EP1554307A2 - Antagonistes il-15 - Google Patents

Antagonistes il-15

Info

Publication number
EP1554307A2
EP1554307A2 EP03750224A EP03750224A EP1554307A2 EP 1554307 A2 EP1554307 A2 EP 1554307A2 EP 03750224 A EP03750224 A EP 03750224A EP 03750224 A EP03750224 A EP 03750224A EP 1554307 A2 EP1554307 A2 EP 1554307A2
Authority
EP
European Patent Office
Prior art keywords
human
cell
fusion protein
nucleic acid
animal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03750224A
Other languages
German (de)
English (en)
Inventor
Ingeborg Dreher
Thomas Moll
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Original Assignee
F Hoffmann La Roche AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F Hoffmann La Roche AG filed Critical F Hoffmann La Roche AG
Priority to EP03750224A priority Critical patent/EP1554307A2/fr
Publication of EP1554307A2 publication Critical patent/EP1554307A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5443IL-15
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P41/00Drugs used in surgical methods, e.g. surgery adjuvants for preventing adhesion or for vitreum substitution
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid

Definitions

  • the invention relates to fusion proteins from a wild-type E -15 and an IgG-Fc fragment and to their production and use for inhibiting immune reactions and for the prophylaxis and / or therapy of secondary transplant and / or autoimmune diseases.
  • T cells An effective immune response is initiated by the activation of T cells in the immune system, which is triggered by an antigen or mitogen.
  • the activation of the T cells requires numerous cellular changes, these include e.g. the expression of cytokines and their receptors. These cytokines include IL-15 and E -2.
  • IL-15 and IL-2 are known growth factors that play a significant role in the proliferation and differentiation of human and murine T cells, macrophages, natural killer (NK) cells, cytotoxic T cells (CTL), lymphocyte-activated Killer (LAK) cells and in the costimulation of B cells that have been activated, for example, by anti-immunoglobulin (anti-IgM) or phorbol esters.
  • NK natural killer
  • CTL cytotoxic T cells
  • LAK lymphocyte-activated Killer
  • anti-IgM anti-immunoglobulin
  • phorbol esters anti-immunoglobulin
  • the proliferation of these cells increases an organism's immune response.
  • LL-15 was first described as a secretory cytokine that induces the proliferation of IL-2 dependent murine cytotoxic T cells (CTLL-2).
  • CTLL-2 IL-2 dependent murine cytotoxic T cells
  • IL-15 has been characterized as a 162 amino acid precursor protein with a leader sequence of 48 amino acids, ie a mature protein of 114 amino acids in length (Grabstein et al., (1994) Science 264 (5161): 965-8).
  • IL-15 is produced in epithelial and fibroblast cell lines as well as peripheral blood monocytes. Its specific mRNA was also found in the placenta, skeletal muscles and kidneys (Grabstein et al., Supra)
  • IL-15 and IL-2 also have homologous structures. Both molecules bind to at least three separated receptor subunits on the membrane of T cells, the beta and gamma subunit complexes via which the signal transduction is the same, while the alpha subunit is specific for the binding of IL-15 and IL-2, respectively . It was found that antibodies directed against the alpha subunit of the IL-2 receptor had no effect on the IL-15 binding to its specific alpha subunit (Grabstein et al., Supra), whereas antibodies directed against the beta Subunit of the IL-2 receptor were directed to block the activity of IL-15 (Giri et al, (1994) EMBO J., 13: 2822). Signal transduction takes place via the beta and gamma subunits of IL-15.
  • autoimmune diseases in particular type I diabetes mellitus (Bottazzo, GF, et al, (1985) N Engl J Med 113: 353), rheumatoid arthritis, multiple sclerosis, chronic liver diseases, inflammatory bowel diseases, transplant-anti- Graft versus host disease (GVHD) and graft rejection (Sakai et al., (1998) Gastroenterology, 114 (6): 1237-1243; Kivakakk et al., (1998) Clin Exp Immunol, 111 (1): 193197).
  • inimun-competent cells are transmitted from a genetically non-identical organism, these cells react to the recipient organism (GVHD) (Janeway CA and Travers P., Spectrum Verlag, German edition 1995 p. 467).
  • Humoral effectors are antibodies of different specificity, such as, for example, antibody-dependent cell-mediated cytotoxicity and antibodies against structures of the donor HLA system.
  • Cellular effectors are in particular cytotoxic T cells in connection with macrophages (Immunologie, Janeway CA and Travers P., Spectrum Verlag, German edition 1995, pp. 522-8).
  • One therapeutic approach is to suppress the humoral or cellular immune response by immunosuppressia, in particular antagonistic IL-15 or IL-2 antibodies or IL-15 or IL-2 antagonists.
  • IL-15 antagonists which change the binding behavior of IL-15 to its receptor. These antagonists were obtained by introducing mutation (s) into the wild-type IL-15 sequence. For example, a mutation at amino acid position 56 (aspartate) [position 8 after cleavage of the leader sequence] has been described, through which binding to the alpha subunit of the IL-15 receptor took place, however binding to the beta subunit was prevented (WO 96/26274). In another approach, the interaction with the gamma subunit was inhibited by a mutation at amino acid position 156 (glutamine) [position 108 after cleavage of the leader sequence] (WO 96/26274; WO 97/41232).
  • IL-15 antagonists described are mutated IL-15 (mut-IL-15) sequences which have antagonistic effects either by themselves or as a fusion protein.
  • fusion proteins are polypeptides consisting of an N-terminal mut-IL-15 fragment and a C-terminal Fc fragment, in particular a murine IgG2a or human IgGl (WO 97/41232; Kim et al., (1998) J Immunol ., 160: 5742-5748).
  • Fc fragment crystallizable fragment
  • the two other identical Fab fragment antigen binding fragments of an antibody have antigen binding activity (Immunology, Janeway CA and Travers P., German edition (1995), p. 117 and the following).
  • IL-15 molecules have a changed primary, secondary and tertiary structure compared to the wild-type IL-15 and therefore have different degradation points, so that degradation products occur which do not occur naturally in the cells, and can have a toxic effect on the organism.
  • the nature and extent of such and other side effects cannot be foreseen in detail.
  • Immunosuppressants are dependent. Usually because that is inadequate Knowledge of the side effects of long-term use of such immunosuppressive agents is urgently needed to rule out or at least limit these side effects.
  • a major disadvantage is that the generally systemic administration of such immunosuppressants leads to their distribution throughout the organism and does not ensure the local presence at the site of the transplanted cells, tissue or organ.
  • inhibiting T cell proliferation throughout the organism can cause infections, toxic breakdown products or even cancer.
  • the object of the present invention is therefore to produce an immunosuppressant which has no or hardly any side effects in an organism in which an immune response is to be inhibited.
  • mutated IL-15 molecules or fusion proteins consisting of a mut-IL-15 and an Fc fragment, have an antagonistic effect on IL-15 by inhibiting or changing the receptor binding behavior.
  • a fusion protein consisting of an N-terminal wild-type IL-15 and a C-terminal Fc fragment, in particular a murine IgG2a, also has an antagonistic effect, although an agonistic effect would be expected in itself . Only by attaching an Fc fragment to a naturally occurring, normally an immunostimulating IL-15 molecule, the mechanism of action could be reversed, i.e. the inhibition of an immune response.
  • the invention therefore relates to a fusion protein composed of a wild-type IL-15 on the one hand and an IgG-Fc fragment on the other hand, with the exception of a murine IgG2b-Fc fragment.
  • a fusion protein according to the present invention is to be understood as the expression product of a fused gene.
  • a fused gene is created by linking two or more genes or gene fragments, which creates a new combination.
  • a wild-type IL-15 according to the present invention is understood to mean the naturally occurring IL-15, as described, for example, in Grabstein et al, (1994) Science 264 (5161): 965-8 or allelic variants thereof.
  • Fc (fragment crystallizable) fragment is to be understood as the fragment of an antibody which does not bind any antigens, for example an antibody molecule which lacks the variable domains, or also partially or completely the first constant domain of the heavy and light chains.
  • the Fc fragment can come from a natural source, can be produced recombinantly and / or can be synthesized. Appropriate methods are known to the person skilled in the art.
  • the Fc fragment of the fusion protein according to the invention is an immunoglobulinG (IgG), specifically a human or murine IgGl, a human IgG2, a murine IgG2a, a human or murine IgG3 or a human IgG4, preferably a human IgGl or a murine IgG2a, especially especially an IgGl.
  • IgGs were preferably used from the hinge region.
  • the flexible region in the Ig molecule is referred to as the hinge region.
  • murine IgG2b (Schlomchik, MJ, (1987 ), Nature 328, 805-811), human IgG3 (Huck, S. et al., (1986), Nucleic Acids Res. 14 (4): 1779-1789), murine IgG3 (Wels et al., (1984) , EMBO J., 3 (9): 2041-2046) and human IgG4 (Pink et al., (1970), Biochem. J., 117 (1): 33-47).
  • the fusion protein according to the invention is preferably a chimeric fusion protein, for example containing a wild-type IL-15 and a heterologous IgGl -Fc fragment or a heterologous IgG2a-Fc fragment.
  • the fusion protein according to the invention comprises the amino acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 SEQ ID NO: 4 or SEQ ID NO: 5.
  • the invention further relates to a nucleic acid which codes for a fusion protein which on the one hand contains a wild-type IL-15 and on the other hand an IgG-Fc fragment, with the exception of a murine IgG2b-Fc fragment.
  • the nucleic acid according to the invention preferably codes for a wild-type IL-15 and a human or murine IgGl, a human IgG2, a murine IgG2a, a human or murine IgG3 or a human IgG4, particularly preferably for a human IgGl or a murine IgG2a, most preferably for an IgGl.
  • the nucleic acid according to the invention preferably encodes a fusion protein with one of the amino acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.
  • the nucleic acid according to the invention contains the DNA sequences SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.
  • a nucleic acid in the sense of the present invention means an RNA or DNA, in particular genomic DNA, cDNA or synthetic DNA, which was synthesized, for example, at the phosphoramidation level. Combinations and or modifications of nucleotides of these nucleic acids are also included. This term also includes single and double-stranded nucleic acids.
  • nucleic acids which contain functionally linked components, for example one or more fused genes or active parts thereof coding for one or more fusion proteins according to the invention, and regulatable elements and / or regulative nucleotide sequences which influence the expression of the gene (s) in terms of quantity and / or as a function of time ,
  • Regulable elements are, for example, promoters for constitutive or cell-specific or tissue-specific expression.
  • Regulatory nucleotide sequences include, for example, leader sequences, polyadenylation sequences, e.g. an SV40 polyadenylation signal, enhancer sequences, IRES sequences and introns.
  • leader sequences of the present inventions are, for example, those listed below: Igk leader:
  • CD5 leader
  • short native IL-15 leader 5 , -ATGTCTTCATTTTGGGCTGTTTCAGTGCAGGGCTTCCTAA-3 ,
  • the components are functionally linked if they are linked in such a way that the sequence (s) of the genes or genes contained are or will be transcribed under the influence of the transcription regulation.
  • the invention further relates to a vector which contains at least one nucleic acid according to the invention.
  • Vectors in the sense of the present invention can be plasmids, shuttle vectors, phagemids, cosmids, adenoviral vectors, retroviral vectors, expression vectors and vectors with gene therapy effects.
  • Expression vectors in the sense of the present invention include at least one nucleic acid according to the invention, at least one translation initiation signal, a translation termination signal and / or a polyadenylation signal for expression in eukaryotes.
  • pIRES from Clontech, Palo Alto, USA
  • pCI-neo vector from Promega, Madison, USA
  • pCMV-Script from Stratagene, La Jolla, USA
  • pCDNA vector Invitrogen, Paisley, UK
  • Gene-therapeutic vectors according to the invention are, for example, virus vectors, for example adenovirus vectors, retroviral vectors or vectors which are based on replicons of RNA viruses (Lindemann et al., 1997, Mol. Med. 3: 466-76; Springer et al. , 1998, Mol. Cell. 2: 549-58; Khromykh, 2000, Curr. Opin. Mol. Ther .; 2: 555-69).
  • Vectors with gene therapy effects can also be obtained by complexing the nucleic acid fragments according to the invention with liposomes. In lipofection, small unilamellar vesicles are made from cationic lipids by ultrasound treatment of the liposome suspension.
  • the DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the plasmid DNA is 100% complexed by the liposomes.
  • DOTMA 1,2-dioleyloxypropyl-3-trimethylammonium bromide
  • DPOE diioloxylphosphatidylethanolamine
  • lipid formulations examples include DOTAP N- [1 - (2,3-dioleoyloxy) propyl] -N, N, N-trimethyl-ammoniumethyl-sulfate or DOGS (TRANSFECTAM; diocta-decylamidoglycylspermin).
  • Excipients that increase the transport of nucleic acids into the cells can be, for example, proteins or peptides that are bound to DNA or synthetic peptide-DNA molecules that enable the transport of the nucleic acid into the nucleus of the cell (Schwartz et al., 1999, Gene Therapy 6: 282; Branden et al.
  • Auxiliaries also include molecules that enable the release of nucleic acids into the cytoplasm of the cell (Planck et al., 1994, J. Biol. Chem. 269, 12918; Kichler et al., 1997, Bioconj. Chem. 8, 213) or for example liposomes (Uhlmann and Peimann, 1990, Chem. Rev. 90, 544).
  • the invention relates to a cell which contains at least one nucleic acid according to the invention and / or at least one vector according to the invention.
  • This cell is preferably a precursor cell, an immortalized cell or a stem cell, in particular a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.
  • pluripotent embryonic stem cells or cell lines can be obtained from the inner cell mass of blastocytes (Robertson, Embryo-derived stem cell lines, in Teratocarcinomas and embryonic stem cells: a practical approach, Robertson, editor, IRL Press, Washington DC, 1987)
  • Particularly preferred stem cells derived from adult tissue include, for example, neuronal stem cells, stem cells from the bone marrow, mesenchymal stem cells, hematopoietic stem cells, epithelial stem cells, stem cells from the digestive tract and duct stem cells.
  • Cells according to the invention are, for example, epithelial cells, vascular cells, liver cells, heart cells, skin cells, muscle cells, nerve cells, bone marrow cells, CHO cells (ovary cells) and cells from the pancreas, from the kidney, from the eye or from the lungs.
  • the cell according to the invention is in particular a mammalian cell, including a human cell.
  • This cell can originate, for example, from a human, a mouse, a rat, a guinea pig, a rabbit, a cow, a goat, a sheep, a horse, a pig, a dog, a cat or a monkey, preferably from a human ,
  • the cells of the invention can also be used to express a heterologous gene.
  • the cell according to the invention is preferably in the form of a cell line.
  • a cell line according to the invention can be produced by transfection, transformation or infection of a cell line with a nucleic acid according to the invention or a vector according to the invention with the aid of methods which Those skilled in the art are familiar, for example transfection, transformation, electroporation, microinjection or infection.
  • the invention further relates to a medicament comprising at least one fusion protein according to the invention, at least one nucleic acid according to the invention, at least one vector according to the invention and / or at least one cell according to the invention and, if appropriate, suitable auxiliaries and / or additives.
  • auxiliaries and / or additives which are used, for example, to stabilize or preserve the medicament or diagnostic agent, are generally known to the person skilled in the art.
  • auxiliaries and / or additives are physiological saline solutions, Ringer's dextrose, dextrose, Ringer's lactate, demineralized water, stabilizers, antioxidants, complexing agents, antimicrobial compounds, proteinase inhibitors and / or inert gases.
  • the medicament according to the invention can e.g. for prophylaxis, therapy or diagnosis of diseases.
  • diseases include, for example: rheumatic diseases, for example rheumatic arthritis, Sjogren's syndrome, scleroderma, dermatomyositis, polymyositis., Reiter's
  • Type I or type II diabetes are Type I or type II diabetes.
  • Autoimmune diseases of the thyroid gland for example Graves' disease, Hashimoto's thyroiditis, • Autoimmune diseases of the central nervous system, for example multiple sclerosis,
  • Skin diseases for example psoriasis, neurodermatitis, inflammatory bowel diseases, for example Crohn's disease, Immune disorders, such as AIDS
  • Post-transplant diseases for example graft rejection reactions and • tumor diseases.
  • the medicament according to the invention is administered by the methods familiar to the person skilled in the art, for example intravenously, intraperitoneally, intramuscularly, subcutaneously, intracranially, intraorbitally, intracapsularly, intraspinally, transmuscularly, topically or orally.
  • Other methods of administration are, for example, systemic or local injection, perfusion or catheter-based administration.
  • the medicament according to the invention can, for example, be administered orally, e.g. Tablets or capsules, over the mucous membrane, e.g. the nose or oral cavity, in the form of sprays implanted in the lungs or in the form of disposers under the skin.
  • Trans-dermal therapeutic systems are e.g. known from EP 0 944 398-A1, EP 0 916 336-A1, EP 0 889 723-A1 or EP 0 852 493-A1.
  • the drug can be introduced into the organism either using an ex vivo approach in which the cells are removed from the patient, genetically modified, for example by DNA transfection, and then reintroduced into the patient or using an in vivo approach, in which vectors according to the invention having gene therapy effects are introduced into the patient's body, as naked DNA or using viral or non-viral vectors according to the invention or cells according to the invention.
  • the dosage of drugs depends on several factors, for example on the body weight, the general state of health, the extent of the body surface, the age of the patient and the interaction with other drugs. Dosage also depends on the type of administration. The dosage must therefore be determined by the specialist in each individual case for each patient.
  • the drug can be administered once or several times a day and over several days, and this can also be determined by a person skilled in the art.
  • Another object of the invention relates to a human or animal organ-specific tissue and / or a human or animal mammalian organ, containing at least one fusion protein, at least one nucleic acid coding for said fusion protein, containing at least one vector containing at least one nucleic acid and / or at least one cell at least one said nucleic acid and / or at least one said vector, the fusion protein containing a wild-type IL-15 and an Fc fragment.
  • the fusion protein of the human or animal organ-specific tissue according to the invention and / or the human or animal mammalian organ according to the invention preferably contains on the one hand a wild-type IL-15 and on the other hand a human or murine IgGl, a human IgG2, a murine IgG2a, a murine IgG2b, a human or murine IgG3 or a human IgG4, preferably a human IgGl or a murine IgG2a, in particular an IgGl, particularly preferably no murine IgG2b.
  • Human or animal organ-specific tissue of the present invention can include, for example, tissue from the pancreas, including, for example, the Langerhan islet cells, as well as heart, heart muscle, kidney, liver, lung, spleen, cartilage, ligament, retina, cornea -, bone marrow, skin, nerve and / or muscle tissue.
  • Human or animal mammalian organs of the present invention can be, for example, the pancreas, the heart, the pancreas, the kidney, the liver, the lungs, the spleen, the eye and / or the skin.
  • the invention further relates to a transgenic non-human mammal which contains at least one fusion protein, at least one nucleic acid which codes for the fusion protein mentioned, at least one vector which contains at least one nucleic acid and or at least one cell which has at least one contains said nucleic acid and / or at least one vector, the fusion protein containing a wild-type IL-15 and an Fc fragment.
  • the fusion protein of the transgenic non-human mammal according to the invention preferably contains on the one hand a wild-type IL-15 and on the other hand a human or murine IgGl, a human IgG2, a murine IgG2a, a murine IgG2b, a human or murine IgG3 or a human IgG4, preferably a human IgGl or a murine IgG2a, in particular an IgGl, particularly preferably no murine IgG2b.
  • Trahsgenic animals generally show a tissue-specific increased expression of nucleic acids and are therefore very suitable for the analysis of, for example, immune reactions.
  • Transgenic mice are preferably used.
  • a non-human mammal according to the invention is, for example, a mouse, a rat, a guinea pig, a rabbit, a cow, a goat, a sheep, a horse, a pig, a dog, a cat or a monkey.
  • the invention also relates to the uses of a fusion protein, a nucleic acid coding for the said fusion protein ; a vector containing at least one named nucleic acid and or a cell containing either at least one named nucleic acid and / or a named vector containing at least one nucleic acid mentioned, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, or a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention: to inhibit an IL-15 mediated cellular event, for inhibiting the interaction of an IL-15 with its receptor and / or for the prophylaxis and / or therapy of secondary transplant diseases, in particular transplant rejection reactions and / or autoimmune diseases.
  • Another object of the invention is the use of a fusion protein, a nucleic acid coding for said fusion protein, a vector containing at least one named nucleic acid and / or a cell containing at least one named nucleic acid and / or said vector, the fusion protein being a wild-type Contains IL-15 and an Fc fragment, for the lysis of cells which express an IL-15 receptor.
  • the fusion protein of the uses according to the invention preferably contains, on the one hand, a wild-type IL-15 and, on the other hand, a human or murine IgGl, a human IgG2, a murine IgG2a, a murine IgG2b, a human or murine IgG3 or a human IgG4, preferably a human IgGl or murine IgG2a, in particular an IgGl, particularly preferably no murine IgG2b.
  • the uses according to the invention are preferably carried out in or in a human or animal mammal.
  • a human mammal in the sense of the present invention is a human
  • an animal mammal in the sense of the present invention is, for example, a mouse, a rat, a guinea pig, a rabbit, a cow, a goat, a sheep, a horse, to understand a pig, a dog, a cat or a monkey.
  • the present invention furthermore relates to the use of the human or animal organ-specific tissue according to the invention and / or the human or animal mammalian organ according to the invention for transplantation into a human or animal mammal. It is preferably an auto, allo or xenograft.
  • the transplant is the transfer of living material, e.g. of cells, tissues or organs, from one part of the body to another (autogenous transplantation) or from one individual to another (allogeneic, syngeneic and xenogeneic transplantation) (Klein, J. S, (1991) Immunologie, 1st edition, VHC Verlagsgesellschaft, Weinheim, p. 483) according to methods generally known to the person skilled in the art. A distinction is made between transplantation into another organism
  • Another aspect of the invention is a method for producing a fusion protein according to the invention, which contains the following steps: a. Introducing at least one nucleic acid according to the invention and / or at least one vector according to the invention into a cell, and b. Expression of the nucleic acid under suitable conditions.
  • nucleic acids, vectors and genes for example differentiation marker genes or transfection marker genes, into cells are well known to the person skilled in the art and comprise the methods customary in the prior art, for example electroporation, injection, transfection and / or transformation. These methods are particularly preferred when the substance is naked nucleic acids, in particular DNA.
  • Suitable conditions for the expression of the nucleic acid can be created, for example, by expression vectors, for example by the aforementioned expression vectors and regulatable elements, for example promoters or regulative nucleic acid sequences.
  • expression vectors also contain promoters suitable for the respective cell or the gene to be transcribed in each case.
  • regulatable elements which enable constitutive expression in eukaryotes are promoters which are recognized by RNA polymerase II.
  • Such promoters for constitutive expression in all cell and tissue types are e.g. the CDl lc promoter, pGk (phosphoglycerate kinase) promoter, the CMV (cytomegalovirus) promoter, the TK (thymidine kinase) promoter, the EFl (elongation factor l-alpha) promoter, the SV40 (Simian Virus) promoter, the RSV (Rous Sarcoma Virus) promoter and the pUB (Ubiquitin) promoter.
  • CDl lc promoter e.g. the CDl lc promoter
  • pGk phosphoglycerate kinase
  • CMV cytomegalovirus
  • TK thymidine kinase
  • EFl elongation factor l-alpha
  • SV40
  • regulatable elements which enable cell-specific or tissue-specific expression in eukaryotes are promoters or activator sequences from promoters or enhancers of those genes which code for proteins which are only expressed in certain cell types.
  • promoters are for example the insulin promoter for beta cells of the pancreas, the Sox-2 promoter for nerve cells, the albumin promoter for liver cells, the myosin heavy chain promoter for muscle cells, the VE-cadherin promoter for endo- thel cells and the keratin promoter for epithelial cells.
  • Expression can also be controlled via regulatory nucleotide sequences that influence expression in terms of quantity and / or time. These include, for example, enhancer sequences, leader sequences, polyadenylation sequences, IRES sequences and introns.
  • Another object of the invention is an in vitro method for producing a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention, which contains the following steps: a. Introducing into at least one stem cell, a precursor cell and / or an immortalized cell of a human or animal organ-specific tissue and / or a human or animal mammalian organ on the one hand encoding at least one nucleic acid for a fusion protein and / or at least one vector containing at least one named nucleic acid, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, and on the other hand at least one suitable differentiation marker gene, b. Differentiation of the cell from step a., C. Selection of the differentiated cell from step b. and d. Introduce the selected cell from step c. in at least one human or animal organ-specific tissue and / or in at least one human or animal mammalian organ.
  • step a after, before or simultaneously with step a. at least one suitable transfection marker gene is introduced and after step a. preferably the transfected cell from step a. selected.
  • suitable conditions for the differentiation of the cells can be created, for example, by adding growth factors which initiate the desired cell differentiation.
  • the method according to the invention preferably contains a positive selection scheme.
  • a marker gene for example a gene which transmits antibiotic resistance, is introduced into the cell before, during or after the differentiation step and is expressed under suitable conditions.
  • suitable conditions can consist, for example, in that the expression of the marker gene is under the control of a promoter which is only active in the desired cells.
  • the expression of the marker gene confers resistance to the antibiotic to the successfully differentiated cells.
  • the selection of the cells following the differentiation can therefore easily be carried out, for example, by bringing the cells into contact with the corresponding antibiotic. Cells that do not contain the appropriate antibiotic resistance die, so that only the differentiated cells survive.
  • contacting can take place, for example, by adding the active substances into the nutrient medium of a cell culture.
  • An antibiotic according to the invention means an antibiotic against which the antibiotic resistance gene (s) used as the selection cassette according to the invention produces resistance. After the antibiotic has been added to the cultured stem cells, only those stem cells which contain the reporter gene expression vector essentially survive and differentiate.
  • a second marker gene is preferably introduced into the cells, as a result of which a selection of the cells in which the introduction of the nucleic acid and / or the vector according to step a. the procedure was successful, can be carried out. This double selection makes it possible to obtain an approximately 90%, preferably approximately 95-100% pure cell population of the desired cells.
  • Differentiation marker genes and transfection marker genes can be used for such selections, for example. As such, genes are predominantly used which impart resistance to certain toxic substances, for example antibiotics.
  • antibiotics for example antibiotics.
  • the most common antibiotics used in this context are neomycin, hygromycin (hph), zeocin (Sh ble) and puromycin (pacA).
  • genes suitable for selection are, for example, genes which express the expression of surface molecules or of fluorescent markers, e.g. Regulate GFP, with the help of which the cells to be selected can be cleaned by cell sorting.
  • Another object of the invention is a method for producing a transgenic non-human mammal according to the invention, which contains the following steps: a. Introduction into at least one oocyte, a stem cell, a precursor cell and / or an immortalized cell of a non-human mammal, on the one hand at least one nucleic acid coding for a fusion protein and / or at least one vector containing at least one said nucleic acid, wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, and on the other hand at least one suitable transfection marker gene, b. Selection of the transfected cell from step a., C. Introduce the after step b. selected cell into at least one non-human mammalian blastocyte, d. Introduce the blastocyte from step c. into a non-human, preferably pregnant woman, mammal foster mother and e. Identification of the transgenic non-human mammal developed from said blastocyte.
  • blastocytes are known to the person skilled in the art. It can be done, for example, by injection (Hogan, B., Beddington, R., Constantini, F. and Lacy, E., A laboratory Manual (1994), Cold Spring " Harbor Laboratory Press).
  • a transgenic non-human mammal can be identified, for example, by extracting genomic DNA from the transgenic non-human mammal, e.g. from the tail of a mouse. In a subsequent PCR (polymerase chain reaction), primers are used which specifically recognize the transgene for the nucleic acid according to the invention. Integration of the transgene can be demonstrated in this way.
  • genomic DNA is transferred to a membrane and detected by means of DNA probes, for example radioactively labeled DNA probes, which are specific for the transgene sought.
  • Mammals by regenerating a non-human stem cell, oocyte, vrufler cell or immortalized cell to a transgenic non-human animal, in particular from transgenic mice, are known to those skilled in the art from DE 196 25 049 and U.S.
  • a transgenic non-human mammal according to the invention can also be produced by direct injection of a nucleic acid according to the invention into the pronucleus (pronucleus) of a non-human mammal.
  • transgenic animals in particular transgenic mice
  • processes for the production of transgenic animals are also known to the person skilled in the art, inter alia. known from WO 98/36052, WO 01/32855, DE 196 25 049, US 4,736,866, US 5,625,122, US 5,698,765, US 5,583,278 and US 5,750,825 and include transgenic animals which are used, for example, via direct injection of vectors according to the invention into embryos or spermatocytes or can be generated via the transfection of vectors or nucleic acids in embryonic stem cells (Polites and Pinkert, in Pinkert, (1994) Transgenic animal technology, A Laboratory Handbook, Academic Press, London, UK, pages 15 to 68; Doetschman, in Pinkert, 1994 , supra, pages 115 to 146).
  • Another object of the invention relates to a transgenic non-human mammal produced according to the method according to the invention described above and to its progeny.
  • the stem cell is involved, which in the in-vitro method according to the invention mentioned for producing a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention and in the method for producing a transgenic non-inventive human mammal is used to generate a pluripotent or multipotent embryonic, fetal, neonatal or adult stem cell.
  • An object of the invention is the use of a transgenic non-human according to the invention for the production of a cell, an organ-specific tissue and / or a mammalian organ for allo- and / or xenotransplantation.
  • this can take place, for example, by means of an implantation method or by means of a catheter injection method through the blood vessel wall.
  • extraction means the removal of the cell, tissue and / or organ mentioned from the organism of a transgenic non-human mammal according to the invention. Appropriate methods of removal are generally known to the person skilled in the art.
  • the invention also relates to the use of a transgenic non-human mammal according to the invention, a human or animal organ-specific tissue according to the invention and / or a human or animal mammalian organ according to the invention for finding pharmacologically active substances and / or for identifying toxic substances.
  • one such method could be to sow cells of the present invention on a 96-well microtiter plate, then to test one Add appropriate pharmacologically active or toxic substance and then analyze by cell count whether the substance has caused an increased death of the cells.
  • pharmacologically active substance and toxic substance in the sense of the invention are understood to mean all those molecules, compounds and / or compositions and substance mixtures which, under suitable conditions, have a pharmacological or toxic influence on individual cells, individual tissues, individual organs or the whole Exercise organism of an animal or human mammal.
  • Possible pharmacologically active substances and toxic substances can be simple chemical (organic or inorganic) molecules or compounds, nucleic acids or analogs of nucleic acids, anti-sense sequences of nucleic acids, peptides, proteins or complexes and antibodies. Examples are organic molecules that come from substance libraries and that are examined for their pharmacological or toxic activity.
  • Pharmacologically active substances are, for example, active substances which exert an influence on: • the ability of cells to divide and / or survive, the secretion of proteins, eg insulin from beta cells of the pancreas, dopamine from nerve cells, muscle cell contraction and / or the migration behavior of cells. When applied to the entire organism of an animal or human mammal, this is to be understood as influencing, for example, the cardiovascular system, the nervous system and the metabolic activities.
  • Toxic substances are, for example, active substances that
  • the identified pharmacologically active substances and toxic substances can optionally be combined or used together with suitable additives and / or auxiliary substances for the production of a diagnostic agent or a medicament for the diagnosis, prophylaxis and or therapy of secondary transplant diseases and / or autoimmune diseases, as exemplified above.
  • FIG. 1 a is an illustration of the amino acid sequence WT-IL-15-hIgG1
  • FIG. 1 b is an illustration of the amino acid sequence WT-IL-15-mIgG2a
  • Figure 2a is an illustration of the amino acid sequence WT-IL-15.
  • Figure 2b is an illustration of the hlgGl amino acid sequence
  • 2c is an illustration of the amino acid sequence mIgG2a
  • Figure 3a is a picture of the amino acid sequence Igk8
  • Figure 3b is a picture of the amino acid sequence 149-Fc
  • 6a is an illustration of the nucleic acid sequence WT-IL-15
  • FIG. 6b is an illustration of the nucleic acid sequence hlgGl
  • FIG. 7 is an illustration of the nucleic acid sequence mIgG2a
  • 8a is an illustration of the nucleic acid sequence of murine IgK leaders
  • FIG. 8b is an illustration of the nucleic acid sequence of human CD5 leaders
  • FIG. 8c is an illustration of the nucleic acid sequence of human CD4 leaders
  • FIG. 8d is an illustration of the nucleic acid sequence of human IL5 leaders 2-leader
  • Figure 9a is an illustration of the nucleic acid sequence of human MCP leaders
  • Figure 9b is an illustration of the nucleic acid sequence of the short native human
  • Figure 9c is an illustration of the nucleic acid sequence of the long native human
  • FIG. 10 is an illustration of the nucleic acid sequence Igk8
  • FIG. 11 is an illustration of the nucleic acid sequence 149-Fc
  • FIG. 12 is an illustration of the inhibitory or proliferation-promoting effect of different protein constructs on the IL-15 mediated Proliferation of CTLL-2 cells.
  • hlgGl stands for human IgGl
  • mIgG2a stands for murine IgG2a.
  • SEQ ID NO: 5 or an allelic variant thereof.
  • nucleic acid coding for a fusion protein according to at least one
  • nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 8 or an allelic variant thereof.
  • nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 9. or an allelic variant of it.
  • nucleic acid according to (viii) containing the DNA sequence SEQ ID NO: 10 or an allelic variant thereof.
  • Medicaments containing at least one fusion protein according to one (i) to (vii) and (xiv), at least one nucleic acid according to one (viii) to (xiii), at least one vector according to (xv) and / or at least one cell according to one (xvi) to (xviii) and suitable auxiliaries and / or additives.
  • transgenic non-human mammal containing at least one fusion protein, in particular for one (i) - (vii) and (xiv), at least one nucleic acid coding for said fusion protein, in particular for one (viii) - (xiii), at least one vector, in particular according to (xv), containing at least one nucleic acid and or at least one cell, in particular after (xvi) - (xviii), containing at least one nucleic acid and / or at least one vector, the fusion protein contains a wild-type IL-15 and an Fc fragment.
  • a fusion protein in particular for a (i) - (vii) and (xiv), a nucleic acid, in particular for a (viii) - (xiii), a vector, in particular for a (xv), and / or one Cell, in particular according to a (xvi) - (xviii), the fusion protein containing a wild-type IL-15 and an Fc fragment or a human or animal organ-specific tissue and / or a human or animal mammalian organ according to (xxi) for the production of a Medicines to inhibit an IL-15 mediated cellular event.
  • a fusion protein in particular for a (i) - (vii) and (xiv), a nucleic acid, in particular for a (viii) - (xiii), a vector, in particular for (xv), and / or a cell , in particular according to a (xvi) - (xviii), the fusion protein containing a wild-type IL-15 and an Fc fragment or a human or animal organ-specific tissue and / or a human or animal mammalian organ according to (xxi), for the manufacture of a medicament to inhibit the interaction of an IL-15 with its receptor.
  • a fusion protein in particular after (i) - (vii) and (xiv), a nucleic acid, in particular after (viii) - (xiii), a vector, in particular after (xv), and / or one Cell, in particular according to an (xvi) - (xviii), wherein the fusion protein contains a wild-type IL-15 and an Fc fragment, for the manufacture of a medicament for the lysis of cells which express an IL-15 receptor.
  • a fusion protein in particular for a (i) - (vii) and (xiv), a nucleic acid, in particular for a (viii) - (xiii), a vector, in particular for (xv), and / or a cell , in particular according to a (xvi) - (xviii), the fusion protein containing a wild-type IL-15 and an Fc fragment or a human or animal organ-specific tissue and / or a human or animal mammalian organ according to (xxi), for the manufacture of a medicament to
  • Prophylaxis and / or therapy of secondary transplant diseases and / or autoimmune diseases are prophylaxis and / or therapy of secondary transplant diseases and / or autoimmune diseases.
  • (xxii) comprising the following steps: a. Introduction into at least one oocyte, a stem cell, a precursor cell and / or an immortalized cell of a non-human mammal, on the one hand at least one nucleic acid, in particular after one (vii) - (xiii), coding for a fusion protein and / or at least one vector, in particular according to (xv), containing at least one named nucleic acid, the fusion protein containing a wild-type IL-15 and an Fc fragment, and on the other hand at least a suitable transfection marker gene, b. Selection of the transferred cell from step a., C. Introduce the after step b. selected cell into at least one non-human mammalian blastocyte, d. Introduce the blastocyte from step c. into a non-human mammal foster mother and e. Identification of the transgenic non-human mammal developed from said blastocyte.
  • reagents such as cell culture media, enzymes, etc. were obtained from Invitrogen (formerly Gibco BRL / Life Technologies), Paisley, UK, and laboratory chemicals from Roth (Karlsruhe, DE).
  • the starting point was a plasmid which in the vector pSecTagA (Invitrogen, Paisley, UK) the cDNA of a fusion protein from a mutated human IL-15 and a murine IgG2a-Fc part (Hinge-C2-C3, Kim et al. 1998, supra ) included.
  • the fusion of IL-15 with the Fc part took place via a BamHI site, whereby an additional amino acid (aspartate) was inserted at the transition.
  • the leader sequences of human IL-2, MCP-1, CD4 and CD5 can alternatively be cloned in.
  • the vector pSecTagA was cut without insert with BglII (approach: 9 ⁇ g DNA, 4 ⁇ l 10X buffer 2, 26 ⁇ l water, 4 ⁇ l BglII (40 units) in a total of 40 ⁇ l, incubation for 2 h at 37 ° C.).
  • the DNA was purified from enzyme and buffer on a Pharmacia S400 microspin column (Amersham-Pharmacia, Freiburg). 40 ⁇ l of the batch were mixed with 5 ⁇ l 10 ⁇ PCR buffer (Taq-Core-Kit, Qiagen, Hilden), 2 ⁇ l dNTPs (10 mM each, Taq-Core-Kit, Qiagen), 2 ⁇ l water and 1 ⁇ l (4 units ) DNA polymerase I (Klenow fragment) were added and incubated for 1 h at 37 ° C. in order to fill up the BglII site.
  • the plasmid was then applied to a 1% agarose gel and the band eluted from the gel using the Concert Rapid-Gel-Extraction System. The entire batch was taken up in 100 ⁇ l of water. 7.5 ⁇ l thereof were ligated together with 7.5 ⁇ l water, 4 ⁇ l 5 ⁇ T4 ligase buffer and 1 ⁇ l T4 ligase (1U) for 1 h at room temperature. Half of the ligation approach was transformed into E.coli XL1 Blue (Stratagene, La Jolla, USA) according to the manufacturer's instructions.
  • Ig-kappa leader + 10 additional amino acid mutIL-15-mIgG2a was cloned into the resulting plasmid again via the interfaces Nhel and Xbal.
  • the original Ig-kappa leader + 10 amino acids + 5'-IL-15 part was then removed via an Nhel / BglII cut and replaced by an oligonucleotide cloning with the above-mentioned signal sequences.
  • the fragment was as follows: 5'-NheI-Leader-IL-15-3 'with a BglII interface in the 5' section of the IL-15. Since this fragment was too long to be covered by a single oligonucleotide, two overlapping oligos and their complementary strands (4 oligonucleotides in total) were obtained from MWG-Biotech (Ebersberg) (sequence of the oligonucleotides see below). The single-stranded oligonucleotides were chosen so that overhanging ends were already available for cloning into the corresponding restriction sites (Nhel, Bglll). The oligonucleotides were first phosphorylated.
  • each oligo were incubated in a 20 ⁇ l mixture with 2 ⁇ l 10 ⁇ forward buffer and 1 ⁇ l T4 polynucleotide kinase (10 U) for 1 h at 37 ° C. Subsequently, equimolar amounts of each strand and counter-strand oligo were annealed by heating to 95 ° C. and slowly cooling to room temperature. The double-stranded oligonucleotides were ligated overnight before cloning into the vector.
  • the clones obtained were examined for their restriction pattern in the Miniprep (QIAamp DNA Mini Kit, Qiagen, Hilden). For this purpose, a triple digestion with Nhel / Bglll (restriction enzymes which directly cut out the leader used) and Xbal (cuts 3 'of the Fc part) was carried out.
  • the DNA positive clones were isolated using the Qiagen Endofree Maxi kit according to the manufacturer's instructions and sequenced at GATC (Constance).
  • the resulting plasmid (mutIL-15 101/108) -mIgG2a with purified Ig kappa leader was called Igk8.
  • PCR was carried out using a forward primer with a BglII cleavage site at the 5 'end (IL-15fw3.1: 5'-attgaagatcttattcaatctatgc-3') and corresponding 3 'reverse primer (WT: 5'- ggatccgaagtgttgatgaacatttggacaatatgtacaaactctgcaaaaattc-3 '), (149: 5' - gggatcc- gaagtgttgatgaacatttgga-3 ') produced the individual mutants.
  • HEK293 cells ATCC, Manassas, USA
  • the proteins of the single mutants were prepared: To this was added per 150cm 2 plate 60 .mu.l lipofectamine2000 in 2 ml Optimem 1 medium and 30 ug plasmid DNA (IgK8, WT-Fc , 149-Fc) also diluted in 2 ml Optimem 1 medium. The two solutions were mixed and incubated for 30 minutes at room temperature. The DNA / liposome mixture was then added to approximately 80% confluent 150 cm 2 HEK-293 plates in the cell culture medium (Dulbecco's MEM + Glutamax + 10% FCS + 1% Pen / Strep).
  • the medium was changed to ultraculture medium (Biowhittaker, Verviers, Belgium) and the cell culture medium was then left on the cells for 4 days.
  • the cell culture supernatant was collected, passed through a folded filter (Schleicher and Schüll, Dassel) to remove the coarse cell components, then sterile filtered through a 2 ⁇ m bottle top filter (Nalgene-Nunc, Wiesbaden) and the IL-15-Fc - Fusion protein isolated by purification via Protein A Sepharose.
  • Protein A-Sepharose (Amersham-Pharmacia, 50% ov / v in washing buffer) swollen in liter buffer (20 mM Tris / HCl, pH 8.5, 130 mM NaCl) were added per liter cell culture supernatant and the mixture was added Shaken 4 ° C overnight in an overhead shaker.
  • the ProteinA-Sepharose was collected in an empty chromatography column and washed with at least 150 ml wash buffer. The protein was eluted from the column with 0.1 M glycine pH 2.5 in 1 ml fractions and immediately neutralized with 60 ⁇ l IM Tris / HCl, pH 9.5.
  • the protein was dialyzed against PBS buffer and sterile filtered. The concentration of the protein was determined in the BCA assay (Pierce, Rockford, USA) and using silver gel and Western blot (first antibody: monoclonal mouse anti-human IL-15, BD Biosciences Pharmingen, San Diego USA, second antibody: POD-Goat anti mouse, Dianova, Hamburg), purity and identity checked. The functionality of the protein was then examined in the proliferation assay.
  • CTLL-2 cells are murine cytotoxic T cells whose proliferation is dependent on IL-15 or IL-2 and which can therefore serve as indicators for the proliferation-inhibiting effect of antagonistic proteins.
  • the cells were cultured in a medium consisting of RPMI1640 medium + 10% heat-activated fetal calf serum (FCS) + 1% Pen Strep + 20% advises T-Stim with ConA (Becton Dickinson Labware, Bedford, USA), a mixture different growth factors.
  • FCS heat-activated fetal calf serum
  • Pen Strep + 20% advises T-Stim with ConA (Becton Dickinson Labware, Bedford, USA), a mixture different growth factors.
  • the cells were freed of the remaining growth factors necessary for the culture of the cells by washing twice with cell culture medium (RPMI 1640 + 10% FCS + 1% Pe ⁇ / Strep) and then also being taken up in this medium. For this, the cells were centrifuged at 349 g for 5 min, the supern
  • the assay was carried out in flat bottom 96-well plates and 150 .mu.l of medium with 3 ⁇ 10 4 cell wells were used per well.
  • the cells received only medium with 10% FCS, without additional factors.
  • the positive control additionally contained recombinant human IL-15 (R&D Systems, Minneapolis, USA) in a concentration which allows a half-maximal proliferation of the cells (eg 12.5 pg / well). Negative and positive controls were pipetted in 6-fold batches.
  • the cells were determined as for the positive control. wrote with recombinant IL-15 and received additionally purified protein of the double mutant 101/108 starting from Igk8, the wild-type protein (WT-Fc) or the single mutant (149-Fc). The highest concentration used was 2 ⁇ g per well and further 1: 2 dilutions (1 ⁇ g, 0.5 ⁇ g, 0.25 ⁇ g, 0.125 ⁇ g, etc.).
  • mIgG2a (BD Biosciences Pharmingen, San Diego, USA) was used as non-specific antibody
  • IL-2-Fc which contains a non-mutated cytokine component and thus the proliferation
  • CTLA4-Fc also a structurally related fusion protein, which, however, should not influence the proliferation.
  • Both of the latter proteins were obtained from Chimerigen (Allston, USA). All batches were pipetted in triplicate.
  • the cells were incubated for 44 + 2 hours at 37 ° C. in the CO 2 incubator and then the proliferation was determined using the XTT-Cell Proliferation Kit (Röche) according to the manufacturer's instructions.
  • the two components of the kit were mixed in a ratio of 1:50 (ie, 75 ⁇ l XTT labeling reagent + 1.5 ⁇ l electron coupling reagent).
  • 75 ⁇ l of the mixture were added per well and the plate was measured after an incubation for 4 hours at 37 ° C. in a CO 2 incubator in an ELISA reader at 490 against 690 nm.
  • WT-Fc, 149-Fc and protein of the double mutant 101/108 show an inhibitory effect on the IL-15 mediated proliferation of CTLL-2 cells.
  • IL-2-Fc and IgG2a show a rather proliferation-promoting effect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Surgery (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Transplantation (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des protéines de fusion composées d'un IL-15 de type sauvage et d'un fragment IgG-Fc, à l'exception d'un fragment IgG2b-Fc de souris, des acides nucléiques qui codent pour ces protéines, des vecteurs, des cellules modifiées et leur utilisation pour la préparation de médicaments destinés par exemple à prévenir et/ou à traiter des troubles résultant d'une transplantation et/ou des maladies auto-immunes.
EP03750224A 2002-10-14 2003-10-13 Antagonistes il-15 Withdrawn EP1554307A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP03750224A EP1554307A2 (fr) 2002-10-14 2003-10-13 Antagonistes il-15

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP02022869 2002-10-14
EP02022869 2002-10-14
EP03750224A EP1554307A2 (fr) 2002-10-14 2003-10-13 Antagonistes il-15
PCT/CH2003/000666 WO2004035622A2 (fr) 2002-10-14 2003-10-13 Antagonistes il-15

Publications (1)

Publication Number Publication Date
EP1554307A2 true EP1554307A2 (fr) 2005-07-20

Family

ID=32103882

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03750224A Withdrawn EP1554307A2 (fr) 2002-10-14 2003-10-13 Antagonistes il-15

Country Status (12)

Country Link
US (1) US20060236411A1 (fr)
EP (1) EP1554307A2 (fr)
JP (1) JP2006518583A (fr)
KR (1) KR20050049545A (fr)
CN (1) CN1703423A (fr)
AU (1) AU2003269659A1 (fr)
BR (1) BR0315327A (fr)
CA (1) CA2502316A1 (fr)
MX (1) MXPA05003887A (fr)
PL (1) PL376509A1 (fr)
RU (1) RU2005114526A (fr)
WO (1) WO2004035622A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005100395A3 (fr) * 2004-04-14 2006-06-01 Hoffmann La Roche Systeme d'expression destine a la preparation de proteines hybrides fc/il-15 et son application

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100334112C (zh) * 2004-10-15 2007-08-29 上海海欣生物技术有限公司 人白细胞介素15与Fc融合蛋白
EP1777294A1 (fr) 2005-10-20 2007-04-25 Institut National De La Sante Et De La Recherche Medicale (Inserm) Le domaine sushi de IL-15Ralpha comme enhancer sélectif et efficace de l'action de f IL-15 grâce à IL-15Rbeta/gamma, et l' hyperagoniste (IL15Ralpha sushi -IL15) comme protéine fusion
CN101831435B (zh) * 2010-05-10 2013-09-11 昆山贝瑞康生物科技有限公司 小鼠il-15亚型蛋白的制备及其应用
CA2824515C (fr) 2011-01-18 2022-09-13 Bioniz, Llc Compositions et methodes dea modulation de l'activite des cytokines gamma-c
WO2013004587A1 (fr) 2011-07-01 2013-01-10 F. Hoffmann-La Roche Ag Technique de séparation de polypeptides monomères de polypeptides agrégés
WO2014170032A1 (fr) 2013-04-19 2014-10-23 Cytune Pharma Traitement dérivé de la cytokine avec syndrome de fuite vasculaire réduit
ES2698375T3 (es) * 2013-06-27 2019-02-04 Inst Nat Sante Rech Med Antagonistas de interleucina 15 (IL-15) y usos de los mismos para el tratamiento de enfermedades autoinmunes y enfermedades inflamatorias
US9959384B2 (en) 2013-12-10 2018-05-01 Bioniz, Llc Methods of developing selective peptide antagonists
EP2915569A1 (fr) 2014-03-03 2015-09-09 Cytune Pharma Procédé de purification de conjugués à base Il -15/IL-15Ralpha
SI3235830T1 (sl) * 2014-12-19 2020-12-31 Jiangsu Hengrui Medicine Co., Ltd. Proteinski kompleks interlevkina 15 in njegove uporabe
PT3359556T (pt) 2015-10-09 2021-08-30 Bioniz Llc Modulação da atividade de citocinas gama-c
EP3468581A1 (fr) 2016-06-13 2019-04-17 Torque Therapeutics, Inc. Méthodes et procédés pour favoriser la fonction des cellules immunitaires
EP3634437A4 (fr) * 2017-05-19 2020-11-18 Case Western Reserve University Compositions et procédés d'expansion ex vivo de cellules tueuses naturelles et leurs utilisations thérapeutiques
EP3678701A4 (fr) 2017-09-05 2021-12-01 Torque Therapeutics, Inc. Compositions protéiques thérapeutiques et procédés de préparation et d'utilisation de celles-ci
DK3794024T5 (da) 2018-05-14 2024-08-19 Werewolf Therapeutics Inc Aktiverbare interleukin-2 polypeptider og fremgangsmåder til anvendelse heraf
EP3794023A1 (fr) 2018-05-14 2021-03-24 Werewolf Therapeutics, Inc. Polypeptides d'interleukine 12 activables et procédés d'utilisation associés
KR102848197B1 (ko) 2018-06-22 2025-08-21 큐진 인크. 신규한 인터루킨-15 (il-15) 융합 단백질 및 이의 용도
US11952419B2 (en) * 2018-07-10 2024-04-09 University Of Connecticut Reagents and methods for treating cancer and autoimmune disease
WO2020023702A1 (fr) 2018-07-25 2020-01-30 AskGene Pharma, Inc. Nouveaux promédicaments d'il-21 et leurs procédés d'utilisation
US20220002370A1 (en) 2018-09-27 2022-01-06 Xilio Development, Inc. Masked cytokine polypeptides
BR112021021878A2 (pt) 2019-05-03 2022-01-18 Bioniz Llc Modulação dos efeitos de sinalização da gama-c-citocina para tratamento da alopecia e distúrbios associados
MX2021013766A (es) 2019-05-14 2022-02-21 Werewolf Therapeutics Inc Restos de separacion y metodos de uso de los mismos.
WO2020252264A1 (fr) 2019-06-12 2020-12-17 AskGene Pharma, Inc. Nouveaux promédicaments d'il-15 et leurs procédés d'utilisation
AU2020384375A1 (en) 2019-11-14 2022-05-26 Werewolf Therapeutics, Inc. Activatable cytokine polypeptides and methods of use thereof
JP7807076B2 (ja) * 2019-12-13 2026-01-27 キュージーン インコーポレイテッド 新規インターロイキン-15(il-15)融合タンパク質およびその使用
TW202235431A (zh) 2020-11-25 2022-09-16 美商艾希利歐發展股份有限公司 腫瘤特異性可裂解連接子
US20230151095A1 (en) 2021-11-12 2023-05-18 Xencor, Inc. Bispecific antibodies that bind to b7h3 and nkg2d
WO2024102636A1 (fr) 2022-11-07 2024-05-16 Xencor, Inc. Anticorps bispécifiques qui se lient à b7h3 et mica/b
US20250243279A1 (en) 2023-10-17 2025-07-31 Xencor, Inc. Bispecific antibodies that bind to nkp46 and mica/b

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4736866A (en) * 1984-06-22 1988-04-12 President And Fellows Of Harvard College Transgenic non-human mammals
US5698765A (en) * 1991-12-02 1997-12-16 The Ontario Cancer Institute Mouse having a disrupted CD4 gene
WO1993018144A1 (fr) * 1992-03-05 1993-09-16 The Trustees Of Columbia University Of The City Of New York Animal presentant une deficience en gene activateur de recombinaison
US5625122A (en) * 1992-04-24 1997-04-29 The Ontario Cancer Institute Mouse having a disrupted lck gene
JP3741447B2 (ja) * 1992-10-23 2006-02-01 中外製薬株式会社 エンドセリン−1遺伝子の機能が欠損したマウス
EP0793504B1 (fr) * 1994-12-12 2005-06-08 Beth Israel Deaconess Medical Center, Inc. Cytokines chimeres et emplois de celles-ci
US6001973A (en) * 1996-04-26 1999-12-14 Beth Israel Deaconess Medical Center Antagonists of interleukin-15

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KIM Y.S. ET AL: "Targeting the IL-15 receptor with an antagonist IL-15 mutant/Fcgamma2a protein blocks delayed-type hypersensitivity", JOURNAL OF IMMUNOLOGY, THE WILLIAMS AND WILKINS CO., vol. 160, no. 12, 15 June 1998 (1998-06-15), pages 5742 - 5748 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005100395A3 (fr) * 2004-04-14 2006-06-01 Hoffmann La Roche Systeme d'expression destine a la preparation de proteines hybrides fc/il-15 et son application

Also Published As

Publication number Publication date
WO2004035622A3 (fr) 2004-07-08
BR0315327A (pt) 2005-08-16
AU2003269659A1 (en) 2004-05-04
PL376509A1 (en) 2005-12-27
WO2004035622A2 (fr) 2004-04-29
JP2006518583A (ja) 2006-08-17
CN1703423A (zh) 2005-11-30
US20060236411A1 (en) 2006-10-19
MXPA05003887A (es) 2005-10-18
KR20050049545A (ko) 2005-05-25
RU2005114526A (ru) 2005-10-10
CA2502316A1 (fr) 2004-04-29

Similar Documents

Publication Publication Date Title
EP1554307A2 (fr) Antagonistes il-15
DE69836088T2 (de) Als lerk6 bezeichnetes cytokin
DE69633617T2 (de) Il-17 receptor
DE60034579T2 (de) Baff rezeptor (bcma), ein immunoregulatorisches mittel
DE69837606T2 (de) Cystein-reiche rezeptoren-train
DE69534593T2 (de) Onkostatin- m rezeptor
DE69434168T2 (de) Liganden für die FLT3 Rezeptoren
DE69929019T2 (de) Mu-1, ein mitglied der zytokinrezeptor-familie
DE69733610T2 (de) Interleukin-15 antagonisten
US6605279B2 (en) Therapeutic compositions for inhibiting the interactions of B7-1 and B7-2 with their natural ligands
DE69838061T2 (de) Typ ii tgf-beta receptor/immunoglobulin konstante domäne fusionsproteine
DE69120146T2 (de) Erzeugung xenogener antikörper
DE69534235T2 (de) Cytokin lerk-7
DE60131456T2 (de) Transchromosomale transgen-nagetiere zur herstellung von humanen antikörpern
DE69323765T2 (de) Säugetier-rezeptoren für interleukin 10 (il-10)
DE69132937T2 (de) Typ-II-Interleukin-1-Rezeptoren
DE60004635T2 (de) Baff, dessen inhibitoren und dessen verwendung zur modulierung der b-zell-antwort
US6130316A (en) Fusion proteins of novel CTLA4/CD28 ligands and uses therefore
WO1999015553A2 (fr) Polypeptide costimulant de lymphocytes t, anticorps monoclonaux, leur production et leur utilisation
DE19821060A1 (de) Ko-stimulierendes Polypeptid von T-Zellen, monoklonale Antikörper sowie die Herstellung und deren Verwendung
JPH08511251A (ja) f1t3受容体に対するリガンド
DE69529822T2 (de) Interleukin-15-rezeptoren
DE69535063T2 (de) Denaturierter low-density lipoprotein (ldl) rezeptor
DE69131426T2 (de) Neue wasserlösliche polypeptide mit hoher affinität für alpha- und beta- interferone
EP1586585A1 (fr) Système d'expression pour la production des protéines de fusion IL-15/Fc et leur utilisation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050511

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
RIN1 Information on inventor provided before grant (corrected)

Inventor name: MOLL, THOMAS

Inventor name: DREHER, INGEBORG

17Q First examination report despatched

Effective date: 20061010

17Q First examination report despatched

Effective date: 20061010

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080503