification. After the emulsification is completed, the mixture is cooled to 50 ° C with stirring using an agitator, and then the substance 15 is added. After cooling to 45 ° C, the substance 14 is added and the substance 1 is added at 35 ° C. For 3 days to prepare the nutritional lotion of the title.

지금까지 본 발명에 대해서 상세히 설명하였으나, 그 과정에서 언급한 실시예는 예시적인 것일 뿐이며, 한정적인 것이 아님을 분명히 하고, 본 발명은 이하의 특허청구범위에 의해 제공되는 본 발명의 기술적 사상이나 분야를 벗어나지 않는 범위내에서, 균등하게 대처될 수 있는 정도의 구성요소 변경은 본 발명의 범위에 속한다 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, It is within the scope of the present invention that component changes to such an extent that they can be coped evenly within a range that does not deviate from the scope of the present invention.

Claims

Glucosidase enzyme-treated liposomes prepared by mixing β-glucosidase enzyme and β-glucosidase enzyme in a ratio of 3: 1: 2 in dry weight ratio, and adding the β-glucosidase enzyme to the extract, A cosmetic composition for improving skin elasticity and wrinkles containing a mixed extract.

[Claim 2] The method according to claim 1, wherein the enzyme-treated liposomes, sage and licorice mixed extract are at least one selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, propylene glycol and butylene glycol Wherein the composition is prepared by extracting with one extraction solvent and then treating with? -Glucosidase enzyme.

delete

The cosmetic composition for improving skin elasticity and wrinkles according to claim 1, wherein the β-glucosidase enzyme-treated liposidase, sage and licorice mixed extract are contained in an amount of 0.001 to 30% by weight based on the total weight of the cosmetic.

The cosmetic composition for skin elasticity and wrinkle improvement according to claim 1, wherein the β-glucosidase enzyme-treated liposidase, sage and licorice mixed extract are liposomized.

delete